US20200113821A1 - Compositions and methods for in utero delivery - Google Patents

Compositions and methods for in utero delivery Download PDF

Info

Publication number
US20200113821A1
US20200113821A1 US16/603,152 US201816603152A US2020113821A1 US 20200113821 A1 US20200113821 A1 US 20200113821A1 US 201816603152 A US201816603152 A US 201816603152A US 2020113821 A1 US2020113821 A1 US 2020113821A1
Authority
US
United States
Prior art keywords
particles
poly
dna
target
polymer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US16/603,152
Other languages
English (en)
Inventor
W. Mark Saltzman
Peter M. Glazer
Adele S. Ricciardi
David H. Stitelman
James Farrelly
Anthony Bianchi
Alexandra S. Piotrowski-Daspit
Amy Kauffman
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yale University
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Priority to US16/603,152 priority Critical patent/US20200113821A1/en
Assigned to YALE UNIVERSITY reassignment YALE UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BIANCHI, Anthony, PIOTROWSKI-DASPIT, Alexandra S., FARRELLY, JAMES, SALTZMAN, W. MARK, GLAZER, PETER M., RICCIARDI, Adele S., STITELMAN, David H.
Assigned to YALE UNIVERSITY reassignment YALE UNIVERSITY ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KAUFFMAN, AMY
Publication of US20200113821A1 publication Critical patent/US20200113821A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0034—Urogenital system, e.g. vagina, uterus, cervix, penis, scrotum, urethra, bladder; Personal lubricants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/18—Growth factors; Growth regulators
    • A61K38/1825—Fibroblast growth factor [FGF]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A61K48/0025—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid
    • A61K48/0041—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition wherein the non-active part clearly interacts with the delivered nucleic acid the non-active part being polymeric
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/0012—Galenical forms characterised by the site of application
    • A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1629—Organic macromolecular compounds
    • A61K9/1635—Organic macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyvinyl pyrrolidone, poly(meth)acrylates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1629—Organic macromolecular compounds
    • A61K9/1641—Organic macromolecular compounds obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, poloxamers
    • A61K9/1647—Polyesters, e.g. poly(lactide-co-glycolide)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
    • A61K9/16—Agglomerates; Granulates; Microbeadlets ; Microspheres; Pellets; Solid products obtained by spray drying, spray freeze drying, spray congealing,(multiple) emulsion solvent evaporation or extraction
    • A61K9/1605—Excipients; Inactive ingredients
    • A61K9/1629—Organic macromolecular compounds
    • A61K9/1652—Polysaccharides, e.g. alginate, cellulose derivatives; Cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5138—Organic macromolecular compounds; Dendrimers obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyvinyl pyrrolidone, poly(meth)acrylates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5146—Organic macromolecular compounds; Dendrimers obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyethylene glycol, polyamines, polyanhydrides
    • A61K9/5153—Polyesters, e.g. poly(lactide-co-glycolide)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
    • A61K9/50—Microcapsules having a gas, liquid or semi-solid filling; Solid microparticles or pellets surrounded by a distinct coating layer, e.g. coated microspheres, coated drug crystals
    • A61K9/51—Nanocapsules; Nanoparticles
    • A61K9/5107—Excipients; Inactive ingredients
    • A61K9/513—Organic macromolecular compounds; Dendrimers
    • A61K9/5161—Polysaccharides, e.g. alginate, chitosan, cellulose derivatives; Cyclodextrin
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00—Drugs for skeletal disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00—Drugs for disorders of the muscular or neuromuscular system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid

Definitions

  • the field of the invention is generally related to compositions and methods for in utero delivery of active agents, particularly those in which the active agent is encapsulated within, surrounded by, and/or dispersed in polymeric microparticles or nanoparticles.
  • MMC Myelomeningocele
  • Hemoglobinopathies are the most commonly inherited single-gene disorders, with a global carrier frequency of over 5%. Depending on the severity of the disease, children affected by ⁇ -thalassemia may require lifelong transfusions or bone marrow transplantation, which can lead to serious complications such as iron overload, sepsis, or graft-versus-host disease. Recent advances in non-invasive genetic testing allow for early gestation diagnosis of genetic disorders such as thalassemia, providing a window during which genetic correction could be achieved prior to birth.
  • Site-specific gene editing to correct disease-causing mutations can be administered to postnatal animals via the intravenous or inhalational administration of polymeric, biodegradable nanoparticles loaded with peptide nucleic acids (PNAs) and single-stranded donor DNAs.
  • PNAs peptide nucleic acids
  • chitosan-DNA nanoparticles were used for in utero gene therapy (Yang et al. Journal of Surgical Research, 171:691-699 (2011)).
  • compositions and methods for in utero therapeutics and diagnostics are needed, where, for example, diseases or disorders can be addressed prior to the point where irreparable harm is done to tissues and/or organ systems of the embryo or fetus.
  • compositions and methods for in utero delivery are provided.
  • compositions and methods for in utero delivery of active agents allow therapeutic and diagnostic molecules to be delivered to an embryo or fetus in need thereof.
  • the methods deliver an effective amount of a composition to the cells of the embryo or fetus, without delivering an effective amount of the composition to the mother of the embryo or fetus.
  • the therapeutic or diagnostic active agent can be encapsulated, entrapped or complexed to biocompatible particles such as nano- or microparticles.
  • the particles can be formulated for cellular internalization or to remain predominately extracellular, releasing their cargo in a paracrine-like fashion. In some embodiments, the particles do not cross the placenta.
  • These nano- and microparticles can be engineered to attach to specific targets or to release their chemical payload at different rates.
  • the active agent can also be administered to a subject in utero without particles.
  • Active agents for in utero delivery include, but are not limited to therapeutic, nutritional, diagnostic, or prophylactic agents, and gene editing compositions.
  • the active agents can be small molecule active agents or biomacromolecules, such as proteins, polypeptides, sugars or polysaccharides, liporproteins or nucleic acids. Suitable small molecule active agents include organic and organometallic compounds.
  • the small molecule active agents can be a hydrophilic, hydrophobic, or amphiphilic compound.
  • the nucleic acids can be oligonucleotide drugs such as DNA, RNAs, antisense, aptamers, small interfering RNAs, ribozymes, external guide sequences for ribonuclease P, and triplex forming agents.
  • the methods are utilized to deliver active agents such as small molecules, peptides, nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), morpholino oligomers (PMOs), etc., absent a gene editing composition.
  • active agents such as small molecules, peptides, nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), morpholino oligomers (PMOs), etc.
  • active agents such as small molecules, peptides, nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), morpholino oligomers (PMOs), etc.
  • active agents such as small molecules, peptides, nucleic acids, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), morpholino oligomers (PMOs), etc.
  • the only active agent is a gene editing composition.
  • the methods typically include administering to an embryo or fetus, or the pregnant mother thereof, an effective amount of an active agent, optionally encapsulated or entrapped in or otherwise associated with particles.
  • Gene editing methods typically include administering to an embryo or fetus, or the pregnant mother thereof, an effective amount a gene editing composition optionally encapsulated or entrapped in particles, alone or in combination with additional active agents.
  • active agent or particles including active agent are delivered in utero by injecting and/or infusing the particles into a vein or artery, such as such the vitelline vein or the umbilical vein, or into the amniotic sac of an embryo or fetus.
  • Particle compositions for extracellular and intracellular delivery of active agents include, but are not limited to, gene editing compositions are also provided and particularly advantageous for use with in utero applications.
  • the particle are preferably made of biodegradable polymers such as polymers or copolymers of lactic acid, glycolic acid, degradable polyesters, polyanhydrides, poly(ortho)esters, polyesters, polyurethanes, poly(butic acid), poly(valeric acid), poly(caprolactone), poly(hydroxyalkanoates), poly(lactide-co-caprolactone), poly(amine-co-ester) polymers, or a combination of any two or more of the foregoing.
  • the particles can be or include poly(lactic-co-glycolic acid) PLGA.
  • the particles include poly(lactic-co-glycolic acid) (PLGA), poly(beta-amino) ester (PBAE), or a combination thereof.
  • the particles can be formed of or contain one or more poly(amine-co-ester), poly(amine-co-amide), poly(amine-co-ester-co-ortho ester) or a combination thereof.
  • Particles can include or be formed of alginate, chitosan, poly(HEMA) or other acrylate polymers and copolymers. Particles can further include a targeting moiety, a cell penetrating peptide, or a combination thereof.
  • the particles used in the compositions can be of single species or a mixture of two or more different species of particles.
  • the particles can include an active agent, such as a gene editing composition, suitable for treatment of and can be administered in an effective amount to treat a disease or disorder.
  • an active agent such as a gene editing composition
  • the formulations and methods provided for the controlled local release of growth factors to cause skin or soft tissue to grow over the exposed spinal cord of the fetal or embryonic subject can include biocompatible particles which preferentially binds to MMC defects in utero and effectively release therapeutic agents to induce at least partial skin or soft tissue coverage of the defect.
  • the formulation can be delivered in a minimally invasive fashion through an intra-amniotic injection.
  • Exemplary diseases and disorders which can be treated include, but are not limited to, genetic disorders such as hemophilia, hemoglobinopathies, cystic fibrosis, xeroderma pigmentosum, muscular dystrophy, Type 2 diabetes, diseases of the liver such as Wilson's disease and hemochromatosis, or diseases of the central nervous system including Fredrich's ataxia, Huntington's disease, spinal muscular atrophy, tuberous sclerosis and lysosomal storage diseases.
  • genetic disorders such as hemophilia, hemoglobinopathies, cystic fibrosis, xeroderma pigmentosum, muscular dystrophy, Type 2 diabetes, diseases of the liver such as Wilson's disease and hemochromatosis, or diseases of the central nervous system including Fredrich's ataxia, Huntington's disease, spinal muscular atrophy, tuberous sclerosis and lysosomal storage diseases.
  • Gene editing compositions include, for example, triplex forming molecules, pseudocomplementary oligonucleotides, a CRISPR system, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), small fragment homologous replacement, and intron encoded meganucleases.
  • a particularly preferred gene editing composition is triplex-forming peptide nucleic acids (PNAs) having one or more substitutions at the ⁇ position of the backbone for increased DNA binding affinity.
  • Gene editing composition can include or be used in conjunction with or combination with a donor oligonucleotide.
  • the donor oligonucleotide can facilitate genome modification.
  • the donor oligonucleotide can include a sequence corresponding to the target sequence or to the target gene.
  • the gene editing composition facilitates insertion of the donor oligonucleotide within the target sequence.
  • the donor oligonucleotide can include a wildtype sequence of the target sequence.
  • the donor oligonucleotide can include a corrective sequence. The insertion of the corrective sequence can result in a wildtype sequence at the target sequence or a target gene.
  • a gene editing composition typically modifies a target sequence within a genome.
  • the gene editing composition can, for example, modify a target sequence within a genome by reducing or preventing expression of the target sequence.
  • the gene editing composition induces single-stranded or double-stranded breaks in the target sequence.
  • the gene editing composition induces formation of a triplex within the target sequence.
  • the target sequence can be, for example, within a fetal genome.
  • the gene editing composition does not modify a target sequence within a maternal genome.
  • the target sequence can be present in the fetal genome and the maternal genome and the sequences can be identical.
  • the target sequence in the fetal genome and maternal genome are not identical, or the target sequence is completely absent from the maternal genome.
  • the fetal genome and the maternal genome can be isolated, derived, or obtained from genetically-related individuals or from genetically un-related individuals.
  • the mother carrying the embryo or fetus can be a surrogate.
  • the fetus and the mother have the same disease or disorder or are at risk for developing the same disease or disorder.
  • the fetus has a disease or disorder or is at risk for developing a disease or disorder, and the mother neither has the disease or disorder nor has any risk of developing a disease or disorder.
  • the composition enters only fetal bodily fluids or tissues, and does not enter maternal bodily fluids or tissues.
  • the composition is administered to a fetus or to the mother once or more when the fetus is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and/or 36 weeks of age.
  • the fetal genome includes one or more mutations in a coding sequence or a non-coding sequence corresponding to a target gene that either indicates the fetus is at risk of developing a disease or disorder or that indicates that the fetus has a disease or disorder.
  • the mutation can include, for example, a substitution, an insertion, a deletion, an indel, an inversion, a frameshift, or a transposition.
  • the mutation can cause, for example, a transcriptional or translational truncation, altered transcriptional splicing, early termination of transcription or translation, variant transcriptional regulation or variant epigenetic regulation.
  • a coding sequence or a non-coding sequence corresponding to the target gene includes the target sequence.
  • a coding sequence corresponding to the target gene can include one or more exon(s) encoding a product of the target gene.
  • a non-coding sequence corresponding to the target gene can include one or more transcriptional regulator(s), enhancer(s), superenhancer(s), intron(s), and/or regulatory RNAs that selectively bind a transcript of the target gene.
  • the one or more transcriptional regulator(s) includes a sequence encoding a promoter.
  • one or more regulatory RNAs that selectively bind a transcript of the target gene include one or more miRNA(s).
  • the triplex forming molecules can be utilized in all manners of gene modification including those methods both with and without a potentiating agent.
  • the triplex forming composition (also referred to herein as a triplex-forming molecule) typically includes a Hoogsteen binding peptide nucleic acid (PNA) segment and a Watson-Crick binding PNA segment, which in embodiments collectively totals no more than about 25, 50, 75, or 100 nucleobases, wherein the two segments can bind or hybridize to a target region having a polypurine stretch in a cell's genome to induce strand invasion, displacement, and formation of a triple-stranded molecule among the two PNA segments and the polypurine stretch.
  • PNA Hoogsteen binding peptide nucleic acid
  • Watson-Crick binding PNA segment which in embodiments collectively totals no more than about 25, 50, 75, or 100 nucleobases
  • the Hoogsteen binding segment binds to the target duplex by Hoogsteen binding for a length of at least five nucleobases
  • the Watson-Crick binding segment typically binds to the target duplex by Watson-Crick binding for a length of least five nucleobases.
  • the triplex forming molecule is a tail-clamp PNA oligomer.
  • one or more of the PNA residue(s) (also referred to herein as ‘residue(s)’) of a PNA oligomer include at least one side chain modification at the gamma position of the backbone.
  • the side chain modification at the ⁇ position of the ⁇ PNA residue(s) of a PNA oligomer can be, for example, the side chain of an amino acid selected from the group consisting of alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, arginine, and the derivatives thereof.
  • the side chain modification at the ⁇ position of the PNA residue or residues is a diethylene glycol moiety (“miniPEG”).
  • miniPEG diethylene glycol moiety
  • all of the peptide nucleic acid residues in the Hoogsteen-binding portion only, all of the peptide nucleic acid residues in the Watson-Crick-binding portion only, or all of the peptide nucleic residues in the PNA oligomer have at least one gamma modification of a backbone carbon.
  • alternating residues in the Hoogsteen-binding portion only, the Watson-Crick-binding portion only, or across the entire PNA oligomer have at least one gamma modification of a backbone carbon. Specific exemplary sequences are provided below.
  • one or more of the cytosine nucleobases of the PNA oligomer is replaced with a clamp-G (9-(2-guanidinoethoxy) phenoxazine).
  • the Hoogsteen binding segment of the PNA oligomer has one or more chemically modified cytosine nucleobases selected from the group consisting of pseudocytosine, pseudoisocytosine, and 5-methylcytosine.
  • the Watson-Crick binding segment preferably includes a nucleobase sequence of up to fifteen nucleobases that binds to the target duplex by Watson-Crick binding outside of the triplex.
  • the two segments are linked by a linker, for example, between 1 and 10 units of 8-amino-3,6-dioxaoctanoic acid.
  • Gene editing compositions such as PNA oligomers can include a targeting moiety, a cell penetrating peptide, or a combination thereof.
  • the methods can include administration of a gene modification potentiating agent.
  • exemplary potentiating agents include, but are not limited to, SCF, a CHK1 or ATR inhibitor, a DNA polymerase alpha inhibitor, a heat shock protein 90 inhibitor (HSP90i) or a combination of any two or more of the foregoing.
  • FIG. 1A is a schematic showing a strategy for targeted correction of a ⁇ -globin gene IVS2-654 (C->T) mutation in ⁇ -globin/GFP transgenic mice using triplex-forming tail clamp PNAs (tcPNAs) and donor DNAs.
  • FIG. 1B is an illustration showing tcPNA and ⁇ tcPNA oligomers (SEQ ID NOS:33-35, 33, and 158, respectively) of which SEQ ID NOS:33-35 and 33 were designed to bind to the homopurine regions within intron 2 of the human ⁇ -globin gene in the vicinity of the thalassemia-associated mutation IVS2-654 (C->T), and a scrambled control sequence (SEQ ID NO:158).
  • FIG. 1A is a schematic showing a strategy for targeted correction of a ⁇ -globin gene IVS2-654 (C->T) mutation in ⁇ -globin/GFP transgenic mice using triplex-forming tail clamp PNAs (tcP
  • FIG. 1C is an illustration of the chemical structures of DNA (and RNA), unmodified (“classic”) PNA and (right-handed “R”) miniPEG gamma PNA ( MP ⁇ PNA) units.
  • FIG. 1D is a bar graph showing gene correction of the IVS2-654 (C->T) mutation within the ⁇ -globin/GFP fusion gene in mouse bone marrow cells treated ex vivo with blank NPs and NPs containing donor DNA (SEQ ID NO:65) alone or in combination with tcPNA3 (SEQ ID NO:35), tcPNA2 (SEQ ID NO:34), or tcPNA1 (SEQ ID NO:33).
  • 1E is a line graph showing release of total nucleic acids (PNAs in combination with donor DNA (SEQ ID NO:65): ⁇ tcPNA4 (SEQ ID NO:33), tcPNA1 (SEQ ID NO:33), tcPNA2 (SEQ ID NO:34), tcPNA3 (SEQ ID NO:35) or ⁇ tcPNA4-Scr (SEQ ID NO:158); or DNA donor (SEQ ID NO:65) alone) from PLGA nanoparticles during incubation at 37° C. in PBS.
  • the residual nucleic acid in the NP pellet was extracted and the total nucleic acid load was calculated as a sum of absorbance obtained from the pellet and supernatant.
  • 1F is a bar graph showing % GFP+ cells determined by flow cytometry among mouse bone marrow cells (from ⁇ -globin/GFP transgenic mice) after ex vivo treatment with PLGA NPs containing tcPNA1 (SEQ ID NO:33), ⁇ tcPNA4 (SEQ ID NO:33), or ⁇ tcPNA4-Scr (SEQ ID NO:158) plus donor DNAs (SEQ ID NO:65). Replicates and statistics as above for FIG. 1D .
  • 1H is a bar graph showing the results of a comet assay to measure DNA breaks in NP-treated bone marrow cells.
  • Cells were treated with NPs containing either tcPNA1/donor DNA (SEQ ID NOS:33 and 65), ⁇ tcPNA4/donor DNA (SEQ ID NOS:33 and 65), or bleomycin/donor DNA (SEQ ID NO:65), as indicated.
  • FIG. 2A is a bar graph showing % GFP expression in treated mouse bone marrow cells based on selected hematopoietic cell surface markers.
  • FIG. 2C is a bar graph showing % GFP expressing CD117+ cells from ⁇ -globin/GFP transgenic mice after ex vivo treatment with NPs containing ⁇ tcPNA4/donor DNA (SEQ ID NOS:33 and 65) with or without prior treatment with the c-Kit ligand, SCF.
  • FIG. 2D is a bar graph showing % GFP expressing CD117+ cells isolated from ⁇ -globin/GFP transgenic mice after ex vivo treatment with NPs containing ⁇ tcPNA4/donor DNA (SEQ ID NOS:33 and 65) in the presence or absence of selected c-Kit pathway kinase inhibitors: dasatinib (inhibits c-Kit), MEK162 (inhibits mitogen/extracellular signal-regulated kinase, MEK) and BKM120 (inhibits phosphatidylinositol-3-kinase, PI3K).
  • FIGS. 2E and 2F are bar graphs showing qPCR determination of mRNA expression levels of BRCA2 ( 2 E) and Rad51 ( 2 F) in CD117- and CD117+ cells.
  • FIG. 2G is a heat map showing up-regulated genes involved in DNA repair pathways in CD117+ cells with or without treatment with SCF; rows are clustered by Euclidean distance measure.
  • 2H is a bar graph showing the results of a gene assay for homology-dependent repair (HDR) activity in the presence or absence of selected c-Kit pathway kinase inhibitors: dasatinib (inhibits c-Kit), MEK162 (inhibits mitogen/extracellular signal-regulated kinase, MEK) and BKM120 (inhibits phosphatidylinositol-3-kinase, PI3K).
  • dasatinib inhibits c-Kit
  • MEK162 inhibits mitogen/extracellular signal-regulated kinase
  • BKM120 inhibitors phosphatidylinositol-3-kinase, PI3K
  • Inset shows a diagram of the luciferase reporter gene assay for repair of a nuclease-induced double-strand break by homology-dependent repair (HDR).
  • FIGS. 3A and 3B are dot plots showing frequencies of gene editing (GFP expression) in bone marrow ( 3 A) and spleen ( 3 B) cells from (3-globin/GFP transgenic mice (6 mice per group) injected or not (as indicated) with 15.6 ⁇ g of SCF i.p. followed by a single treatment of 4 mg of NPs injected intravenously.
  • Each group received either blank NPs or NPs containing ⁇ tcPNA4 and donor DNA (SEQ ID NOS:33 and 65), with or without SCF and were harvested and analyzed two days later.
  • Each data point represents analysis of cells from a single mouse.
  • Statistical analyses were performed using student's t-test: asterisk, p ⁇ 0.05.
  • 3C is a bar graph showing the results of deep-sequencing analysis to quantify the frequency of targeted gene editing (% modification frequency IVS2-654 (T->C)) in vivo in CD117+ cells from bone marrow and spleen of ⁇ -globin/GFP mice treated as described for FIGS. 3A and 3B . Error bars indicate standard error of proportions.
  • FIGS. 4A-4C are line graphs showing blood hemoglobin levels (g/dl) of thalassemic mice treated with blank NPs ( 4 A), SCF plus scrambledgfp ⁇ tcPNA4-Scr/donor DNA ( 4 B) (SEQ ID NOS:158 and 65) NPs, or with SCF plus ⁇ tcPNA4/donor DNA ( 4 C) (SEQ ID NOS:33 and 65) NPs performed at the indicated times after treatment. Each line represents an individual mouse followed over time.
  • FIG. 4D is a bar graph showing reticulocyte counts (% of total RBCs) calculated in blood smears from thalassemic mice treated with either blank NPs or with NPs containing ⁇ tcPNA4/donor DNA (SEQ ID NOS:33 and 65) plus SCF on days 0 and 36 post treatment.
  • FIG. 4E is a bar graphs showing the % gene modification (T->C) as determined by deep-sequencing analysis of genomic DNA from bone marrow cells after treatment of thalassemic mice with either blank NPs or with NPs containing and ⁇ tcPNA4/donor DNA (SEQ ID NOS:33 and 65) plus SCF.
  • FIG. 5A is a flow diagram illustrating a GFP/beta globin gene correction assay.
  • FIG. 5B is a bar graph showing gene correction of cells treated with nanoparticles containing tcPNA1 (SEQ ID NO:35) and donor DNA (SEQ ID NO:175) alone, or in combination with an ataxia telangiectasia and Rad3-related protein (ATR) pathway inhibitor (MIRIN, KU5593, VE-821, NU7441, LCA, or L189).
  • ATR ataxia telangiectasia and Rad3-related protein pathway inhibitor
  • 5C is a bar graph showing gene correction of cells treated with nanoparticles containing tcPNA1 (SEQ ID NO:35) and donor DNA (SEQ ID NO:175) alone, or in combination with a Checkpoint Kinase 1 inhibitor (Chk1i) (SB218075), a DNA polymerase alpha inhibitor (Aphi) (aphidicolin) or a polyADP ribose polymerase (PARPi) (AZD-2281 (olaparib)).
  • Chk1i Checkpoint Kinase 1 inhibitor
  • Aphi DNA polymerase alpha inhibitor
  • PARPi polyADP ribose polymerase
  • 5D is a bar graph showing gene correction of control (blank), and cells treated with nanoparticles containing tcPNA1 (SEQ ID NO:35) and donor DNA (SEQ ID NO:175) alone, or in combination with a heat shock protein 90 inhibitor (HSP90i) (STA-9090 (ganetespib)).
  • HSP90i heat shock protein 90 inhibitor
  • FIG. 6A is an illustration of a Sickle Cell Disease mutation (GAG->GTG) in the human beta globin gene, relative to the ATG transcriptional start site and exemplary tcPNAs.
  • FIG. 6B shows the sequences of exemplary PNAs: tcPNA1: lys-lys-lys-JJTJTTJ-OOO-CTTCTCCAAAGGAGT-lys-lys-lys (SEQ ID NO:66); tcPNA2: lys-lys-lys-TTJJTJT-OOO-TCTCCTTAAACCTGT-lys-lys-lys (SEQ ID NO:67); and tcPNA3: lys-lys-lys-TJTJTTJT-OOO-TCTTCTCTGTCTCCAC-lys-lys-lys (SEQ ID NO:68).
  • FIG. 6C shows the sequence of a DNA donor (SEQ ID NO:64).
  • FIG. 7A is a bar graph showing the results of a MQAE (N-(Ethoxycarbonylmethyl)-6-Methoxyquinolinium Bromide) assay (delta(AFU)/(delta(Time (sec)) measuring chloride flux for negative control CFBE cells; CFBE cells treated with blank nanoparticles, PNA2: lys-lys-lys-TJTJJTTT-OOO-TTTCCTCTATGGGTAAG-lys-lys-lys (SEQ ID NO:93)-loaded nanoparticles, PNA2 (SEQ ID NO:93)-loaded nanoparticles with an MPG peptide, ⁇ PNA2 lys-lys-lys- J JJ T -OOO-TTTCCTCTATGGGTAAG-lys-lys-lys (SEQ ID NO:93)-loaded nanoparticles; and untreated positive control wildtype 16HBE14o- cells.
  • MQAE N-(Ethoxycarbonyl
  • FIG. 7B is a dot pot showing nasal potential difference (NPD) (pretreatment, after treatment with ⁇ PNA2 (SEQ ID NO:93)-loaded nanoparticles, and after treatment with blank nanoparticles) measured using a non-invasive assay used to detect chloride potential differences in vivo.
  • NPD nasal potential difference
  • FIG. 8A is an illustration of a mutation (G->A) in the CFTR gene (W1282X) relative to three exemplary tcPNAs.
  • FIG. 8B provides the sequences of the tcPNAs: CF-1236 lys-lys-lys-JTTJJTJTTT-OOO-TTTCTCCTTCAGTGTTCA-lys-lys-lys (SEQ ID NO:169), CF-1314 lys-lys-lys-TTTTJJT-OOO-TCCTTTTGCTCACCTGTGGT-lys-lys-lys (SEQ ID NO:170), and CF-1329: lys-lys-lys-lys-TJTTTTTTJJ-OOO-CCTTTTTTCTGGCTAAGT-lys-lys-lys (SEQ ID NO:157).
  • FIG. 8C provides the sequence of an exemplary donor DNA: T(s)C(s)T(s)TGGGATTCAATAAC TTGCA ACAGTG AGGAA GCC TTTGG GTGATACCACAGG-(s)T(s)G(s) (SEQ ID NO:109).
  • FIG. 9A is an illustration of a mutation (G->T) in the CFTR gene (G542X) relative to three exemplary tcPNAs.
  • FIG. 9B provides the sequences of the tcPNAs: CF-302 lys-lys-lys-TJTTTTT-OOO-TTTTTCTGTAATTTTTAA-lys-lys-lys (SEQ ID NO:121), CF-529 lys-lys-lys-lys-TJTJTTTJT-OOO-TCTTTCTCTGCAAACTT-lys-lys-lys-lys (SEQ ID NO:122), and CF-586 lys-lys-lys-TTTJTTT-OOO-TTTCTTTAAGAACGAGCA-lys-lys-lys (SEQ ID NO:123).
  • FIG. 9C provides the sequence of an exemplary donor DNA: T(s)C(s)C(s)-AAGTTTGCAGAGAAAGA AATATAGT CTT GAG AAGG GGAATCAC CTGAGTGGA-G(s)G(s)T(s) (SEQ ID NO:124).
  • FIG. 10A is an illustration of Strategy for targeted correction of a ⁇ -globin gene containing SCD mutation (A->T) mutation and tcPNAs designed to bind to homopurine regions near the mutation.
  • FIGS. 10D-10E are bar graphs showing the results of deep-sequencing analysis to quantify the frequency of targeted gene editing in vivo in bone marrow cells of Berkley “Berk” mice ( FIG. 10D ) and Townes mice ( FIG. 10E ). Error bars indicate standard error of proportions.
  • FIG. 12 is a graph showing cumulative release of nucleic acid from ⁇ PNA/DNA NPs over a period of 100 hours.
  • FIG. 13A is a bar graph showing blood hemoglobin levels of, from left to right for each time group of 6 and 10 weeks, untreated Hbb th-4 /Hbb + mice; Hbb th-4 /Hbb + mice treated with 300 mg/kg ⁇ tcPNA/DNA NP at E15.5; Hbb th-4 /Hbb + mice treated with 400 mg/kg ⁇ tcPNA/DNA NP at E15.5; and wildtype B6 mice.
  • RBCs total red blood cells
  • FIG. 14D-14E are plots showing how the expected fractional abundance of the wild-type allele (after QuantaSoftTM Software fit the fluorescence data after amplification to a Poisson distribution) was calculated using the ddPCR-quantified copies/ ⁇ l of wild-type and beta-thal alleles in each control sample. The plots compare the ddPCR measured and expected fractional abundance of the wild-type allele in each sample. The observed correlation is linear.
  • FIG. 14E is zoomed-in view of the lower range of FIG. 14D , indicated by a box on the plot of FIG. 14D . Error bars indicate the 95% confidence interval.
  • FIG. 15 is a bar graph showing long-term gene editing (9 months) in 654-eGFP mice (% gene editing in various tissue) either untreated, or treated with ⁇ PNA/DNA PLGA NPs either intravenously (vitelline vein) at E15.5 (15 ⁇ l of NPs resuspended at 9 mg/ml in 1 ⁇ dPBS) or intra-amniotically at E16.5 (20 ⁇ l of NPs resuspended at 9 mg/ml in 1 ⁇ dPBS), or treated with blank PLGA NPs.
  • FIG. 16B is a bar graph showing confirmation of gene editing (% modification) by deep sequencing of e15.5 IV-treated lung 4 days post nanoparticle delivery.
  • FIGS. 16C and 16D are representative 2D ddPCR plots of edited lungs four days post-intravenous in utero NP treatment.
  • Looped dots labeled “empty” indicate empty droplets (no DNA template)
  • looped dots labeled “beta-thal” indicate droplets loaded with unedited templates containing the beta-thalasemia 654-splice site mutation
  • looped dots labeled “edit” indicate droplets containing edited templates
  • looped dots labeled “double positive” indicate droplets that contain both edited and un-edited templates.
  • FIGS. 17A-17E are 2D ddPCR plots.
  • FIG. 17A illustrates the design of a ddPCR assay to detect murine CFTR gene editing. This 2D plot is the overlay of four samples (no template control (“no template”), ssDNA containing the F508del mutation (“F508del”), ssDNA containing the edited template (“edit”), and a sample containing both F508del and edited ssDNA (“double positive”)).
  • no template no template control
  • F508del ssDNA containing the F508del mutation
  • edit ssDNA containing the edited template
  • double positive double positive
  • 17B-17E are representative ddPCR 2D plots of no template control ( 17 B), untreated gDNA ( 17 C), gDNA extracted from the lung ( 17 D) and nasal epithelium ( 17 E) 8 months after E16.5 intra-amniotic treatment with PNA/DNA PLGA/PBAE/MPG NPs (20 ⁇ l of NPs resuspended to a concentration of 9 mg/ml in 1 ⁇ dPBS).
  • FIG. 19 is a bar graph showing quantification of gene editing of the IVS2-654 mutation in bone marrow (BM) cells treated with PNA/DNA-loaded PLGA or 60% PDL PACE NPs after 48 h.
  • FIG. 20 is a graph showing the binding specificity (using defect-to-skin brightness ratio used as a surrogate for binding specificity) of fluorescent particles to the MMC defect for different particle compositions.
  • FIG. 21 is a graph showing the amount of rat/mouse basic fibroblast growth factor (bFGF) (pg/mL), obtained from ELISA, of non-injected MMC fetuses at different timepoints around the time of injection. Despite a decrease at E17.5, there appears to be an overall increase in bFGF levels toward full term, with a mean level of 67.3 pg/mL by E21.
  • bFGF basic fibroblast growth factor
  • affinity tags are defined herein as molecular species which form highly specific, non-covalent, physiochemical interactions with defined binding partners. Affinity tags which form highly specific, non-covalent, physiochemical interactions with one another are defined herein as “complementary”.
  • coupling agents are defined herein as molecular entities which associate with polymeric particles and provide substrates that facilitate the modular assembly and disassembly of functional elements onto the particle.
  • Coupling agents can be conjugated to affinity tags.
  • Affinity tags allow for flexible assembly and disassembly of functional elements which are conjugated to affinity tags that form highly specific, noncovalent, physiochemical interactions with affinity tags conjugated to adaptor elements.
  • Coupling agents can also be covalently coupled to functional elements in the absence of affinity tags.
  • isolated describes a compound of interest (e.g., either a polynucleotide or a polypeptide) that is in an environment different from that in which the compound naturally occurs, e.g., separated from its natural milieu such as by concentrating a peptide to a concentration at which it is not found in nature. “Isolated” is meant to include compounds that are within samples that are substantially enriched for the compound of interest and/or in which the compound of interest is partially or substantially purified.
  • isolated includes any non-naturally-occurring nucleic acid sequence, since such non-naturally-occurring sequences are not found in nature and do not have immediately contiguous sequences in a naturally-occurring genome.
  • the term “host cell” refers to prokaryotic and eukaryotic cells into which a nucleic acid can be introduced.
  • transformed and transfected encompass the introduction of a nucleic acid into a cell by one of a number of techniques known in the art.
  • a molecule “specifically binds” to a target refers to a binding reaction which is determinative of the presence of the molecule in the presence of a heterogeneous population of other biologics.
  • a specified molecule binds preferentially to a particular target and does not bind in a significant amount to other biologics present in the sample.
  • Specific binding of an antibody to a target under such conditions requires the antibody be selected for its specificity to the target.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select monoclonal antibodies specifically immunoreactive with a protein.
  • Specific binding between two entities means an affinity of at least 10 6 , 10 7 , 10 8 , 10 9 , or 10 10 M ⁇ 1 . Affinities greater than 10 8 M ⁇ 1 are preferred.
  • targeting molecule is a substance which can direct a particle to a receptor site on a selected cell or tissue type, can serve as an attachment molecule, or serve to couple or attach another molecule.
  • direct refers to causing a molecule to preferentially attach to a selected cell or tissue type. This can be used to direct cellular materials, molecules, or drugs, as discussed below.
  • antibody or “immunoglobulin” are used to include intact antibodies and binding fragments thereof. Typically, fragments compete with the intact antibody from which they were derived for specific binding to an antigen fragment including separate heavy chains, light chains Fab, Fab′ F(ab′)2, Fabc, and Fv. Fragments are produced by recombinant DNA techniques, or by enzymatic or chemical separation of intact immunoglobulins.
  • antibody also includes one or more immunoglobulin chains that are chemically conjugated to, or expressed as, fusion proteins with other proteins.
  • antibody also includes a bispecific antibody. A bispecific or bifunctional antibody is an artificial hybrid antibody having two different heavy/light chain pairs and two different binding sites.
  • Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab′ fragments. See, e.g., Songsivilai and Lachmann, Clin. Exp. Immunol., 79:315-321 (1990); Kostelny, et al., J. Immunol., 148, 1547-1553 (1992).
  • epitopes As used herein, the terms “epitope” or “antigenic determinant” refer to a site on an antigen to which B and/or T cells respond.
  • B-cell epitopes can be formed both from contiguous amino acids or noncontiguous amino acids juxtaposed by tertiary folding of a protein. Epitopes formed from contiguous amino acids are typically retained on exposure to denaturing solvents whereas epitopes formed by tertiary folding are typically lost on treatment with denaturing solvents.
  • An epitope typically includes at least 3, and more usually, at least 5 or 8-10, amino acids, in a unique spatial conformation. Methods of determining spatial conformation of epitopes include, for example, x-ray crystallography and 2-dimensional nuclear magnetic resonance.
  • T-cells recognize continuous epitopes of about nine amino acids for CD8 cells or about 13-15 amino acids for CD4 cells.
  • T cells that recognize the epitope can be identified by in vitro assays that measure antigen-dependent proliferation, as determined by 3 H-thymidine incorporation by primed T cells in response to an epitope (Burke, et al., J. Inf. Dis., 170:1110-19 (1994)), by antigen-dependent killing (cytotoxic T lymphocyte assay, Tigges, et al., J. Immunol., 156, 3901-3910) or by cytokine secretion.
  • small molecule generally refers to an organic molecule that is less than about 2000 g/mol in molecular weight, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol. Small molecules are non-polymeric and/or non-oligomeric.
  • carrier or “excipient” refers to an organic or inorganic ingredient, natural or synthetic inactive ingredient in a formulation, with which one or more active ingredients are combined.
  • the term “pharmaceutically acceptable” means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients.
  • the terms “effective amount” or “therapeutically effective amount” means a dosage sufficient to alleviate one or more symptoms of a disorder, disease, or condition being treated, or to otherwise provide a desired pharmacologic and/or physiologic effect.
  • the precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, etc.), the disease or disorder being treated, as well as the route of administration and the pharmacokinetics of the agent being administered.
  • prevention means to administer a composition to a subject or a system at risk for or having a predisposition for one or more symptom caused by a disease or disorder to cause cessation of a particular symptom of the disease or disorder, a reduction or prevention of one or more symptoms of the disease or disorder, a reduction in the severity of the disease or disorder, the complete ablation of the disease or disorder, stabilization or delay of the development or progression of the disease or disorder.
  • the term “subject” or “patient” refers to any mammal who is the target of administration.
  • the subject can be a human.
  • the subject can be domesticated, agricultural, or wild animals.
  • domesticated animals include, for example, dogs, cats, rabbits, ferrets, guinea pigs, hamsters, pigs, monkeys or other primates, and gerbils.
  • Agricultural animals include, for example, horses, cattle, pigs, sheep, rabbits, and goats. The term does not denote a particular age or sex.
  • the subject is an embryo or fetus.
  • compositions and methods for in utero treatment of a fetus or embryo are provided.
  • the methods can include injecting or infusing into the vitelline vein of a fetus or embryo, injecting or infusing into its amniotic sac (e.g., intraamniotic sac injection), or a combination thereof and a composition having an effective amount of an active agent.
  • the composition is the active agent.
  • an effective amount of the same or a different active agents are administered by injection or infusion into the vitelline vein and by injection or infusion into the amniotic sac.
  • the active agent can be a therapeutic agent, a nutritional agent, a diagnostic agent, or a prophylactic agent.
  • the active agent can be a small molecule, a protein, or a nucleic acid.
  • the active agent can be an antisense agent or a gene editing composition.
  • compositions can include a biodegradable or bioerodible material in which the active agent is embedded or encapsulated.
  • Any of the active agents including, but not limited to, therapeutic, nutritional, diagnostic, prophylactic agents, etc., can be, but need not necessarily be, delivered to the target cells using a particle-based delivery vehicle.
  • the active agent can be encapsulated and/or entrapped and/or dispersed in a particle(s).
  • Compositions can include a plurality of particles having an active agent encapsulated and/or entrapped and/or dispersed therein, in a pharmaceutically-acceptable carrier, and formulated for infusion or injection into a vitelline artery or a vitelline vein or for intraamniotic sac injection.
  • the particles can be capable of controlled release of the active agent.
  • the particles can be microparticle(s) and/or nanoparticle(s).
  • the particles can include one or more polymers.
  • One or more of the polymers can be a synthetic polymer.
  • the particle or particles can be formed by, for example, single emulsion technique or double emulsion technique or nanoprecipitation.
  • compositions are packaged in particles and some are not.
  • a gene editing technology and/or donor oligonucleotide can be incorporated into particles while a co-administered potentiating factor is not.
  • a gene editing technology and/or donor oligonucleotide and a potentiating factor are both packaged in particles.
  • Different compositions can be packaged in the same particles or different particles. For example, two or more active agents can be mixed and packaged together.
  • the different compositions are packaged separately into separate particles wherein the particles are similarly or identically composed and/or manufactured.
  • the different compositions are packaged separately into separate particles wherein the particles are differentially composed and/or manufactured.
  • the delivery vehicles can be nanoscale compositions, for example, 0.5 nm up to, but not including, about 1 micron.
  • the particles can be smaller, or larger.
  • the particles can be microparticles, supraparticles, etc.
  • particle compositions can be between about 1 micron to about 1000 microns. Such compositions can be referred to as microparticulate compositions.
  • Nanoparticles generally refers to particles in the range of less than 0.5 nm up to, but not including 1,000 nm. In some embodiments, the nanoparticles have a diameter between 500 nm to less than 0.5 nm, or between 50 and 500 nm, or between 50 and 300 nm. Cellular internalization of polymeric particles can highly dependent upon their size, with nanoparticulate polymeric particles being internalized by cells with much higher efficiency than micoparticulate polymeric particles. For example, Desai, et al. have demonstrated that about 2.5 times more nanoparticles that are 100 nm in diameter are taken up by cultured Caco-2 cells as compared to microparticles having a diameter on 1 ⁇ M (Desai, et al., Pharm. Res., 14:1568-73 (1997)). Nanoparticles also have a greater ability to diffuse deeper into tissues in vivo.
  • the particles can be microparticles.
  • Microparticle generally refers to a particle having a diameter, from about 1 micron to about 100 microns.
  • the particles can also be from about 1 to about 50 microns, or from about 1 to about 30 microns, or from about 1 micron to about 10 microns.
  • the microparticles can have any shape. Microparticles having a spherical shape may be referred to as “microspheres.”
  • Supraparticles are particles having a diameter above about 100 ⁇ m in size.
  • supraparticle may have a diameter of about 100 ⁇ m to about 1,000 ⁇ m in size.
  • the particles can have a mean particle size.
  • Mean particle size generally refers to the statistical mean particle size (diameter) of the particles in the composition.
  • Two populations can be said to have a substantially equivalent mean particle size when the statistical mean particle size of the first population of particles is within 20% of the statistical mean particle size of the second population of particles; more preferably within 15%, most preferably within 10%.
  • the weight average molecular weight can vary for a given polymer but is generally from about 1000 Daltons to 1,000,000 Daltons, 1000 Daltons to 500,000 Dalton, 1000 Daltons to 250,000 Daltons, 1000 Daltons to 100,000 Daltons, 5,000 Daltons to 100,000 Daltons, 5,000 Daltons to 75,000 Daltons, 5,000 Daltons to 50,000 Daltons, or 5,000 Daltons to 25,000 Daltons.
  • Particles are can be formed of one or more polymers. Exemplary polymers are discussed below. Copolymers such as random, block, or graft copolymers, or blends of the polymers listed below can also be used.
  • Functional groups on the polymer can be capped to alter the properties of the polymer and/or modify (e.g., decrease or increase) the reactivity of the functional group.
  • the carboxyl termini of carboxylic acid contain polymers, such as lactide- and glycolide-containing polymers, may optionally be capped, e.g., by esterification, and the hydroxyl termini may optionally be capped, e.g. by etherification or esterification.
  • Copolymers of PEG or derivatives thereof with any of the polymers described below may be used to make the polymeric particles.
  • the PEG or derivatives may be located in the interior positions of the copolymer.
  • the PEG or derivatives may locate near or at the terminal positions of the copolymer.
  • one or more of the polymers above can be terminated with a block of polyethylene glycol.
  • the core polymer is a blend of pegylated polymer and non-pegylated polymer, wherein the base polymer is the same (e.g., PLGA and PLGA-PEG) or different (e.g., PLGA-PEG and PLA).
  • the microparticles or nanoparticles are formed under conditions that allow regions of PEG to phase separate or otherwise locate to the surface of the particles.
  • the surface-localized PEG regions alone may perform the function of, or include, the surface-altering agent.
  • the particles are prepared from one or more polymers terminated with blocks of polyethylene glycol as the surface-altering material.
  • the particles in amniotic space release therapeutic agents over at least 3 days, 5 days, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or longer.
  • the particles possess a ⁇ -potential of between about 50 mV and about ⁇ 50 mV, between about 30 mV and about ⁇ 30 mV, or between about 10 mV and about ⁇ 10 mV.
  • Some charges on the surface of the particles may facilitate binding with the MMC defect in amniotic space or binding to nucleic acids.
  • the charge of the particles can be selected based on the active agent to be delivered, the disease to be treated, or a combination thereof.
  • the particles may be desirable for the particles to have a negative charge, for example when delivering proteins such as growth factors.
  • some or all of the polymers forming the particle can have a terminal moiety that imparts a negative charge to the particle.
  • the negatively charged moiety is a chemical modification to the polymer itself that imparts a negative charge to the polymer.
  • the negatively charge moiety is a separate, negatively-charged component that is conjugated to the polymer.
  • the terminal moiety that imparts a negative charge to the particles can be an acidic group or an anionic group.
  • acidic groups include, but are not limited to, carboxylic acids, protonated sulfates, protonated sulfonates, protonated phosphates, singly- or doubly protonated phosphonates, and singly- or doubly protonated hydroxamates.
  • the corresponding salts of these acidic groups form anionic groups such as carboxylates, sulfates, sulfonates, singly- or doubly deprotonated phosphates, singly- or doubly deprotonated phosphonates, and hydroxamates.
  • the particles may be used as nucleic acid carriers.
  • the particles can be formed of one or more cationic polymers which complex with one or more nucleic acids which are negatively charged.
  • the cationic polymer can be any synthetic or natural polymer bearing at least two positive charges per molecule and having sufficient charge density and molecular size to bind to nucleic acid under physiological conditions (i.e., pH and salt conditions encountered within the body or within cells).
  • the polycationic polymer contains one or more amine residues.
  • Suitable cationic polymers include, for example, polyethylene imine (PEI), polyallylamine, polyvinylamine, polyvinylpyridine, aminoacetalized poly(vinyl alcohol), acrylic or methacrylic polymers (for example, poly(N,N-dimethylaminoethylmethacrylate)) bearing one or more amine residues, polyamino acids such as polyornithine, polyarginine, and polylysine, protamine, cationic polysaccharides such as chitosan, DEAE-cellulose, and DEAE-dextran, and polyamidoamine dendrimers (cationic dendrimer), as well as copolymers and blends thereof.
  • the polycationic polymer is poly(amine-co-ester), poly(amine-co-amide) polymer, or poly(amine-co-ester-co-ortho ester).
  • Cationic polymers can be either linear or branched, can be either homopolymers or copolymers, and when containing amino acids can have either L or D configuration, and can have any mixture of these features.
  • the cationic polymer molecule is sufficiently flexible to allow it to form a compact complex with one or more nucleic acid molecules.
  • the cationic polymer has a molecular weight of between about 5,000 Daltons and about 100,000 Daltons, more preferably between about 5,000 and about 50,000 Daltons, most preferably between about 10,000 and about 35,000 Daltons.
  • the particles include a hydrophobic polymer, poly(amine-co-ester), poly(amine-co-amide) polymer, or poly(amine-co-ester-co-ortho ester), and optionally, but a shell of, for example, PEG.
  • the core-shell particles can be formed by a co-block polymer. Exemplary polymers are provided below.
  • the polymer that forms the core of the particle may be any biodegradable or non-biodegradable synthetic or natural polymer.
  • the polymer is a biodegradable polymer.
  • Particles are ideal materials for the fabrication of gene editing delivery vehicles: 1) control over the size range of fabrication, down to 100 nm or less, an important feature for passing through biological barriers; 2) reproducible biodegradability without the addition of enzymes or cofactors; 3) capability for sustained release of encapsulated, protected nucleic acids over a period in the range of days to months by varying factors such as the monomer ratios or polymer size, for example, the ratio of lactide to glycolide monomer units in poly(lactide-co-glycolide) (PLGA); 4) well-understood fabrication methodologies that offer flexibility over the range of parameters that can be used for fabrication, including choices of the polymer material, solvent, stabilizer, and scale of production; and 5) control over surface properties facilitating the introduction of modular functionalities into the surface.
  • the monomer ratios or polymer size for example, the ratio of lactide to glycolide monomer units in poly(lactide-co-glycolide) (PLGA)
  • PLGA poly(l
  • biocompatible polymers can be used to prepare the particles.
  • the biocompatible polymer(s) is biodegradable.
  • the particles are non-degradable.
  • the particles are a mixture of degradable and non-degradable particles.
  • biodegradable polymers include synthetic polymers that degrade by hydrolysis such as poly(hydroxy acids), such as polymers and copolymers of lactic acid and glycolic acid, other degradable polyesters, polyanhydrides, poly(ortho)esters, polyesters, polyurethanes, poly(butic acid), poly(valeric acid), poly(caprolactone), poly(hydroxyalkanoates), poly(lactide-co-caprolactone), and poly(amine-co-ester) polymers, such as those described in Zhou, et al., Nature Materials, 11(1):82-90 (2011), Tietjen, et al. Nature Communications, 8:191 (2017) doi:10.1038/s41467-017-00297-x, and WO 2013/082529, U.S. Published Application No. 2014/0342003, and PCT/US2015/061375.
  • poly(hydroxy acids) such as polymers and copolymers of lactic acid and glycolic acid
  • Preferred natural polymers include alginate and other polysaccharides, collagen, albumin and other hydrophilic proteins, zein and other prolamines and hydrophobic proteins, copolymers and mixtures thereof. In general, these materials degrade either by enzymatic hydrolysis or exposure to water in vivo, by surface or bulk erosion.
  • Exemplary polymers include, but are not limited to, cyclodextrin-containing polymers, in particular cationic cyclodextrin-containing polymers, such as those described in U.S. Pat. No. 6,509,323,
  • non-biodegradable polymers can be used, especially hydrophobic polymers.
  • preferred non-biodegradable polymers include ethylene vinyl acetate, poly(meth) acrylic acid, copolymers of maleic anhydride with other unsaturated polymerizable monomers, poly(butadiene maleic anhydride), polyamides, copolymers and mixtures thereof, and dextran, cellulose and derivatives thereof.
  • biodegradable and non-biodegradable polymers include, but are not limited to, polyanhydrides, polyamides, polycarbonates, polyalkylenes, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate) and ethylene vinyl acetate polymer (EVA), polyvinyl alcohols, polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyethylene, polypropylene, poly(vinyl acetate), poly vinyl chloride, polystyrene, polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polyvinylpyrrolidone, polymers of acrylic and methacrylic esters, polysiloxanes, polyurethanes and copo
  • the polymer may be a bioadhesive polymer that is hydrophilic or hydrophobic.
  • Hydrophilic polymers include CARBOPOLTM (a high molecular weight, crosslinked, acrylic acid-based polymers such as those manufactured by NOVEONTM), polycarbophil, cellulose esters, and dextran.
  • polymers of acrylic acids include, but are not limited to, poly(methyl(meth)acrylate) (PMMA), poly(ethyl(meth)acrylate), poly(butyl(meth)acrylate), poly(isobutyl(meth)acrylate), poly(hexyl(meth)acrylate), poly(isodecyl(meth)acrylate), poly(lauryl(meth)acrylate), poly(phenyl(meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), and poly(octadecyl acrylate) (jointly referred to herein as “polyacrylic acids”).
  • Release rate controlling polymers may be included in the polymer matrix or in the coating on the formulation.
  • rate controlling polymers examples include hydroxypropylmethylcellulose (HPMC) with viscosities of either 5, 50, 100 or 4000 cps or blends of the different viscosities, ethylcellulose, methylmethacrylates, such as EUDRAGIT® RS100, EUDRAGIT® RL100, EUDRAGIT® NE 30D (supplied by Rohm America).
  • Gastrosoluble polymers, such as EUDRAGIT® E100 or enteric polymers such as EUDRAGIT® L100-55D, L100 and 5100 may be blended with rate controlling polymers to achieve pH dependent release kinetics.
  • Other hydrophilic polymers such as alginate, polyethylene oxide, carboxymethylcellulose, and hydroxyethylcellulose may be used as rate controlling polymers.
  • polymers can be obtained from sources such as Sigma Chemical Co., St. Louis, Mo.; Polysciences, Warrenton, Pa.; Aldrich, Milwaukee, Wis.; Fluka, Ronkonkoma, N.Y.; and BioRad, Richmond, Calif., or can be synthesized from monomers obtained from these or other suppliers using standard techniques.
  • the hydrophobic polymer is an aliphatic polyester. In preferred embodiments, the hydrophobic polymer is polyhydroxyester such as poly(lactic acid), poly(glycolic acid), or poly(lactic acid-co-glycolic acid).
  • polymers include, but are not limited to, polyalkyl cyanoacralate, polyamino acids such as poly-L-lysine (PLL), poly(valeric acid), and poly-L-glutamic acid, hydroxypropyl methacrylate (HPMA), polyorthoesters, poly(ester amides), poly(ester ethers), polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poly(butyric acid), trimethylene carbonate, and polyphosphazenes.
  • polyalkyl cyanoacralate polyamino acids such as poly-L-lysine (PLL), poly(valeric acid), and poly-L-glutamic acid, hydroxypropyl methacrylate (HPMA), polyorthoesters, poly(ester amides), poly(ester ethers), polydioxanone and its copolymers, polyhydroxyalkanoates, polypropy
  • the particles can be designed to release molecules to be encapsulated or attached over a period of days to weeks.
  • Factors that affect the duration of release include pH of the surrounding medium (higher rate of release at pH 5 and below due to acid catalyzed hydrolysis of PLGA) and polymer composition.
  • Aliphatic polyesters differ in hydrophobicity and that in turn affects the degradation rate.
  • the hydrophobic poly (lactic acid) (PLA), more hydrophilic poly (glycolic acid) PGA and their copolymers, poly (lactide-co-glycolide) (PLGA) have different release rates.
  • the degradation rate of these polymers, and often the corresponding drug release rate can vary from days (PGA) to months (PLA) and is easily manipulated by varying the ratio of PLA to PGA.
  • the particles can contain one more of the following polyesters: homopolymers including glycolic acid units, referred to herein as “PGA”, and lactic acid units, such as poly-L-lactic acid, poly-D-lactic acid, poly-D,L-lactic acid, poly-L-lactide, poly-D-lactide, and poly-D,L-lactide, collectively referred to herein as “PLA”, and caprolactone units, such as poly(8-caprolactone), collectively referred to herein as “PCL”; and copolymers including lactic acid and glycolic acid units, such as various forms of poly(lactic acid-co-glycolic acid) and poly(lactide-co-glycolide) characterized by the ratio of lactic acid:glycolic acid, collectively referred to herein as “PLGA”; and polyacrylates, and derivatives thereof.
  • PGA glycolic acid units
  • lactic acid units such as poly-L-lactic acid, poly-D-lactic acid, poly-D,L-
  • Exemplary polymers also include copolymers of polyethylene glycol (PEG) and the aforementioned polyesters, such as various forms of PLGA-PEG or PLA-PEG copolymers, collectively referred to herein as “PEGylated polymers”.
  • PEG polyethylene glycol
  • the PEG region can be covalently associated with polymer to yield “PEGylated polymers” by a cleavable linker.
  • particles can also contain one or more polymer conjugates containing end-to-end linkages between the polymer and a targeting moiety or a detectable label.
  • a modified polymer can be a PLGA-PEG-peptide block polymer.
  • the in vivo stability/release of the particles can be adjusted during the production by using polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the external surface, it may increase the time these materials circulate due to the hydrophilicity of PEG.
  • polymers such as poly(lactide-co-glycolide) copolymerized with polyethylene glycol (PEG). If PEG is exposed on the external surface, it may increase the time these materials circulate due to the hydrophilicity of PEG.
  • a shell can also be formed of or contain a hyperbranched polymer (HP) with hydroxyl groups, such as a hyperbranched polyglycerol (HPG), hyperbranched peptides (HPP), hyperbranched oligonucleotides (HON), hyperbranched polysaccharides (HPS), and hyperbranched polyunsaturated or saturated fatty acids (HPF).
  • HP can be covalently bound to the one or more materials that form the core such that the hydrophilic HP is oriented towards the outside of the particles and the hydrophobic material oriented to form the core.
  • the HP coating can be modified to adjust the properties of the particles.
  • unmodified HP coatings impart stealth properties to the particles which resist non-specific protein absorption and are referred to as nonbioadhesive nanoparticles (NNPs).
  • NNPs nonbioadhesive nanoparticles
  • the hydroxyl groups on the HP coating can be chemically modified to form functional groups that react with functional groups on tissue or otherwise interact with tissue to adhere the particles to the tissue, cells, or extracellular materials, such as proteins.
  • functional groups include, but are not limited to, aldehydes, amines, and O-substituted oximes.
  • Particles with an HP coating chemically modified to form functional groups are referred to as bioadhesive nanoparticles (BNPs).
  • the chemically modified HP coating of BNPs forms a bioadhesive corona of the particle surrounding the hydrophobic material forming the core. See, for example, WO 2015/172149, WO 2015/172153, WO 2016/183209, and U.S. Published Applications 2017/0000737 and 2017/0266119.
  • Particles can be formed of polymers fabricated from polylactides (PLA) and copolymers of lactide and glycolide (PLGA). These have established commercial use in humans and have a long safety record (Jiang, et al., Adv. Drug Deliv. Rev., 57(3):391-410); Aguado and Lambert, Immunobiology, 184(2-3):113-25 (1992); Bramwell, et al., Adv. Drug Deliv. Rev., 57(9):1247-65 (2005)). These polymers have been used to encapsulate siRNA (Yuan, et al., Jour. Nanosocience and Nanotechnology, 6:2821-8 (2006); Braden, et al., Jour. Biomed.
  • microspheres were too large to be endocytosed (35-45 ⁇ m) (Conner and Schmid, Nature, 422(6927):37-44 (2003)) and required release of the anti-VEGF siRNA extracellularly as a polyplex with either polyarginine or PEI before they could be internalized by the cell.
  • These microparticles may have limited applications because of the toxicity of the polycations and the size of the particles. Nanoparticles (100-300 nm) of PLGA can penetrate deep into tissue and are easily internalized by many cells (Conner and Schmid, Nature, 422(6927):37-44 (2003)).
  • Exemplary particles are described in U.S. Pat. Nos. 4,883,666, 5,114,719, 5,601,835, 7,534,448, 7,534,449, 7,550,154, and 8,889,117, and U.S. Published Application Nos.
  • the core of the particles can be formed of or contain one or more poly(amine-co-ester), poly(amine-co-amide), poly(amine-co-ester-co-ortho ester) or a combination thereof.
  • the particles are polyplexes.
  • the content of a hydrophobic monomer in the polymer is increased relative the content of the same hydrophobic monomer when used to form polyplexes.
  • Increasing the content of a hydrophobic monomer in the polymer forms a polymer that can form solid core particles in the presence of nucleic acids. Unlike polyplexes, these particles are stable for long periods of time during incubation in buffered water, or serum, or upon administration (e.g., injection) into animals.
  • the molecular weight of the polymer is less than 5 kDa, 7.5 kDa, 10 kDa, 20 kDa, or 25 kDa. In some forms the molecular weight of the polymer is between about 1 kDa and about 25 kDa, between about 1 kDa and about 10 kDa, between about 1 kDa and about 7.5 kDa.
  • the polymers can have the general formula:
  • A, B, C, D, and E independently include monomeric units derived from lactones (such as pentadecalactone), a polyfunctional molecule (such as N-methyldiethanolamine), a diacid or diester (such as diethylsebacate), an ortho ester, or polyalkylene oxide (such as polyethylene glycol).
  • lactones such as pentadecalactone
  • a polyfunctional molecule such as N-methyldiethanolamine
  • a diacid or diester such as diethylsebacate
  • an ortho ester or polyalkylene oxide
  • polyalkylene oxide such as polyethylene glycol
  • the polymers include at least a lactone, a polyfunctional molecule, and a diacid or diester monomeric units.
  • the polymers include at least a lactone, a polyfunctional molecule, an ortho ester, and a diacid or diester monomeric units.
  • the polyfunctional molecule contains one or more cations, one or more positively ionizable atoms, or combinations thereof.
  • the one or more cations are formed from the protonation of a basic nitrogen atom, or from quaternary nitrogen atoms.
  • x, y, q, w, and f are independently integers from 0-1000, with the proviso that the sum (x+y+q+w+f) is greater than one.
  • h is an integer from 1 to 1000.
  • the percent composition of the lactone can be between about 30% and about 100%, calculated as the mole percentage of lactone unit vs. (lactone unit+diester/diacid).
  • the lactone unit vs. (lactone unit+diester/diacid) content is between about 0.3 and about 1.
  • the number of carbon atoms in the lactone unit is between about 10 and about 24. In some embodiments, the number of carbon atoms in the lactone unit is between about 12 and about 16. In some embodiments, the number of carbon atoms in the lactone unit is 12 (dodecalactone), 15 (pentadecalactone), or 16 (hexadecalactone).
  • Suitable polymers as well as particles and polyplexes formed therefrom are disclosed in WO 2013/082529, WO 2016/183217, U.S. Published Application No. 2016/0251477, U.S. Published Application No. 2015/0073041, U.S. Published Application No. 2014/0073041, and U.S. Pat. No. 9,272,043, each of which is specifically incorporated by reference in entirety.
  • the polymer includes a structure that has the formula:
  • n is an integer from 1-30
  • m, o, and p are independently an integer from 1-20
  • x, y, and q are independently integers from 1-1000
  • Z and Z′ are independently O or NR′, wherein R and R′ are independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl.
  • R and R′ groups include, but are not limited to, hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, phenyl, naphthalyl, anthracenyl, phenanthryl, chrysenyl, pyrenyl, tolyl, xylyl, etc.
  • the values of x, y, and q are such that the weight average molecular weight of the polymer is greater than 5,000 Daltons. In some aspects, the molecular weight of the polymer is less than 5 kDa, 7.5 kDa, 10 kDa, 20 kDa, or 25 kDa. In some forms the molecular weight of the polymer is between about 1 kDa and about 25 kDa, between about 1 kDa and about 10 kDa, between about 1 kDa and about 7.5 kDa.
  • the polymer can be prepared from one or more lactones, one or more amine-diols, triamines, or hydroxy diamines, and one or more diacids or diesters.
  • lactones one or more amine-diols, triamines, or hydroxy diamines
  • diacids or diesters one or more diacids or diesters.
  • the values of n, o, p, and/or m can be the same or different.
  • the percent composition of the lactone unit is between about 30% and about 100%, calculated lactone unit vs. (lactone unit+diester/diacid).
  • the lactone unit vs. (lactone unit+diester/diacid) content is between about 0.3 and about 1, i.e., x/(x+q) is between about 0.3 and about 1.
  • the number of carbon atoms in the lactone unit is between about 10 and about 24, more preferably the number of carbon atoms in the lactone unit is between about 12 and about 16. Most preferably, the number of carbon atoms in the lactone unit is 12 (dodecalactone), 15 (pentadecalactone), or 16 (hexadecalactone).
  • Z and Z′ are O. In some embodiments, Z is O and Z′ is NR′, or Z is NR′ and Z′ is O, wherein R′ is hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl.
  • R′ examples include, but are not limited to, hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, phenyl, naphthalyl, anthracenyl, phenanthryl, chrysenyl, pyrenyl, tolyl, xylyl, etc.
  • Z and Z′ are O and n is an integer from 1-24, such 4, 10, 13, or 14.
  • Z and Z′ are O, n is an integer from 1-24, such 4, 10, 13, or 14, and m is an integer from 1-10, such as 4, 5, 6, 7, or 8.
  • Z and Z′ are O, n is an integer from 1-24, such 4, 10, 13, or 14, m is an integer from 1-10, such as 4, 5, 6, 7, or 8, and o and p are the same integer from 1-6, such 2, 3, or 4.
  • Z and Z′ are O
  • n is an integer from 1-24, such 4, 10, 13, or 14
  • m is an integer from 1-10, such as 4, 5, 6, 7, or 8
  • R is alkyl, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, or aryl, such as phenyl, naphthalyl, anthracenyl, phenanthryl, chrysenyl, pyrenyl, tolyl, or xylyl.
  • n 14 (e.g., pentadecalactone, PDL), m is 7 (e.g., diethylsebacate, DES), o and p are 2 (e.g., N-methyldiethanolamine, MDEA).
  • n, m, o, and p are as defined above, and PEG is incorporated as a monomer.
  • the values of x, y, and q are such that the weight average molecular weight of the polymer is greater than 5,000 Daltons.
  • n, o, p, and/or m can be the same or different.
  • the monomer units can be substituted at one or more positions with one or more substituents.
  • substituents include, but are not limited to, alkyl groups, cyclic alkyl groups, alkene groups, cyclic alkene groups, alkynes, halogen, hydroxyl, carbonyl (such as a carboxyl, alkoxycarbonyl, formyl, or an acyl), thiocarbonyl (such as a thioester, a thioacetate, or a thioformate), alkoxyl, phosphoryl, phosphate, phosphonate, phosphinate, amino, amido, amidine, imine, cyano, nitro, azido, sulfhydryl, alkylthio, sulfate, sulfonate, sulfamoyl, sulfonamido, sulfonyl, nitro, heterocyclyl, aralkyl, or an aromatic or heteroar
  • the polymer is preferably biocompatible.
  • lactones of various ring sizes are known to possess low toxicity: for example, polyesters prepared from small lactones, such as poly(caprolactone) and poly(p-dioxanone) are commercially available biomaterials which have been used in clinical applications.
  • Large (e.g., C 16 -C 24 ) lactones and their polyester derivatives are natural products that have been identified in living organisms, such as bees. Lactones containing ring carbon atoms between 16 and 24 are specifically contemplated and disclosed.
  • the polymer is biocompatible and biodegradable.
  • the nucleic acid(s) encapsulated by and/or associated with the particles can be released through different mechanisms, including diffusion and degradation of the polymeric matrix.
  • the rate of release can be controlled by varying the monomer composition of the polymer and thus the rate of degradation. For example, if simple hydrolysis is the primary mechanism of degradation, increasing the hydrophobicity of the polymer may slow the rate of degradation and therefore increase the time period of release.
  • the polymer composition is selected such that an effective amount of nucleic acid(s) is released to achieve the desired purpose/outcome.
  • the polymers can further include one or more blocks of an alkylene oxide, such as polyethylene oxide, polypropylene oxide, and/or polyethylene oxide-co-polypropylene oxide.
  • an alkylene oxide such as polyethylene oxide, polypropylene oxide, and/or polyethylene oxide-co-polypropylene oxide.
  • n is an integer from 1-30
  • m, o, and p are independently an integer from 1-20
  • x, y, q, and w are independently integers from 1-1000
  • Z and Z′ are independently O or NR′
  • R and R′ are independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl, wherein T is oxygen or is absent
  • R 7 is hydrogen, alkyl, substituted alkyl, aryl, substituted alkyl, cycloalkyl, substituted cycloalkyl, maleimide, amine, thiol, N-hydroxysuccinimide ester, azide, acrylate, methacrylate, alkyne, hydroxide, or isocynate.
  • the values of x, y, q, and w are such that the weight average molecular weight of the polymer is greater than 5,000 Daltons. In some aspects, the molecular weight of the polymer is less than 5 kDa, 7.5 kDa, 10 kDa, 20 kDa, or 25 kDa. In some forms the molecular weight of the polymer is between about 1 kDa and about 25 kDa, between about 1 kDa and about 10 kDa, between about 1 kDa and about 7.5 kDa.
  • R and R′ groups include, but are not limited to, hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, phenyl, naphthalyl, anthracenyl, phenanthryl, chrysenyl, pyrenyl, tolyl, xylyl, etc.
  • n is an integer from 1-30
  • m, o, and p are independently an integer from 1-20
  • x, y, q, and w are independently integers from 1-1000
  • Z and Z′ are independently O or NR′
  • R and R′ are independently hydrogen, substituted or unsubstituted alkyl, or substituted or unsubstituted aryl, wherein T is oxygen or is absent
  • R 7 is hydrogen, alkyl, substituted alkyl, aryl, substituted alkyl, cycloalkyl, substituted cycloalkyl, maleimide, amine, thiol, N-hydroxysuccinimide ester, azide, acrylate, methacrylate, alkyne, hydroxide, or isocynate.
  • the values of x, y, q, and w are such that the weight average molecular weight of the polymer is greater than 5,000 Daltons. In some aspects, the molecular weight of the polymer is less than 5 kDa, 7.5 kDa, 10 kDa, 20 kDa, or 25 kDa. In some forms the molecular weight of the polymer is between about 1 kDa and about 25 kDa, between about 1 kDa and about 10 kDa, between about 1 kDa and about 7.5 kDa.
  • R and R′ groups include, but are not limited to, hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, cyclohexyl, (cyclohexyl)methyl, cyclopropylmethyl, and homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, phenyl, naphthalyl, anthracenyl, phenanthryl, chrysenyl, pyrenyl, tolyl, xylyl, etc.
  • the blocks of polyalkylene oxide can located at the termini of the polymer (i.e., by reacting PEG having one hydroxy group blocked, for example, with a methoxy group), within the polymer backbone (i.e., neither of the hydroxyl groups are blocked), or combinations thereof.
  • the synthetic polymer includes polymers or copolymers of lactic acid, glycolic acid, degradable polyesters, polyanhydrides, poly(ortho)esters, polyesters, polyurethanes, poly(butic acid), poly(valeric acid), poly(caprolactone), poly(hydroxyalkanoates), poly(lactide-co-caprolactone), poly(amine-co-ester) polymers, or a combination of any two or more of the foregoing.
  • the particles are nanoparticles formed of PLGA poly(lactic-co-glycolic acid) (PLGA), a blend of PLGA and poly(beta-amino) esters (PBAEs) (e.g., about 5 and about 25 percent PBAE (wt %)), or poly(amine-co-ester) (PACE).
  • PLGA poly(lactic-co-glycolic acid)
  • PBAEs poly(beta-amino) esters
  • PACE poly(amine-co-ester)
  • these particles are utilized for intracellular delivery of gene editing compositions such as peptide nucleic acids alone or in combination with donor oligonucleotides.
  • the particles are formed of hydrogel type materials such as alginate, chitosan, poly(HEMA) and other acrylate polymers and copolymers.
  • the particles are microparticles formed of alginate. In some embodiments, these particles are utilized for extracellular delivery (e.g., paracrine delivery) of a growth factor such a FGF.
  • the nucleic acids are complexed to polycations to increase the encapsulation efficiency of the nucleic acids into the particles.
  • polycation refers to a compound having a positive charge, preferably at least 2 positive charges, at a selected pH, preferably physiological pH.
  • Polycationic moieties have between about 2 to about 15 positive charges, preferably between about 2 to about 12 positive charges, and more preferably between about 2 to about 8 positive charges at selected pH values.
  • Suitable constituents of polycations include basic amino acids and their derivatives such as arginine, asparagine, glutamine, lysine and histidine; cationic dendrimers; and amino polysaccharides.
  • Suitable polycations can be linear, such as linear tetralysine, branched or dendrimeric in structure.
  • Exemplary polycations include, but are not limited to, synthetic polycations based on acrylamide and 2-acrylamido-2-methylpropanetrimethylamine, poly(N-ethyl-4-vinylpyridine) or similar quartemized polypyridine, diethylaminoethyl polymers and dextran conjugates, polymyxin B sulfate, lipopolyamines, poly(allylamines) such as the strong polycation poly(dimethyldiallylammonium chloride), polyethyleneimine, polybrene, and polypeptides such as protamine, the histone polypeptides, polylysine, polyarginine and polyornithine.
  • synthetic polycations based on acrylamide and 2-acrylamido-2-methylpropanetrimethylamine
  • poly(N-ethyl-4-vinylpyridine) or similar quartemized polypyridine diethylaminoethyl polymers and dextran conjugates
  • the polycation is a polyamine
  • Polyamines are compounds having two or more primary amine groups.
  • the polyamine is a naturally occurring polyamine that is produced in prokaryotic or eukaryotic cells.
  • Naturally occurring polyamines represent compounds with cations that are found at regularly-spaced intervals and are therefore particularly suitable for complexing with nucleic acids.
  • Polyamines play a major role in very basic genetic processes such as DNA synthesis and gene expression. Polyamines are integral to cell migration, proliferation and differentiation in plants and animals. The metabolic levels of polyamines and amino acid precursors are critical and hence biosynthesis and degradation are tightly regulated.
  • Suitable naturally occurring polyamines include, but are not limited to, spermine, spermidine, cadaverine and putrescine.
  • the polyamine is spermidine.
  • the polycation is a cyclic polyamine
  • Cyclic polyamines are known in the art and are described, for example, in U.S. Pat. No. 5,698,546, WO 1993/012096 and WO 2002/010142.
  • Exemplary cyclic polyamines include, but are not limited to, cyclen.
  • spermine and spermidine are derivatives of putrescine (1,4-diaminobutane), which is produced from L-ornithine by action of ODC (ornithine decarboxylase). L-ornithine is the product of L-arginine degradation by arginase.
  • Spermidine is a triamine structure that is produced by spermidine synthase (SpdS) which catalyzes monoalkylation of putrescine (1,4-diaminobutane) with decarboxylated S-adenosylmethionine (dcAdoMet) 3-aminopropyl donor.
  • putrescine, spermidine and spermine are metabolites derived from the amino acids L-arginine (L-ornithine, putrescine) and L-methionine (dcAdoMet, aminopropyl donor).
  • the particles themselves are a polycation (e.g., a blend of PLGA and poly(beta amino ester).
  • the external surface of the polymeric particles may be modified by conjugating to, or incorporating into, the surface of the particle a coupling agent or ligand.
  • the coupling agent is present in high density on the surface of the particle.
  • “high density” refers to polymeric particles having a high density of ligands or coupling agents, which is preferably in the range of 1,000 to 10,000,000, more preferably 10,000-1,000,000 ligands per square micron of particle surface area. This can be measured by fluorescence staining of dissolved particles and calibrating this fluorescence to a known amount of free fluorescent molecules in solution.
  • Coupling agents associate with the polymeric particles and provide substrates that facilitate the modular assembly and disassembly of functional elements to the particles.
  • Coupling agents or ligands may associate with particles through a variety of interactions including, but not limited to, hydrophobic interactions, electrostatic interactions and covalent coupling.
  • the coupling agents are molecules that match the polymer phase hydrophile-lipophile balance.
  • Hydrophile-lipophile balances range from 1 to 15. Molecules with a low hydrophile-lipophile balance are more lipid loving and thus tend to make a water in oil emulsion while those with a high hydrophile-lipophile balance are more hydrophilic and tend to make an oil in water emulsion. Fatty acids and lipids have a low hydrophile-lipophile balance below 10.
  • amphiphilic polymer with a hydrophile-lipophile balance in the range 1-10, more preferably between 1 and 6, most preferably between 1 and up to 5, can be used as a coupling agent.
  • coupling agents which may associate with polymeric particles via hydrophobic interactions include, but are not limited to, fatty acids, hydrophobic or amphipathic peptides or proteins, and polymers. These classes of coupling agents may also be used in any combination or ratio.
  • the association of adaptor elements with particles facilitates a prolonged presentation of functional elements, which can last for several weeks.
  • Coupling agents can also be attached to polymeric particles through covalent interactions through various functional groups.
  • Functionality refers to conjugation of a molecule to the surface of the particle via a functional chemical group (carboxylic acids, aldehydes, amines, sulfhydryls and hydroxyls) present on the surface of the particle and present on the molecule to be attached.
  • Functionality may be introduced into the particles in two ways.
  • the first is during the preparation of the particles, for example during the emulsion preparation of particles by incorporation of stabilizers with functional chemical groups.
  • Suitable stabilizers include hydrophobic or amphipathic molecules that associate with the outer surface of the particles.
  • a second is post-particle preparation, by direct crosslinking particles and ligands with homo- or heterobifunctional crosslinkers.
  • This second procedure may use a suitable chemistry and a class of crosslinkers (CDI, EDAC, glutaraldehydes, etc. as discussed in more detail below) or any other crosslinker that couples ligands to the particle surface via chemical modification of the particle surface after preparation.
  • This second class also includes a process whereby amphiphilic molecules such as fatty acids, lipids or functional stabilizers may be passively adsorbed and adhered to the particle surface, thereby introducing functional end groups for tethering to ligands.
  • One useful protocol involves the “activation” of hydroxyl groups on polymer chains with the agent, carbonyldiimidazole (CDI) in aprotic solvents such as DMSO, acetone, or THF.
  • CDI forms an imidazolyl carbamate complex with the hydroxyl group which may be displaced by binding the free amino group of a molecule such as a protein.
  • the reaction is an N-nucleophilic substitution and results in a stable N-alkylcarbamate linkage of the molecule to the polymer.
  • the “coupling” of the molecule to the “activated” polymer matrix is maximal in the pH range of 9-10 and normally requires at least 24 hrs.
  • the resulting molecule-polymer complex is stable and resists hydrolysis for extended periods of time.
  • Another coupling method involves the use of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) or “water-soluble CDI” in conjunction with N-hydroxylsulfosuccinimide (sulfo NHS) to couple the exposed carboxylic groups of polymers to the free amino groups of molecules in a totally aqueous environment at the physiological pH of 7.0.
  • EDAC and sulfo-NHS form an activated ester with the carboxylic acid groups of the polymer which react with the amine end of a molecule to form a peptide bond.
  • the resulting peptide bond is resistant to hydrolysis.
  • the use of sulfo-NHS in the reaction increases the efficiency of the EDAC coupling by a factor of ten-fold and provides for exceptionally gentle conditions that ensure the viability of the molecule-polymer complex.
  • a useful coupling procedure for attaching molecules with free hydroxyl and carboxyl groups to polymers involves the use of the cross-linking agent, divinylsulfone. This method would be useful for attaching sugars or other hydroxylic compounds with bioadhesive properties to hydroxylic matrices.
  • the activation involves the reaction of divinylsulfone to the hydroxyl groups of the polymer, forming the vinylsulfonyl ethyl ether of the polymer.
  • the vinyl groups will couple to alcohols, phenols and even amines Activation and coupling take place at pH 11.
  • the linkage is stable in the pH range from 1-8 and is suitable for transit through the intestine.
  • Any suitable coupling method known to those skilled in the art for the coupling of molecules and polymers with double bonds including the use of UV crosslinking, may be used for attachment of molecules to the polymer.
  • coupling agents can be conjugated to affinity tags.
  • Affinity tags are any molecular species which form highly specific, noncovalent, physiochemical interactions with defined binding partners. Affinity tags which form highly specific, noncovalent, physiochemical interactions with one another are defined herein as “complementary”. Suitable affinity tag pairs are well known in the art and include epitope/antibody, biotin/avidin, biotin/streptavidin, biotin/neutravidin, glutathione-S-transferase/glutathione, maltose binding protein/amylase and maltose binding protein/maltose.
  • epitope/antibody binding pairs examples include, but are not limited to, HA, FLAG, c-Myc, glutatione-S-transferase, His 6 , GFP, DIG, biotin and avidin.
  • Antibodies both monoclonal and polyclonal and antigen-binding fragments thereof which bind to these epitopes are well known in the art.
  • Affinity tags that are conjugated to coupling agents allow for highly flexible, modular assembly and disassembly of functional elements which are conjugated to affinity tags which form highly specific, noncovalent, physiochemical interactions with complementary affinity tags which are conjugated to coupling agents.
  • Adaptor elements may be conjugated with a single species of affinity tag or with any combination of affinity tag species in any ratio. The ability to vary the number of species of affinity tags and their ratios conjugated to adaptor elements allows foraki control over the number of functional elements which may be attached to the particles and their ratios.
  • coupling agents are coupled directly to functional elements in the absence of affinity tags, such as through direct covalent interactions.
  • Coupling agents can be covalently coupled to at least one species of functional element.
  • Coupling agents can be covalently coupled to a single species of functional element or with any combination of species of functional elements in any ratio.
  • coupling agents are conjugated to at least one affinity tag that provides for assembly and disassembly of modular functional elements which are conjugated to complementary affinity tags.
  • coupling agents are fatty acids that are conjugated with at least one affinity tag.
  • the coupling agents are fatty acids conjugated with avidin or streptavidin. Avidin/streptavidin-conjugated fatty acids allow for the attachment of a wide variety of biotin-conjugated functional elements.
  • the coupling agents are preferably provided on, or in the surface of, particles at a high density. This high density of coupling agents allows for coupling of the polymeric particles to a variety of species of functional elements while still allowing for the functional elements to be present in high enough numbers to be efficacious.
  • the coupling agents may include fatty acids.
  • Fatty acids may be of any acyl chain length and may be saturated or unsaturated.
  • the fatty acid is palmitic acid.
  • Other suitable fatty acids include, but are not limited to, saturated fatty acids such as butyric, caproic, caprylic, capric, lauric, myristic, stearic, arachidic and behenic acid.
  • Still other suitable fatty acids include, but are not limited to, unsaturated fatty acids such as oleic, linoleic, alpha-linolenic, arachidonic, eicosapentaenoic, docosahexaenoic and erucic acid.
  • the coupling agents may include hydrophobic or amphipathic peptides.
  • Preferred peptides should be sufficiently hydrophobic to preferentially associate with the polymeric particle over the aqueous environment
  • Amphipathic polypeptides useful as adaptor elements may be mostly hydrophobic on one end and mostly hydrophilic on the other end. Such amphipathic peptides may associate with polymeric particles through the hydrophobic end of the peptide and be conjugated on the hydrophilic end to a functional group.
  • Coupling agents may include hydrophobic polymers.
  • hydrophobic polymers include, but are not limited to, polyanhydrides, poly(ortho)esters, and polyesters such as polycaprolactone.
  • the methods typically include in utero delivery of one or more therapeutic prophylactic, or diagnostic agents.
  • the particles have encapsulated therein, dispersed therein, complexed thereto and/or covalently or non-covalently associated with the surface one or more therapeutic prophylactic, or diagnostic agents.
  • the therapeutic prophylactic, or diagnostic agent can be a small molecule, protein, polysaccharide or saccharide, nucleic acid molecule and/or lipid.
  • the agent is a growth factor.
  • Growth factors typically act as signaling molecules between cells. Examples are cytokines and hormones that bind to specific receptors on the surface of their target cells. They often promote cell differentiation and maturation, which varies between growth factors. For example, bone morphogenetic proteins stimulate bone cell differentiation, while fibroblast growth factors and vascular endothelial growth factors stimulate blood vessel differentiation.
  • Exemplary growth factors include, but are not limited to, Adrenomedullin (AM), Angiopoietin (Ang), Autocrine motility factor, Bone morphogenetic proteins (BMPs), Ciliary neurotrophic factor family, Ciliary neurotrophic factor (CNTF), Leukemia inhibitory factor (LIF), Interleukin-6 (IL-6), Colony-stimulating factors, Macrophage colony-stimulating factor (m-CSF), Granulocyte colony-stimulating factor (G-CSF), Granulocyte macrophage colony-stimulating factor (GM-CSF), Epidermal growth factor (EGF), Ephrins, Erythropoietin (EPO), Fibroblast growth factors (FGF, and FGF1-23), Foetal Bovine Somatotrophin (FBS), GDNF family of ligands, Glial cell line-derived neurotrophic factor (GDNF), Neurturin, Persephin, Artemin, Growth differentiation factor-9 (GDF
  • bFGF Basic Fibroblast Growth Factor
  • the growth factor is an FGF.
  • the mammalian fibroblast growth factor (FGF) family consists of 22 structurally similar polypeptides that are present in most multicellular organisms and exert diverse biological effects. Members of the FGF family are active in many embryological and adult physiological processes, and FGFs have been shown to play a part in many developmental, neoplastic, metabolic, and neurological diseases. FGFs can work via paracrine, intracrine, and endocrine signaling pathways.
  • FGF2 prototypical FGFs
  • basic FGF basic FGF
  • bFGF is an 18 kDa polypeptide with 155 amino acids that works primarily by paracrine signaling and plays an important role in all four phases of wound healing: hemostasis; inflammation; proliferation; remodeling.
  • bFGF is a potent mitogen that stimulates the migration, proliferation, and differentiation of cells of mesenchymal and neurectodermal origin, such as keratinocytes, fibroblasts, melanocytes, and endothelial cells.
  • fetal MMC it the ability of bFGF to stimulate growth and proliferation of keratinocytes and fibroblasts, vital participants in new skin formation, that makes it a logical therapeutic candidate.
  • Alginate microparticles have been successfully used for encapsulation and controlled delivery of growth factor protein.
  • the Examples below show that intra-amniotic injection of various biodegradable and biocompatible microparticles is safe for the delivery of fluorescent dyes and nucleotides, and FGF delivered in this manner can be used to treat MMC.
  • the active agent is one or more nucleic acids.
  • the nucleic acid can alter, correct, or replace an endogenous nucleic acid sequence.
  • the nucleic acid can be used to, for example, treat cancers, diseases and disorders, and correct defects in genes. Gene therapy is a technique for correcting defective genes responsible for disease development. researchers may use one of several approaches for correcting faulty genes:
  • a normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene. This approach is most common.
  • An abnormal gene can be swapped for a normal gene through homologous recombination.
  • the abnormal gene can be repaired through selective reverse mutation, which returns the gene to its normal function.
  • the regulation (the degree to which a gene is turned on or off) of a particular gene could be altered.
  • the nucleic acid can be a DNA, RNA, a chemically modified nucleic acid, or combinations thereof. Gene editing technologies are discussed in more detail below.
  • the active agent is one or more small molecules.
  • exemplary classes of small molecule therapeutic agents include, but are not limited to, analgesics, anti-inflammatory drugs, antipyretics, antidepressants, antiepileptics, antiopsychotic agents, neuroprotective agents, anti-proliferatives, such as anti-cancer agent, anti-infectious agents, such as antibacterial agents and antifungal agents, antihistamines, antimigraine drugs, antimuscarinics, anxioltyics, sedatives, hypnotics, antipsychotics, bronchodilators, anti-asthma drugs, cardiovascular drugs, corticosteroids, dopaminergics, electrolytes, gastro-intestinal drugs, muscle relaxants, nutritional agents, vitamins, parasympathomimetics, stimulants, anorectics and anti-narcoleptics.
  • the active agent is one or diagnostic agents.
  • diagnostic materials include paramagnetic molecules, fluorescent compounds, magnetic molecules, and radionuclides.
  • Suitable diagnostic agents include, but are not limited to, x-ray imaging agents and contrast media. Radionuclides also can be used as imaging agents. Examples of other suitable contrast agents include gases or gas emitting compounds, which are radioopaque.
  • Nanoparticles can further include agents useful for determining the location of administered particles. Agents useful for this purpose include fluorescent tags, radionuclides and contrast agents.
  • the percent drug loading is from about 1% to about 80%, from about 1% to about 50%, preferably from about 1% to about 40% by weight, more preferably from about 1% to about 20% by weight, most preferably from about 1% to about 10% by weight.
  • the ranges above are inclusive of all values from 1% to 80%.
  • the agent to be delivered may be encapsulated within a nanoparticle and associated with the surface of the particle.
  • Nutraceuticals can also be incorporated. These may be vitamins, supplements such as calcium or biotin, or natural ingredients such as plant extracts or phytohormones.
  • Excipients may be included in the particle formulations to enhance the stability, solubility, and/or controlled release manner of encapsulated therapeutic agents.
  • An exemplary excipient to stabilize protein agents is human serum albumin.
  • trehalose may be used as a stabilizing agent for proteins.
  • the therapeutic, prophylactic or diagnostic agent is, or encodes, a gene editing technology.
  • Gene editing technologies can be used alone or in combination with a potentiating agent and/or other active agents.
  • Exemplary gene editing technologies include, but are not limited to, triplex-forming, pseudocomplementary oligonucleotides, CRISPR/Cas, zinc finger nucleases, and TALENs, each of which are discussed in more detail below.
  • Some gene editing technologies are used in combination with a donor oligonucleotide.
  • the gene editing technology is the donor oligonucleotide, which can be used alone to modify genes.
  • Strategies include, but are not limited to, small fragment homologous replacement (e.g., polynucleotide small DNA fragments (SDFs)), single-stranded oligodeoxynucleotide-mediated gene modification (e.g., ssODN/SSOs) and other described in Sargent, Oligonucleotides, 21(2): 55-75 (2011)), and elsewhere.
  • SDFs polynucleotide small DNA fragments
  • ssODN/SSOs single-stranded oligodeoxynucleotide-mediated gene modification
  • Other suitable gene editing technologies include, but are not limited to intron encoded meganucleases that are engineered to change their target specificity. See, e.g., Arnould, et al., Protein Eng. Des. Sel., 24(1-2):27-31 (2011)).
  • the gene editing composition does not modify a target sequence within a maternal genome.
  • the target sequence of the fetal or embryonic genome and the target sequence of maternal genome are identical. In some embodiments they are not identical.
  • the fetal or embryonic genome and the maternal genome can be isolated, derived, or obtained from genetically-related or genetically un-related individuals.
  • the fetal or embryonic genome can include one or more mutations in a coding sequence or a non-coding sequence corresponding to a target gene that either indicates the fetus or embryo is at risk of developing a disease or disorder or that indicates that the fetus has a disease or disorder.
  • the coding sequence or a non-coding sequence corresponding to the target gene can include the target sequence.
  • the coding sequence corresponding to the target gene can include one or more exon(s) encoding a product of the target gene.
  • the non-coding sequence corresponding to the target gene can include one or more transcriptional regulator(s), enhancer(s), superenhancer(s), intron(s), and regulatory RNAs that selectively bind a transcript of the target gene.
  • the one or more transcriptional regulator(s) can include a sequence encoding a promoter.
  • the one or more regulatory RNAs that selectively bind a transcript of the target gene comprise one or more miRNA(s).
  • the mutation can include a substitution, an insertion, a deletion, an indel, an inversion, a frameshift, or a transposition.
  • the mutation can be a transcriptional or translational truncation, altered transcriptional splicing, early termination of transcription or translation, variant transcriptional regulation or variant epigenetic regulation.
  • the gene editing composition modifies a target sequence within a genome by reducing or preventing expression of the target sequence.
  • the gene editing composition can induce single-stranded or double-stranded breaks in the target sequence.
  • the gene editing composition can induce formation of a triplex within the target sequence.
  • Gene editing compositions include CRISPR systems, zinc finger nucleases (ZFN), transcription activator-like effector nucleases (TALEN), small fragment homologous replacement.
  • the gene editing composition can be a triplex forming composition.
  • the gene editing composition can be a pseudocomplementary oligonucleotide or PNA oligomer.
  • TBMs Triplex-Forming Molecules
  • compositions containing “triplex-forming molecules,” that bind to duplex DNA in a sequence-specific manner to form a triple-stranded structure include, but are not limited to, triplex-forming oligonucleotides (TFOs), peptide nucleic acids (PNA), and “tail clamp” PNA (tcPNA).
  • TFOs triplex-forming oligonucleotides
  • PNA peptide nucleic acids
  • tcPNA tail clamp PNA
  • the triplex-forming molecules can be used to induce site-specific homologous recombination in mammalian cells when combined with donor DNA molecules.
  • the donor DNA molecules can contain mutated nucleic acids relative to the target DNA sequence. This is useful to activate, inactivate, or otherwise alter the function of a polypeptide or protein encoded by the targeted duplex DNA.
  • Triplex-forming molecules include triplex-forming oligonucleotides and peptide nucleic acids (PNAs). Triplex forming molecules are described in U.S. Pat. Nos. 5,962,426, 6,303,376, 7,078,389, 7,279,463, 8,658,608, U.S. Published Application Nos.
  • triplex forming molecules are typically single-stranded oligonucleotides that bind to polypyrimidine:polypurine target motif in a double stranded nucleic acid molecule to form a triple-stranded nucleic acid molecule.
  • the single-stranded oligonucleotide/oligomer typically includes a sequence substantially complementary to the polypurine strand of the polypyrimidine:polypurine target motif.
  • TFOs Triplex-Forming Oligonucleotides
  • TFOs Triplex-forming oligonucleotides
  • the oligonucleotides are synthetic or isolated nucleic acid molecules which selectively bind to or hybridize with a predetermined target sequence, target region, or target site within or adjacent to a human gene so as to form a triple-stranded structure.
  • the oligonucleotide is a single-stranded nucleic acid molecule between 7 and 40 nucleotides in length, most preferably 10 to 20 nucleotides in length for in vitro mutagenesis and 20 to 30 nucleotides in length for in vivo mutagenesis.
  • the nucleobase (sometimes referred to herein simply as “base”) composition may be homopurine or homopyrimidine.
  • the nucleobase composition may be polypurine or polypyrimidine.
  • other compositions are also useful.
  • oligonucleotides are preferably generated using known DNA synthesis procedures. In one embodiment, oligonucleotides are generated synthetically. Oligonucleotides can also be chemically modified using standard methods that are well known in the art.
  • the nucleobase sequence of the oligonucleotides/oligomer is selected based on the sequence of the target sequence, the physical constraints imposed by the need to achieve binding of the oligonucleotide/oligomer within the major groove of the target region, and the need to have a low dissociation constant (K d ) for the oligo/target sequence complex.
  • the oligonucleotides/oligomers have a nucleobase composition which is conducive to triple-helix formation and is generated based on one of the known structural motifs for third strand binding (e.g. Hoogsteen binding).
  • TFOs polypurine:polypyrimidine elements
  • the most stable complexes are formed on polypurine:polypyrimidine elements, which are relatively abundant in mammalian genomes.
  • Triplex formation by TFOs can occur with the third strand oriented either parallel or anti-parallel to the purine strand of the nucleic acid duplex.
  • the triplets are G.G:C and A.A:T
  • the canonical triplets are C + .G:C and T.A:T.
  • the triplex structures can be stabilized by one, two or three Hoogsteen hydrogen bonds (depending on the nucleobase) between the bases in the TFO strand and the purine strand in the duplex.
  • the oligonucleotide/oligomer binds to or hybridizes to the target sequence under conditions of high stringency and specificity.
  • the oligonucleotides/oligomers bind in a sequence-specific manner within the major groove of duplex DNA. Reaction conditions for in vitro triple helix formation of an oligonucleotide/oligomer to a double stranded nucleic acid sequence vary from oligo to oligo, depending on factors such as polymer length, the number of G:C and A:T base pairs, and the composition of the buffer utilized in the hybridization reaction.
  • An oligonucleotide substantially complementary, based on the third strand binding code, to the target region of the double-stranded nucleic acid molecule is preferred.
  • a triplex forming molecule is said to be substantially complementary to a target region when the oligonucleotide has a nucleobase composition which allows for the formation of a triple-helix with the target region.
  • an oligonucleotide/oligomer can be substantially complementary to a target region even when there are non-complementary bases present in the oligonucleotide/oligomer.
  • structural motifs available which can be used to determine the nucleobase sequence of a substantially complementary oligonucleotide/oligomer.
  • PNA Peptide Nucleic Acids
  • the triplex-forming molecules are peptide nucleic acids (PNAs).
  • Peptide nucleic acids can be considered polymeric molecules in which the sugar phosphate backbone of an oligonucleotide has been replaced in its entirety by repeating substituted or unsubstituted N-(2-aminoethyl)-glycine residues that are linked by amide bonds.
  • the various nucleobases are linked to the backbone by methylene carbonyl linkages.
  • PNAs maintain spacing of the nucleobases in a manner that is similar to that of an oligonucleotides (DNA or RNA), but because the sugar phosphate backbone has been replaced, classic (unsubstituted) PNAs are achiral and neutrally charged molecules.
  • Peptide nucleic acids are composed of peptide nucleic acid residues (sometimes referred to as ‘residues’).
  • the nucleobases can be any of the standard bases (uracil, thymine, cytosine, adenine and guanine) or any of the modified heterocyclic nucleobases described below.
  • PNAs can bind to DNA via Watson-Crick hydrogen bonds, but with binding affinities significantly higher than those of a corresponding nucleotide composed of DNA or RNA.
  • the neutral backbone of PNAs decreases electrostatic repulsion between the PNA and target DNA phosphates.
  • PNAs can mediate strand invasion of duplex DNA resulting in displacement of one DNA strand to form a D-loop.
  • Highly stable triplex PNA:DNA:PNA structures can be formed from a homopurine DNA strand and two PNA strands.
  • the two PNA strands may be two separate PNA molecules (see Bentin et al., Nucl. Acids Res., 34(20): 5790-5799 (2006) and Hansen et al., Nucl. Acids Res., 37(13): 4498-4507 (2009)), or two PNA molecules linked together by a linker of sufficient flexibility to form a single bis-PNA molecule (See: U.S. Pat. No. 6,441,130).
  • the PNA molecule(s) forms a triplex “clamp” with one of the strands of the target duplex while displacing the other strand of the duplex target.
  • one strand forms Watson-Crick base pairs with the DNA strand in the anti-parallel orientation (the Watson-Crick binding portion), whereas the other strand forms Hoogsteen base pairs to the DNA strand in the parallel orientation (the Hoogsteen binding portion).
  • a homopurine strand allows formation of a stable PNA/DNA/PNA triplex.
  • PNA clamps can form at shorter homopurine sequences than those required by triplex-forming oligonucleotides (TFOs) and also do so with greater stability.
  • Suitable molecules for use in linkers of bis-PNA molecules include, but are not limited to, 8-amino-3,6-dioxaoctanoic acid, referred to as an O-linker, and 6-aminohexanoic acid.
  • Poly(ethylene) glycol monomers can also be used in bis-PNA linkers.
  • a bis-PNA linker can contain multiple linker residues in any combination of two or more of the foregoing.
  • PNAs can also include other positively charged moieties to increase the solubility of the PNA and increase the affinity of the PNA for duplex DNA.
  • positively charged moieties include the amino acids lysine and arginine (e.g., as additional substituents attached to the C- or N-terminus of the PNA oligomer (or a segment thereof) or as a side-chain modification of the backbone (see Huang et al., Arch. Pharm. Res. 35(3): 517-522 (2012) and Jain et al., JOC, 79(20): 9567-9577 (2014)), although other positively charged moieties may also be useful (See for Example: U.S. Pat. No. 6,326,479).
  • the PNA oligomer can have one or more ‘miniPEG’ side chain modifications of the backbone (see, for example, U.S. Pat. No. 9,193,758 and Sahu et al., JOC, 76: 5614-5627 (2011)).
  • Peptide nucleic acids are unnatural synthetic polyamides, prepared using known methodologies, generally as adapted from peptide synthesis processes.
  • triplex-forming molecules include a “tail” added to the end of the Watson-Crick binding portion. Adding additional nucleobases, known as a “tail” or “tail clamp”, to the Watson-Crick binding portion that bind to the target strand outside the triple helix further reduces the requirement for a polypurine:polypyrimidine stretch and increases the number of potential target sites.
  • the tail is most typically added to the end of the Watson-Crick binding sequence furthest from the linker.
  • This molecule therefore mediates a mode of binding to DNA that encompasses both triplex and duplex formation (Kaihatsu, et al., Biochemistry, 42(47):13996-4003 (2003); Bentin, et al., Biochemistry, 42(47):13987-95 (2003)).
  • the triplex-forming molecules are tail clamp PNA (tcPNA)
  • the PNA/DNA/PNA triple helix portion and the PNA/DNA duplex portion both produce displacement of the pyrimidine-rich strand, creating an altered helical structure that strongly provokes the nucleotide excision repair pathway and activating the site for recombination with a donor DNA molecule (Rogers, et al., Proc. Natl. Acad. Sci. U.S.A., 99(26):16695-700 (2002)).
  • Tails added to clamp PNAs (sometimes referred to as bis-PNAs) form tail-clamp PNAs (referred to as tcPNAs) that have been described by Kaihatsu, et al., Biochemistry, 42(47):13996-4003 (2003); Bentin, et al., Biochemistry, 42(47):13987-95 (2003).
  • tcPNAs are known to bind to DNA more efficiently due to low dissociation constants.
  • the addition of the tail also increases binding specificity and binding stringency of the triplex-forming molecules to the target duplex. It has also been found that the addition of a tail to clamp PNA improves the frequency of recombination of the donor oligonucleotide at the target site compared to PNA without the tail.
  • a positively charged region having a positively charged amino acid subunit e.g., a lysine subunit
  • a first region comprising a plurality of PNA subunits having Hoogsteen homology with a target sequence
  • a third region comprising a plurality of PNA subunits having Watson Crick homology binding with a tail target sequence
  • a second positively charged region having a positively charged amino acid subunit e.g., a lysine subunit.
  • a linker is disposed between b) and c).
  • one or more PNA monomers of the tail claim is modified as disclosed herein.
  • PNAs can also include other positively charged moieties to increase the solubility of the PNA and increase the affinity of the PNA for duplex DNA.
  • Commonly used positively charged moieties include the amino acids lysine and arginine, although other positively charged moieties may also be useful. Lysine and arginine residues can be added to a bis-PNA linker or can be added to the carboxy or the N-terminus of a PNA strand.
  • Common modifications to PNA are discussed in Sugiyama and Kittaka, Molecules, 18:287-310 (2013)) and Sahu, et al., J. Org.
  • the some or all of the PNA residues are modified at the gamma position in the polyamide backbone ( ⁇ PNAs) as illustrated below (wherein “B” is a nucleobase and “R” is a substitution at the gamma position).
  • miniPEG One class of ⁇ substitution, is miniPEG, but other residues and side chains can be considered, and even mixed substitutions can be used to tune the properties of the oligomers.
  • “MiniPEG” and “MP” refers to diethylene glycol.
  • MiniPEG-containing ⁇ PNAs are conformationally preorganized PNAs that exhibit superior hybridization properties and water solubility as compared to the original PNA design and other chiral ⁇ PNAs. Sahu et al., describes ⁇ PNAs prepared from L-amino acids that adopt a right-handed helix, and ⁇ PNAs prepared from D-amino acids that adopt a left-handed helix.
  • PNA residues are miniPEG-containing ⁇ PNAs (Sahu, et al., J. Org. Chem., 76, 5614-5627 (2011).
  • tcPNAs are prepared wherein every other PNA residue on the Watson-Crick binding side of the linker is a miniPEG-containing ⁇ PNA. Accordingly, for these embodiments, the tail clamp side of the PNA has alternating classic PNA and miniPEG-containing ⁇ PNA residues.
  • PNA-mediated gene editing are achieved via additional or alternative ⁇ substitutions or other PNA chemical modifications including but limited to those introduced above and below.
  • ⁇ substitution with other side chains include that of alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, arginine, and the derivatives thereof.
  • derivatives thereof herein are defined as those chemical moieties that are covalently attached to these amino acid side chains, for instance, to that of serine, cysteine, threonine, tyrosine, aspartic acid, glutamic acid, asparagine, glutamine, lysine, and arginine.
  • any of the triplex forming sequences can be modified to include guanidine-G-clamp (“G-clamp”) PNA residues(s) to enhance PNA binding, wherein the G-clamp is linked to the backbone as any other nucleobase would be.
  • G-clamp guanidine-G-clamp
  • clamp-G 9-(2-guanidinoethoxy) phenoxazine
  • clamp-G monomer-to-G base pair (clamp-G indicated by the “X”) is illustrated below in comparison to C-G base pair.
  • the gene editing composition includes at least one peptide nucleic acid (PNA) oligomer.
  • the at least one PNA oligomer can be a modified PNA oligomer including at least one modification at a gamma position of a backbone carbon.
  • the modified PNA oligomer can include at least one miniPEG modification at a gamma position of a backbone carbon.
  • the gene editing composition can include at least one donor oligonucleotide.
  • the gene editing composition can modify a target sequence within a fetal genome.
  • the PNA can include a Hoogsteen binding peptide nucleic acid (PNA) segment and a Watson-Crick binding PNA segment collectively totaling no more than 50 nucleobases in length, wherein the two segments bind or hybridize to a target region of a genomic DNA comprising a polypurine stretch to induce strand invasion, displacement, and formation of a triple-stranded composition among the two PNA segments and the polypurine stretch of the genomic DNA, wherein the Hoogsteen binding segment binds to the target region by Hoogsteen binding for a length of least five nucleobases, and wherein the Watson-Crick binding segment binds to the target region by Watson-Crick binding for a length of least five nucleobases.
  • PNA Hoogsteen binding peptide nucleic acid
  • the PNA segments can include a gamma modification of a backbone carbon.
  • the gamma modification can be a gamma miniPEG modification.
  • the Hoogsteen binding segment can include one or more chemically modified cytosines selected from the group consisting of pseudocytosine, pseudoisocytosine, and 5-methylcytosine.
  • the Watson-Crick binding segment can include a sequence of up to fifteen nucleobases that binds to the target duplex by Watson-Crick binding outside of the triplex. The two segments can be linked by a linker.
  • all of the peptide nucleic acid residues in the Hoogsteen-binding segment only, in the Watson-Crick-binding segment only, or across the entire PNA oligomer include a gamma modification of a backbone carbon. In some embodiments, one or more of the peptide nucleic acid residues in the Hoogsteen-binding segment only or in the Watson-Crick-binding segment only of the PNA oligomer include a gamma modification of a backbone carbon.
  • alternating peptide nucleic acid residues in the Hoogsteen-binding portion only, in the Watson-Crick-binding portion only, or across the entire PNA oligomer include a gamma modification of a backbone carbon.
  • least one gamma modification of the backbone carbon is a gamma miniPEG modification.
  • at least one gamma modification is a side chain of an amino acid selected from the group consisting of alanine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, phenylalanine, tyrosine, aspartic acid, glutamic acid, asparagine, glutamine, histidine, lysine, arginine, and the derivatives thereof.
  • all gamma modifications are gamma miniPEG modifications.
  • at least one PNA segment comprises a clamp-G (9-(2-guanidinoethoxy) phenoxazine).
  • the triplex-forming molecules bind to a predetermined target region referred to herein as the “target sequence,” “target region,” or “target site.”
  • the target sequence for the triplex-forming molecules can be within or adjacent to a human gene encoding, for example the beta globin, cystic fibrosis transmembrane conductance regulator (CFTR) or other gene discussed in more detail below, or an enzyme necessary for the metabolism of lipids, glycoproteins, or mucopolysaccharides, or another gene in need of correction.
  • the target sequence can be within the coding DNA sequence of the gene or within an intron.
  • the target sequence can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences or sites that regulate RNA splicing.
  • triplex-forming molecules are selected based on the sequence of the target sequence, the physical constraints, and the preference for a low dissociation constant (K d ) for the triplex-forming molecules/target sequence.
  • K d dissociation constant
  • triplex-forming molecules are said to be substantially complementary to a target region when the triplex-forming molecules has a nucleobase composition which allows for the formation of a triple-helix with the target region.
  • a triplex-forming molecule can be substantially complementary to a target region even when there are non-complementary nucleobases present in the triplex-forming molecules.
  • the triplex-forming molecules bind to or hybridize to the target sequence under conditions of high stringency and specificity.
  • Reaction conditions for in vitro triple helix formation of an triplex-forming molecules probe or primer to a nucleic acid sequence vary from triplex-forming molecules to triplex-forming molecules, depending on factors such as the length triplex-forming molecules, the number of G:C and A:T base pairs, and the composition of the buffer utilized in the hybridization reaction.
  • the TFO is a single-stranded nucleic acid molecule between 7 and 40 nucleotides in length, most preferably 10 to 20 nucleotides in length for in vitro mutagenesis and 20 to 30 nucleotides in length for in vivo mutagenesis.
  • the base composition may be homopurine or homopyrimidine.
  • the base composition may be polypurine or polypyrimidine.
  • other compositions are also useful.
  • the oligonucleotides bind in a sequence-specific manner within the major groove of duplex DNA. An oligonucleotide substantially complementary, based on the third strand binding code, to the target region of the double-stranded nucleic acid molecule is preferred.
  • the oligonucleotides will have a base composition which is conducive to triple-helix formation and will be generated based on one of the known structural motifs for third strand binding.
  • the most stable complexes are formed on polypurine:polypyrimidine elements, which are relatively abundant in mammalian genomes. Triplex formation by TFOs can occur with the third strand oriented either parallel or anti-parallel to the purine strand of the duplex. In the anti-parallel, purine motif, the triplets are G.G:C and A.A:T, whereas in the parallel pyrimidine motif, the canonical triplets are C + .G:C and T.A:T.
  • triplex structures are stabilized by two Hoogsteen hydrogen bonds between the bases in the TFO strand and the purine strand in the duplex.
  • a review of base compositions for third strand binding oligonucleotides is provided in U.S. Pat. No. 5,422,251.
  • TFOs are preferably generated using known DNA and/or PNA synthesis procedures.
  • oligonucleotides are generated synthetically. Oligonucleotides can also be chemically modified using standard methods that are well known in the art.
  • triplex-forming molecules such as PNA, PNA clamps and tail clamp PNAs (tcPNAs) invade the target duplex, with displacement of the polypyrimidine strand, and induce triplex formation with the polypurine strand of the target duplex by both Watson-Crick and Hoogsteen binding.
  • both the Watson-Crick and Hoogsteen binding portions of the triplex forming molecules are substantially complementary to the target sequence.
  • PNA clamps can form at shorter homopurine sequences than those required by triplex-forming oligonucleotides and also do so with greater stability.
  • PNAs are between 6 and 50 nucleobase-containing residues in length.
  • the Watson-Crick portion should be 9 or more nucleobase-containing residues in length, optionally including a tail sequence. More preferably, the Watson-Crick binding portion is between about 9 and 30 nucleobase-containing residues in length, optionally including a tail sequence of between 0 and about 15 nucleobase-containing residues. More preferably, the Watson-Crick binding portion is between about 10 and 25 nucleobase-containing residues in length, optionally including a tail sequence of between 0 and about 10 nucleobase-containing residues in length.
  • the Watson-Crick binding portion is between 15 and 25 nucleobase-containing residues in length, optionally including a tail sequence of between 5 and 10 nucleobase-containing residues in length.
  • the Hoogsteen binding portion should be 6 or more nucleobase residues in length. Most preferably, the Hoogsteen binding portion is between about 6 and 15 nucleobase-containing residues in length, inclusive.
  • the triplex-forming molecules are designed to target the polypurine strand of a polypurine:polypyrimidine stretch in the target duplex nucleotide. Therefore, the base composition of the triplex-forming molecules may be homopyrimidine. Alternatively, the base composition may be polypyrimidine.
  • the addition of a “tail” reduces the requirement for polypurine:polypyrimidine run. Adding additional nucleobase-containing residues, known as a “tail,” to the Watson-Crick binding portion of the triplex-forming molecules allows the Watson-Crick binding portion to bind/hybridize to the target strand outside the site of polypurine sequence for triplex formation.
  • Triplex-forming molecules including, e.g., triplex-forming oligonucleotides (TFOs) and helix-invading peptide nucleic acids (bis-PNAs and tcPNAs), also generally utilize a polypurine:polypyrimidine sequence to a form a triple helix.
  • TFOs triplex-forming oligonucleotides
  • bis-PNAs and tcPNAs helix-invading peptide nucleic acids
  • Peptide nucleic acids need fewer purines to a form a triple helix, although at least 10 or preferably more may be needed.
  • PNAs Peptide nucleic acids including a tail, also referred to tail clamp PNAs, or tcPNAs, require even fewer purines to a form a triple helix.
  • a triple helix may be formed with a target sequence containing fewer than 8 purines. Therefore, PNAs should be designed to target a site on duplex nucleic acid containing between 6-30 polypurine:polypyrimidines, preferably, 6-25 polypurine:polypyrimidines, more preferably 6-20 polypurine:polypyrimidines.
  • a “mixed-sequence” tail to the Watson-Crick-binding strand of the triplex-forming molecules such as PNAs also increases the length of the triplex-forming molecule and, correspondingly, the length of the binding site. This increases the target specificity and size of the lesion created at the target site and disrupts the helix in the duplex nucleic acid, while maintaining a low requirement for a stretch of polypurine:polypyrimidines. Increasing the length of the target sequence improves specificity for the target, for example, a target of 17 base pairs will statistically be unique in the human genome.
  • triple-forming molecules are preferably generated using known synthesis procedures. In one embodiment, triplex-forming molecules are generated synthetically. Triplex-forming molecules can also be chemically modified using standard methods that are well known in the art.
  • the gene editing technology can be pseudocomplementary oligonucleotides such as those disclosed in U.S. Pat. No. 8,309,356.
  • Double duplex-forming molecules are oligonucleotides that bind to duplex DNA in a sequence-specific manner to form a four-stranded structure.
  • Double duplex-forming molecules such as a pair of pseudocomplementary oligonucleotides/PNAs, can induce recombination with a donor oligonucleotide at a chromosomal site in mammalian cells.
  • Pseudocomplementary oligonucleotides/PNAs are complementary oligonucleotides/PNAs that contain one or more modifications such that they do not recognize or hybridize to each other, for example due to steric hindrance, but each can recognize and hybridize to its complementary nucleic acid strands at the target site.
  • the term ‘pseudocomplementary oligonucleotide(s)’ include pseudocomplementary peptide nucleic acids (pcPNAs).
  • pcPNAs pseudocomplementary peptide nucleic acids
  • a pseudocomplementary oligonucleotide is said to be substantially complementary to a target region when the oligonucleotide has a base composition which allows for the formation of a double duplex with the target region. As such, an oligonucleotide can be substantially complementary to a target region even when there are non-complementary bases present in the pseudocomplementary oligonucleotide
  • This strategy can be more efficient and provides increased flexibility over other methods of induced recombination such as triple-helix oligonucleotides and bis-peptide nucleic acids which prefer a polypurine sequence in the target double-stranded DNA.
  • the design ensures that the pseudocomplementary oligonucleotides do not pair with each other but instead bind the cognate nucleic acids at the target site, inducing the formation of a double duplex.
  • the predetermined region that the double duplex-forming molecules bind to can be referred to as a “double duplex target sequence,” “double duplex target region,” or “double duplex target site.”
  • the double duplex target sequence (DDTS) for the double duplex-forming molecules can be, for example, within or adjacent to a human gene in need of induced gene correction.
  • the DDTS can be within the coding DNA sequence of the gene or within introns.
  • the DDTS can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences.
  • the nucleotide/nucleobase sequence of the pseudocomplementary oligonucleotides is selected based on the sequence of the DDTS.
  • Therapeutic administration of pseudocomplementary oligonucleotides involves two single stranded oligonucleotides unlinked, or linked by a linker.
  • One pseudocomplementary oligonucleotide strand is complementary to the DDTS, while the other is complementary to the displaced DNA strand.
  • pseudocomplementary oligonucleotides are not subject to limitation on sequence choice and/or target length and specificity as are triplex-forming oligonucleotides, helix-invading peptide nucleic acids (bis-PNAs and tcPNAs) and side-by-side minor groove binders.
  • Pseudocomplementary oligonucleotides do not require third-strand Hoogsteen-binding, and therefore are not restricted to homopurine targets.
  • Pseudocomplementary oligonucleotides can be designed for mixed, general sequence recognition of a desired target site.
  • the target site contains an A:T base pair content of about 40% or greater.
  • pseudocomplementary oligonucleotides are between about 8 and 50 nucleobase-containing residues in length, more preferably 8 to 30, even more preferably between about 8 and 20 nucleobase-containing residues in length.
  • the pseudocomplementary oligonucleotides should be designed to bind to the target site (DDTS) at a distance of between about 1 to 800 bases from the target site of the donor oligonucleotide. More preferably, the pseudocomplementary oligonucleotides bind at a distance of between about 25 and 75 bases from the donor oligonucleotide. Most preferably, the pseudocomplementary oligonucleotides bind at a distance of about 50 bases from the donor oligonucleotide.
  • Preferred pcPNA sequences for targeted repair of a mutation in the ⁇ -globin intron IVS2 are described in U.S. Pat. No. 8,309,356.
  • the pseudocomplementary oligonucleotides bind/hybridize to the target nucleic acid molecule under conditions of high stringency and specificity.
  • the oligonucleotides bind in a sequence-specific manner and induce the formation of double duplex.
  • Specificity and binding affinity of the pseudocomplemetary oligonucleotides may vary from oligomer to oligomer, depending on factors such as length, the number of G:C and A:T base pairs, and the formulation.
  • the gene editing composition is the CRISPR/Cas system.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the prokaryotic CRISPR/Cas system has been adapted for use as gene editing (silencing, enhancing or changing specific genes) for use in eukaryotes (see, for example, Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et al., Science, 337(6096):816-21 (2012)).
  • the organism's genome can be cut and modified at any desired location.
  • Methods of preparing compositions for use in genome editing using the CRISPR/Cas systems are described in detail in WO 2013/176772 and WO 2014/018423, which are specifically incorporated by reference herein in their entireties.
  • CRISPR system refers collectively to transcripts and other elements involved in the expression of or directing the activity of CRISPR-associated (“Cas”) genes, including sequences encoding a Cas gene, a tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or an active partial tracrRNA), a tracr-mate sequence (encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system), a guide sequence (also referred to as a “spacer” in the context of an endogenous CRISPR system), or other sequences and transcripts from a CRISPR locus.
  • a tracr trans-activating CRISPR
  • tracr-mate sequence encompassing a “direct repeat” and a tracrRNA-processed partial direct repeat in the context of an endogenous CRISPR system
  • guide sequence also referred to as a “spacer” in the context of an endogenous CRISPR system
  • One or more tracr mate sequences operably linked to a guide sequence can also be referred to as pre-crRNA (pre-CRISPR RNA) before processing or crRNA after processing by a nuclease.
  • pre-crRNA pre-CRISPR RNA
  • a tracrRNA and crRNA are linked and form a chimeric crRNA-tracrRNA hybrid where a mature crRNA is fused to a partial tracrRNA via a synthetic stem loop to mimic the natural crRNA:tracrRNA duplex as described in Cong, Science, 15:339(6121):819-823 (2013) and Jinek, et al., Science, 337(6096):816-21 (2012)).
  • a single fused crRNA-tracrRNA construct can also be referred to as a guide RNA or gRNA (or single-guide RNA (sgRNA)).
  • the crRNA portion can be identified as the “target sequence” and the tracrRNA is often referred to as the “scaffold.”
  • one or more vectors driving expression of one or more elements of a CRISPR system are introduced into a target cell such that expression of the elements of the CRISPR system direct formation of a CRISPR complex at one or more target sites. While the specifics can be varied in different engineered CRISPR systems, the overall methodology is similar.
  • a practitioner interested in using CRISPR technology to target a DNA sequence can insert a short DNA fragment containing the target sequence into a guide RNA expression plasmid.
  • the sgRNA expression plasmid contains the target sequence (about 20 nucleotides), a form of the tracrRNA sequence (the scaffold) as well as a suitable promoter and necessary elements for proper processing in eukaryotic cells.
  • Such vectors are commercially available (see, for example, Addgene). Many of the systems rely on custom, complementary oligomers that are annealed to form a double stranded DNA and then cloned into the sgRNA expression plasmid. Co-expression of the sgRNA and the appropriate Cas enzyme from the same or separate plasmids in transfected cells results in a single or double strand break (depending of the activity of the Cas enzyme) at the desired target site.
  • the element that induces a single or a double strand break in the target cell's genome is a nucleic acid construct or constructs encoding a zinc finger nucleases (ZFNs).
  • ZFNs are typically fusion proteins that include a DNA-binding domain derived from a zinc-finger protein linked to a cleavage domain.
  • Fok1 catalyzes double-stranded cleavage of DNA, at 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other. See, for example, U.S. Pat. Nos. 5,356,802; 5,436,150 and 5,487,994; as well as Li et al. Proc., Natl. Acad. Sci. USA 89 (1992):4275-4279; Li et al. Proc. Natl. Acad. Sci. USA, 90:2764-2768 (1993); Kim et al. Proc. Natl. Acad. Sci. USA.
  • the DNA-binding domain which can, in principle, be designed to target any genomic location of interest, can be a tandem array of Cys 2 His 2 zinc fingers, each of which generally recognizes three to four nucleotides in the target DNA sequence.
  • the Cys 2 His 2 domain has a general structure: Phe (sometimes Tyr)-Cys-(2 to 4 amino acids)-Cys-(3 amino acids)-Phe(sometimes Tyr)-(5 amino acids)-Leu-(2 amino acids)-His-(3 amino acids)-His.
  • Rational design includes, for example, using databases including triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; 6,534,261; 6,610,512; 6,746,838; 6,866,997; 7,067,617; U.S. Published Application Nos. 2002/0165356; 2004/0197892; 2007/0154989; 2007/0213269; and International Patent Application Publication Nos. WO 98/53059 and WO 2003/016496.
  • the element that induces a single or a double strand break in the target cell's genome is a nucleic acid construct or constructs encoding a transcription activator-like effector nuclease (TALEN).
  • TALENs have an overall architecture similar to that of ZFNs, with the main difference that the DNA-binding domain comes from TAL effector proteins, transcription factors from plant pathogenic bacteria.
  • the DNA-binding domain of a TALEN is a tandem array of amino acid repeats, each about 34 residues long. The repeats are very similar to each other; typically they differ principally at two positions (amino acids 12 and 13, called the repeat variable diresidue, or RVD).
  • Each RVD specifies preferential binding to one of the four possible nucleotides, meaning that each TALEN repeat binds to a single base pair, though the NN RVD is known to bind adenines in addition to guanine.
  • TAL effector DNA binding is mechanistically less well understood than that of zinc-finger proteins, but their seemingly simpler code could prove very beneficial for engineered-nuclease design.
  • TALENs also cleave as dimers, have relatively long target sequences (the shortest reported so far binds 13 nucleotides per monomer) and appear to have less stringent requirements than ZFNs for the length of the spacer between binding sites.
  • Monomeric and dimeric TALENs can include more than 10, more than 14, more than 20, or more than 24 repeats.
  • the gene editing composition includes or is administered in combination with a donor oligonucleotide.
  • the donor oligonucleotide can be encapsulated or entrapped in the same or different particles from other active agents such as the triplex forming composition.
  • the donor oligonucleotide includes a sequence that can correct a mutation(s) in the host genome, though in some embodiments, the donor introduces a mutation that can, for example, reduce expression of an oncogene or a receptor that facilitates HIV infection.
  • the donor oligonucleotide may also contain synonymous (silent) mutations (e.g., 7 to 10).
  • the additional silent mutations can facilitate detection of the corrected target sequence using allele-specific PCR of genomic DNA isolated from treated cells.
  • Triplex-forming composition and other gene editing compositions such as those discussed above can increase the rate of recombination of the donor oligonucleotide in the target cells relative to administering donor alone.
  • the triplex forming molecules including peptide nucleic acids may be administered in combination with, or tethered to, a donor oligonucleotide via a mixed sequence linker or used in conjunction with a non-tethered donor oligonucleotide that is substantially homologous to the target sequence.
  • Triplex-forming molecules can induce recombination of a donor oligonucleotide sequence up to several hundred base pairs away. It is preferred that the donor oligonucleotide sequence targets a region between 0 to 800 bases from the target binding site of the triplex-forming molecules. More preferably the donor oligonucleotide sequence targets a region between 25 to 75 bases from the target binding site of the triplex-forming molecules. Most preferably that the donor oligonucleotide sequence targets a region about 50 nucleotides from the target binding site of the triplex-forming molecules.
  • the donor sequence can contain one or more nucleic acid sequence alterations compared to the sequence of the region targeted for recombination, for example, a substitution, a deletion, or an insertion of one or more nucleotides. Successful recombination of the donor sequence results in a change of the sequence of the target region.
  • Donor oligonucleotides are also referred to herein as donor fragments, donor nucleic acids, donor DNA, or donor DNA fragments. This strategy exploits the ability of a triplex to provoke DNA repair, potentially increasing the probability of recombination with the homologous donor DNA.
  • Tethering of a donor oligonucleotide to a triplex-forming molecule facilitates target site recognition via triple helix formation while at the same time positioning the tethered donor fragment for possible recombination and information transfer.
  • Triplex-forming molecules also effectively induce homologous recombination of non-tethered donor oligonucleotides.
  • recombinagenic as used herein, is used to define a DNA fragment, oligonucleotide, peptide nucleic acid, or composition as being able to recombine into a target site or sequence or induce recombination of another DNA fragment, oligonucleotide, or composition.
  • Non-tethered or unlinked fragments may range in length from 20 nucleotides to several thousand.
  • the donor oligonucleotide molecules, whether linked or unlinked, can exist in single stranded or double stranded form.
  • the donor fragment to be recombined can be linked or un-linked to the triplex forming molecules.
  • the linked donor fragment may range in length from 4 nucleotides to 100 nucleotides, preferably from 4 to 80 nucleotides in length.
  • the unlinked donor fragments have a much broader range, from 20 nucleotides to several thousand.
  • the oligonucleotide donor is between 25 and 80 nucleobases.
  • the non-tethered donor oligonucleotide is about 50 to 60 nucleotides in length.
  • the donor oligonucleotides contain at least one mutated, inserted or deleted nucleotide relative to the target DNA sequence.
  • Target sequences can be within the coding DNA sequence of the gene or within introns.
  • Target sequences can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences or sequences that regulate RNA splicing.
  • the donor oligonucleotides can contain a variety of mutations relative to the target sequence.
  • Representative types of mutations include, but are not limited to, point mutations, deletions and insertions. Deletions and insertions can result in frameshift mutations or deletions. Point mutations can cause missense or nonsense mutations. These mutations may disrupt, reduce, stop, increase, improve, or otherwise alter the expression of the target gene.
  • compositions including triplex-forming molecules such as tcPNA may include one or more than one donor oligonucleotides. More than one donor oligonucleotides may be administered with triplex-forming molecules in a single transfection, or sequential transfections. Use of more than one donor oligonucleotide may be useful, for example, to create a heterozygous target gene where the two alleles contain different modifications.
  • Donor oligonucleotides are preferably DNA oligonucleotides, composed of the principal naturally-occurring nucleotides (uracil, thymine, cytosine, adenine and guanine) as the heterocyclic nucleobases, deoxyribose as the sugar moiety, and phosphate ester linkages.
  • Donor oligonucleotides may include modifications to nucleobases, sugar moieties, or backbone/linkages, as described above, depending on the desired structure of the replacement sequence at the site of recombination or to provide some resistance to degradation by nucleases.
  • One exemplary modification is a thiophosphate ester linkage. Modifications to the donor oligonucleotide should not prevent the donor oligonucleotide from successfully recombining at the recombination target sequence in the presence of triplex-forming molecules.
  • the nuclease activity of the genome editing systems described herein cleave target DNA to produce single or double strand breaks in the target DNA.
  • Double strand breaks can be repaired by the cell in one of two ways: non-homologous end joining, and homology-directed repair.
  • non-homologous end joining NHEJ
  • the double-strand breaks are repaired by direct ligation of the break ends to one another. As such, no new nucleic acid material is inserted into the site, although some nucleic acid material may be lost, resulting in a deletion.
  • a donor polynucleotide with homology to the cleaved target DNA sequence is used as a template for repair of the cleaved target DNA sequence, resulting in the transfer of genetic information from a donor polynucleotide to the target DNA.
  • new nucleic acid material can be inserted/copied into the site.
  • the genome editing composition optionally includes a donor oligonucleotide.
  • the modifications of the target DNA due to NHEJ and/or homology-directed repair can be used to induce gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, gene mutation, etc.
  • cleavage of DNA by the genome editing composition can be used to delete nucleic acid material from a target DNA sequence by cleaving the target DNA sequence and allowing the cell to repair the sequence in the absence of an exogenously provided donor polynucleotide.
  • the methods can be used to add, i.e., insert or replace, nucleic acid material to a target DNA sequence (e.g., to “knock in” a nucleic acid that encodes for a protein, an siRNA, an miRNA, etc.), to add a tag (e.g., 6 ⁇ His, a fluorescent protein (e.g., a green fluorescent protein; a yellow fluorescent protein, etc.), hemagglutinin (HA), FLAG, etc.), to add a regulatory sequence to a gene (e.g., promoter, polyadenylation signal, internal ribosome entry sequence (IRES), 2A peptide, start codon, stop codon, splice signal, localization signal, etc.), to modify a nucleic acid sequence (e.g., introduce a mutation), and the like.
  • a target DNA sequence e.g., to “knock in” a nucleic acid that encodes for a protein, an siRNA, an miRNA, etc.
  • compositions can be used to modify DNA in a site-specific, i.e., “targeted”, way, for example gene knock-out, gene knock-in, gene editing, gene tagging, etc. as used in, for example, gene therapy.
  • an oligonucleotide including a donor sequence to be inserted is also provided to the cell.
  • a “donor sequence” or “donor polynucleotide” or “donor oligonucleotide” it is meant a nucleic acid sequence to be inserted at the cleavage site.
  • the donor polynucleotide typically contains sufficient homology to a genomic sequence at the cleavage site, e.g., 70%, 80%, 85%, 90%, 95%, or 100% homology with the nucleotide sequences flanking the cleavage site, e.g., within about 50 bases or less of the cleavage site, e.g., within about 30 bases, within about 15 bases, within about 10 bases, within about 5 bases, or immediately flanking the cleavage site, to support homology-directed repair between it and the genomic sequence to which it bears homology.
  • the donor sequence is typically not identical to the genomic sequence that it replaces.
  • the donor sequence may contain at least one or more single base changes, insertions, deletions, inversions or rearrangements with respect to the genomic sequence, so long as sufficient homology is present to support homology-directed repair.
  • the donor oligonuleotide includes a non-homologous sequence flanked by two regions of homology, such that homology-directed repair between the target DNA region and the two flanking sequences results in insertion of the non-homologous sequence at the target region.
  • any of the gene editing technologies, components thereof, donor oligonucleotides, or other nucleic acids disclosed herein can include one or more modifications or substitutions to the nucleobases or linkages. Although modifications are particularly preferred for use with triplex-forming technologies and typically discussed below with reference thereto, any of the modifications can be utilized in the construction of any of the gene editing compositions, donor, nucleotides, etc. Modifications should not prevent, and preferably enhance the activity, persistence, or function of the gene editing technology. For example, modifications to oligonucleotides for use as triplex-forming molecules should not prevent, and preferably enhance duplex invasion, strand displacement, and/or stabilize triplex formation as described above by increasing specificity or binding affinity of the triplex-forming molecules to the target site.
  • Modified bases and base analogues, modified sugars and sugar analogues and/or various suitable linkages known in the art are also suitable for use in the molecules disclosed herein.
  • oligonucleotide compositions including PNA, and modification thereof to include MiniPEG at the ⁇ position in the PNA backbone are discussed above. Additional modifications are discussed in more detail below.
  • the principal naturally-occurring nucleotides include uracil, thymine, cytosine, adenine and guanine as the heterocyclic nucleobases.
  • Gene editing molecules can include chemical modifications to their nucleotide constituents. For example, target sequences with adjacent cytosines can be problematic. Triplex stability is greatly compromised by runs of cytosines, thought to be due to repulsion between the positive charge resulting from the N 3 protonation or perhaps because of competition for protons by the adjacent cytosines. Chemical modification of nucleotides including triplex-forming molecules such as PNAs may be useful to increase binding affinity of triplex-forming molecules and/or triplex stability under physiologic conditions.
  • nucleobases or nucleobase analogs may be effective to increase the binding affinity of a nucleotide or its stability in a triplex.
  • Chemically-modified nucleobases include, but are not limited to, inosine, 5-(1-propynyl) uracil (pU), 2-thio uracil, 5-(1-propynyl) cytosine (pC), 5-methylcytosine, 8-oxo-adenine, 2,6-diaminopurine, pseudocytosine, pseudoisocytosine, 5 and 2-amino-5-(2′-deoxy- ⁇ -D-ribofuranosyl)pyridine (2-aminopyridine), and various pyrrolo- and pyrazolopyrimidine derivatives. Substitution of 5-methylcytosine or pseudoisocytosine for cytosine in triplex-forming molecules such as PNAs helps to stabilize triplex formation at neutral and/or physiological pH, especially in triplex-forming molecules with isolated
  • PNAs The nucleotide residues of the triplex-forming molecules such as PNAs are connected by an internucleotide bond that refers to a chemical linkage between two nucleoside moieties.
  • Unmodified peptide nucleic acids are synthetic DNA mimics in which the phosphate backbone of the oligonucleotide is replaced in its entirety by repeating N-(2-aminoethyl)-glycine units that are linked by amide bonds.
  • the various nucleobases are linked to the backbone by methylene carbonyl bonds, which allow them to form PNA-DNA or PNA-RNA duplexes via Watson-Crick base pairing with high affinity and sequence-specificity.
  • PNAs maintain spacing of nucleobases that is similar to conventional DNA oligonucleotides, but are achiral and neutrally charged molecules.
  • Peptide nucleic acids are composed of peptide nucleic acid residues.
  • backbone modifications particularly those relating to PNAs, include peptide and amino acid variations and modifications.
  • the backbone constituents of PNAs may be peptide linkages, or alternatively, they may be non-peptide linkages. Examples include acetyl caps, amino spacers such as 8-amino-3,6-dioxaoctanoic acid (referred to herein as O-linkers), amino acids such as lysine are particularly useful if positive charges are desired in the PNA, and the like.
  • O-linkers amino spacers
  • amino acids such as lysine are particularly useful if positive charges are desired in the PNA, and the like.
  • Methods for the chemical assembly of PNAs are well known. See, for example, U.S. Pat. Nos. 5,539,082, 5,527,675, 5,623,049, 5,714,331, 5,736,336, 5,773,571 and 5,786,571.
  • Backbone modifications used to generate triplex-forming molecules should not prevent the molecules from binding with high specificity to the target site and creating a triplex with the target duplex nucleic acid by displacing one strand of the target duplex and forming a clamp around the other strand of the target duplex.
  • Oligonucleotides are composed a chain of nucleotides which are linked to one another.
  • Canonical nucleotides typically are composed of a nucleobase (nucleic acid base), a sugar moiety attached to the heterocyclic base, and a phosphate moiety which esterifies a hydroxyl function of the sugar moiety.
  • the principal naturally-occurring nucleotides include uracil, thymine, cytosine, adenine and guanine as the heterocyclic nucleobases, and ribose or deoxyribose sugar linked by phosphodiester bonds.
  • modified nucleotide or “chemically modified nucleotide” defines a nucleotide that has a chemical modification of one or more of the nucleobase, sugar moiety or phosphate moiety constituents.
  • charge of the modified nucleotide is reduced compared to DNA or RNA oligonucleotides of the same nucleobase sequence.
  • triplex-forming molecules have low negative charge, no charge, or positive charge such that electrostatic repulsion with the nucleotide duplex at the target site is reduced compared to DNA or RNA oligonucleotides with the corresponding nucleobase sequence.
  • modified nucleotides with reduced charge examples include modified internucleotide linkages such as phosphate analogs having achiral and uncharged intersubunit linkages (e.g., Sterchak, E. P. et al., Organic Chem., 52:4202, (1987)), and uncharged morpholino-based polymers having achiral intersubunit linkages (see, e.g., U.S. Pat. No. 5,034,506).
  • Some internucleotide linkage analogs include morpholidate, acetal, and polyamide-linked heterocycles.
  • Locked nucleic acids are modified RNA nucleotides (see, for example, Braasch, et al., Chem.
  • LNAs form hybrids with DNA which are more stable than DNA/DNA hybrids, a property similar to that of peptide nucleic acid (PNA)/DNA hybrids. Therefore, LNA can be used just as PNA molecules would be except they have a negatively charged backbone, whereas PNAs generally have a neutrally charged backbone (although certain amino acid side chain modifications can alter the backbone charge). LNA binding efficiency can be increased in some embodiments by adding positive charges to it.
  • Commercial nucleic acid synthesizers and standard phosphoramidite chemistry can be used to make LNAs.
  • Molecules may also include nucleotides with modified nucleobases, sugar moieties or sugar moiety analogs.
  • Modified nucleotides may include modified nucleobases or base analogs as described above with respect to peptide nucleic acids.
  • Sugar moiety modifications include, but are not limited to, 2′-O-aminoethoxy, 2′-O-amonioethyl (2′-OAE), 2′-O-methoxy, 2′-O-methyl, 2-guanidoethyl (2′-OGE), 2′-0,4′-C-methylene (LNA), 2′-O-(methoxyethyl) (2′-OME) and 2′-O—(N-(methyl)acetamido) (2′-OMA).
  • 2′-O-aminoethyl sugar moiety substitutions are especially preferred because they are protonated at neutral pH and thus suppress the charge repulsion between the triplex-forming molecule and the target duplex. This modification stabilizes the C3′-endo conformation of the ribose or deoxyribose and also forms a bridge with the i ⁇ 1 phosphate in the purine strand of the duplex.
  • the compositions and methods include a potentiating factor.
  • certain potentiating factors can be used to increase the efficacy of gene editing technologies.
  • Gene expression profiling on SCF-treated CD117+ cells versus untreated CD117+ cells discussed in the Examples below showed additional up-regulation of numerous DNA repair genes including RAD51 and BRCA2. These results and others discussed below indicate that a functional c-Kit signaling pathway mediates increased HDR and promotes gene editing, rather than CD117 simply being a phenotypic marker. When CD117+ cells were treated with SCF, expression of these DNA repair genes was increased even more, correlating with a further increase in gene editing.
  • compositions and methods of increasing the efficacy of gene editing technology are provided.
  • a “gene editing potentiating factor” or “gene editing potentiating agent” or “potentiating factor or “potentiating agent” refers a compound that increases the efficacy of editing (e.g., mutation, including insertion, deletion, substitution, etc.) of a gene, genome, or other nucleic acid) by a gene editing technology relative to use of the gene editing technology in the absence of the compound.
  • Preferred gene editing technologies suitable for use alone or more preferably in combination with the potentiating factors are discussed in more detail below.
  • the potentiating factor is administered as a nucleic acid encoding the potentiating factor.
  • the gene editing technology is a triplex-forming ⁇ PNA and donor DNA, optionally, but preferably in a particle composition.
  • Potentiating factors include, for example, DNA damage or repair-stimulating or -potentiating factors.
  • the factor is one that engages one or more endogenous high fidelity DNA repair pathways.
  • the factor is one that increases expression of Rad51, BRCA2, or a combination thereof.
  • the preferred methods typically include contacting cells with an effective amount of a gene editing potentiating factor.
  • the contacting can occur ex vivo, for example isolated cells, or in vivo following, for example, administration of the potentiating factor to a subject.
  • exemplary gene editing potentiating agents include receptor tyrosine kinase C-kit ligands, ATR-Chk1 cell cycle checkpoint pathway inhibitors, a DNA polymerase alpha inhibitors, and heat shock protein 90 inhibitors (HSP90i).
  • the factor is an activator of the receptor tyrosine kinase c-Kit.
  • CD117 also known as mast/stem cell growth factor receptor or proto-oncogene c-Kit protein
  • SCF Stem cell factor
  • the C-kit ligand is stem factor protein or fragment thereof sufficient to causes dimerization of C-kit and activates its tyrosine kinase activity.
  • the C-kit ligand can be a nucleic acid encoding a stem factor protein or fragment thereof sufficient to causes dimerization of C-kit and activates its tyrosine kinase activity.
  • the nucleic acid can be an mRNA or an expression vector.
  • the human SCF gene encodes for a 273 amino acid transmembrane protein, which contains a 25 amino acid N-terminal signal sequence, a 189 amino acid extracellular domain, a 23 amino acid transmembrane domain, and a 36 amino acid cytoplasmic domain.
  • a canonical human SCF amino acid sequence is:
  • the secreted soluble form of SCF is generated by proteolytic processing of the membrane-anchored precursor.
  • a cleaved, secreted soluble form of human SCF is underlined in SEQ ID NO:1, which corresponds to SEQ ID NO:2 without the N-terminal methionine.
  • Murine and rat SCF are fully active on human cells.
  • a canonical mouse SCF amino acid sequence is:
  • a cleaved, secreted soluble form of mouse SCF is underlined in SEQ ID NO:3, which corresponds to SEQ ID NO:4 without the N-terminal methionine.
  • a canonical mouse SCF amino acid sequence is:
  • a cleaved, secreted soluble form of rat SCF is underlined in SEQ ID NO:5, which corresponds to SEQ ID NO:6 without the N-terminal methionine.
  • the factor is a SCF such as any of SEQ ID NO:1-6, with or without the N-terminal methionine, or a functional fragment thereof, or a variant thereof with at least 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or more sequence identity to any one of SEQ ID NO:1-6.
  • SCF can be administered to cells or a subject as SCF protein, or as a nucleic acid encoding SCF (transcribed RNA, DNA, DNA in an expression vector).
  • nucleic acid sequences including RNA (e.g., mRNA) and DNA sequences, encoding SEQ ID NOS:1-6 are also provided, both alone and inserted into expression cassettes and vectors.
  • a sequence encoding SCF can be incorporated into an autonomously replicating plasmid, a virus (e.g., a retrovirus, lentivirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote.
  • SCF erythropoietin
  • GM-CSF GM-CSF
  • EGF especially for epithelial cells; lung epithelia for cystic fibrosis
  • hepatocyte growth factor etc.
  • gene editing is enhanced in specific cell types using cytokines targeted to these cell types.
  • the potentiating factor is a replication modulator that can, for example, manipulate replication progression and/or replication forks.
  • the ATR-Chk1 cell cycle checkpoint pathway has numerous roles in protecting cells from DNA damage and stalled replication, one of the most prominent being control of the cell cycle and prevention of premature entry into mitosis (Thompson and Eastman, Br J Clin Pharmacol., 76(3): 358-369 (2013), Smith, et al., Adv Cancer Res., 108:73-112 (2010)).
  • Chk1 also contributes to the stabilization of stalled replication forks, the control of replication origin firing and replication fork progression, and homologous recombination.
  • DNA polymerase alpha also known as Pol ⁇ is an enzyme complex found in eukaryotes that is involved in initiation of DNA replication.
  • Hsp90 heat shock protein 90
  • Hsp90 heat shock protein 90
  • the potentiating factor is a CHK1 or ATR pathway inhibitor, a DNA polymerase alpha inhibitor, or an HSP90 inhibitor.
  • the inhibitor can be a functional nucleic acid, for example siRNA, miRNA, aptamers, ribozymes, triplex forming molecules, RNAi, or external guide sequences that targets CHK1, ATR, or another molecule in the ATR-Chk1 cell cycle checkpoint pathway; DNA polymerase alpha; or HSP90 and reduces expression or active of ATR, CHK1, DNA polymerase alpha, or HSP90.
  • a functional nucleic acid for example siRNA, miRNA, aptamers, ribozymes, triplex forming molecules, RNAi, or external guide sequences that targets CHK1, ATR, or another molecule in the ATR-Chk1 cell cycle checkpoint pathway; DNA polymerase alpha; or HSP90 and reduces expression or active of ATR, CHK1, DNA polymerase alpha, or HSP90.
  • the inhibitor is a small molecule.
  • the potentiating factor can be a small molecule inhibitor of ATR-Chk1 Cell Cycle Checkpoint Pathway Inhibitor.
  • Such inhibitors are known in the art, and many have been tested in clinical trials for the treatment of cancer.
  • Exemplary CHK1 inhibitors include, but are not limited to, AZD7762, SCH900776/MK-8776, IC83/LY2603618, LY2606368, GDC-0425, PF-00477736, XL844, CEP-3891, SAR-020106, CCT-244747, Arry-575 (Thompson and Eastman, Br J Clin Pharmacol., 76(3): 358-369 (2013)), and SB218075.
  • Exemplary ATR pathway inhibitors include, but are not limited to Schisandrin B, NU6027, NVP-BEZ235, VE-821, VE-822 (VX-970), AZ20, AZD6738, MIRIN, KU5593, VE-821, NU7441, LCA, and L189 (Weber and Ryan, Pharmacology & Therapeutics, 149:124-138 (2015)).
  • the potentiating factor is a DNA polymerase alpha inhibitor, such as aphidicolin.
  • the potentiating factor is a heat shock protein 90 inhibitor (HSP90i) such as STA-9090 (ganetespib).
  • HSP90 inhibitors include, but are not limited to, benzoquinone ansamycin antibiotics such as geldanamycin (GA); 17-AAG (17-Allylamino-17-demethoxy-geldanamycin); 17-DMAG (17-dimethylaminoethylamino-17-demethoxy-geldanamycin) (Alvespimycin); IPI-504 (Retaspimycin); and AUY922 (Tatokoro, et al., EXCLI J., 14:48-58 (2015)).
  • Functional molecules can be associated with, linked, conjugated, or otherwise attached directly or indirectly gene editing technology, potentiating agents, or particles utilized for delivery thereof.
  • the composition can include a targeting agent, a cell penetrating peptide, or a combination thereof.
  • the targeting agent is typically capable of specifically binding to a target on or in the fetus or embryo.
  • Target agents can be bound or conjugated to particles (e.g., a polymer of the particle).
  • Targeting molecules can be associated with, linked, conjugated, or otherwise attached directly or indirectly to the gene editing molecule, or to a particle or other delivery vehicle thereof.
  • Targeting molecules can be proteins, peptides, nucleic acid molecules, saccharides or polysaccharides that bind to a receptor or other molecule on the surface of a targeted cell.
  • the degree of specificity and the avidity of binding to the graft can be modulated through the selection of the targeting molecule.
  • antibodies are very specific. These can be polyclonal, monoclonal, fragments, recombinant, or single chain, many of which are commercially available or readily obtained using standard techniques.
  • moieties include, for example, targeting moieties which provide for the delivery of molecules to specific cells, e.g., antibodies to hematopoietic stem cells, CD34 + cells, T cells or any other preferred cell type, as well as receptor and ligands expressed on the preferred cell type.
  • the moieties target hematopoeitic stem cells.
  • the targeting molecule targets a cell surface protein.
  • Examples of molecules targeting extracellular matrix (“ECM”) include glycosaminoglycan (“GAG”) and collagen.
  • GAG glycosaminoglycan
  • the external surface of polymer particles may be modified to enhance the ability of the particles to interact with selected cells or tissue. The method described above wherein an adaptor element conjugated to a targeting molecule is inserted into the particle is preferred.
  • the outer surface of a polymer micro- or nanoparticle having a carboxy terminus may be linked to targeting molecules that have a free amine terminus.
  • PAMPs pathogen-associated molecular patterns
  • TLRs Toll-like Receptors
  • PAMPs conjugated to the particle surface or co-encapsulated may include: unmethylated CpG DNA (bacterial), double-stranded RNA (viral), lipopolysacharride (bacterial), peptidoglycan (bacterial), lipoarabinomannin (bacterial), zymosan (yeast), mycoplasmal lipoproteins such as MALP-2 (bacterial), flagellin (bacterial) poly(inosinic-cytidylic) acid (bacterial), lipoteichoic acid (bacterial) or imidazoquinolines (synthetic).
  • the outer surface of the particle may be treated using a mannose amine, thereby mannosylating the outer surface of the particle. This treatment may cause the particle to bind to the target cell or tissue at a mannose receptor on the antigen presenting cell surface.
  • surface conjugation with an immunoglobulin molecule containing an Fc portion targeting Fc receptor
  • HSP receptor heat shock protein moiety
  • phosphatidylserine scavenger receptors
  • LPS lipopolysaccharide
  • Lectins that can be covalently attached to micro- and nanoparticles to render them target specific to the mucin and mucosal cell layer include lectins isolated from Abrus precatroius, Agaricus bisporus, Anguilla, Arachis hypogaea, Pandeiraea simplicifolia, Bauhinia purpurea, Caragan arobrescens, Cicer arietinum, Codium fragile, Datura stramonium, Dolichos biflorus, Erythrina corallodendron, Erythrina cristagalli, Euonymus europaeus, Glycine max, Helix aspersa, Helix pomatia, Lathyrus odoratus, Lens culinaris, Limulus polyphemus, Lysopersicon esculentum, Maclura pomifera, Momordica charantia, Mycoplasma gallisepticum, Naja mocambique , as
  • the choice of targeting molecule will depend on the method of administration of the particle composition and the cells or tissues to be targeted.
  • the targeting molecule may generally increase the binding affinity of the particles for cell or tissues or may target the particle to a particular tissue in an organ or a particular cell type in a tissue.
  • Avidin increases the ability of polymeric particles to bind to tissues. While the exact mechanism of the enhanced binding of avidin-coated particles to tissues has not been elucidated, it is hypothesized it is caused by electrostatic attraction of positively charged avidin to the negatively charged extracellular matrix of tissue. Non-specific binding of avidin, due to electrostatic interactions, has been previously documented and zeta potential measurements of avidin-coated PLGA particles revealed a positively charged surface as compared to uncoated PLGA particles.
  • any positively charged ligand such as polyethyleneimine or polylysine
  • any polymeric particle may improve bioadhesion due to the electrostatic attraction of the cationic groups coating the beads to the net negative charge of the mucus.
  • Any ligand with a high binding affinity for mucin could also be covalently linked to most particles with the appropriate chemistry and be expected to influence the binding of particles to the gut.
  • polyclonal antibodies raised against components of mucin or else intact mucin, when covalently coupled to particles, would provide for increased bioadhesion.
  • antibodies directed against specific cell surface receptors exposed on the lumenal surface of the intestinal tract would increase the residence time of beads, when coupled to particles using the appropriate chemistry.
  • the ligand affinity need not be based only on electrostatic charge, but other useful physical parameters such as solubility in mucin or else specific affinity to carbohydrate groups.
  • any of the natural components of mucin in either pure or partially purified form to the particles would decrease the surface tension of the bead-gut interface and increase the solubility of the bead in the mucin layer.
  • the list of useful ligands includes, but is not limited to the following: sialic acid, neuraminic acid, n-acetyl-neuraminic acid, n-glycolylneuraminic acid, 4-acetyl-n-acetylneuraminic acid, diacetyl-n-acetylneuraminic acid, glucuronic acid, iduronic acid, galactose, glucose, mannose, fucose, any of the partially purified fractions prepared by chemical treatment of naturally occurring mucin, e.g., mucoproteins, mucopolysaccharides and mucopolysaccharide-protein complexes, and antibodies immunoreactive against proteins or sugar structure on the mucosal surface.
  • polyamino acids containing extra pendant carboxylic acid side groups e.g., polyaspartic acid and polyglutamic acid
  • polyamino acids containing extra pendant carboxylic acid side groups e.g., polyaspartic acid and polyglutamic acid
  • polyamino acids in the 15,000 to 50,000 kDa molecular weight range yields chains of 120 to 425 amino acid residues attached to the surface of the particles.
  • the polyamino chains increase bioadhesion by means of chain entanglement in mucin strands as well as by increased carboxylic charge.
  • epithelial cells constitute the principal barrier that separates an organism's interior from the outside world.
  • Epithelial cells such as those that line the gastrointestinal tract form continuous monolayers that simultaneously confront the extracellular fluid compartment and the extracorporeal space.
  • the particles herein further include epithelial cell targeting molecules.
  • Epithelial cell targeting molecules include monoclonal or polyclonal antibodies or bioactive fragments thereof that recognize and bind to epitopes displayed on the surface of epithelial cells.
  • Epithelial cell targeting molecules also include ligands which bind to a cell surface receptor on epithelial cells.
  • Ligands include, but are not limited to, molecules such as polypeptides, nucleotides and polysaccharides.
  • a variety of receptors on epithelial cells may be targeted by epithelial cell targeting molecules.
  • suitable receptors to be targeted include, but are not limited to, IgE Fc receptors, EpCAM, selected carbohydrate specificities, dipeptidyl peptidase, and E-cadherin.
  • Suitable functional elements that can be associated with, linked, conjugated, or otherwise attached directly or indirectly to the gene editing molecule, potentiating agent, or to a particle or other delivery vehicle thereof, include protein transduction domains and fusogenic peptides.
  • the efficiency of particle delivery systems can also be improved by the attachment of functional ligands to the particle surface.
  • Potential ligands include, but are not limited to, small molecules, cell-penetrating peptides (CPPs), targeting peptides, antibodies or aptamers (Yu, et al., PLoS One., 6:e24077 (2011), Cu, et al., J Control Release, 156:258-264 (2011), Nie, et al., J Control Release, 138:64-70 (2009), Cruz, et al., J Control Release, 144:118-126 (2010)). Attachment of these moieties serves a variety of different functions; such as inducing intracellular uptake, endosome disruption, and delivery of the plasmid payload to the nucleus.
  • lipid-conjugated polyethylene glycol is used as a multivalent linker of penetratin, a CPP, or folate (Cheng, et al., Biomaterials, 32:6194-6203 (2011)).
  • PEG is used as a linker for linking functional molecules to particles.
  • DSPE-PEG(2000)-maleimide is commercially available and can be used utilized for covalently attaching functional molecules such as CPP.
  • PTD Protein Transduction Domain
  • PTA Protein Transduction Domain
  • a PTD attached to another molecule facilitates the molecule traversing membranes, for example going from extracellular space to intracellular space, or cytosol to within an organelle.
  • PTA can be short basic peptide sequences such as those present in many cellular and viral proteins.
  • Exemplary protein transduction domains that are well-known in the art include, but are not limited to, the Antennapedia PTD and the TAT (transactivator of transcription) PTD, poly-arginine, poly-lysine or mixtures of arginine and lysine, HIV TAT (YGRKKRRQRRR (SEQ ID NO:7) or RKKRRQRRR (SEQ ID NO:8), 11 arginine residues, VP22 peptide, and an ANTp peptide (RQIKIWFQNRRMKWKK) (SEQ ID NO:9) or positively charged polypeptides or polynucleotides having 8-15 residues, preferably 9-11 residues.
  • Short, non-peptide polymers that are rich in amines or guanidinium groups are also capable of carrying molecules crossing biological membranes.
  • Penetratin and other derivatives of peptides derived from antennapedia Choeng, et al., Biomaterials, 32(26):6194-203 (2011) can also be used.
  • results show that penetratin in which additional Args are added, further enhances uptake and endosomal escape, and IKK NBD, which has an antennapedia domain for permeation as well as a domain that blocks activation of NFkB and has been used safely in the lung for other purposes (von Bismarck, et al., Pulmonary Pharmacology & Therapeutics, 25(3):228-35 (2012), Kamei, et al., Journal Of Pharmaceutical Sciences, 102(11):3998-4008 (2013)).
  • a “fusogenic peptide” is any peptide with membrane destabilizing abilities.
  • fusogenic peptides have the propensity to form an amphiphilic alpha-helical structure when in the presence of a hydrophobic surface such as a membrane.
  • the presence of a fusogenic peptide induces formation of pores in the cell membrane by disruption of the ordered packing of the membrane phospholipids.
  • Some fusogenic peptides act to promote lipid disorder and in this way enhance the chance of merging or fusing of proximally positioned membranes of two membrane enveloped particles of various nature (e.g. cells, enveloped viruses, liposomes).
  • fusogenic peptides may simultaneously attach to two membranes, causing merging of the membranes and promoting their fusion into one.
  • fusogenic peptides include a fusion peptide from a viral envelope protein ectodomain, a membrane-destabilizing peptide of a viral envelope protein membrane-proximal domain from the cytoplasmic tails.
  • amphiphilic-region containing peptides include: melittin, magainins, the cytoplasmic tail of HIV1 gp41, microbial and reptilian cytotoxic peptides such as bomolitin 1, pardaxin, mastoparan, crabrolin, cecropin, entamoeba , and staphylococcal .alpha.-toxin; viral fusion peptides from (1) regions at the N terminus of the transmembrane (TM) domains of viral envelope proteins, e.g.
  • TM transmembrane
  • HIV-1, SIV, influenza, polio, rhinovirus, and coxsackie virus (2) regions internal to the TM ectodomain, e.g. semliki forest virus, Sindbis virus, rota virus, rubella virus and the fusion peptide from sperm protein PH-30: (3) regions membrane-proximal to the cytoplasmic side of viral envelope proteins e.g. in viruses of avian leukosis (ALV), Feline immunodeficiency (FIV), Rous Sarcoma (RSV), Moloney murine leukemia virus (MoMuLV), and spleen necrosis (SNV).
  • ABV avian leukosis
  • FMV Feline immunodeficiency
  • RSV Rous Sarcoma
  • MoMuLV Moloney murine leukemia virus
  • SNV spleen necrosis
  • a functional molecule such as a CPP is covalently linked to DSPE-PEG-maleimide functionalized particles such as PBAE/PLGA blended particles using known methods such as those described in Fields, et al., J Control Release, 164(1):41-48 (2012).
  • DSPE-PEG-function molecule can be added to the 5.0% PVA solution during formation of the second emulsion.
  • the loading ratio is about 5 nmol/mg ligand-to-polymer ratio.
  • the functional molecule is a CPP such as those above, or mTAT (HIV-1 (with histidine modification) HHHHRKKRRQRRRRHHHHH (SEQ ID NO:10) (Yamano, et al., J Control Release, 152:278-285 (2011)); or bPrPp (Bovine prion) MVKSKIGSWILVLFVAMWS DVGLCKKRPKP (SEQ ID NO:11) (Magzoub, et al., Biochem Biophys Res Commun., 348:379-385 (2006)); or MPG (Synthetic chimera: SV40 Lg T.
  • CPP such as those above, or mTAT (HIV-1 (with histidine modification) HHHHRKKRRQRRRRHHHHH (SEQ ID NO:10) (Yamano, et al., J Control Release, 152:278-285 (2011)); or bPrPp (Bovine prion) MVKSKIGSWI
  • the particle compositions described herein can be prepared by a variety of methods.
  • the nucleic acid is first complexed to a polycation.
  • Complexation can be achieved by mixing the nucleic acids and polycations at an appropriate molar ratio.
  • a polyamine is used as the polycation species, it is useful to determine the molar ratio of the polyamine nitrogen to the polynucleotide phosphate (N/P ratio).
  • N/P ratio the molar ratio of the polyamine nitrogen to the polynucleotide phosphate
  • nucleic acids and polyamines are mixed together to form a complex at an N/P ratio of between approximately 8:1 to 15:1.
  • the volume of polyamine solution required to achieve particular molar ratios can be determined according to the following formula:
  • V NH ⁇ ⁇ 2 C nucacid , final ⁇ M w , nucacid / C nucacid , final ⁇ M w , P ⁇ ⁇ N : P ⁇ ⁇ ⁇ ⁇ V final C NH ⁇ ⁇ 2 / M w , NH ⁇ ⁇ 2
  • M w,nucacid molecular weight of nucleic acid
  • M w,P molecular weight of phosphate groups of the nucleic acid
  • ⁇ N:P N:P ratio (molar ratio of nitrogens from polyamine to the ratio of phosphates from the nucleic acid)
  • C NH2 , stock concentration of polyamine stock solution
  • M w,NH2 molecular weight per nitrogen of polyamine
  • the particles are formed by a double-emulsion solvent evaporation technique, such as is disclosed in U.S. Published Application No. 2011/0008451 or U.S. Published Application No. 2011/0268810, each of which is a specifically incorporated by reference in its entirety, or Fahmy, et al., Biomaterials, 26:5727-5736, (2005), or McNeer, et al., Mol. Ther. 19, 172-180 (2011)).
  • the nucleic acids or nucleic acid/polycation complexes are reconstituted in an aqueous solution. Nucleic acid and polycation amounts are discussed in more detail below and can be chosen, for example, based on amounts and ratios disclosed in U.S.
  • This mixture is then added dropwise to solution containing a surfactant, such as polyvinyl alcohol (PVA) and sonicated to form the double emulsion.
  • a surfactant such as polyvinyl alcohol (PVA)
  • PVA polyvinyl alcohol
  • the final emulsion is then poured into a solution containing the surfactant in an aqueous solution and stirred for a period of time to allow the dichloromethane to evaporate and the particles to harden.
  • concentration of the surfactant used to form the emulsion, and the sonication time and amplitude can been optimized according to principles known in the art for formulating particles with a desired diameter.
  • the particles can be collected by centrifugation. If it is desirable to store the particles for later use, they can be rapidly frozen, and lyophilized.
  • the particles are PLGA particles.
  • nucleic acid such as PNA, DNA, or PNA-DNA
  • a polycation such as spermidine
  • Encapsulant in H 2 O can be added dropwise to a polymer solution of 50:50 ester-terminated PLGA dissolved in dichloromethane (DCM), then sonicated to form the first emulsion.
  • DCM dichloromethane
  • This emulsion can then be added dropwise to 5% polyvinyl alcohol, then sonicated to form the second emulsion.
  • This mixture can be poured into 0.3% polyvinyl alcohol, and stirred at room temperature to form particles.
  • Particles can then be collected and washed with, for example H 2 O, collected by centrifugation, and then resuspended in H 2 O, frozen at ⁇ 80° C., and lyophilized Particles can be stored at ⁇ 20° C. following lyophilization.
  • the polymer is dissolved in a volatile organic solvent, such as methylene chloride.
  • a volatile organic solvent such as methylene chloride.
  • the drug either soluble or dispersed as fine particles
  • the mixture is suspended in an aqueous solution that contains a surface active agent such as poly(vinyl alcohol).
  • the resulting emulsion is stirred until most of the organic solvent evaporated, leaving solid particles.
  • the resulting particles are washed with water and dried overnight in a lyophilizer. Particles with different sizes (0.5-1000 microns) and morphologies can be obtained by this method.
  • This method is useful for relatively stable polymers like polyesters and polystyrene.
  • labile polymers such as polyanhydrides
  • polyanhydrides may degrade during the fabrication process due to the presence of water.
  • the following two methods which can be performed in completely anhydrous organic solvents, are more useful.
  • Interfacial polycondensation is used to microencapsulate a core material in the following manner.
  • One monomer and the core material are dissolved in a solvent.
  • a second monomer is dissolved in a second solvent (typically aqueous) which is immiscible with the first.
  • An emulsion is formed by suspending the first solution through stirring in the second solution. Once the emulsion is stabilized, an initiator is added to the aqueous phase causing interfacial polymerization at the interface of each droplet of emulsion.
  • the polymer In solvent evaporation microencapsulation, the polymer is typically dissolved in a water immiscible organic solvent and the material to be encapsulated is added to the polymer solution as a suspension or solution in an organic solvent.
  • An emulsion is formed by adding this suspension or solution to a beaker of vigorously stirring water (often containing a surface active agent, for example, polyethylene glycol or polyvinyl alcohol, to stabilize the emulsion).
  • the organic solvent is evaporated while continuing to stir. Evaporation results in precipitation of the polymer, forming solid microcapsules containing core material.
  • the solvent evaporation process can be used to entrap a liquid core material in a polymer such as PLA, PLA/PGA copolymer, or PLA/PCL copolymer microcapsules.
  • the polymer or copolymer is dissolved in a miscible mixture of solvent and nonsolvent, at a nonsolvent concentration which is immediately below the concentration which would produce phase separation (i.e., cloud point).
  • the liquid core material is added to the solution while agitating to form an emulsion and disperse the material as droplets. Solvent and nonsolvent are vaporized, with the solvent being vaporized at a faster rate, causing the polymer or copolymer to phase separate and migrate towards the surface of the core material droplets.
  • phase-separated solution is then transferred into an agitated volume of nonsolvent, causing any remaining dissolved polymer or copolymer to precipitate and extracting any residual solvent from the formed membrane.
  • the result is a microcapsule composed of polymer or copolymer shell with a core of liquid material.
  • Solvent evaporation microencapsulation can result in the stabilization of insoluble active agent particles in a polymeric solution for a period of time ranging from 0.5 hours to several months.
  • Stabilizing an insoluble pigment and polymer within the dispersed phase can be useful for most methods of microencapsulation that are dependent on a dispersed phase, including film casting, solvent evaporation, solvent removal, spray drying, phase inversion, and many others.
  • insoluble active agent particles within the polymeric solution could be critical during scale-up.
  • the particles can remain homogeneously dispersed throughout the polymeric solution as well as the resulting polymer matrix that forms during the process of microencapsulation.
  • Solvent evaporation microencapsulation have several advantages. SEM allows for the determination of the best polymer-solvent-insoluble particle mixture that will aid in the formation of a homogeneous suspension that can be used to encapsulate the particles. SEM stabilizes the insoluble particles or pigments within the polymeric solution, which will help during scale-up because one will be able to let suspensions of insoluble particles or pigments sit for long periods of time, making the process less time-dependent and less labor intensive. SEM allows for the creation of particles that have a more optimized release of the encapsulated material.
  • the polymer is first melted and then mixed with the solid particles.
  • the mixture is suspended in a non-miscible solvent (like silicon oil), and, with continuous stirring, heated to 5° C. above the melting point of the polymer.
  • a non-miscible solvent like silicon oil
  • the emulsion is stabilized, it is cooled until the polymer particles solidify.
  • the resulting particles are washed by decantation with petroleum ether to give a free-flowing powder. Particles with sizes between 0.5 to 1000 microns are obtained with this method.
  • the external surfaces of spheres prepared with this technique are usually smooth and dense. This procedure is used to prepare particles made of polyesters and polyanhydrides. However, this method is limited to polymers with molecular weights between 1,000-50,000.
  • the polymer In solvent removal microencapsulation, the polymer is typically dissolved in an oil miscible organic solvent and the material to be encapsulated is added to the polymer solution as a suspension or solution in organic solvent.
  • Surface active agents can be added to improve the dispersion of the material to be encapsulated.
  • An emulsion is formed by adding this suspension or solution to vigorously stirring oil, in which the oil is a nonsolvent for the polymer and the polymer/solvent solution is immiscible in the oil.
  • the organic solvent is removed by diffusion into the oil phase while continuing to stir. Solvent removal results in precipitation of the polymer, forming solid microcapsules containing core material.
  • phase separation microencapsulation the material to be encapsulated is dispersed in a polymer solution with stirring. While continually stirring to uniformly suspend the material, a nonsolvent for the polymer is slowly added to the solution to decrease the polymer's solubility. Depending on the solubility of the polymer in the solvent and nonsolvent, the polymer either precipitates or phase separates into a polymer rich and a polymer poor phase. Under proper conditions, the polymer in the polymer rich phase will migrate to the interface with the continuous phase, encapsulating the core material in a droplet with an outer polymer shell.
  • Spontaneous emulsification involves solidifying emulsified liquid polymer droplets by changing temperature, evaporating solvent, or adding chemical cross-linking agents.
  • the physical and chemical properties of the encapsulant, and the material to be encapsulated dictates the suitable methods of encapsulation. Factors such as hydrophobicity, molecular weight, chemical stability, and thermal stability affect encapsulation.
  • Coacervation is a process involving separation of colloidal solutions into two or more immiscible liquid layers (Ref. Dowben, R. General Physiology, Harper & Row, New York, 1969, pp. 142-143.).
  • coacervation compositions comprised of two or more phases and known as coacervates may be produced.
  • the ingredients that comprise the two phase coacervate system are present in both phases; however, the colloid rich phase has a greater concentration of the components than the colloid poor phase.
  • This technique is primarily designed for polyanhydrides.
  • the drug is dispersed or dissolved in a solution of the selected polymer in a volatile organic solvent like methylene chloride.
  • This mixture is suspended by stirring in an organic oil (such as silicon oil) to form an emulsion.
  • an organic oil such as silicon oil
  • this method can be used to make particles from polymers with high melting points and different molecular weights. Particles that range between 1-300 microns can be obtained by this procedure.
  • the external morphology of spheres produced with this technique is highly dependent on the type of polymer used.
  • the polymer is dissolved in organic solvent.
  • a known amount of the active drug is suspended (insoluble drugs) or co-dissolved (soluble drugs) in the polymer solution.
  • the solution or the dispersion is then spray-dried.
  • the polymer and nucleic acids are co-dissolved in a selected, water-miscible solvent, for example DMSO, acetone, ethanol, acetone, etc.
  • a selected, water-miscible solvent for example DMSO, acetone, ethanol, acetone, etc.
  • nucleic acids and polymer are dissolved in DMSO.
  • the solvent containing the polymer and nucleic acids is then drop-wise added to an excess volume of stirring aqueous phase containing a stabilizer (e.g., poloxamer, Pluronic®, and other stabilizers known in the art). Particles are formed and precipitated during solvent evaporation.
  • a stabilizer e.g., poloxamer, Pluronic®, and other stabilizers known in the art.
  • the viscosity of the aqueous phase can be increased by using a higher concentration of the stabilizer or other thickening agents such as glycerol and others known in the art.
  • the entire dispersed system is centrifuged, and the nucleic acid-loaded polymer particles are collected and optionally filtered. Nanoprecipitation-based techniques are discussed in, for example, U.S. Pat. No. 5,118,528.
  • nanoprecipitation includes: the method can significantly increase the encapsulation efficiency of drugs that are polar yet water-insoluble, compared to single or double emulsion methods (Alshamsan, Saudi Pharmaceutical Journal, 22(3):219-222 (2014)).
  • No emulsification or high shear force step e.g., sonication or high-speed homogenization
  • Nanoprecipitation relies on the differences in the interfacial tension between the solvent and the nonsolvent, rather than shear stress, to produce particles. Hydrophobicity of the drug will retain it in the instantly-precipitating particles; the un-precipitated polymer due to equilibrium is “lost” and not in the precipitated particle form.
  • targeting molecules There are two principle groups of molecules to be encapsulated or attached to the polymer, either directly or via a coupling molecule: targeting molecules, attachment molecules and therapeutic, nutritional, diagnostic or prophylactic agents. These can be coupled using standard techniques.
  • the targeting molecule or therapeutic molecule to be delivered can be coupled directly to the polymer or to a material such as a fatty acid which is incorporated into the polymer.
  • Functionality refers to conjugation of a ligand to the surface of the particle via a functional chemical group (carboxylic acids, aldehydes, amines, sulfhydryls and hydroxyls) present on the surface of the particle and present on the ligand to be attached.
  • Functionality may be introduced into the particles in two ways. The first is during the preparation of the particles, for example during the emulsion preparation of particles by incorporation of stabilizers with functional chemical groups. Example 1 demonstrates this type of process whereby functional amphiphilic molecules are inserted into the particles during emulsion preparation.
  • a second is post-particle preparation, by direct crosslinking particles and ligands with homo- or heterobifunctional crosslinkers.
  • This second procedure may use a suitable chemistry and a class of crosslinkers (CDI, EDAC, glutaraldehydes, etc. as discussed in more detail below) or any other crosslinker that couples ligands to the particle surface via chemical modification of the particle surface after preparation.
  • This second class also includes a process whereby amphiphilic molecules such as fatty acids, lipids or functional stabilizers may be passively adsorbed and adhered to the particle surface, thereby introducing functional end groups for tethering to ligands.
  • the surface is modified to insert amphiphilic polymers or surfactants that match the polymer phase HLB or hydrophile-lipophile balance, as demonstrated in the following example.
  • HLBs range from 1 to 15. Surfactants with a low HLB are more lipid loving and thus tend to make a water in oil emulsion while those with a high HLB are more hydrophilic and tend to make an oil in water emulsion. Fatty acids and lipids have a low HLB below 10. After conjugation with target group (such as hydrophilic avidin), HLB increases above 10. This conjugate is used in emulsion preparation. Any amphiphilic polymer with an HLB in the range 1-10, more preferably between 1 and 6, most preferably between 1 and up to 5, can be used. This includes all lipids, fatty acids and detergents.
  • One useful protocol involves the “activation” of hydroxyl groups on polymer chains with the agent, carbonyldiimidazole (CDI) in aprotic solvents such as DMSO, acetone, or THF.
  • CDI forms an imidazolyl carbamate complex with the hydroxyl group which may be displaced by binding the free amino group of a ligand such as a protein.
  • the reaction is an N-nucleophilic substitution and results in a stable N-alkylcarbamate linkage of the ligand to the polymer.
  • the “coupling” of the ligand to the “activated” polymer matrix is maximal in the pH range of 9-10 and normally requires at least 24 hrs.
  • the resulting ligand-polymer complex is stable and resists hydrolysis for extended periods of time.
  • Another coupling method involves the use of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) or “water-soluble CDI” in conjunction with N-hydroxylsulfosuccinimide (sulfo NHS) to couple the exposed carboxylic groups of polymers to the free amino groups of ligands in a totally aqueous environment at the physiological pH of 7.0.
  • EDAC and sulfo-NHS form an activated ester with the carboxylic acid groups of the polymer which react with the amine end of a ligand to form a peptide bond.
  • the resulting peptide bond is resistant to hydrolysis.
  • the use of sulfo-NHS in the reaction increases the efficiency of the EDAC coupling by a factor of ten-fold and provides for exceptionally gentle conditions that ensure the viability of the ligand-polymer complex.
  • a useful coupling procedure for attaching ligands with free hydroxyl and carboxyl groups to polymers involves the use of the cross-linking agent, divinylsulfone. This method would be useful for attaching sugars or other hydroxylic compounds with bioadhesive properties to hydroxylic matrices.
  • the activation involves the reaction of divinylsulfone to the hydroxyl groups of the polymer, forming the vinylsulfonyl ethyl ether of the polymer.
  • the vinyl groups will couple to alcohols, phenols and even amines Activation and coupling take place at pH 11.
  • the linkage is stable in the pH range from 1-8 and is suitable for transit through the intestine.
  • Coupling is preferably by covalent binding but it may also be indirect, for example, through a linker bound to the polymer or through an interaction between two molecules such as strepavidin and biotin. It may also be by electrostatic attraction by dip-coating.
  • the molecules to be delivered can also be encapsulated into the polymer using double emulsion solvent evaporation techniques, such as that described by Luo et al., Controlled DNA delivery system, Phar. Res., 16: 1300-1308 (1999).
  • the particle formulation can be selected based on the considerations including the targeted tissue or cells.
  • a preferred particle formulation is PLGA or PACE.
  • PBAEs Poly(beta-amino) esters
  • PBAEs Poly(beta-amino) esters
  • conjugate Miichael-like
  • bifunctional amines to diacrylate esters
  • PBAEs appear to have properties that make them efficient vectors for gene delivery.
  • These cationic polymers are able to condense negatively charged pDNA, induce cellular uptake, and buffer the low pH environment of endosomes leading to DNA escape (Lynn, Langer R, editor. J Am Chem Soc. 2000. pp.
  • PBAEs have the ability to form hybrid particles with other polymers, which allows for production of solid, stable and storable particles. For example, blending cationic PBAE with PLGA produced highly loaded pDNA particles. The addition of PBAE to PLGA resulted in an increase in gene transfection in vitro and induced antigen-specific tumor rejection in a murine model (Little, et al. Proc Natl Acad Sci USA., 101:9534-9539 (2004), Little, et al., J Control Release, 107:449-462 (2005)).
  • the particles utilized to deliver the compositions are composed of a blend of PBAE and a second polymer one of those discussed above. In some embodiments, the particles are composed of a blend of PBAE and PLGA.
  • PLGA and PBAE/PLGA blended particles loaded with gene editing technology can be formulated using a double-emulsion solvent evaporation technique such as that described in detail above, and in McNeer, et al., Nature Commun., 6:6952. doi: 10.1038/ncomms7952 (2015), and Fields, et al., Adv Healthc Mater., 4(3):361-6 (2015). doi: 10.1002/adhm.201400355 (2015) Epub 2014.
  • PBAE Poly(beta amino ester)
  • PBAE blended particles such as PLGA/PBAE blended particles, contain between about 1 and 99, or between about 1 and 50, or between about 5 and 25, or between about 5 and 20, or between about 10 and 20, or about 15 percent PBAE (wt %).
  • PBAE blended particles such as PLGA/PBAE blended particles, contain about 50, 45, 40, 35, 30, 25, 20, 15, 10, or 5% PBAE (wt %). Solvent from these particles in PVA as discussed above, and in some cases may continue overnight.
  • PLGA/PBAE/MPG nanoparticles was shown to produce significantly greater nanoparticle association with airway epithelial cells than PLGA nanoparticles (Fields, et al., Advanced Healthcare Materials, 4:361-366 (2015)).
  • the methods most typically include in utero delivery of at least one active agent to an embryo or fetus in need thereof.
  • the methods of administration are used to deliver an active agent such as a therapeutic, nutritional, diagnostic, or prophylactic agents.
  • the active agents can be small molecule active agents or biomacromolecules, such as proteins, polypeptides, or nucleic acids.
  • two or more active agent are delivered using an in utero delivery method.
  • at least one of the active agents is a gene editing technology.
  • the active agent is typically administered in an effective amount to a subject in need thereof.
  • the effective amount or therapeutically effective amount can be a dosage sufficient to treat, inhibit, or alleviate one or more symptoms of a disease or disorder, or to otherwise provide a desired pharmacologic and/or physiologic effect, for example, reducing, inhibiting, or reversing one or more of the underlying pathophysiological mechanisms underlying a disease or disorder.
  • a composition including active agent can be administered to a specific location, organ, or tissue of the fetus or embryo.
  • the composition can have a defined release profile. In some embodiments the composition is incapable of crossing the placenta.
  • the agents or their particles can have the same targeting agent, or different targeting agents, wherein the different targeting agents are capable of specifically binding to the same or different targets on or in the fetus or embryo.
  • the release profiles for the different active agents can be the same or different.
  • compositions can be administered or otherwise contacted with target cells once, twice, or three time daily; one, two, three, four, five, six, seven times a week, one, two, three, four, five, six, seven or eight times a month.
  • the composition is administered every two or three days, or on average about 2 to about 4 times about week.
  • the methods include contacting a cell with an effective amount of gene editing composition, alone or in combination with a potentiating agent, to modify the cell's genome.
  • the active agent is internalized by the cell. In some embodiments, the active agent need not be internalized. In some embodiments, the active agent serves as a paracrine factor. As discussed in more detail below, the contacting can occur ex vivo or in vivo.
  • the gene editing composition is administered in vivo, or ex vivo edited cells can be administered to a subject in need thereof.
  • the method includes contacting a population of target cells with an effective amount of gene editing composition, preferably in combination with a potentiating agent, to modify the genomes of a sufficient number of cells to achieve a therapeutic result.
  • cells are not administered.
  • the molecules when the gene editing technology is triplex forming molecules, the molecules can be administered in an effective amount to induce formation of a triple helix at the target site.
  • An effective amount of gene editing technology such as triplex-forming molecules may also be an amount effective to increase the rate of recombination of a donor fragment relative to administration of the donor fragment in the absence of the gene editing technology.
  • the formulation is made to suit the mode of administration.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions containing the nucleic acids. The precise dosage will vary according to a variety of factors such as subject-dependent variables (e.g., age, immune system health, clinical symptoms etc.). Exemplary symptoms, pharmacologic, and physiologic effects are discussed in more detail below.
  • a potentiating agent is administered to the subject prior to administration of the gene editing technology to the subject.
  • the potentiating agent can be administered to the subject, for example, 1, 2, 3, 4, 5, 6, 8, 10, 12, 18, or 24 hours, or 1, 2, 3, 4, 5, 6, or 7 days, or any combination thereof prior to administration of the gene editing technology to the subject.
  • a gene editing technology is administered to the subject prior to administration of a potentiating agent to the subject.
  • the gene editing technology can be administered to the subject, for example, 1, 2, 3, 4, 5, 6, 8, 10, 12, 18, or 24 hours, or 1, 2, 3, 4, 5, 6, or 7 days, or any combination thereof prior to administration of the potentiating agent to the subject.
  • compositions are administered in an amount effective to induce gene modification in at least one target allele to occur at frequency of at least 0.1, 0.2. 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25% of target cells.
  • gene modification occurs in at least one target allele at a frequency of about 0.1-25%, or 0.5-25%, or 1-25% 2-25%, or 3-25%, or 4-25% or 5-25% or 6-25%, or 7-25%, or 8-25%, or 9-25%, or 10-25%, 11-25%, or 12-25%, or 13%-25% or 14%-25% or 15-25%, or 2-20%, or 3-20%, or 4-20% or 5-20% or 6-20%, or 7-20%, or 8-20%, or 9-20%, or 10-20%, 11-20%, or 12-20%, or 13%-20% or 14%-20% or 15-20%, 2-15%, or 3-15%, or 4-15% or 5-15% or 6-15%, or 7-15%, or 8-15%, or 9-15%, or 10-15%, 11-15%, or 12-15%, or 13%-15% or 14%-15%.
  • gene modification occurs in at least one target allele at a frequency of about 0.1% to about 10%, or about 0.2% to about 10%, or about 0.3% to about 10%, or about 0.4% to about 10%, or about 0.5% to about 10%, or about 0.6% to about 10%, or about 0.7% to about 10%, or about 0.8% to about 10%, or about 0.9% to about 10%, or about 1.0% to about 10%, or about 1.1% to about 10%, or about 1.1% to about 10%, 1.2% to about 10%, or about 1.3% to about 10%, or about 1.4% to about 10%, or about 1.5% to about 10%, or about 1.6% to about 10%, or about 1.7% to about 10%, or about 1.8% to about 10%, or about 1.9% to about 10%, or about 2.0% to about 10%, or about 2.5% to about 10%, or about 3.0% to about 10%, or about 3.5% to about 10%, or about 4.0% to about 10%, or about 4.5% to about 10%, or about 5.0% to about 10%.
  • gene modification occurs with low off-target effects.
  • off-target modification is undetectable using routine analysis such as those described in the Examples below.
  • off-target incidents occur at a frequency of 0-1%, or 0-0.1%, or 0-0.01%, or 0-0.001%, or 0-0.0001%, or 0-0000.1%, or 0-0.000001%.
  • off-target modification occurs at a frequency that is about 10 2 , 10 3 , 10 4 , or 10 5 -fold lower than at the target site.
  • dosage forms useful in the methods can include doses in the range of about 10 2 to about 10 50 , or about 10 5 to about 10 40 , or about 10 10 to about 10 30 , or about 10 12 to about 10 20 copies of the gene editing technology per dose.
  • about 10 13 , 10 14 , 10 15 , 10 16 , or 10 17 copies of gene editing technology are administered to a subject in need thereof.
  • dosages are expressed in moles.
  • the dose of gene editing technology is about 0.1 nmol to about 100 nmol, or about 0.25 nmol to about 50 nmol, or about 0.5 nmol to about 25 nmol, or about 0.75 nmol to about 7.5 nmol.
  • dosages are expressed in molecules per target cells.
  • the dose of gene editing technology is about 10 2 to about 10 50 , or about 10 5 to about 10 15 , or about 10 7 to about 10 12 , or about 10 8 to about 10 11 copies of the gene editing technology per target cell.
  • dosages are expressed in mg/kg, particularly when the expressed as an in vivo dosage of an active agent such as a growth factors or a gene editing composition packaged in a particle with or without functional molecules.
  • Dosages for active agents can be, for example, between 0.1 mg/kg and about 1,000 mg/kg, or 0.5 mg/kg and about 1,000 mg/kg, or 1 mg/kg and about 1,000 mg/kg, or about 10 mg/kg and about 500 mg/kg, or about 20 mg/kg and about 500 mg/kg per dose, or 20 mg/kg and about 100 mg/kg per dose, or 25 mg/kg and about 75 mg/kg per dose, or about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, or 75 mg/kg per dose.
  • intra-amniotic injections were performed with 20 ⁇ l of 9 mg/ml PNA/DNA nanoparticles, or intravenously with 15 ⁇ l of either 9 mg/ml or 12 mg/ml PNA/DNA NPs, correlating to doses of 300 mg kg ⁇ 1 or 400 mg kg ⁇ 1 , respectively.
  • each fetus received 30 ⁇ L of 20 mg/mL alginate microparticles suspended in PBS.
  • bFGF was diluted to match the expected concentration of bFGF in the Alginate-HSA-bFGF, which was approximately 0.4 ⁇ g/ ⁇ L or 12 ⁇ g per injection.
  • dosages are expressed in mg/ml, particularly when expressed as an ex vivo dosage of active agent such a growth factor or gene editing composition packaged in a particle with or without functional molecules.
  • Dosages can be, for example 0.01 mg/ml to about 100 mg/ml, or about 0.5 mg/ml to about 50 mg/ml, or about 1 mg/ml to about 10 mg/ml per dose to a cell population of 10 6 cells.
  • gene editing technology can be administered without, but is preferably administered with at least one donor oligonucleotide. Such donors can be administered at similar dosages as the gene editing technology.
  • Compositions should include an amount of donor fragment effective to recombine at the target site in the presence of a gene editing technology such as triplex forming molecules.
  • potentiating agents preferably an amount effective to increase gene modification when used in combination with a gene modifying technology, compared to using the gene modifying technology in the absence of the potentiating agent.
  • Exemplary dosages for SCF include, between about 0.01 mg/kg and about 250 mg/kg, or about 0.1 mg/kg and about 100 mg/kg, or about 0.5 mg/kg and about 50 mg/kg, or about 0.75 mg/kg to about 10 mg/kg.
  • the dosage can be selected by the practitioner based on known, preferred humans dosages.
  • the dosage is below the lowest-observed-adverse-effect level (LOAEL), and is preferably a no observed adverse effect level (NOAEL) dosage.
  • LOAEL lowest-observed-adverse-effect level
  • NOAEL no observed adverse effect level
  • Dosage units including an effective amount of the compositions are also provided.
  • the dosage can be lower than the effective dosage of the same composition when administered to treat the fetus after birth, as a child, or as an adult.
  • the dosage can be effective to treat or prevent a disease or disorder in the fetus.
  • compositions can be administered directly to a subject for in vivo gene therapy.
  • compositions are preferably employed for therapeutic uses in combination with a suitable pharmaceutical carrier.
  • suitable pharmaceutical carrier include an effective amount of the composition, and a pharmaceutically acceptable carrier or excipient.
  • nucleotides administered in vivo are taken up and distributed to cells and tissues (Huang, et al., FEBS Lett., 558(1-3):69-73 (2004)).
  • Nyce, et al. have shown that antisense oligodeoxynucleotides (ODNs) when inhaled bind to endogenous surfactant (a lipid produced by lung cells) and are taken up by lung cells without a need for additional carrier lipids (Nyce, et al., Nature, 385:721-725 (1997)).
  • small nucleic acids are readily taken up into T24 bladder carcinoma tissue culture cells (Ma, et al., Antisense Nucleic Acid Drug Dev., 8:415-426 (1998)).
  • compositions including active agents such as triplex-forming molecules, such as TFOs and PNAs, and donor fragments may be in a formulation for administration topically, locally or systemically in a suitable pharmaceutical carrier.
  • active agents such as triplex-forming molecules, such as TFOs and PNAs
  • donor fragments may be in a formulation for administration topically, locally or systemically in a suitable pharmaceutical carrier.
  • Remington's Pharmaceutical Sciences, 15th Edition by E. W. Martin discloses typical carriers and methods of preparation.
  • the compound may also be encapsulated in suitable biocompatible microcapsules, microparticles, nanoparticles, or microspheres formed of biodegradable or non-biodegradable polymers or proteins or liposomes for targeting to cells.
  • biodegradable or non-biodegradable polymers or proteins or liposomes for targeting to cells.
  • Such systems are well known to those skilled in the art and may be optimized for use with the appropriate nucleic acid.
  • nucleic acid delivery systems include the desired nucleic acid, by way of example and not by limitation, in either “naked” form as a “naked” nucleic acid, or formulated in a vehicle suitable for delivery, such as in a complex with a cationic molecule or a liposome forming lipid, or as a component of a vector, or a component of a pharmaceutical composition.
  • the nucleic acid delivery system can be provided to the cell either directly, such as by contacting it with the cell, or indirectly, such as through the action of any biological process.
  • the nucleic acid delivery system can be provided to the cell by endocytosis, receptor targeting, coupling with native or synthetic cell membrane fragments, physical means such as electroporation, combining the nucleic acid delivery system with a polymeric carrier such as a controlled release film or nanoparticle or microparticle, using a vector, injecting the nucleic acid delivery system into a tissue or fluid surrounding the cell, simple diffusion of the nucleic acid delivery system across the cell membrane, or by any active or passive transport mechanism across the cell membrane. Additionally, the nucleic acid delivery system can be provided to the cell using techniques such as antibody-related targeting and antibody-mediated immobilization of a viral vector.
  • Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, or thickeners can be used as desired.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and non-aqueous sterile suspensions, solutions or emulsions that can include suspending agents, solubilizers, thickening agents, dispersing agents, stabilizers, and preservatives.
  • aqueous and non-aqueous, isotonic sterile injection solutions which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient
  • aqueous and non-aqueous sterile suspensions, solutions or emulsions that can include suspending agents, solubilizers, thickening agents, dispersing agents, stabilizers, and preservatives.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, optionally with an added preservative.
  • the compositions may take such forms as sterile aqueous or nonaqueous solutions, suspensions and emulsions, which can be isotonic with the blood of the subject in certain embodiments.
  • nonaqueous solvents are polypropylene glycol, polyethylene glycol, vegetable oil such as olive oil, sesame oil, coconut oil, arachis oil, peanut oil, mineral oil, injectable organic esters such as ethyl oleate, or fixed oils including synthetic mono or di-glycerides.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, 1,3-butandiol, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, and electrolyte replenishers (such as those based on Ringer's dextrose). Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents and inert gases.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil including synthetic mono- or di-glycerides may be employed.
  • fatty acids such as oleic acid may be used in the preparation of injectables.
  • Carrier formulation can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. Those of skill in the art can readily determine the various parameters for preparing and formulating the compositions without resort to undue experimentation.
  • the compositions include pharmaceutically acceptable carriers with formulation ingredients such as salts, carriers, buffering agents, emulsifiers, diluents, excipients, chelating agents, fillers, drying agents, antioxidants, antimicrobials, preservatives, binding agents, bulking agents, silicas, solubilizers, or stabilizers.
  • formulation ingredients such as salts, carriers, buffering agents, emulsifiers, diluents, excipients, chelating agents, fillers, drying agents, antioxidants, antimicrobials, preservatives, binding agents, bulking agents, silicas, solubilizers, or stabilizers.
  • the triplex-forming molecules and/or donor oligonucleotides are conjugated to lipophilic groups like cholesterol and lauric and lithocholic acid derivatives with C32 functionality to improve cellular uptake.
  • cholesterol has been demonstrated to enhance uptake and serum stability of siRNA in vitro (Lorenz, et al., Bioorg. Med.
  • acridine derivatives include acridine derivatives; cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II) and porphyrin-Fe(II); alkylating moieties; nucleases such as alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; radioactive markers; non-radioactive markers; carbohydrates; and polylysine or other polyamines U.S. Pat.
  • No. 6,919,208 to Levy, et al. also describes methods for enhanced delivery.
  • These pharmaceutical formulations may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • the methods typically include in utero administration to an embryo or fetus of an effective amount of gene editing composition.
  • Routes of administration include traditional routes such as to intramuscular, intraperitoneal, spinal canal, lumina, lateral cerebral ventricles, puncture of the fetal heart, placental cord insertion, the intrahepatic umbilical vein, intraplacental, yolk sac vessels, intra-organ (e.g., other organs and tissues, including brain, muscle, heart, etc.) and other disclosed herein and in Waddington, et al., “In Utero gene therapy: current challenges and perspectives,” Molecular Therapy , Volume 11, Issue 5, May 2005, Pages 661-676.
  • the route of administration is via an intravenous or intra-amniotic injection or infusion.
  • the compositions can be administered during in utero surgery.
  • the experiments below show that administration of nanoparticulate compositions to fetal mice results in particle retention within the fetuses with no detectable particle accumulation in the maternal mouse.
  • the methods can used to deliver effective amounts of compositions to the embryo or fetus, or cells thereof, without delivering an effective amount of the composition of the mother of the embryo or fetus, or her cells.
  • the target embryo or fetus is contacted with an effective amount of gene editing composition to alter the genomes of a sufficient number of its cells to reduce or prevent one or more symptoms of a target genetic disease.
  • the amount, route of delivery, or combination thereof may not be effective to alter genome of a sufficient number of her cells to change her phenotype.
  • compositions can be administered by injection or infusion intravascularly into the vitelline vein, or umbilical vein, or an artery such as the vitelline artery of an embryo or fetus.
  • intra-vitelline vein delivery of fluorescent PLGA nanoparticles (NPs) resulted in widespread fetal particle distribution at both E15.5 and E16.5 with the most abundant NP accumulation in the fetal liver. It is believed that the substantial accumulation of NPs in the fetal liver observed occurs because extraembryonic vitelline veins anastomose to form the portal circulation.
  • the same or different compositions can be administered by injection or infusion into the amniotic cavity.
  • the fetus breaths amniotic fluid into and out of the developing lungs, providing the necessary forces to direct lung development and growth.
  • Developing fetuses additionally swallow amniotic fluid, which aids the formation of the gastrointestinal tract.
  • the methods can be carried out at any time it is technically feasible to do so and the method are efficacious.
  • the process of injection can be performed in a manner similar to amniocentesis, during which an ultrasound-guided needle is inserted into the amniotic sac to withdraw a small amount of amniotic fluid for genetic testing.
  • a glass pipette is an exemplary needle-like tool amenable for shape and size modification for piercing through the amniotic membrane via a tiny puncture, and dispensing formulation into the utero.
  • a pulled glass pipette with approximately 60 micron tip, 30 microliters of suspended microparticles are injected into the amniotic space surrounding the rat fetuses. Dimensions of the tool to deliver formulation into the amniotic space are variable depending on the subject.
  • the uterus is then returned to its normal position within the abdomen, and the pregnant dam's abdominal wall is closed.
  • composition can be administered to a fetus, embryo, or to the mother or other subject when the fetus or embryo is about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36 weeks of age.
  • the methods are carried out at a gestational time point during which agents can be safely delivered via the umbilical vessels.
  • in utero administration is carried out on or after the gestational equivalent of E15, E15.5, or E16 of a mouse (e.g., a human or mammal's gestational age equivalent to murine gestational age E15, E15.5, or E16).
  • intraamniotic injection is carried out on or after the gestational equivalent of E16 or E16.5, or on or after fetal breathing and/or swallowing has begun.
  • intraamniotic injection is carried out on or after the gestational equivalent of E14, E15, E16, E17, E18, E19, E20, or E21 of a rat (e.g., a human or other mammal's gestational age equivalent to rat gestational age E14, E15, E16, E17, E18, E19, E20, or E21).
  • a rat e.g., a human or other mammal's gestational age equivalent to rat gestational age E14, E15, E16, E17, E18, E19, E20, or E21.
  • compositions can be administered before damage has occurred or when only limited damage has occurred.
  • the compositions are administered before nerve damage occurs, (e.g., the limbs of the fetus or embryo are still moving).
  • compositions are injected into the organism undergoing genetic manipulation, such as an animal requiring gene therapy.
  • the compositions can be administered by a number of routes including, but not limited to, oral, intravenous, intraperitoneal, intramuscular, transdermal, subcutaneous, topical, sublingual, rectal, intranasal, pulmonary, and other suitable means.
  • the compositions can also be administered via liposomes.
  • Such administration routes and appropriate formulations are generally known to those of skill in the art.
  • Administration of the formulations may be accomplished by any acceptable method which allows the gene editing compositions to reach their targets.
  • any acceptable method known to one of ordinary skill in the art may be used to administer a formulation to the subject.
  • the administration may be localized (i.e., to a particular region, physiological system, tissue, organ, or cell type) or systemic, depending on the condition being treated.
  • Injections can be e.g., intravenous, intradermal, subcutaneous, intramuscular, or intraperitoneal. In some embodiments, the injections can be given at multiple locations. Implantation includes inserting implantable drug delivery systems, e.g., microspheres, hydrogels, polymeric reservoirs, cholesterol matrixes, polymeric systems, e.g., matrix erosion and/or diffusion systems and non-polymeric systems, e.g., compressed, fused, or partially-fused pellets. Inhalation includes administering the composition with an aerosol in an inhaler, either alone or attached to a carrier that can be absorbed. For systemic administration, it may be preferred that the composition is encapsulated in liposomes.
  • implantable drug delivery systems e.g., microspheres, hydrogels, polymeric reservoirs, cholesterol matrixes, polymeric systems, e.g., matrix erosion and/or diffusion systems and non-polymeric systems, e.g., compressed, fused, or partially-fused pellet
  • compositions may be delivered in a manner which enables tissue-specific uptake of the agent and/or nucleotide delivery system.
  • Techniques include using tissue or organ localizing devices, such as wound dressings or transdermal delivery systems, using invasive devices such as vascular or urinary catheters, and using interventional devices such as stents having drug delivery capability and configured as expansive devices or stent grafts.
  • the formulations may be delivered using a bioerodible implant by way of diffusion or by degradation of the polymeric matrix.
  • the administration of the formulation may be designed so as to result in sequential exposures to the composition, over a certain time period, for example, hours, days, weeks, months or years. This may be accomplished, for example, by repeated administrations of a formulation or by a sustained or controlled release delivery system in which the compositions are delivered over a prolonged period without repeated administrations. Administration of the formulations using such a delivery system may be, for example, by oral dosage forms, bolus injections, transdermal patches or subcutaneous implants. Maintaining a substantially constant concentration of the composition may be preferred in some cases.
  • release delivery systems include time-release, delayed release, sustained release, or controlled release delivery systems. Such systems may avoid repeated administrations in many cases, increasing convenience to the subject and the physician.
  • release delivery systems include, for example, polymer-based systems such as polylactic and/or polyglycolic acids, polyanhydrides, polycaprolactones, copolyoxalates, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and/or combinations of these.
  • Microcapsules of the foregoing polymers containing nucleic acids are described in, for example, U.S. Pat. No. 5,075,109.
  • Non-polymer systems that are lipid-based including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di- and triglycerides; hydrogel release systems; liposome-based systems; phospholipid based-systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; or partially fused implants.
  • Specific examples include erosional systems in which the oligonucleotides are contained in a formulation within a matrix (for example, as described in U.S. Pat. Nos.
  • the formulation may be as, for example, microspheres, hydrogels, polymeric reservoirs, cholesterol matrices, or polymeric systems.
  • the system may allow sustained or controlled release of the composition to occur, for example, through control of the diffusion or erosion/degradation rate of the formulation containing the triplex-forming molecules and donor oligonucleotides.
  • a pump-based hardware delivery system may be used to deliver one or more embodiments.
  • Examples of systems in which release occurs in bursts include systems in which the composition is entrapped in liposomes which are encapsulated in a polymer matrix, the liposomes being sensitive to specific stimuli, e.g., temperature, pH, light or a degrading enzyme and systems in which the composition is encapsulated by an ionically-coated microcapsule with a microcapsule core degrading enzyme.
  • Examples of systems in which release of the inhibitor is gradual and continuous include, e.g., erosional systems in which the composition is contained in a form within a matrix and effusional systems in which the composition permeates at a controlled rate, e.g., through a polymer.
  • Such sustained release systems can be in the form of pellets, or capsules.
  • Long-term release implant means that the implant containing the composition is constructed and arranged to deliver therapeutically effective levels of the composition for at least 30 or 45 days, and preferably at least 60 or 90 days, or even longer in some cases.
  • Long-term release implants are well known to those of ordinary skill in the art, and include some of the release systems described above.
  • ex vivo gene therapy of cells is used for the treatment of a subject.
  • cells are isolated, for example from a subject, and contacted ex vivo with the compositions to produce cells containing mutations in or adjacent to genes.
  • the cells are isolated from the subject to be treated or from a syngenic host.
  • Target cells are removed from a subject prior to contacting with a gene editing composition and preferably a potentiating factor.
  • the cells can be hematopoietic progenitor or stem cells.
  • the target cells are CD34 + hematopoietic stem cells.
  • HSCs Hematopoietic stem cells
  • CD34+ cells are multipotent stem cells that give rise to all the blood cell types including erythrocytes. Therefore, CD34+ cells can be isolated from a patient with, for example, thalassemia, sickle cell disease, or a lysosomal storage disease, the mutant gene altered or repaired ex-vivo using the compositions and methods, and the cells reintroduced back into the patient as a treatment or a cure.
  • Stem cells can be isolated and enriched by one of skill in the art. Methods for such isolation and enrichment of CD34 + and other cells are known in the art and disclosed for example in U.S. Pat. Nos. 4,965,204; 4,714,680; 5,061,620; 5,643,741; 5,677,136; 5,716,827; 5,750,397 and 5,759,793.
  • enriched indicates a proportion of a desirable element (e.g. hematopoietic progenitor and stem cells) which is higher than that found in the natural source of the cells.
  • a composition of cells may be enriched over a natural source of the cells by at least one order of magnitude, preferably two or three orders, and more preferably 10, 100, 200 or 1000 orders of magnitude.
  • CD34 + cells can be recovered from cord blood, bone marrow or from blood after cytokine mobilization effected by injecting the donor with hematopoietic growth factors such as granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor (GM-CSF), stem cell factor (SCF) subcutaneously or intravenously in amounts sufficient to cause movement of hematopoietic stem cells from the bone marrow space into the peripheral circulation.
  • G-CSF granulocyte colony stimulating factor
  • GM-CSF granulocyte-monocyte colony stimulating factor
  • SCF stem cell factor
  • bone marrow cells may be obtained from any suitable source of bone marrow, e.g. tibiae, femora, spine, and other bone cavities.
  • an appropriate solution may be used to flush the bone, which solution will be a balanced salt solution, conveniently supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from about 5 to 25 mM.
  • Convenient buffers include Hepes, phosphate buffers, lactate buffers, etc.
  • Cells can be selected by positive and negative selection techniques.
  • Cells can be selected using commercially available antibodies which bind to hematopoietic progenitor or stem cell surface antigens, e.g. CD34, using methods known to those of skill in the art.
  • the antibodies may be conjugated to magnetic beads and immunogenic procedures utilized to recover the desired cell type.
  • Other techniques involve the use of fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • the CD34 antigen which is found on progenitor cells within the hematopoietic system of non-leukemic individuals, is expressed on a population of cells recognized by the monoclonal antibody My-10 (i.e., express the CD34 antigen) and can be used to isolate stem cell for bone marrow transplantation.
  • progenitor or stem cells can be characterized as being any of CD3 ⁇ , CDT, CD8 ⁇ , CD10 ⁇ , CD14 ⁇ , CD15 ⁇ , CD19 ⁇ , CD20 ⁇ , CD33 ⁇ , Class II HLA + and Thy-1 + .
  • progenitor or stem cells may be propagated by growing in any suitable medium.
  • progenitor or stem cells can be grown in conditioned medium from stromal cells, such as those that can be obtained from bone marrow or liver associated with the secretion of factors, or in medium including cell surface factors supporting the proliferation of stem cells.
  • Stromal cells may be freed of hematopoietic cells employing appropriate monoclonal antibodies for removal of the undesired cells.
  • the isolated cells are contacted ex vivo with a combination of triplex-forming molecules and donor oligonucleotides in amounts effective to cause the desired mutations in or adjacent to genes in need of repair or alteration, for example the human beta-globin or ⁇ -L-iduronidase gene. These cells are referred to herein as modified cells.
  • Methods for transfection of cells with oligonucleotides and peptide nucleic acids are well known in the art (Koppelhus, et al., Adv. Drug Deliv. Rev., 55(2): 267-280 (2003)). It may be desirable to synchronize the cells in S-phase to further increase the frequency of gene correction.
  • Methods for synchronizing cultured cells for example, by double thymidine block, are known in the art (Zielke, et al., Methods Cell Biol., 8:107-121 (1974)).
  • the modified cells can be maintained or expanded in culture prior to administration to a subject.
  • Culture conditions are generally known in the art depending on the cell type. Conditions for the maintenance of CD34 + in particular have been well studied, and several suitable methods are available.
  • a common approach to ex vivo multi-potential hematopoietic cell expansion is to culture purified progenitor or stem cells in the presence of early-acting cytokines such as interleukin-3.
  • TPO thrombopoietin
  • SCF stem cell factor
  • Flt-3L flt3 ligand
  • cells can be maintained ex vivo in a nutritive medium (e.g., for minutes, hours, or 3, 6, 9, 13, or more days) including murine prolactin-like protein E (mPLP-E) or murine prolactin-like protein F (mPIP-F; collectively mPLP-E/IF) (U.S. Pat. No. 6,261,841).
  • a nutritive medium e.g., for minutes, hours, or 3, 6, 9, 13, or more days
  • mPLP-E murine prolactin-like protein E
  • mPIP-F murine prolactin-like protein F
  • the modified hematopoietic stem cells are differentiated ex vivo into CD4 + cells culture using specific combinations of interleukins and growth factors prior to administration to a subject using methods well known in the art.
  • the cells may be expanded ex vivo in large numbers, preferably at least a 5-fold, more preferably at least a 10-fold and even more preferably at least a 20-fold expansion of cells compared to the original population of isolated hematopoietic stem cells.
  • cells for ex vivo gene therapy can be dedifferentiated somatic cells.
  • Somatic cells can be reprogrammed to become pluripotent stem-like cells that can be induced to become hematopoietic progenitor cells.
  • the hematopoietic progenitor cells can then be treated with triplex-forming molecules and donor oligonucleotides as described above with respect to CD34 + cells to produce recombinant cells having one or more modified genes.
  • Representative somatic cells that can be reprogrammed include, but are not limited to fibroblasts, adipocytes, and muscles cells.
  • Hematopoietic progenitor cells from induced stem-like cells have been successfully developed in the mouse (Hanna, J. et al. Science, 318:1920-1923 (2007)).
  • somatic cells are harvested from a host.
  • the somatic cells are autologous fibroblasts.
  • the cells are cultured and transduced with vectors encoding Oct4, Sox2, Klf4, and c-Myc transcription factors.
  • the transduced cells are cultured and screened for embryonic stem cell (ES) morphology and ES cell markers including, but not limited to AP, SSEA1, and Nanog.
  • ES embryonic stem cell
  • the transduced ES cells are cultured and induced to produce induced stem-like cells.
  • Cells are then screened for CD41 and c-kit markers (early hematopoietic progenitor markers) as well as markers for myeloid and erythroid differentiation.
  • the modified hematopoietic stem cells or modified induced hematopoietic progenitor cells are then introduced into a subject. Delivery of the cells may be effected using various methods and includes most preferably intravenous administration by infusion as well as direct depot injection into periosteal, bone marrow and/or subcutaneous sites.
  • the subject receiving the modified cells may be treated for bone marrow conditioning to enhance engraftment of the cells.
  • the recipient may be treated to enhance engraftment, using a radiation or chemotherapeutic treatment prior to the administration of the cells.
  • the cells Upon administration, the cells will generally require a period of time to engraft. Achieving significant engraftment of hematopoietic stem or progenitor cells typically takes weeks to months.
  • modified hematopoietic stem cells A high percentage of engraftment of modified hematopoietic stem cells is not envisioned to be necessary to achieve significant prophylactic or therapeutic effect. It is expected that the engrafted cells will expand over time following engraftment to increase the percentage of modified cells. In some embodiments, the modified cells have a corrected ⁇ -L-iduronidase gene. Therefore, in a subject with Hurler syndrome, the modified cells are expected to improve or cure the condition. It is expected that engraftment of only a small number or small percentage of modified hematopoietic stem cells will be required to provide a prophylactic or therapeutic effect.
  • the cells to be administered to a subject will be autologous, e.g. derived from the subject, or syngenic.
  • the method can treat or prevent a disease or disorder in the fetus or embryo.
  • the disease or disorder can be a structural defect or genetic defect.
  • the disease or disorder can be a fetal disease or disorder.
  • Suitable subject include, but are not limited to mammals such as a human or other primate, a rodent such as a mouse or rat, or an agricultural or domesticated animal such as a dog, cat, cow, horse, pig, or sheep.
  • the composition does not enter the mother's bodily fluids or tissues.
  • the mother can genetically related to the fetus or genetically unrelated to the fetus or embryo.
  • the mother can be a surrogate.
  • the fetus or embryo and the mother have the same disease or disorder or be at risk for developing the same disease or disorder.
  • the fetus or embryo can have a disease or disorder or be at risk for developing a disease or disorder that the mother neither has nor has any risk of developing.
  • the formulations can be delivered in a minimally invasive fashion through an intra-amniotic injection or intravenous injection.
  • the methods can be performed throughout gestation.
  • Intra-amniotic injection has an adverse event profile similar to amniocentesis and IA pharmacotherapy.
  • biocompatible micro- and nanoparticle formulation for the controlled delivery of therapeutic, prophylactic, and/or diagnostic agents e.g., drugs, proteins, or DNA editing molecules
  • therapeutic, prophylactic, and/or diagnostic agents e.g., drugs, proteins, or DNA editing molecules
  • diagnostic agents e.g., drugs, proteins, or DNA editing molecules
  • MMC is converted into spina bifida occulta or at least secondary nerve injury is prevented until definitive postnatal repair can be performed.
  • spina bifida occulta is usually asymptomatic, this conversion could effectively be a cure for the devastating sequelae of spina bifida.
  • target diseases and disorders include, but are not limited to, muscular dystrophy, Type 2 diabetes, diseases of the liver such as Wilson's disease and hemochromatosis, or diseases of the central nervous system including Fredrich's ataxia, Huntington's disease, spinal muscular atrophy, tuberous sclerosis.
  • the fetus or embryo is suffering spina bifida, a respiratory defect, or a gastrointestinal defect
  • the methods include administering an effective amount of a therapeutic composition to treat the spina bifida, a respiratory defect, or a gastrointestinal defect.
  • Candidates for in utero gene therapy include diseases corrected by replacement of an inactive or absent protein.
  • Monogenic diseases that pose the risk of serious fetal, neonatal, and pediatric morbidity or mortality are particularly attractive targets for in utero gene editing.
  • Exemplary disease targets include, but are not limited to, cystic fibrosis, Tay-Sachs disease, hematopoietic stem cell disorders (e.g., sickle cell, thalassemia), and others disclosed herein.
  • Attractive targets for in utero gene therapy also include those discussed in Schneider & Coutelle, Nature Medicine, 5, 256-257 (1999), a the Table from which is reproduced below.
  • Cystic fibrosis Bronchial and transmembrane intestinal conductance regulator epithelial cells Ornithine transcarbanylas Ornithine Hepatocytes deficiency transcarbaronylase Glycogen storage ⁇ 1,4-glucosidase muscle cells, disorders: hepatocytes, Pompe disease neurons Sphingolipid storage Glucocerebrosidase Hematopietic disorders: ⁇ -N- stem cells, Gaucher disease acetylhexosaminidase muscle cells, Tay-Sachs disease cerebroxide sulfatase fibroblasts, Metachromatic neurons leucodystrophy ⁇ -L-idoronidase hematopoietic Mucopolysaccharide storage disorders: Horler disease iduronate-2 sulfatase stem cells, Hunter disease ⁇ -glucoronidase fibroblasts, Sky disease
  • Gene therapy is apparent when studied in the context of human genetic diseases, for example, cystic fibrosis, hemophilia, globinopathies such as sickle cell anemia and beta-thalassemia, xeroderma pigmentosum, and lysosomal storage diseases, though the strategies are also useful for treating non-genetic disease such as HIV, in the context of ex vivo-based cell modification and also for in vivo cell modification.
  • the compositions are especially useful to treat genetic deficiencies, disorders and diseases caused by mutations in single genes, for example, to correct genetic deficiencies, disorders and diseases caused by point mutations. If the target gene contains a mutation that is the cause of a genetic disorder, then the compositions can be used for mutagenic repair that may restore the DNA sequence of the target gene to normal.
  • the target sequence can be within the coding DNA sequence of the gene or within an intron.
  • the target sequence can also be within DNA sequences that regulate expression of the target gene, including promoter or enhancer sequences.
  • the oligonucleotide is useful for causing a mutation that inactivates the gene and terminates or reduces the uncontrolled proliferation of the cell.
  • the oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation.
  • the target gene can also be a gene that encodes an immune regulatory factor, such as PD-1, in order to enhance the host's immune response to a cancer.
  • Programmed cell death protein 1 also known as PD-1 and CD279 (cluster of differentiation 279), is a protein encoded by the PDCD1 gene.
  • PD-1 has two ligands: PD-L1 and PD-L2.
  • PD-1 is expressed on a subset of thymocytes and up-regulated on T, B, and myeloid cells after activation (Agata, et al., Int. Immunol., 8:765-772 (1996)).
  • PD-1 acts to antagonize signal transduction downstream of the TCR after it binds a peptide antigen presented by the major histocompatibility complex (MHC).
  • MHC major histocompatibility complex
  • T-cells can function as an immune checkpoint, by preventing the activation of T-cells, which in turn reduces autoimmunity and promotes self-tolerance, but can also reduce the body's ability to combat cancer.
  • compositions are used to treat cancer.
  • the gene modification technology can be designed to reduce or prevent expression of PD-1, and administered in an effective amount to do so.
  • compositions can be used as antiviral agents, for example, when designed to modify a specific a portion of a viral genome necessary for proper proliferation or function of the virus.
  • the fetus or embryo has a genetic mutation that causes hemophilia, a hemoglobinopaty, cystic fibrosis, xeroderma, pigmentosum, or a lysosomal storage disease
  • the methods include administering an effective amount of a gene editing composition to correct to the mutation in the fetus or embryo.
  • any of the triplex-forming molecules herein can have one or more mutations (e.g., substitutions, deletions, or insertions), such that the triplex-forming molecules still bind to the target sequence.
  • triplex-forming molecules herein can be manufactured using canonical nucleic acids or other suitable substitutes including those disclosed herein (e.g., PNAs), without or without any of the base, sugar, or backbone modifications discussed herein or in WO 1996/040271, WO/2010/123983, and U.S. Pat. No. 8,658,608.
  • any of the triplex-forming molecules herein can be peptide nucleic acids.
  • one or more of the cytosines of any of triplex-forming molecules herein is substituted with a pseudoisocytosine.
  • all of the cytosines in the Hoogsteen-binding portion of a triplex forming molecule are substituted with pseudoisocytosine.
  • any of the triplex-forming molecules herein includes one or more of peptide nucleic acid residues substituted with side chain (for example: amino acid side chain or miniPEG side chain) at the alpha, beta and/or gamma position of the backbone.
  • the PNA oligomer can comprise at least one residue comprising a gamma modification/substitution of a backbone carbon atom.
  • all of the peptide nucleic acid residues in the Hoogsteen-binding portion only, the Watson-Crick-binding portion only, or across the entire PNA are substituted with ⁇ PNA residues.
  • alternating residues are PNA and ⁇ PNA in the Hoogsteen-binding portion only, the Watson-Crick-binding portion only, or across the entire PNA are substituted.
  • the modifications are miniPEG ⁇ PNA residues, methyl ⁇ PNA residues, or another ⁇ substitution discussed above.
  • the PNA oligomer includes two or more different modifications of the backbone (e.g. two different types of gamma side chains).
  • residues in the Watson-Crick binding portion are ⁇ PNA residues (e g, miniPEG-containing ⁇ PNA residues); (2) some or all of the residues in the Hoogsteen binding portion are ⁇ PNA residues (e.g., miniPEG-containing ⁇ PNA residues); or (3) some or all of the residues (in the Watson-Crick and/or Hoogsteen binding portions) are ⁇ PNA residues (e.g., miniPEG-containing ⁇ PNA residues).
  • any of the triplex forming molecules herein is a peptide nucleic acid wherein (1) all of the residues in the Watson-Crick binding portion are ⁇ PNA residues (e g, miniPEG-containing ⁇ PNA residues) and none of the residues is in Hoogsteen binding portion are ⁇ PNA residues (e g, miniPEG-containing ⁇ PNA residues); (2) all of the residues in the Hoogsteen binding portion are ⁇ PNA residues (e g, miniPEG-containing ⁇ PNA residues) and none of the residues is in Watson-Crick binding portion are ⁇ PNA residues (e.g., miniPEG-containing ⁇ PNA residues); or (3) all of the residues (in the Watson-Crick and Hoogsteen binding portions) are ⁇ PNA residues (e.g., miniPEG-containing ⁇ PNA residues).
  • the triplex-forming molecules are bis-peptide nucleic acids or tail-clamp PNAs with pseudoisocytosine substituted for one or more cytosines, particularly in the Hoogsteen-binding portion, and wherein some or all of the PNA residues are ⁇ PNA residues.
  • any of the triplex-forming molecules herein can have one or more G-clamp-containing residues.
  • one or more cytosines or variant thereof such as pseudoisocytosine in any of the triplex-forming molecules herein can be substituted or otherwise modified to be a clamp-G (9-(2-guanidinoethoxy) phenoxazine).
  • any of the triplex-forming molecules herein can include a flexible linker, linking, for example, a Hoogsteen-binding domain and a Watson-Crick binding domain to form a bis-PNA or tcPNA.
  • the sequences can be linked with a flexible linker.
  • the flexible linker includes about 1-10, more preferably 2-5, most preferably about 3 units such as 8-amino-2, 6, 10-trioxaoctanoic acid residues.
  • Some molecules include N-terminal or C-terminal non-binding residues, preferably positively charged residues.
  • some molecules include 1-10, preferably 2-5, most preferably about 3 lysines at the N-terminus, the C-terminus, or at both the N-terminus and the C-terminus.
  • J is pseudoisocytosine
  • 0 can be a flexible 8-amino-3,6-dioxaoctanoic acid, 6-aminohexanoic acid, or 8-amino-2, 6, 10-trioxaoctanoic acid moiety
  • K and lys are lysine.
  • PNA sequence are generally presented in N-terminal-to-C-terminal orientation.
  • PNA sequences can be presented in the form: H-“nucleobase sequence”-NH 2 orientation, wherein the H represents the N-terminal hydrogen atom of an unmodified PNA oligomer and the —NH 2 represents the C-terminal amide of the polymer.
  • the Hoosten-binding portion can be oriented up stream (e.g., at the “H” or N-terminal end of the polyamide) of the linker, while the Watson-Crick-binding portion can be oriented downstream (e.g., at the NH 2 (C-terminal) end) of the polymer/linker.
  • any of the donor oligonucleotides can include optional phosphorothiate internucleoside linkages, particular between the two, three or four terminal 5′ and two, three or four terminal 3′ nucleotides.
  • the phosphorothioate internucleotide linkages need not be sequential and can be dispersed within the donor oligonucleotide.
  • the phosphorothioate internucleotide linkages can be oriented primarily near each termini of the donor oligonucleotide.
  • each of the donor oligonucleotide sequences disclosed herein is expressly disclosed without any phosphorothiate internucleoside linkages, and with phosphorothiate internucleoside linkages, preferably between the two, three or four terminal 5′ and two, three or four terminal 3′ nucleotides.
  • globinopathies account for significant morbidity and mortality. Over 1,200 different known genetic mutations affect the DNA sequence of the human alpha-like (HBZ, HBA2, HBA1, and HBQ1) and beta-like (HBE1, HBG1, HBD, and HBB) globin genes. Two of the more prevalent and well-studied globinopathies are sickle cell anemia and ⁇ -thalassemia. Substitution of valine for glutamic acid at position 6 of the ⁇ -globin chain in patients with sickle cell anemia predisposes to hemoglobin polymerization, leading to sickle cell rigidity and vasoocclusion with resulting tissue and organ damage.
  • globinopathies represent the most common single-gene disorders in man.
  • Triplex forming molecules are particularly well suited to treat globinopathies, as they are single gene disorders caused by point mutations.
  • Triplex forming molecules are effective at binding to the human ⁇ -globin both in vitro and in living cells, both ex vivo and in vivo (including by in utero application) in animals.
  • Experimental results demonstrate correction of a thalassemia-associated mutation in vivo in a transgenic mouse carrying a human beta globin gene with the IVS2-654 thalassemia mutation (in place of the endogenous mouse beta globin) with correction of the mutation in 4% of the total bone marrow cells, cure of the anemia with blood hemoglobin levels showing a sustained elevation into the normal range, reversal of extramedullary hematopoiesis and reversal of splenomegaly, and reduction in reticulocyte counts, following systemic administration of PNA and DNA containing nanoparticles.
  • ⁇ -thalassemia is an unstable hemoglobinopathy leading to the precipitation of ⁇ -hemoglobin within RBCs resulting in a severe hemolytic anemia.
  • Patients experience jaundice and splenomegaly, with substantially decreased blood hemoglobin concentrations necessitating repeated transfusions, typically resulting in severe iron overload with time.
  • Cardiac failure due to myocardial siderosis is a major cause of death from (3-thalassemia by the end of the third decade. Reduction of repeated blood transfusions in these patients is therefore of primary importance to improve patient outcomes.
  • GenBank sequence of the chromosome-11 human-native hemoglobin-gene cluster (GenBank: U01317.1—Human beta globin region on chromosome 11—LOCUS HUMHBB, 73308 bp ds-DNA) from base 60001 to base 66060 is presented below.
  • This portion of the GenBank sequence contains the native ⁇ globin gene sequence.
  • intron 2 In sickle cell hemoglobin the adenine base at position 62206 (or position 2206 as listed in SEQ ID NO:13, indicated in bold and heavy underlining) is mutated to a thymine.
  • IVS2 intron 2
  • SEQ ID NO:14 Other common point mutations occur in intron 2 (IVS2), which is highlighted in the sequence below by italics (SEQ ID NO:14) and corresponds with nucleotides 2,632-3,481 of SEQ ID NO:13. Mutations include IVS2-1, IVS2-566, IVS2-654, IVS2-705, and IVS2-745, which are also shown in bold and heavy underlining; numbering relative to the start of intron 2.
  • Target regions can be reference based on the coding strand of genomic DNA, or the complementary non-coding sequence thereto (e.g., the Watson or Crick stand).
  • Exemplary target regions are identified with reference to the coding sequence of the ⁇ globin gene sequence in the sequence below by double underlining and a combination of underlining and double underlining (wherein the underlining is optional additional binding sequence).
  • the complementary target sequence on the reverse non-coding strand is also explicitly disclosed as a triplex forming molecule binding sequence.
  • triplex forming molecules can be designed to bind a target region on either the coding or non-coding strand.
  • triplex-forming molecules such as PNA and tcPNA preferably invade the target duplex, displacement of the polypyrimidine, and induce triplex formation with the displaced polypurine.
  • Gene editing molecules can be designed based on the guidance provided herein and otherwise known in the art. Exemplary triplex forming molecule and donor sequences, are provided in, for example, WO 1996/040271, WO/2010/123983, and U.S. Pat. No. 8,658,608, and in the working Examples below, and can be altered to include one or more of the modifications disclosed herein.
  • Triplex forming molecules can include a sequence substantially complementary to the polypurine strand of the polypyrimidine:polypurine target motif.
  • the triplex forming molecules target a region corresponding to nucleotides 566-577, optionally 566-583 or more of SEQ ID NO:14; a region corresponding to nucleotides 807-813, optionally 807-824 or more of SEQ ID NO:14; or a region corresponding to nucleotides 605-611, optionally 605-621 of SEQ ID NO:14.
  • the triplex-forming molecules can form a triple-stranded molecule with the sequence including GAAAGAAAGAGA (SEQ ID NO:15) or TGCCCTGAAAGAAAGAGA (SEQ ID NO:16) or GGAGAAA (SEQ ID NO:17) or AGAATGGTGCAAAGAGG (SEQ ID NO:18) or AAAAGGG (SEQ ID NO:19) or ACATGATTAGCAAAAGGG (SEQ ID NO:20).
  • the triplex-forming molecule includes the nucleic acid sequence CTTTCTTTCTCT (SEQ ID NO:21), preferably includes the sequence CTTTCTTTCTCT (SEQ ID NO:21) linked to the sequence TCTCTTTCTTTC (SEQ ID NO:22), or more preferably includes the sequence CTTTCTTTCTCT (SEQ ID NO:21) linked to the sequence TCTCTTTCTTTCAGGGCA (SEQ ID NO:23).
  • the triplex-forming molecule includes the nucleic acid sequence TTTCCC (SEQ ID NO:24), preferably includes the sequence TTTCCC (SEQ ID NO:24) linked to the sequence CCCTTTT (SEQ ID NO:25), or more preferably includes the sequence TTTCCC (SEQ ID NO:24) linked to the sequence CCCTTTTGCTAATCATGT (SEQ ID NO:26).
  • the triplex-forming molecule includes the nucleic acid sequence TTTCTCC (SEQ ID NO:27), preferably includes the sequence TTTCTCC (SEQ ID NO:27) linked to the sequence CCTCTTT (SEQ ID NO:28), or more preferably includes the sequence TTTCTCC (SEQ ID NO:27) linked to the sequence CCTCTTTGCACCATTCT (SEQ ID NO:29).
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence JTTTJTTTJTJT (SEQ ID NO:30) linked to the sequence TCTCTTTCTTTC (SEQ ID NO:22) or TCTCTTTCTTTCAGGGCA (SEQ ID NO:23); or
  • a peptide nucleic acid including the sequence TTTTJJJ (SEQ ID NO:31) linked to the sequence CCCTTTT (SEQ ID NO:25) or CCCTTTTGCTAATCATGT (SEQ ID NO:26);
  • TTTJTJJ (SEQ ID NO:32) linked to the sequence CCTCTTT (SEQ ID NO:28) or CCTCTTTGCACCATTCT (SEQ ID NO:29),
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming molecule is a peptide nucleic acid including the sequence lys-lys-lys-JTTTJTTTJTJT-OOO-T T T T T T A G C -lys-lys-lys (SEQ ID NO:33), or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence TJTTTTJTTJ (SEQ ID NO:36) linked to the sequence CTTCTTTTCT (SEQ ID NO:37); or
  • TTJTTJTTTJ (SEQ ID NO:38) linked to the sequence CTTTCTTCTT (SEQ ID NO:39);
  • JJJTJJTTJT (SEQ ID NO:40) linked to the sequence TCTTCCTCCC (SEQ ID NO:41);
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence lys-lys-lys-TJTTTTJTTJ-OOO-C T T T C -lys-lys-lys (SEQ ID NO:42) (IVS2-24); or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • the triplex-forming molecule includes the nucleic acid sequence CCTCTTC (SEQ ID NO:45), preferably includes the sequence CCTCTTC (SEQ ID NO:45) linked to the sequence CTTCTCC (SEQ ID NO:46), or more preferably includes the sequence CCTCTTC (SEQ ID NO:45) linked to the sequence CTTCTCCAAAGGAGT (SEQ ID NO:47) or CTTCTCCACAGGAGTCAG (SEQ ID NO:48) or CTTCTCCACAGGAGTCAGGTGC (SEQ ID NO:205).
  • the triplex-forming molecule includes the nucleic acid sequence TTCCTCT (SEQ ID NO:49), preferably includes the sequence TTCCTCT (SEQ ID NO:49) linked to the sequence TCTCCTT (SEQ ID NO:50), or more preferably includes the sequence TTCCTCT (SEQ ID NO:49) linked to the sequence TCTCCTTAAACCTGT (SEQ ID NO:51) or TCTCCTTAAACCTGTCTT (SEQ ID NO:69).
  • the triplex-forming molecule includes the nucleic acid sequence TCTCTTCT (SEQ ID NO:52), preferably includes the sequence TCTCTTCT (SEQ ID NO:52) linked to the sequence TCTTCTCT (SEQ ID NO:53), or more preferably includes the sequence TCTCTTCT (SEQ ID NO:52) linked to the sequence TCTTCTCTGTCTCCAC (SEQ ID NO:54) or TCTTCTCTGTCTCCACAT (SEQ ID NO:55).
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence JJTJTTJ (SEQ ID NO:56) linked to the sequence CTTCTCC (SEQ ID NO:46) or CTTCTCCAAAGGAGT (SEQ ID NO:47) or CTTCTCCACAGGAGTCAG (SEQ ID NO:48) or CTTCTCCACAGGAGTCAGGTGC (SEQ ID NO:205);
  • TTJJTJT SEQ ID NO:49
  • TCTCCTT SEQ ID NO:50
  • TCTCCTTAAACCTGT SEQ ID NO:51
  • TCTCCTTAAACCTGTCTT SEQ ID NO:69
  • TJTJTTJT SEQ ID NO:52
  • TCTTCTCT SEQ ID NO:53
  • TCTTCTCTGTCTCCAC SEQ ID NO:54
  • TCTTCTCTCTGTCTCCACAT SEQ ID NO:55
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence lys-lys-lys-JJTJTTJ-OOO-C T T C A G A T-lys-lys-lys (SEQ ID NO:66); or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • the triplex forming molecules are used in combination with a donor oligonucleotide for correction of IVS2-654 mutation that includes the sequence 5′AAAGAATAACAGTGATAATTTCTGGGTTAAGG AATAGCAATA TCTCTGCATATAAATAT 3′ (SEQ ID NO:65) with the correcting IVS2-654 nucleotide underlined, or a functional fragment thereof that is suitable and sufficient to correct the IVS2-654 mutation.
  • DonorGFP-IVS2-1 Sense
  • DonorGFP-IVS2-1 Antisense
  • 5′-AAACATCAAGGGTCCCATA GACTCACCTCGCCCTCGCCGGACACGCTGAAC-3′ SEQ ID NO:62
  • a Sickle Cells Disease mutation can be corrected using a donor having the sequence 5′CTTGCCCCACAGGGCAGTAACGGCAGATTTTTC CGG CGTTAAATGCACCATGGTGTCTGTTTGAGGT 3′ (SEQ ID NO:63), or a functional fragment thereof that is suitable and sufficient to correct a mutation, wherein the three boxed nucleotides represent the corrected codon 6 which reverts the mutant Valine (associated with human sickle cell disease) back to the wildtype Glutamic acid and nucleotides in bold font (without underlining) represent changes to the genomic DNA but not to the encoded amino acid; or
  • 5′ACAGACACCATGGTGCACCTGACTCCTG AGGAAGTCT GCCGTTACTGCC 3′ SEQ ID NO:64
  • a functional fragment thereof that is suitable and sufficient to correct a mutation, wherein the bolded and underlined residue is the correction (see, e.g., FIG.
  • Cystic fibrosis is a lethal autosomal recessive disease caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), an ion channel that mediates Cl-transport. Lack of CFTR function results in chronic obstructive lung disease and premature death due to respiratory failure, intestinal obstruction syndromes, exocrine and endocrine pancreatic dysfunction, and infertility (Davis, et al., Pediatr Rev., 22(8):257-64 (2001)).
  • CFTR cystic fibrosis transmembrane conductance regulator
  • CFTR CFTR protein
  • nonsense mutations account for approximately 10% of disease causing mutations.
  • G542X and W1282X are the most common with frequencies of 2.6% and 1.6% respectfully.
  • triplex-forming PNA molecules and donor DNA can be used to correct mutations leading to cystic fibrosis.
  • the compositions are administered by intranasal or pulmonary delivery.
  • the triplex-forming molecules can be administered in utero; for example by amniotic sac injection and/or injection into the vitelline vein.
  • In utero approaches offer several advantages including, for example, the large number of somatic stem cells available for gene correction and a reduced inflammatory response due to the immune-privileged status of the fetus (see, e.g., Larson and Cohen, In Utero Gene Therapy, Ochsner J., 2(2):107-110 (2000)).
  • Other exemplary advantages include stem cells are rapidly dividing, relatively smaller size of the organism compared to mature, adult organisms, a smaller dosage can be effective, therapies can be delivered before or during the pathogenesis of irreversible organ damage, etc.
  • compositions can be administered in an effective amount to induce or enhance gene correction in an amount effective to reduce one or more symptoms of cystic fibrosis.
  • the gene correction occurs at an amount effective to improve impaired response to cyclic AMP stimulation, improve hyperpolarization in response to forskolin, reduction in the large lumen negative nasal potential, reduction in inflammatory cells in the bronchoalveolar lavage (BAL), improve lung histology, or a combination thereof.
  • the target cells are cells, particularly epithelial cells, that make up the sweat glands in the skin, that line passageways inside the lungs, liver, pancreas, or digestive or reproductive systems.
  • the target cells are bronchial epithelial cells.
  • the target cells are lung epithelial progenitor cells. Modification of lung epithelial progenitors can induce more long-term correction of phenotype.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • the triplex-forming molecules are designed to target the CFTR gene at nucleotides 9,152-9,159 (TTTCCTCT (SEQ ID NO:70)) or 9,159-9,168 (TTTCCTCTATGGGTAAG (SEQ ID NO:71) of accession number AH006034.1, or the non-coding strand (e.g., 3′-5′ complementary sequence) corresponding to nucleotides 9,152-9,159 or 9,152-9,168 (e.g., 5′-AGAGGAAA-3′ (SEQ ID NO:72), or 5′-CTTACCCATAGAGGAAA-3′ (SEQ ID NO:73)).
  • the triplex-forming molecules are designed to target the CFTR gene at nucleotides 9,039-9,046 (5′-AGAAGAGG-3′ (SEQ ID NO:74), or 9,030-9,046 (5′-ATGCCAACTAGAAGAGG-3′ (SEQ ID NO:75)) of accession number AH006034.1, or the non-coding strand (e.g., 3′-5′ complementary sequence) corresponding to nucleotides (5′ CCTCTTCT 3′ (SEQ ID NO:76)) or (5′ CCTCTTCTAGTTGGCAT 3′ (SEQ ID NO:77).
  • the triplex-forming molecules are designed to target the CFTR gene at nucleotides 8,665-8,683 (CTTTCCCTT (SEQ ID NO:78)) or 8,665-8,682 (CTTTCCCTTGTATCTTTT (SEQ ID NO:79) of accession number AH006034.1, or the non-coding strand (e.g., 3′-5′ complementary sequence) corresponding to nucleotides 8,665-8,683 or 8,665-8,682 (e.g., 5′-AAGGGAAAG-3′ (SEQ ID NO:80), or 5′-AAAAGATAC AAGGGAAAG-3′ (SEQ ID NO:81)).
  • CTTTCCCTT SEQ ID NO:78
  • CTTCCCTTGTATCTTTTTT accession number AH006034.1
  • the non-coding strand e.g., 3′-5′ complementary sequence
  • nucleotides 8,665-8,683 or 8,665-8,682 e.g., 5′-AAGGGA
  • the triplex-forming molecules are designed to target the W1282X mutation in CFTR gene at the sequence GAAGGAGAAA (SEQ ID NO:163), AAAAGGAA (SEQ ID NO:164), or AGAAAAAAGG (SEQ ID NO:165), or the inverse complement thereof. See FIG. 8C .
  • the triplex-forming molecules are designed to target the G542X mutation in CFTR gene at the sequence AGAAAAA (SEQ ID NO:166), AGAGAAAGA (SEQ ID NO:167), or AAAGAAA (SEQ ID NO:168), or the inverse complement thereof. See FIG. 9C .
  • the triplex-forming molecule includes the nucleic acid sequence includes TCTCCTTT (SEQ ID NO:82), preferably linked to the sequence TTTCCTCT (SEQ ID NO:83) or more preferably includes TCTCCTTT (SEQ ID NO:82) linked to the sequence TTTCCTCTATGGGTAAG (SEQ ID NO:84); or
  • TCTTCTCC (SEQ ID NO:85) preferably linked to the sequence CCTCTTCT (SEQ ID NO:86), or more preferably includes TCTTCTCC (SEQ ID NO:85) linked to CCTCTTCTAGTTGGCAT (SEQ ID NO:87); or
  • TTCCCTTTC (SEQ ID NO:88), preferably includes the sequence TTCCCTTTC (SEQ ID NO:88) linked to the sequence CTTTCCCTT (SEQ ID NO:89), or more preferably includes the sequence TTCCCTTTC (SEQ ID NO:89) linked to the sequence CTTTCCCTTGTATCTTTT (SEQ ID NO:90).
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence TJTJJTTT (SEQ ID NO:91), linked to the sequence TTTCCTCT (SEQ ID NO:83) or TTTCCTCTATGGGTAAG (SEQ ID NO:84); or
  • TJTTJTJJ (SEQ ID NO:91) linked to the sequence CCTCTTCT (SEQ ID NO:86), or CCTCTTCTAGTTGGCAT (SEQ ID NO:87); or
  • TTJJJTTTJ (SEQ ID NO:92) linked to the sequence CTTTCCCTT (SEQ ID NO:89), or CTTTCCCTTGTATCTTTT (SEQ ID NO:90);
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence is lys-lys-lys-TJTJJTTT-OOO-T T C C A G G A G-lys-lys-lys (SEQ ID NO:93) (hCFPNA2); or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • a donor that can be used for CFTR gene correction particularly in combination with the foregoing triplex forming molecules, includes the sequence 5′TTCTGTATCTATATTCATCATAGGAAACACCAAAGATAATGTTCT CCTTAATGGTGCCAGG3′ (SEQ ID NO:96), or a functional fragment thereof that is suitable and sufficient to correct the F508del mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
  • CFTR cystic fibrosis transmembrane conductance regulator
  • the triplex-forming molecule includes the nucleic acid sequence CTTCCTCTTT (SEQ ID NO:97), preferably includes the sequence CTTCCTCTTT (SEQ ID NO:97) linked to the sequence TTTCTCCTTC (SEQ ID NO:98), or more preferably includes the sequence CTTCCTCTTT (SEQ ID NO:97) linked to the sequence TTTCTCCTTCAGTGTTCA (SEQ ID NO:99); or
  • the triplex-forming molecule includes the nucleic acid sequence TTTTCCT (SEQ ID NO:100), preferably includes the sequence TTTTCCT (SEQ ID NO:100) linked to the sequence TCCTTTT (SEQ ID NO:101), or more preferably includes the sequence TTTTCCT (SEQ ID NO:100) linked to the sequence TCCTTTTGCTCACCTGTGGT (SEQ ID NO:102); or
  • the triplex-forming molecule includes the nucleic acid sequence TCTTTTTTCC (SEQ ID NO:103), preferably includes the sequence TCTTTTTTCC (SEQ ID NO:103) linked to the sequence CCTTTTTTCT (SEQ ID NO:104), or more preferably includes the sequence TCTTTTTTCC (SEQ ID NO:103) linked to the sequence CCTTTTTTCTGGCTAAGT (SEQ ID NO:105).
  • the triple forming nucleic acid is a peptide nucleic acid including the sequence
  • JTTJJTJTTT (SEQ ID NO:106) linked to the sequence TTTCTCCTTC (SEQ ID NO:98) or TTTCTCCTTCAGTGTTCA (SEQ ID NO:99); or
  • a peptide nucleic acid including the sequence TTTTJJT (SEQ ID NO:107) linked to the sequence TCCTTTT (SEQ ID NO:101) or linked to the sequence TCCTTTTGCTCACCTGTGGT (SEQ ID NO:102); or
  • a peptide nucleic acid including the sequence TJTTTTTTJJ (SEQ ID NO:108) linked to the sequence CCTTTTTTCT (SEQ ID NO:104) or linked to the sequence CCTTTTTTCTGGCTAAGT (SEQ ID NO:105);
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence lys-lys-lys-JTTJJTJTTT-OOO-T T T C T A T T C -lys-lys-lys (SEQ ID NO:169) (tcPNA-1236); or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • a donor that can be used for CFTR gene correction particularly in combination with the foregoing triplex forming molecules, includes the sequence T(s)C(s)T(s)-TGGGATTCAATAAC TTGCA ACAGTG AGGAA GCCTTTGG G TGATACCACAGG-(s)T(s)G(s) (SEQ ID NO:109) or a functional fragment thereof that is suitable and sufficient to correct a mutation in CFTR, wherein the bolded and underlined nucleotides are inserted mutations for gene correction, and “(s)” indicates an optional phosphorothiate internucleoside linkage. See also, FIGS. 8A-8C , W1282X.
  • the triplex-forming molecule includes the nucleic acid sequence TCTTTTT (SEQ ID NO:110), preferably includes the sequence TCTTTTT (SEQ ID NO:110) linked to the sequence TTTTTCT (SEQ ID NO:111), or more preferably includes the sequence TCTTTTT (SEQ ID NO:110) linked to the sequence TTTTTCTGTAATTTTTAA (SEQ ID NO:112); or
  • the triplex-forming molecule includes the nucleic acid sequence TCTCTTTCT (SEQ ID NO:113), preferably includes the sequence TCTCTTTCT (SEQ ID NO:113) linked to the sequence TCTTTCTCT (SEQ ID NO:114), or more preferably includes the sequence TCTCTTTCT (SEQ ID NO:113) linked to the sequence TCTTTCTCTGCAAACTT (SEQ ID NO:115); or
  • the triplex-forming molecule includes the nucleic acid sequence TTTCTTT (SEQ ID NO:116), preferably includes the sequence TTTCTTT (SEQ ID NO:116) linked to the sequence TTTCTTT (SEQ ID NO:116), or more preferably includes the sequence TTTCTTT (SEQ ID NO:116) linked to the sequence TTTCTTTAAGAACGAGCA (SEQ ID NO:117).
  • the triple forming nucleic acid is a peptide nucleic acid including the sequence TJTTTTT (SEQ ID NO:118) linked to the sequence TTTTTCT (SEQ ID NO:111) or TTTTTCTGTAATTTTTAA (SEQ ID NO:112); or
  • a peptide nucleic acid including the sequence TJTJTTTJT (SEQ ID NO:119) linked to the sequence TCTTTCTCT (SEQ ID NO:114) or linked to the sequence TCTTTCTCTGCAAACTT (SEQ ID NO:115); or
  • a peptide nucleic acid including the sequence TTTJTTT (SEQ ID NO:120) linked to the sequence TTTCTTT (SEQ ID NO:116) or linked to the sequence TTTCTTTAAGAACGAGCA (SEQ ID NO:117);
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence lys-lys-lys-TJTTTTT-OOO-T T T T T A T T A -lys-lys-lys (SEQ ID NO:121) (tcPNA-302); or
  • the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • a donor that can be used for CFTR gene correction particularly in combination with the foregoing triplex forming molecules, includes the sequence T(s)C(s)C(s)-AAGTTTGCAGAGAAAGA AATATAGT CTT GAGAAGG GGAAT CAC CTGAGTGGA-G(s)G(s)T(s) (SEQ ID NO:124), or a functional fragment thereof that is suitable and sufficient to correct a mutation in CFTR, wherein the bolded and underlined nucleotides are inserted mutations for gene correction, and “(s)” indicates an optional phosphorothiate internucleoside linkage. See also, FIGS. 9A-9C , G542X.
  • the gene editing compositions can be used to treat infections, for example those caused by HIV.
  • the target sequence for the triplex-forming molecules is within or adjacent to a human gene that encodes a cell surface receptor for human immunodeficiency virus (HIV).
  • the target sequence of the triplex-forming molecules is within or is adjacent to a portion of a HIV receptor gene important to its function in HIV entry into cells, such as sequences that are involved in efficient expression of the receptor, transport of the receptor to the cell surface, stability of the receptor, viral binding by the receptor, or endocytosis of the receptor.
  • Target sequences can be within the coding DNA sequence of the gene or within introns.
  • Target sequences can also be within DNA sequences that regulate expression of the target gene, including promoter or enhancer sequences.
  • the target sequence can be within or adjacent to any gene encoding a cell surface receptor that facilitates entry of HIV into cells.
  • the molecular mechanism of HIV entry into cells involves specific interactions between the viral envelope glycoproteins (env) and two target cell proteins, CD4 and the chemokine receptors. HIV cell tropism is determined by the specificity of the env for a particular chemokine receptor, a 7 transmembrane-spanning, G protein-coupled receptor (Steinberger, et al., Proc. Natl. Acad. Sci. USA. 97: 805-10 (2000)).
  • CXC chemokine receptors The two major families of chemokine receptors are the CXC chemokine receptors and the CC chemokine receptors (CCR) so named for their binding of CXC and CC chemokines, respectively. While CXC chemokine receptors traditionally have been associated with acute inflammatory responses, the CCRs are mostly expressed on cell types found in connection with chronic inflammation and T-cell-mediated inflammatory reactions: eosinophils, basophils, monocytes, macrophages, dendritic cells, and T cells (Nansen, et al. 2002, Blood 99:4). In one embodiment, the target sequence is within or adjacent to the human genes encoding chemokine receptors, including, but not limited to, CXCR4, CCR5, CCR2b, CCR3, and CCR1.
  • the target sequence is within or adjacent to the human CCR5 gene.
  • the CCR5 chemokine receptor is the major co-receptor for R5-tropic HIV strains, which are responsible for most cases of initial, acute HIV infection. Individuals who possess a homozygous inactivating mutation, referred to as the ⁇ 32 mutation, in the CCR5 gene are almost completely resistant to infection by R5-tropic HIV-1 strains. The ⁇ 32 mutation produces a 32 base pair deletion in the CCR5 coding region.
  • CCR5 Another naturally occurring mutation in the CCR5 gene is the m303 mutation, characterized by an open reading frame single T to A base pair transversion at nucleotide 303 which indicates a cysteine to stop codon change in the first extracellular loop of the chemokine receptor protein at amino acid 101 (C101X) (Carrington et al. 1997). Mutagenesis assays have not detected the expression of the m303 co-receptor on the surface of CCR5 null transfected cells which were found to be non-susceptible to HIV-1 R5-isolates in infection assays (Blanpain, et al. (2000).
  • compositions and methods for targeted gene therapy using triplex-forming oligonucleotides and peptide nucleic acids for treating infectious diseases such as HIV are described in U.S. Application No. 2008/050920 and WO 2011/133803.
  • Each provides sequences of triplex forming molecules, target sequences, and donor oligonucleotides that can be utilized in the compositions and methods provided herein.
  • the gene for human CCR5 is known in the art and is provided at GENBANK accession number NM_000579.
  • the coding region of the human CCR5 gene is provided by nucleotides 358 to 1416 of GENBANK accession number NM_000579.
  • the target region is a polypurine site within or adjacent to a gene encoding a chemokine receptor including CXCR4, CCR5, CCR2b, CCR5, and CCR1.
  • the target region is a polypurine or homopurine site within the coding region of the human CCR5 gene.
  • Three homopurine sites in the coding region of the CCR5 gene that are especially useful as target sites for triplex-forming molecules are from positions 509-518, 679-690 and 900-908 relative to the ATG start codon.
  • the homopurine site from 679-690 partially encompasses the site of the nonsense mutation created by the ⁇ 32 mutation. Triplex-forming molecules that bind to this target site are particularly useful.
  • the triplex-forming molecule includes the nucleic acid sequence CTCTTCTTCT (SEQ ID NO:125), preferably includes the sequence CTCTTCTTCT (SEQ ID NO:125) linked to the sequence TCTTCTTCTC (SEQ ID NO:126), or more preferably includes the sequence CTCTTCTTCT (SEQ ID NO:125) linked to the sequence TCTTCTTCTCATTTC (SEQ ID NO:127).
  • the triplex-forming molecule includes the nucleic acid sequence CTTCT (SEQ ID NO:128), preferably includes the sequence CTTCT (SEQ ID NO:128) linked to the sequence TCTTC (SEQ ID NO:129) or TCTTCTTCTC (SEQ ID NO:130), or more preferably includes the sequence CTTCT (SEQ ID NO:128) linked to the sequence TCTTCTTCTCATTTC (SEQ ID NO:131).
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence JTJTTJTTJT (SEQ ID NO:132) linked to the sequence TCTTCTTCTC (SEQ ID NO:126) or TCTTCTTCTCATTTC (SEQ ID NO:127);
  • JTTJT (SEQ ID NO:133) linked to the sequence TCTTC (SEQ ID NO:129) or TCTTCTTCTC (SEQ ID NO:130) or more preferably TCTTCTTCTCATTTC (SEQ ID NO:131);
  • PNA residues optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid including the sequence Lys-Lys-Lys-JTJTTJTTJT-OOO-T T C T T T A T C-Lys-Lys-Lys (SEQ ID NO:134) (PNA-679);
  • T C-Lys-Lys-Lys (SEQ ID NO:135) (tcPNA-684) optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • the triplex forming molecules are used in combination with one or more donor oligonucleotides such as donor 591 having the sequence: 5′ AT TCC CGA GTA GCA GAT GAC CAT GAC AGC TTA GGG CAG GAC CAG CCC CAA GAT GAC TAT C 3′ (SEQ ID NO:136), or donor 597 having the sequence 5′ TT TAG GAT TCC CGA GTA GCA GAT GAC CCC TCA GAG CAG CGG CAG GAC CAG CCC CAA GAT G 3′ (SEQ ID NO:137), which can be used in combination to induce two different non-sense mutations, one in each allele of the CCR5 gene, in the vicinity of the ⁇ 32 deletion (mutation sites are bolded); or a functional fragment thereof that is suitable and sufficient to introduce a non-sense mutation in at least one allele of the CCR5 gene.
  • donor oligonucleotides such as donor 591 having the sequence: 5′ AT TCC CGA GTA G
  • donor oligonucleotides are designed to span the ⁇ 32 deletion site (see, e.g., FIG. 1 of WO 2011/133803) and induce changes into a wildtype CCR5 allele that mimic the ⁇ 32 deletion.
  • Donor sequences designed to target the ⁇ 32 deletion site may be particularly usefully to facilitate knockout of the single wildtype CCR5 allele in heterozygous cells.
  • Preferred donor sequences designed to target the ⁇ 32 deletion site include, but are not limited to, Donor DELTA32JDC:
  • SEQ ID NO:138, 139, or 140 or a functional fragment of SEQ ID NO:138, 139, or 140 that is suitable and sufficient to introduce mutation CCR5 gene.
  • compositions and methods compositions can also be used to treat lysosomal storage diseases.
  • Lysosomal storage diseases are a group of more than 50 clinically-recognized, rare inherited metabolic disorders that result from defects in lysosomal function (Walkley, J. Inherit. Metab. Dis., 32(2):181-9 (2009)). Lysosomal storage disorders are caused by dysfunction of the cell's lysosome orangelle, which is part of the larger endosomal/lysosomal system. Together with the ubiquitin-proteosomal and autophagosomal systems, the lysosome is essential to substrate degradation and recycling, homeostatic control, and signaling within the cell.
  • Lysosomal dysfunction is usually the result of a deficiency of a single enzyme necessary for the metabolism of lipids, glycoproteins (sugar containing proteins) or mucopolysaccharides (long unbranched polysaccharides consisting of a repeating disaccharide unit; also known as glycosaminoglycans, or GAGs) which are fated for breakdown or recycling.
  • Enzyme deficiency reduces or prevents break down or recycling of the unwanted lipids, glycoproteins, and GAGs, and results in buildup or “storage” of these materials within the cell.
  • Most lysosomal diseases show widespread tissue and organ involvement, with brain, viscera, bone and connective tissues often being affected. More than two-thirds of lysosomal diseases affect the brain. Neurons appear particularly vulnerable to lysosomal dysfunction, exhibiting a range of defects from specific axonal and dendritic abnormalities to neuron death.
  • LSDs occur with incidences of less than 1:100,000, however, as a group the incidence is as high as 1 in 1,500 to 7,000 live births (Staretz-Chacham, et al., Pediatrics, 123(4):1191-207 (2009)). LSDs are typically the result of inborn genetic errors. Most of these disorders are autosomal recessively inherited, however a few are X-linked recessively inherited, such as Fabry disease and Hunter syndrome (MPS II). Affected individuals generally appear normal at birth, however the diseases are progressive. Develop of clinical disease may not occur until years or decades later, but is typically fatal. Lysosomal storage diseases affect mostly children and they often die at a young and unpredictable age, many within a few months or years of birth.
  • Lysosomal storage diseases This makes these types of lysosomal storage diseases attractive for pre-natal intervention. Many other children die of this disease following years of suffering from various symptoms of their particular disorder. Clinical disease may be manifest as mental retardation and/or dementia, sensory loss including blindness or deafness, motor system dysfunction, seizures, sleep and behavioral disturbances, and so forth. Some people with Lysosomal storage disease have enlarged livers (hepatomegaly) and enlarged spleens (splenomegaly), pulmonary and cardiac problems, and bones that grow abnormally.
  • ERT enzyme replacement therapy
  • SRT substrate reduction therapy
  • ERT enzyme replacement therapy
  • SRT substrate reduction therapy
  • ERT enzyme replacement therapy
  • SRT substrate reduction therapy
  • Allogeneic hematopoietic stem cell transplantation (HSCT) represents a highly effective treatment for selected LSDs. It is currently the only means to prevent the progression of associated neurologic sequelae.
  • HSCT is expensive, requires an HLA-matched donor and is associated with significant morbidity and mortality. Recent gene therapy studies suggest that LSDs are good targets for this type of treatment.
  • compositions and methods for targeted gene therapy using triplex-forming oligonucleotides and peptide nucleic acids for treating lysosomal storage diseases are described in WO 2011/133802, which provides sequences of triplex forming molecules, target sequences, and donor oligonucleotides that can be utilized in the compositions and methods provided herein.
  • compositions and methods can be are employed to treat Gaucher's disease (GD).
  • Gaucher's disease also known as Gaucher syndrome, is the most common lysosomal storage disease.
  • Gaucher's disease is an inherited genetic disease in which lipid accumulates in cells and certain organs due to deficiency of the enzyme glucocerebrosidase (also known as acid ⁇ -glucosidase) in lysosomes.
  • Glucocerebrosidase enzyme contributes to the degradation of the fatty substance glucocerebroside (also known as glucosylceramide) by cleaving b-glycoside into b-glucose and ceramide residues (Scriver C R, Beaudet A L, Valle D, Sly W S. The metabolic and molecular basis of inherited disease. 8th ed. New York: McGraw-Hill Pub, 2001: 3635-3668).
  • the enzyme is defective, the substance accumulates, particularly in cells of the mononuclear cell lineage, and organs and tissues including the spleen, liver, kidneys, lungs, brain and bone marrow.
  • non-neuropathic type 1
  • neuropathic type 2 and 3
  • GBA GBA glucosidase, beta, acid
  • GD glucosidase-mediated GD
  • chromosome 1 location 1q21.
  • More than 200 mutations have been defined within the known genomic sequence of this single gene (NCBI Reference Sequence: NG_009783.1).
  • the most commonly observed mutations are N370S, L444P, RecNciI, 84GG, R463C, recTL and 84 GG is a null mutation in which there is no capacity to synthesize enzyme.
  • N370S mutation is almost always related with type 1 disease and milder forms of disease.
  • triplex-forming molecules are used to induce recombination of donor oligonucleotides designed to correct mutations in GBA.
  • compositions and the methods herein are used to treat Fabry disease (also known as Fabry's disease, Anderson-Fabry disease, angiokeratoma corporis diffusum and alpha-galactosidase A deficiency), a rare X-linked recessive disordered, resulting from a deficiency of the enzyme alpha galactosidase A (a-GAL A, encoded by GLA).
  • Fabry disease also known as Fabry's disease, Anderson-Fabry disease, angiokeratoma corporis diffusum and alpha-galactosidase A deficiency
  • a-GAL A encoded by GLA
  • the human gene encoding GLA has a known genomic sequence (NCBI Reference Sequence: NG_007119.1) and is located at Xp22 of the X chromosome.
  • Gb3, GL-3, or ceramide trihexoside glycolipid globotriaosylceramide
  • Gb3, GL-3, or ceramide trihexoside glycolipid globotriaosylceramide
  • the condition affects hemizygous males (i.e. all males), as well as homozygous, and potentially heterozygous (carrier), females. Males typically experience severe symptoms, while women can range from being asymptomatic to having severe symptoms. This variability is thought to be due to X-inactivation patterns during embryonic development of the female.
  • triplex-forming molecules are used to induce recombination of donor oligonucleotides designed to correct mutations in GLA.
  • the compositions and methods are used to treat Hurler syndrome (HS).
  • Hurler syndrome also known as mucopolysaccharidosis type I (MPS I), ⁇ -L-iduronidase deficiency, and Hurler's disease
  • MPS I mucopolysaccharidosis type I
  • ⁇ -L-iduronidase deficiency a genetic disorder that results in the buildup of mucopolysaccharides due to a deficiency of ⁇ -L iduronidase, an enzyme responsible for the degradation of mucopolysaccharides in lysosomes (Dib and Pastories, Genet. Mol. Res., 6(3):667-74 (2007)).
  • MPS I is divided into three subtypes based on severity of symptoms.
  • MPS I H or Hurler syndrome is the most severe of the MPS I subtypes.
  • the other two types are MPS I S or Scheie syndrome and MPS I H-S or Hurler-Scheie syndrome.
  • ⁇ -L-iduronidase heparan sulfate and dermatan sulfate, the main components of connective tissues, build-up in the body.
  • GAGs glycosaminoglycans
  • the human gene encoding alpha-L-iduronidase ( ⁇ -L-iduronidase; IDUA) is found on chromosome 4, location 4p16.3, and has a known genomic sequence ( NCBI Reference Sequence : NG_008103.1).
  • IDUA alpha-L-iduronidase
  • Two of the most common mutations in IDUA contributing to Hurler syndrome are the Q70X and the W420X, non-sense point mutations found in exon 2 (nucleotide 774 of genomic DNA relative to first nucleotide of start codon) and exon 9 (nucleotide 15663 of genomic DNA relative to first nucleotide of start codon) of IDUA respectively. These mutations cause dysfunction alpha-L-iduronidase enzyme.
  • triplex-forming molecule target sequences including a polypurine:polypyrimidine stretches have been identified within the IDUA gene.
  • One target site with the polypurine sequence 5′ CTGCTCGGAAGA 3′ (SEQ ID NO:141) and the complementary polypyrimidine sequence 5′ TCTTCCGAGCAG 3′ (SEQ ID NO:142) is located 170 base pairs downstream of the Q70X mutation.
  • a second target site with the polypurine sequence 5′ CCTTCACCAAGGGGA 3′ (SEQ ID NO:143) and the complementary polypyrimidine sequence 5′ TCCCCTTGGTGAAGG 3′ (SEQ ID NO:144) is located 100 base pairs upstream of the W402X mutation.
  • triplex-forming molecules are designed to bind/hybridize in or near these target locations.
  • a triplex-forming molecule binds to the target sequence upstream of the W402X mutation includes the nucleic acid sequence TTCCCCT (SEQ ID NO:145), preferably includes the sequence TTCCCCT (SEQ ID NO:145) linked to the sequence TCCCCTT (SEQ ID NO:146), or more preferably includes the sequence TTCCCCT (SEQ ID NO:145) linked to the sequence TCCCCTTGGTGAAGG (SEQ ID NO:147).
  • the triplex forming nucleic acid is a peptide nucleic acid that binds to the target sequence upstream of the W402X mutation including the sequence TTJJJJT (SEQ ID NO:148), linked to the sequence TCCCCTT (SEQ ID NO:146) or TCCCCTTGGTGAAGG (SEQ ID NO:147), optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the triplex forming nucleic acid is a peptide nucleic acid having the sequence Lys-Lys-Lys-TTJJJJT-OOO-T C C T G G A G-Lys-Lys-Lys (SEQ ID NO:159) (IDUA402tc715) optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • triplex-forming molecules are administered according to the methods in combination with one or more donor oligonucleotides designed to correct the point mutations at Q70X or W402X mutations sites.
  • the donor oligonuclotides may also contain 7 to 10 additional, synonymous (silent) mutations. The additional silent mutations can facilitate detection of the corrected target sequence using allele-specific PCR of genomic DNA isolated from treated cells.
  • the donor oligonucleotide with the sequence 5′ AGGACGGTCCCGGCCTGCGACACTTCCGCCCATAATTGTTCTTCAT CTGCGGGGCGGGGGGGGG 3′ (SEQ ID NO:149), or a functional fragment thereof that is suitable and sufficient to correct the W402X mutation is administered with triplex-forming molecules designed to target the binding site upstream of W402X to correct the W402X mutation in cells.
  • a triplex-forming molecule that binds to the target sequence downstream of the Q70X mutation includes the nucleic acid sequence CCTTCT (SEQ ID NO:150), preferably includes the sequence CCTTCT (SEQ ID NO:150) linked to the sequence TCTTCC (SEQ ID NO:151), or more preferably includes the sequence CCTTCT (SEQ ID NO:150) linked to the sequence TCTTCCGAGCAG (SEQ ID NO:152).
  • the triplex forming nucleic acid is a peptide nucleic acid that binds to the target sequence downstream of the Q70X mutation including the sequence JJTTJT (SEQ ID NO:153) linked to the sequence TCTTCC (SEQ ID NO:151) or TCTTCCGAGCAG (SEQ ID NO:152) optionally, but preferably wherein one or more of the PNA residues is a ⁇ PNA.
  • the bolded and underlined residues are miniPEG-containing ⁇ PNA.
  • a donor oligonucleotide can have the sequence 5′GGGACGGCGCCCACATAGGCCAAATTCAATTGCTGATCCCAGCT TAAGACGTACTGGTCAGCCTGGC 3′ (SEQ ID NO:154), or a functional fragment thereof that is suitable and sufficient to correct the Q70X mutation is administered with triplex-forming molecules designed to target the binding site downstream of Q70X to correct the of Q70X mutation in cells.
  • Each of the different active agents including components of gene editing and potentiation here can be administered alone or in any combination and further in combination with one or more additional active agents.
  • the combination of agents can be part of the same admixture, or administered as separate compositions.
  • the separate compositions are administered through the same route of administration. In other embodiments, the separate compositions are administered through different routes of administration.
  • Examples of preferred additional active agents include other conventional therapies known in the art for treating the desired disease or condition.
  • the additional therapy may be hydroxurea.
  • the additional therapy may include mucolytics, antibiotics, nutritional agents, etc.
  • Specific drugs are outlined in the Cystic Fibrosis Foundation drug pipeline and include, but are not limited to, CFTR modulators such as KALYDECO® (invascaftor), ORKAMBITM (lumacaftor+ivacaftor), ataluren (PTC124), VX-661+invacaftor, riociguat, QBW251, N91115, and QR-010; agents that improve airway surface liquid such as hypertonic saline, bronchitol, and P-1037; mucus alteration agents such as PULMOZYME® (dornase alfa); anti-inflammatories such as ibuprofen, alpha 1 anti-trypsin, CTX-4430, and JBT-101; anti-infective such as inhaled tobramycin, azithromycin, CAYSTON® (az
  • the additional therapy maybe an antiretroviral agents including, but not limited to, a non-nucleoside reverse transcriptase inhibitor (NNRTIs), a nucleoside reverse transcriptase inhibitor (NRTIs), a protease inhibitors (PIs), a fusion inhibitors, a CCR5 antagonists (CCR5s) (also called entry inhibitors), an integrase strand transfer inhibitors (INSTIs), or a combination thereof.
  • NRTIs non-nucleoside reverse transcriptase inhibitor
  • NRTIs nucleoside reverse transcriptase inhibitor
  • PIs protease inhibitors
  • CCR5s CCR5 antagonists
  • INSTIs integrase strand transfer inhibitors
  • the additional therapy could include, for example, enzyme replacement therapy, bone marrow transplantation, or a combination thereof.
  • compositions can be used in combination with other mutagenic agents.
  • the additional mutagenic agents are conjugated or linked to gene editing technology or a delivery vehicle (such as a nanoparticle or microparticle) thereof.
  • Additional mutagenic agents that can be used in combination with gene editing technology, particularly triplex forming molecules include agents that are capable of directing mutagenesis, nucleic acid crosslinkers, radioactive agents, or alkylating groups, or molecules that can recruit DNA-damaging cellular enzymes.
  • Other suitable mutagenic agents include, but are not limited to, chemical mutagenic agents such as alkylating, bialkylating or intercalating agents.
  • a preferred agent for co-administration is psoralen-linked molecules as described in PCT/US/94/07234 by Yale University.
  • compositions may also be desirable to administer gene editing compositions in combination with agents that further enhance the frequency of gene modification in cells.
  • the compositions can be administered in combination with a histone deacetylase (HDAC) inhibitor, such as suberoylanilide hydroxamic acid (SAHA), which has been found to promote increased levels of gene targeting in asynchronous cells.
  • HDAC histone deacetylase
  • SAHA suberoylanilide hydroxamic acid
  • compositions can be administered in combination with an agent that enhances or increases the nucleotide excision repair pathway, for example an agent that increases the expression, or activity, or localization to the target site, of the endogenous damage recognition factor XPA.
  • an agent that enhances or increases the nucleotide excision repair pathway for example an agent that increases the expression, or activity, or localization to the target site, of the endogenous damage recognition factor XPA.
  • compositions may also be administered in combination with a second active agent that enhances uptake or delivery of the gene editing technology.
  • a second active agent that enhances uptake or delivery of the gene editing technology.
  • the lysosomotropic agent chloroquine has been shown to enhance delivery of PNAs into cells (Abes, et al., J. Controll. Rel., 110:595-604 (2006).
  • Agents that improve the frequency of gene modification are particularly useful for in vitro and ex vivo application, for example ex vivo modification of hematopoietic stem cells for therapeutic use.
  • a useful measure of triple helix formation is the equilibrium dissociation constant, K d , of the triplex, which can be estimated as the concentration of triplex-forming molecules at which triplex formation is half-maximal.
  • the molecules have a binding affinity for the target sequence in the range of physiologic interactions.
  • Preferred triplex-forming molecules have a K d less than or equal to approximately 10 ⁇ 7 M. Most preferably, the K d is less than or equal to 2 ⁇ 10 ⁇ 8 M in order to achieve significant intramolecular interactions.
  • K d was estimated using a gel mobility shift assay (R. H. Durland et al., Biochemistry 30, 9246 (1991)).
  • the dissociation constant (K d ) can be determined as the concentration of triplex-forming molecules in which half was bound to the target sequence and half was unbound.
  • Sequencing and allele-specific PCR are preferred methods for determining if gene modification has occurred.
  • PCR primers are designed to distinguish between the original allele, and the new predicted sequence following recombination.
  • Other methods of determining if a recombination event has occurred are known in the art and may be selected based on the type of modification made.
  • Methods include, but are not limited to, analysis of genomic DNA, for example by sequencing, allele-specific PCR, or restriction endonuclease selective PCR (REMS-PCR); analysis of mRNA transcribed from the target gene for example by Northern blot, in situ hybridization, real-time or quantitative reverse transcriptase (RT) PCT; and analysis of the polypeptide encoded by the target gene, for example, by immunostaining, ELISA, or FACS. In some cases, modified cells will be compared to parental controls. Other methods may include testing for changes in the function of the RNA transcribed by, or the polypeptide encoded by the target gene. For example, if the target gene encodes an enzyme, an assay designed to test enzyme function may be used.
  • the medical kits can include, for example, a dosage supply of gene editing technology or a potentiating agent thereof, or a combination thereof in separately or together in the same admixture.
  • the active agents can be supplied alone (e.g., lyophilized), or in a pharmaceutical composition.
  • the active agents can be in a unit dosage, or in a stock that should be diluted prior to administration.
  • the kit includes a supply of pharmaceutically acceptable carrier.
  • the kit can also include devices for administration of the active agents or compositions, for example, syringes.
  • the kits can include printed instructions for administering the compound in a use as described above.
  • Example 1 Triplex-Forming PNA Design and Nanoparticle Formulation for Gene Editing of a ⁇ -Globin Mutation
  • tcPNA1 H-KKK-JTTTJTTTJTJT-OOO-TCTCTTTCTTTCAGGGCA-KKK-NH 2
  • tcPNA2 H-KKK-TTTTJJJ 000-CCCTTTTGCTAATCATGT-KKK-NH 2
  • tcPNA3 H-KKK-TTTJTJJ 000-CCTCTTTGCACCATTCT-KKK-NH 2
  • ⁇ tcPNA4 H-KKK-JTTTJTTTJTJT-OOO-T T T T T T T T T T A G C -KKK-NH 2 (SEQ ID NO:33) ⁇ tcPNA4-Scr.: H-KKK-TTJTTTJTTJTJ-OOO-C C T T T T T G C G -KKK-NH 2 (SEQ ID NO:158)
  • tcPNA1 and ⁇ tcPNA4 Sequences of tcPNAs and ⁇ tcPNAs used in this study to bind to positions 577 to 595 (tcPNA1 and ⁇ tcPNA4), 611 to 629 (tcPNA2), and 807 to 825 (tcPNA3) in ⁇ -globin intron 2 within the ⁇ -globin/GFP fusion gene and within the human ⁇ -globin gene in the thalassemic mouse model.
  • ⁇ tcPNA4-Scr is a scrambled version of ⁇ tcPNA4 with the same base composition.
  • Bold and underline indicates ⁇ PNA residues. All PNAs have three lysine residues conjugated to each end.
  • J indicates pseudoisocytosine substituted for C to allow pH-independent triplex formation.
  • O represents 8-amino-2,6,10-trioxaoctanoic acid residues that are used to form flexible linkers connecting the Hoogsteen and Watson-Crick binding domains of the tcPNAs.
  • the single-stranded donor DNA oligomer was prepared by standard DNA synthesis except for the inclusion of 3 phosphorothiate internucleoside linkages at each end to protect from nuclease degradation.
  • the sequence of the donor DNA matches positions 624 to 684 in ⁇ -globin intron 2 and is as follows, with the correcting IVS2-654 nucleotide underlined: 5′AAAGAATAACAGTGATAATTTCTGGGTTAAGG AATAGCAATA TCTCTGCATATAAATAT3′ (SEQ ID NO:65).
  • PLGA nanoparticles containing the PNAs and DNAs were formulated using a double-emulsion solvent evaporation method and characterized as previously described (McNeer, et al., Molecular Therapy, 19(1):172-180 (2011), and). Release profiles were analyzed as previously described (McNeer, et al., Mol. Ther., 19:172-180 (2011)).
  • a transgenic mouse model was utilized with a ⁇ -globin/GFP fusion transgene of human ⁇ -globin intron 2 carrying a thalassemia-associated IVS2-654 (C ⁇ T) mutation embedded within the GFP coding sequence, resulting in incorrect splicing of ⁇ -globin/GFP mRNA and lack of GFP expression (Sazani, et al., Nat. Biotechnol., 20:1228-1233 (2002)).
  • C ⁇ T thalassemia-associated IVS2-654
  • PNA-mediated triplex-formation induces DNA repair and recombination of the genomic site with a 60-nucleotide sense donor DNA that is homologous to a portion of the ⁇ -globin intron 2 sequence except for providing a wild-type nucleotide at the IVS2-654 position.
  • the splice-site mutation is corrected and expression of functional GFP occurs ( FIG. 1A ) (McNeer, et al., Gene Therapy, 20:658-669 (2013); Bahal, et al., Curr. Gene Ther., 14:331-342 (2014)).
  • GFP expression provides a direct phenotypic assessment of genome editing frequencies that can be quantified by flow cytometry.
  • tcPNAs were designed to bind to selected polypurine stretches in the ⁇ -globin intron in the vicinity of the IVS2-654 mutation ( FIG. 1B ).
  • Two of the tcPNAs were synthesized to contain partial substitution with a mini-polyethylene-glycol (mini-PEG) group at the ⁇ position ( MP ⁇ PNA) ( FIG. 1C , and sequences above).
  • mini-PEG mini-polyethylene-glycol
  • FIG. 1C and sequences above.
  • Gamma substitutions in PNAs have been shown to enhance strand invasion and DNA binding affinity in the Watson-Crick binding mode due to helical pre-organization enforced by the modification (Bahal, et al., ChemBioChem, 13:56-60 (2012)).
  • ⁇ tcPNA4 matches the sequence of tcPNA1 except that it contains ⁇ units at alternating positions in the Watson-Crick domain (see sequences above). Scrambled ⁇ tcPNA ( ⁇ tcPNA4-Scr) had the same base composition as ⁇ tcPNA4 but a scrambled sequence. All tcPNA oligomers were synthesized with 3 lysines at both termini to improve solubility and increase binding affinity to genomic DNA (see sequences above).
  • Poly(lactic-co-glycolic acid) (PLGA) NPs can effectively deliver PNA/donor DNA combinations into primary human and mouse hematopoietic cells with essentially no toxicity (McNeer, et al., Gene Therapy, 20:658-669 (2013); Schleifman, et al., Mol. Ther.—Nucleic Acids, 2:e135 (2013); McNeer, et al., Mol. Ther., 19:172-180 (2011)).
  • tcPNAs and donor DNAs at a molar ratio of 2:1, were incorporated into PLGA NPs.
  • the NP formulations were evaluated by scanning electron microscopy (SEM) and dynamic light scattering (DLS). All the NPs exhibited sizes within the expected range and showed a uniform charge distribution as calculated from their zeta potential.
  • Bone marrow cells were harvested by flushing of femurs and tibias from ⁇ -globin/GFP transgenic mice with Roswell Park Memorial Institute (RPMI)/10% FBS media. Two mg/ml of nanoparticles were used to treat approximately 300,000-500,000 cells for 48 hr in RPMI/10% FBS media containing glutamine, in triplicate samples. After 48 hr, cells were fixed by using 4% paraformaldehyde, and flow cytometry analyses were performed. Cells treated with blank nanoparticles were included as a control.
  • RPMI Roswell Park Memorial Institute
  • Iscove's Modified Dulbecco's Media (IMDM) media containing insulin (10 ng/ml), FCS (10%) and erythropoietin (1 U/ml) was used to culture CD117+ cells after isolation using magnetic separation.
  • IMDM Iscove's Modified Dulbecco's Media
  • FCS FCS
  • erythropoietin 1 U/ml
  • 3 ⁇ g/ml of SCF Recombinant murine SCF, catalog #250-03, PeproTech, Rocky Hill, N.J.;
  • 2 mg/ml of NPs were used to treat 50,000-100,000 CD117+ cells in triplicate for 48 hrs in the above media, followed by flow cytometry analyses as above.
  • Inhibitors were used at concentrations of 200 nM (dasatinib), 1.0 ⁇ M (MEK162) and 3.0 ⁇ M (BKM120). Dasatanib was obtained from Cayman Chemical (Ann Arbor, Mich.; item #11498) and dissolved according to manufacturer's protocol. MEK162 and BKM120 were obtained from Dr. Harriet Kluger, Yale University.
  • 400,000 bone marrow cells/well were plated on 6-well plates in 1 mL media, then treated with 2 mg/mL of PLGA nanoparticles with or without PNA and donor DNA. After 48 hours, cells were scraped and harvested, and prepared using the Trevigen Comet Assay kit per manufacturer's protocol (Trevigen, Gaithersburg, Md.). Briefly, cells were suspended in agarose, added to comet slides, allowed to set, incubated 1 hr in lysis solution, placed in electrophoresis solution for 30 min, then run at 21 V for 45 min, placed in acetate solution for 30 min, transferred to 70% ethanol solution for 30 min, dried, stained with Sybr Green for 30 min, then visualized using an EVOS microscope. TriTek Comet Score freeware was used to analyze images.
  • Bone marrow cells harvested from ⁇ -globin/GFP transgenic mice were treated ex vivo with PLGA NPs containing tcPNA1/donor DNA, tcPNA2/donor DNA and tcPNA3/donor DNA combinations. After 48 hr, the percentage of GFP+(corrected) cells was quantified via flow cytometry, revealing that tcPNA1/donor DNA, tcPNA2/donor and tcPNA3/donor DNA-containing NPs induced genome modification at frequencies of ⁇ 1.0%, 0.51% and 0.1% respectively ( FIG. 1D ).
  • NPs containing the ⁇ -substituted tcPNA ( ⁇ tcPNA4) and donor DNA yielded significantly higher gene modification (1.62%) ( FIG. 1F ), showing that the MP ⁇ substitutions confer increased biological activity that correlates with their improved binding properties.
  • NPs with the ⁇ -substituted but scrambled sequence ⁇ tcPNA4-Scr produced no modification ( FIG. 1F ).
  • Bone marrow cells treated with either blank NPs or NPs containing ⁇ tcPNA4/donor DNA were plated in methylcellulose medium supplemented with selected cytokines for growth of granulocyte/macrophage colonies (CFU-G, CFU-M and CFU-GM) or combined colonies (CFU-GEMM, granulocyte, erythroid, monocyte/macrophage, megakaryocyte).
  • CFU-G, CFU-M and CFU-GM combined colonies
  • the two sets of treated cells formed myeloid and erythroid colonies at similar frequencies, indicating that treatment with ⁇ tcPNA4 and donor DNA does not impair the ability of the progenitor cells to proliferate and differentiate ( FIG. 1G ).
  • Example 3 Gene Modification is Elevated by ⁇ tcPNAs in CD117+ Hematopoietic Cells
  • BD Bioscience kit catalog #558451 (BDImagTm Hematopoietic Progenitor Stem Cell Enrichment Set—DM) was used to isolate CD117 cells. Enrichment for CD117 was confirmed by flow cytometry. CD117+ enriched cells were labeled with CD117-APC (BD PharmingenTM catalog #558451) antibody. Cells were co-labelled with control IgG antibody (BD PharmingenTM catalog #555746) for gating purposes. To quantify GFP expression, after CD117 co-labelling, flow cytometry was performed using FACScaliburS by resuspending cells in PBS/1% FBS where green fluorescent cells are measured in the Fl1 channel and APC stained cells are in the Fl4 channel. Antibodies for other markers were Ter119 (BD PharmingenTM catalog #561033) and CD45 APC (BD PharmingenTM catalog #561018).
  • CD117 also known as mast/stem cell growth factor receptor or proto-oncogene c-Kit protein
  • CD117 is a receptor tyrosine kinase expressed on the surface of hematopoietic stem and progenitor cells as well as other cell types.
  • Stem cell factor (SCF) the ligand for c-Kit, causes dimerization of the receptor and activates its tyrosine kinase activity to trigger downstream signaling pathways that can impact survival, proliferation, and differentiation.
  • Inhibitors of signaling factors downstream of c-Kit including mitogen/extracellular signal-regulated kinase (MEK) (Binimetinib; MEK162) and phosphatidylinositol-3-kinase (PI3K) (BKM120), also decreased the gene editing frequencies in CD117+ cells to 2.6% and 4.1%, respectively ( FIG. 2D ).
  • MEK mitogen/extracellular signal-regulated kinase
  • PI3K phosphatidylinositol-3-kinase
  • RNA stabilization reagent Qiagen
  • RNA was extracted from the cell pellets using the RNAeasy Mini Plus kit from Qiagen, as per the manufacturer's protocol.
  • the Invitrogen SuperScript III kit was used to generate cDNA from the RNA, as per the manufacturer's protocol, using 500 ng of RNA per reaction.
  • PCR reactions contained cDNA, 20% Betaine, 0.2 mM dNTPS, Advantage 2 Polymerase Mix, 0.2 ⁇ M of each primer, 2% Platinum Taq, and Brilliant SYBR Green. Primers and ROX reference dye were obtained from Stratagene and analysis was conducted using a Mx3000p realtime cycler.
  • Cycler conditions were 94° C. for 2 min, 40 cycles of 94° C. 30 s/50° C. 30 s/72° C. 1 min, then 95° C. 1 min.
  • Relative expression were calculated using the 2 ⁇ Ct method (Ct ⁇ 36) and then normalized.
  • Mouse BRCA2 primers were designed using Primer3 database: BRCA2-3F: 5′ GTTCATAACCGTGGGGCTTA (SEQ ID NO:203) and BRCA2-3R: 5′ TTGGGAAATTTTTAAGGCGA (SEQ ID NO:176).
  • CD117+ and CD117 ⁇ cells were isolated from ⁇ -globin/GFP mice and protein was extracted with Radio-Immunoprecipitation Assay (RIPA) lysis buffer. 50-100 ⁇ g total protein was run on SDS/PAGE gels and transferred to nitrocellulose membranes.
  • Antibodies used were: Anti-BRCA2 (Ab-1) mouse mAb (EMD Millipore, OP95-100 ug) anti-RAD51-antibody (Santa Cruz biotechnology, SC 8349)).
  • I-Sce1 site was cloned 56 amino acids into the firefly luciferase open reading frame under the control of a CMV promoter.
  • the reporter construct also contains a promoterless luciferase gene used as a template for homologous recombination.
  • a double-strand break in the luciferase reporter is created by in vitro digestion with the I-Sce I restriction enzyme (NEB # R0694L). Plasmid DNA was digested with I-Sce 1 for 1 hour at 37° C. at a ratio of 10 units enzyme to 1 ⁇ g DNA and then the enzyme was inactivated at 65° C. for 20 minutes.
  • the linearization of the plasmid was confirmed for each digestion via gel electrophoresis and the linear plasmid was purified using the Qiagen Qiaquick spin columns.
  • cells were transfected using the Lonza 2b Nucleofector Device. 5 ⁇ 10 5 cells were transfected with 1 ⁇ g of either the luciferase reporter vector or a positive control firefly luciferase expression vector, along with 50 ng of a renilla luciferase expression plasmid as a transfection efficiency control. All transfections were performed in triplicate.
  • luciferase activity was measured using the Promega Dual Luciferase Assay Kit. In each sample firefly luciferase activity was normalized to the renilla luciferase transfection control. Reporter reactivation was calculated as a ratio of normalized firefly luciferase activity in the cells transfected with the reporter plasmid to the positive control.
  • a luciferase-based assay was used to quantify repair of DNA double-strand breaks (DSBs) by HDR.
  • DSBs DNA double-strand breaks
  • repair of a DSB in a reporter plasmid via intramolecular homologous recombination creates (“reactivates”) a functional luciferase gene ( FIG. 2H ), and so the assay provides a measure of HDR capacity ( FIG. 2J ).
  • the results show increased luciferase reactivation in CD117+ compared to CD117 ⁇ cells ( FIG. 2H ).
  • Example 7 In Vivo Gene Editing by Intravenous Injections of PNA/DNA NPs is Enhanced by SCF Treatment
  • mice The ⁇ -globin/GFP transgenic mice were obtained from Ryszard Kole, University of North Carolina (Sazani, et al., Nat. Biotechnol., 20:1228-1233 (2002)).
  • SCF 15.6 ug per mouse, Recombinant Mouse SCF, carrier-free, R&D catalog #455-mc-050/CF
  • mice were sacrificed 48 hrs after the NP injections and bone marrow and spleen cells were harvested for further analysis.
  • the bone marrow and spleen cells (500,000 each) were co-labelled with APC conjugated antibodies as described above and flow cytometry was performed as above.
  • CD117+ cells were isolated based on magnetic separation methods according to BD Bioscience protocol (BDImagTm Hematopoietic Progenitor Stem Cell Enrichment Set—DM), and genomic DNA from three mice was pooled followed by sequence analysis as described (McNeer, et al., Gene Therapy, 20:658-669 (2013)).
  • mice The IVS2-654 ⁇ -thalassemic mice were also obtained from Ryszard Kole, University of North Carolina (Svasti, et al., Proc Natl Acad Sci USA, 106:1205-1210 (2009)).
  • SCF 15.6 ug per mouse, Recombinant Mouse SCF, carrier-free, R&D catalog #455-mc-050/CF
  • NPs NPs in 150 ⁇ l PBS delivered via retro-orbital intravenous injection.
  • Each mouse received 4 treatments given at 48 hr intervals.
  • mice were anesthetized with isoflurane followed by retro-orbital bleeding ( ⁇ 100 ⁇ L) using ethylenediaminetetraacetic acid-treated glass capillary tubes.
  • the blood was evacuated into tubes with 5 ⁇ L of 0.5 M EDTA acid in heparinized coated tubes.
  • Complete blood counts were performed using a Hemavet 950FS (Drew Scientific, Oxford, Conn.) according to the manufacturer's protocol. Slides containing blood smears were stained with Wright and Giemsa stain for microscopy. Methylene blue staining was used for reticulocyte counts.
  • Spleen images and weights were taken after selected mice were sacrificed on day 36 after the last treatment. Harvested spleens were fixed in 10% neutral buffered formalin and processed by Yale Pathology Tissue Services for H&E, CD61 and E cadherin staining.
  • mice For assigning animals into treatment groups as listed above, littermate animals were genotyped, and then the pups carrying the required genotypes (either ⁇ -globin/GFP transgenic mice or IVS2-654 ⁇ -thalassemic mice) were randomized into the several treatment groups in cohorts of 3 to 6, as indicated. The investigators were not blinded as to treatment groups.
  • PCR tube consisted of 28.2 ⁇ L dH2O, 5 ⁇ L 10 ⁇ HiFi Buffer, 3 ⁇ L 50 mM MgCl ⁇ 2, 1 ⁇ L DNTP, 1 ⁇ L each of forward and reverse primer, 0.8 ⁇ L High Fidelity Platinum Taq Polymerase (Invitrogen, Carlsbad Calif.) and 10 ⁇ L DNA template.
  • PCR products were prepared by end-repair and adapter ligation according to Illumina protocols (San Diego, Calif.), and samples sequenced by the Illumina HiSeq with 75 paired-end reads at the Yale Center for Genome Analysis. Samples were analyzed as previously described (McNeer, et al., Gene Therapy, 20:658-669 (2013)).
  • Primers for deep sequencing were designed using Primer3 data base.
  • the primers used for ⁇ -globin intron 2 were as follows: forward primer: 5′ TATCATGCCTCTTTGCACCA (SEQ ID NO:179); reverse primer: 5′ AGCAATATGAAACCTCTTACATCA (SEQ ID NO:180).
  • Vascular cell adhesion protein precursor 1 (5′ AGATAATTATTGCCTCCCACTGC (SEQ ID NO:181) and 5′ AATGGAAGGGCATGCAGTCA (SEQ ID NO:182)); Polypyrimidine tract binding protein (5′ CCCAATCCTGAATCCTGGCT (SEQ ID NO:183) and 5′ CATACTGATGTCTGTGGCTTGA (SEQ ID NO:184)); Protocadherin fat 4 precursor (5′ AAGCTCAAACCTACCAGACCA (SEQ ID NO:185) and 5′ AGCTGGAAGCTTCTTCAGTCA (SEQ ID NO:186)); Olfactory receptor 266 (5′ CCCTCTGTGGACTGAGGAAG (SEQ ID NO:187) and 5′ TGATGAGCTACGGGTATGTGA (SEQ ID NO:188)); Syntaxin binding protein (5′ CAAAAAGCCTTAAGCAAACACTC (SEQ ID NO:189) and
  • mice were treated with a single intravenous dose of 4 mg NPs in 150 ⁇ l PBS, and 2 days later the mice were sacrificed for analysis of gene editing in cells from the bone marrow and spleen. Some mice also received murine SCF (15.6 ⁇ g) given by intraperitoneal injection 3 hr prior to the NP injection, as indicated.
  • SCF murine SCF (15.6 ⁇ g) given by intraperitoneal injection 3 hr prior to the NP injection, as indicated.
  • In vivo gene editing was scored by GFP expression in marker-sorted cell populations from bone marrow and spleen ( FIGS. 3A and B). The highest levels of gene editing were seen in CD117+ cells from bone marrow and spleen of the SCF-treated mice, with frequencies in the range of 1% in several mice, and average frequencies in the 0.4% to 0.5% range.
  • Mutation frequencies at these sites were quantified via deep sequencing. Extremely low frequencies of off-target effects were found in the ⁇ tcPNA4/donor DNA treated mice, with six sites showing no detectable sequence changes out of millions of reads and two sites showing modification frequencies of only 0.0074% and 0.00018% compared to 0.56% at the targeted ⁇ -globin site. (Table 4). The overall off-target modification frequency at all seven sites combined was 0.00034%, 1,647-fold lower than the frequency of the targeted gene editing.
  • the top seven gene loci with partial homology to the 18 bp ⁇ tcPNA4 target site in ⁇ -globin intron 2 were identified, with the sequences as indicated.
  • ⁇ -globin/GFP mice were treated with SCF followed by intravenous infusion with NPs containing ⁇ tcPNA4/donor DNA, and genomic DNA from c-Kit+ bone marrow cells was subject to deep sequencing analysis at these loci.
  • the size of the region sequenced around each site is listed, along with the number of alleles sequenced and the number of alleles with modified sequences.
  • Example 8 SCF and PNA NP Treatment can Correct a Genomic Mutation in a Mouse ⁇ -Thalassemia Disease Model
  • a transgenic mouse line was utilized in which the two (cis) murine adult beta globin genes were replaced with a single copy of the human ⁇ -globin gene with the thalassemia-associated IVS2-654 mutation (Svasti, et al., Proc Natl Acad Sci USA, 106:1205-1210 (2009)).
  • mice Homozygous mice do not survive, and heterozygotes have a moderate form of ⁇ -thalassemia, with marked hemolytic anemia, microcytosis, and increased MCHC and red cell distribution width reflecting reduced amounts of mouse ⁇ -globin and no human ⁇ -globin (Lewis, et al., Blood, 91:2152-2156 (1998); Svasti, et al., Proc Natl Acad Sci USA, 106:1205-1210 (2009)). Blood smears from these mice show erythrocyte morphologies consistent with ⁇ -thalassemia.
  • Treatment groups for this experiment included (1) blank NPs; (2) SCF treatment alone (no NPs); (3) SCF plus ⁇ tcPNA4/donor DNA NPs; and (4) SCF plus ⁇ tcPNA4-Scr/donor DNA.
  • SCF injections were given i.p., and NPs were given i.v. via retro-orbital injection.
  • Each treatment group consisted of six mice, and each mouse received four treatments at two-day intervals.
  • Treatment with ⁇ tcPNA4/donor DNA and SCF ameliorates the poikilocytosis and yields a reduction in anisocytosis, ovalocytosis, and target cells indicative of reduced alpha-globin precipitation in the RBCs.
  • CBC analyses performed on blood samples taken at 30, 45, 60, and 75 days post-treatment from mice in each group showed persistent correction of the anemia in the mice treated with SCF plus the ⁇ tcPNA4/donor DNA NPs ( FIG. 4A-4C ), with elevation of the blood hemoglobin levels into the normal range. Only the SCF plus ⁇ tcPNA4/donor DNA-treated mice achieved and maintained hemoglobin levels within the normal range during the duration of the experiment, reflecting the increased hemoglobin stability conferred by the gene editing.
  • mice treated with SCF plus the ⁇ tcPNA4/donor DNA NPs but not in the mice treated with blank NPs FIG. 4D ).
  • Deep sequencing analyses were performed on genomic DNA extracted from bone marrow cells of three mice from each group that were sacrificed on day 36 post-treatment. Correction of the targeted mutation was seen at a frequency of almost 4% in the ⁇ tcPNA4/donor DNA treated group ( FIG. 4E ), whereas no correction was seen in the mice treated with blank NPs.
  • the ⁇ tcPNA4/donor DNA treated mice also showed reduced splenomegaly at 36 days post-treatment.
  • mice sacrificed on day 36 showed substantially improved splenic architecture specifically in the ⁇ tcPNA4/donor DNA treated mice.
  • the regular splenic histologic pattern of white pulp (lymphoid follicles) surrounded by rims of red pulp as seen in the wild-type spleen is disrupted in the ⁇ -thalassemic animals (blank NPs, SCF alone, SCF plus scrambled ⁇ tcPNA4-Scr/donor DNA NPs) due to extramedullary hematopoiesis, which results in an expansion in the red pulp (causing the splenomegaly) and disruption of the white pulp.
  • the CD61 and Ecad immunohistochemical stains highlight the increased cellularity characteristic of extramedullary hematopoiesis and demonstrate that the expanded red pulp in the (3-thalassemic animals includes elevated numbers of megakaryocytes and erythroid precursors, respectively. This increased cellularity is substantially ameliorated in the ⁇ tcPNA4/donor DNA treated mice.
  • Deep-sequencing was also used to assess off-target effects in the bone marrow of the in vivo treated thalassemic mice.
  • seven off-target sites with partial homology to the binding site of ⁇ tcPNA4 in the ⁇ -globin gene were analyzed. Only extremely low frequencies of off-target effects were found in the ⁇ tcPNA4/donor DNA-treated thalassemic mice (Table 5), similar to the results in the ⁇ -globin/GFP transgenic mice (Table 4).
  • the overall off-target modification frequency in this case was 0.0032%, 1,218-fold lower than the frequency of ⁇ -globin gene editing.
  • the top seven gene loci with partial homology to the 18 bp ⁇ tcPNA4 target site in ⁇ -globin intron 2 were identified, with the sequences as indicated.
  • Thalassemic mice were treated with SCF followed by intravenous infusion with NPs containing ⁇ tcPNA4/donor DNA, and genomic DNA from c-Kit+ bone marrow cells was subject to deep sequencing analysis at these loci.
  • the size of the region sequenced around each site is listed, along with the number of alleles sequenced and the number of alleles with modified sequences.
  • Another advance is the finding that the SCF/c-Kit pathway promotes increased gene editing by triplex-forming PNAs and donor DNAs.
  • the gene editing frequency in c-Kit+ cells was as high as 8%.
  • the combination of SCF treatment with the ⁇ PNAs yielded even higher frequencies in the c-Kit+ cells, with just over 15% in a single treatment.
  • CD117 is the product of the c-Kit gene and is a receptor tyrosine kinase that mediates downstream signalling to multiple cellular pathways. The results discussed above indicate that activation of this pathway promotes gene editing, rather than CD117 simply being a marker for the phenotype. Inhibition of the c-Kit kinase with dasatinib reduces the frequency by almost 4-fold, whereas treatment with SCF almost doubles the frequency.
  • CD117+ bone marrow cells in comparison to CD117 ⁇ cells, have elevated levels of expression of numerous DNA repair genes, including factors in the HDR pathway that prior work has shown is required for triplex-induced gene editing (Vasquez, et al., Science, 290:530-533 (2000); Rogers, et al., Proc. Natl. Acad. Sci. USA, 99:16695-16700 (2002); Datta, et al., J Biol Chem, 276:18018-18023 (2001); Vasquez, et al., Proc Natl Acad Sci USA, 99:5848-5853 (2002)).
  • SCF triplex-induced gene editing
  • results show that the elevated expression of DNA repair genes in CD117+ cells is associated with functionally increased HDR activity using an assay for recombination between reporter gene constructs.
  • Treatment of the CD117+ cells with SCF produced a further 2-fold increase in HDR, whereas dasatinib and the other inhibitors yielded reductions in HDR activity.
  • the 4% frequency of bone marrow gene editing achieved in the thalassemic mice was sufficient to achieve a clear improvement in phenotype, with blood hemoglobin levels rising into the normal range, suppression of the reticulocytosis, and reduction in the splenomegaly that is otherwise associated with extramedullary hematopoiesis.
  • SCF stimulates gene editing identifies SCF as a pharmacologic means to boost gene editing, a strategy that should be applicable not just to PNA-mediated gene editing as well as other methods, such as CRISPR/Cas9, SFHR, or ZFNs.
  • CRISPR/Cas9 CRISPR/Cas9
  • SFHR CRISPR/Cas9
  • ZFNs CRISPR/Cas9
  • ZFNs CRISPR/Cas9
  • Skin fibroblasts were isolated from the ⁇ -globin/GFP mice (intron 2 of human ⁇ -globin inserted with in the GFP coding regions) and grown in culture in DMEM medium plus 10% FCS.
  • the intron contains the IVS2-654 (C->T) mutation.
  • the gene correction assay is illustrated in FIG. 5A .
  • the fibroblasts were treated ex vivo with nanoparticles containing tcPNA1+Donor DNA and 72 hours later flow cytometry analysis was performed to quantify the % gene correction based on the frequency of GFP positive cells. In some cases, DNA repair inhibitors or other small molecule inhibitors were given 48 hours before the nanoparticle treatment.
  • Inhibition of CHK1 substantially boosts gene editing in GFP/beta globin gene correction assay.
  • Inhibition of DNA polymerase alpha (by aphidicolin) or of polyADP ribose polymerase by AZD-2281 (olaparib) also boosts gene editing.
  • the results are presented in FIG. 5C .
  • Example 11 Nanoparticle Delivered tcPNA and Donor Oligonucleotide Correct a Sickle Cell Mutation In Vivo
  • SCD-tcPNA 1 (SEQ ID NO: 59) H-KKK-JJTJTTJ-OOO-CTTCTCCACAGGAGTCAG-KKK-NH 2
  • SCD-tcPNA 2 (SEQ ID NO: 162) H-KKK-TTJJTJT-OOO-TCTCCTTAAACCTGTCTT-KKK-NH 2
  • SCD-tcPNA 3 (SEQ ID NO: 60) H-KKK-TJTJTTJT-OOO-TCTTCTCTGTCTCCACAT-KKK-NH 2 .
  • K indicates lysine
  • J pseudoisocytosine (for C) for pH-independent triplex formation.
  • O 8-amino-2,6,10-trioxaoctanoic acid linkers connecting the Hoogsteen and Watson-Crick domains of the tcPNAs.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Physics & Mathematics (AREA)
  • Biomedical Technology (AREA)
  • Nanotechnology (AREA)
  • Optics & Photonics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Reproductive Health (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Pulmonology (AREA)
  • Urology & Nephrology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Dermatology (AREA)
  • Obesity (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Biochemistry (AREA)
  • Emergency Medicine (AREA)
  • Neurology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
US16/603,152 2017-04-04 2018-04-04 Compositions and methods for in utero delivery Abandoned US20200113821A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US16/603,152 US20200113821A1 (en) 2017-04-04 2018-04-04 Compositions and methods for in utero delivery

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US201762481562P 2017-04-04 2017-04-04
US201762489377P 2017-04-24 2017-04-24
US201762589275P 2017-11-21 2017-11-21
PCT/US2018/026116 WO2018187493A1 (fr) 2017-04-04 2018-04-04 Compositions et procédés d'administration in utero
US16/603,152 US20200113821A1 (en) 2017-04-04 2018-04-04 Compositions and methods for in utero delivery

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2018/026116 A-371-Of-International WO2018187493A1 (fr) 2017-04-04 2018-04-04 Compositions et procédés d'administration in utero

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/397,091 Continuation US20240207172A1 (en) 2017-04-04 2023-12-27 Compositions and methods for in utero delivery

Publications (1)

Publication Number Publication Date
US20200113821A1 true US20200113821A1 (en) 2020-04-16

Family

ID=62067803

Family Applications (2)

Application Number Title Priority Date Filing Date
US16/603,152 Abandoned US20200113821A1 (en) 2017-04-04 2018-04-04 Compositions and methods for in utero delivery
US18/397,091 Pending US20240207172A1 (en) 2017-04-04 2023-12-27 Compositions and methods for in utero delivery

Family Applications After (1)

Application Number Title Priority Date Filing Date
US18/397,091 Pending US20240207172A1 (en) 2017-04-04 2023-12-27 Compositions and methods for in utero delivery

Country Status (2)

Country Link
US (2) US20200113821A1 (fr)
WO (1) WO2018187493A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11136597B2 (en) 2016-02-16 2021-10-05 Yale University Compositions for enhancing targeted gene editing and methods of use thereof
CN114832114A (zh) * 2022-05-06 2022-08-02 黑龙江中医药大学 Atra-pbae前药共聚物及其制备方法和应用
US11654410B2 (en) 2019-05-16 2023-05-23 Gem Innov Method for preparing biodegradable microcapsules and microcapsules thus obtained
WO2023220358A3 (fr) * 2022-05-12 2024-02-29 The Research Institute At Nationwide Children's Hospital Procédé de ciblage de gène utilisant une vésicule de membrane externe

Families Citing this family (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20210189431A1 (en) * 2018-08-10 2021-06-24 Yale University Compositions and methods for embryonic gene editing in vitro
US20210340280A1 (en) 2018-08-31 2021-11-04 Yale University Compositions and methods for enhancing donor oligonucleotide-based gene editing
US20210338815A1 (en) 2018-08-31 2021-11-04 Yale University Compositions and methods for enhancing triplex and nuclease-based gene editing
US20220372474A1 (en) 2019-06-21 2022-11-24 Yale University Hydroxymethyl-modified gamma-pna compositions and methods of use thereof
US20220243211A1 (en) 2019-06-21 2022-08-04 Yale University Peptide nucleic acid compositions with modified hoogsteen binding segments and methods of use thereof
WO2021022161A1 (fr) * 2019-07-31 2021-02-04 Yale University Compositions et méthodes de traitement de la drépanocytose
AU2020336992A1 (en) 2019-08-30 2022-04-14 Yale University Compositions and methods for delivery of nucleic acids to cells
US20220339294A1 (en) 2019-09-09 2022-10-27 Yale University Nanoparticles for selective tissue or cellular uptake
CN116529266A (zh) 2020-08-31 2023-08-01 耶鲁大学 用于将核酸递送到细胞的组合物和方法
WO2024055034A1 (fr) 2022-09-09 2024-03-14 Yale University Anticorps ciblant la protéolyse et leurs procédés d'utilisation
WO2024081736A2 (fr) 2022-10-11 2024-04-18 Yale University Compositions et procédés d'utilisation d'anticorps de pénétration cellulaire
WO2024196702A1 (fr) 2023-03-21 2024-09-26 Yale University Polymères d'éthylène brassylate-co-dioxanone et leurs utilisations

Family Cites Families (89)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB929406A (en) 1958-12-22 1963-06-19 Upjohn Co A process for the production of encapsulated material
GB929401A (en) 1958-12-22 1963-06-19 Upjohn Co Encapsulated emulsions and processes for their preparation
GB969808A (en) 1962-06-08 1964-09-16 Boots Pure Drug Co Ltd Anthelmintic compositions and compounds
US3854480A (en) 1969-04-01 1974-12-17 Alza Corp Drug-delivery system
US3832253A (en) 1973-03-21 1974-08-27 Baxter Laboratories Inc Method of making an inflatable balloon catheter
IT1148784B (it) 1980-04-09 1986-12-03 Eurand Spa Procedimento per la preparazione di microcapsule in un veicolo liquido
US4675189A (en) 1980-11-18 1987-06-23 Syntex (U.S.A.) Inc. Microencapsulation of water soluble active polypeptides
US4452775A (en) 1982-12-03 1984-06-05 Syntex (U.S.A.) Inc. Cholesterol matrix delivery system for sustained release of macromolecules
CA1200416A (fr) 1983-05-13 1986-02-11 Societe Des Produits Nestle S.A. Procede de production de produit alimentaire
US4965204A (en) 1984-02-06 1990-10-23 The Johns Hopkins University Human stem cells and monoclonal antibodies
US4714680B1 (en) 1984-02-06 1995-06-27 Univ Johns Hopkins Human stem cells
US4794000A (en) 1987-01-08 1988-12-27 Synthetic Blood Corporation Coacervate-based oral delivery system for medically useful compositions
US5034506A (en) 1985-03-15 1991-07-23 Anti-Gene Development Group Uncharged morpholino-based polymers having achiral intersubunit linkages
US4667013A (en) 1986-05-02 1987-05-19 Union Carbide Corporation Process for alkylene oxide polymerization
US5075109A (en) 1986-10-24 1991-12-24 Southern Research Institute Method of potentiating an immune response
US5422251A (en) 1986-11-26 1995-06-06 Princeton University Triple-stranded nucleic acids
FR2608988B1 (fr) 1986-12-31 1991-01-11 Centre Nat Rech Scient Procede de preparation de systemes colloidaux dispersibles d'une substance, sous forme de nanoparticules
US5601835A (en) 1987-04-29 1997-02-11 Massachusetts Institute Of Technology Polymeric device for controlled drug delivery to the CNS
US5114719A (en) 1987-04-29 1992-05-19 Sabel Bernhard A Extended drug delivery of small, water-soluble molecules
US4883666A (en) 1987-04-29 1989-11-28 Massachusetts Institute Of Technology Controlled drug delivery system for treatment of neural disorders
US5133974A (en) 1989-05-05 1992-07-28 Kv Pharmaceutical Company Extended release pharmaceutical formulations
US5061620A (en) 1990-03-30 1991-10-29 Systemix, Inc. Human hematopoietic stem cell
JPH04167172A (ja) 1990-10-31 1992-06-15 Nec Corp ベクトルプロセッサ
US5714331A (en) 1991-05-24 1998-02-03 Buchardt, Deceased; Ole Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility
US6441130B1 (en) 1991-05-24 2002-08-27 Isis Pharmaceuticals, Inc. Linked peptide nucleic acids
US5539082A (en) 1993-04-26 1996-07-23 Nielsen; Peter E. Peptide nucleic acids
US5407686A (en) 1991-11-27 1995-04-18 Sidmak Laboratories, Inc. Sustained release composition for oral administration of active ingredient
GB9126677D0 (en) 1991-12-16 1992-02-12 Johnson Matthey Plc Improvements in chemical compounds
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5962426A (en) 1993-06-25 1999-10-05 Yale University Triple-helix forming oligonucleotides for targeted mutagenesis
AU691194B2 (en) 1993-06-25 1998-05-14 Yale University Chemically modified oligonucleotide for site-directed mutagenesis
US5527675A (en) 1993-08-20 1996-06-18 Millipore Corporation Method for degradation and sequencing of polymers which sequentially eliminate terminal residues
DE4331012A1 (de) 1993-09-13 1995-03-16 Bayer Ag Nukleinsäuren-bindende Oligomere mit N-Verzweigung für Therapie und Diagnostik
US5409813A (en) 1993-09-30 1995-04-25 Systemix, Inc. Method for mammalian cell separation from a mixture of cell populations
GB9400411D0 (en) 1994-01-11 1994-03-09 Johnson Matthey Plc Improvements in chemical compounds
US5677136A (en) 1994-11-14 1997-10-14 Systemix, Inc. Methods of obtaining compositions enriched for hematopoietic stem cells, compositions derived therefrom and methods of use thereof
AU6043296A (en) 1995-06-06 1996-12-24 Yale University Chemically modified oligonucleotide for site-directed mutage nesis
WO1996040271A1 (fr) 1995-06-07 1996-12-19 Yale University Traitement des hemoglobinopathies
US7279463B2 (en) 1995-06-07 2007-10-09 Yale University Triple-helix forming oligonucleotides for targeted mutagenesis
US5736152A (en) 1995-10-27 1998-04-07 Atrix Laboratories, Inc. Non-polymeric sustained release delivery system
US5945337A (en) 1996-10-18 1999-08-31 Quality Biological, Inc. Method for culturing CD34+ cells in a serum-free medium
US5786571A (en) 1997-05-09 1998-07-28 Lexmark International, Inc. Wrapped temperature sensing assembly
GB9710807D0 (en) 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
GB9710809D0 (en) 1997-05-23 1997-07-23 Medical Res Council Nucleic acid binding proteins
US6326479B1 (en) 1998-01-27 2001-12-04 Boston Probes, Inc. Synthetic polymers and methods, kits or compositions for modulating the solubility of same
US6509323B1 (en) 1998-07-01 2003-01-21 California Institute Of Technology Linear cyclodextrin copolymers
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
WO2001000788A2 (fr) 1999-06-25 2001-01-04 Northwestern University Compositions, kits et methodes de modulation de survie et de differentiation de cellules precurseurs hematopoietiques multi-potentiel
US6919208B2 (en) 2000-05-22 2005-07-19 The Children's Hospital Of Philadelphia Methods and compositions for enhancing the delivery of a nucleic acid to a cell
AU7814301A (en) 2000-08-02 2002-02-13 Slil Biomedical Corp Cyclic polyamine compounds for cancer therapy
US7067617B2 (en) 2001-02-21 2006-06-27 The Scripps Research Institute Zinc finger binding domains for nucleotide sequence ANN
US20040197892A1 (en) 2001-04-04 2004-10-07 Michael Moore Composition binding polypeptides
JP2005500061A (ja) 2001-08-20 2005-01-06 ザ スクリップス リサーチ インスティテュート Ｃｎｎについての亜鉛フィンガー結合ドメイン
AU2002363997A1 (en) 2001-12-14 2003-06-30 Yale University Intracellular generation of single-stranded dna
WO2006080951A2 (fr) 2004-07-01 2006-08-03 Yale University Materiaux polymeres charges de medicaments cibles a forte densite
US8658608B2 (en) 2005-11-23 2014-02-25 Yale University Modified triple-helix forming oligonucleotides for targeted mutagenesis
WO2007062422A2 (fr) 2005-11-28 2007-05-31 The Scripps Research Institute Domaines liant des doigts de zinc pour le triplet tnn
WO2007081647A2 (fr) 2006-01-03 2007-07-19 The Scripps Research Institute Domaines à doigts de zinc se liant spécifiquement à l'agc
JP2008053276A (ja) 2006-08-22 2008-03-06 Nec Electronics Corp 半導体装置の製造方法
JP2010515464A (ja) 2007-01-11 2010-05-13 イエール・ユニバーシテイ Ｈｉｖ細胞表面受容体の標的化不活性化のための組成物および方法
US10265407B2 (en) 2007-02-15 2019-04-23 Yale University Modular nanodevices for smart adaptable vaccines
WO2008115641A2 (fr) 2007-02-15 2008-09-25 Yale University Nanodispositifs modulaires pour des vaccins adaptables intelligents
US20100151436A1 (en) 2007-03-02 2010-06-17 Fong Peter M Methods for Ex Vivo Administration of Drugs to Grafts Using Polymeric Nanoparticles
WO2009114614A2 (fr) 2008-03-11 2009-09-17 Yale University Compositions et procédés pour une administration contrôlée d'acides ribonucléiques inhibiteurs
US8309356B2 (en) 2009-04-01 2012-11-13 Yale University Pseudocomplementary oligonucleotides for targeted gene therapy
WO2010123983A1 (fr) 2009-04-21 2010-10-28 Yale University Compositions et procédés de thérapie génique ciblée
US9136352B2 (en) 2009-07-31 2015-09-15 Fuji Electric Co., Ltd. Manufacturing method of semiconductor apparatus and semiconductor apparatus
US20110268810A1 (en) 2009-11-02 2011-11-03 Yale University Polymeric materials loaded with mutagenic and recombinagenic nucleic acids
US8586363B2 (en) 2009-12-10 2013-11-19 Regents Of The University Of Minnesota TAL effector-mediated DNA modification
US20110293585A1 (en) 2010-04-21 2011-12-01 Helix Therapeutics, Inc. Compositions and methods for treatment of lysosomal storage disorders
WO2011133803A1 (fr) 2010-04-21 2011-10-27 Helix Therapeutics, Inc. Compositions et méthodes d'inactivation ciblée de récepteurs de surface cellulaire de vih
WO2012138955A2 (fr) 2011-04-08 2012-10-11 Ly Danith H Acides nucléiques gamma-peptidiques contenant du minipeg, conformationnellement préorganisés
US9272043B2 (en) 2011-12-02 2016-03-01 Yale University Enzymatic synthesis of poly(amine-co-esters) and methods of use thereof for gene delivery
WO2013082529A1 (fr) 2011-12-02 2013-06-06 Yale University Synthèse enzymatique de poly(amine-co-esters) et ses méthodes d'utilisation pour une libération de gènes
US10465042B2 (en) 2011-12-02 2019-11-05 Yale University Poly(amine-co-ester) nanoparticles and methods of use thereof
US9895451B2 (en) 2011-12-02 2018-02-20 Yale University Formulations for targeted release of agents to low pH tissue environments or cellular compartments and methods of use thereof
WO2013166487A1 (fr) 2012-05-04 2013-11-07 Yale University Nanosupports à pénétration élevée pour le traitement d'une maladie du snc
DK2800811T3 (en) 2012-05-25 2017-07-17 Univ Vienna METHODS AND COMPOSITIONS FOR RNA DIRECTIVE TARGET DNA MODIFICATION AND FOR RNA DIRECTIVE MODULATION OF TRANSCRIPTION
JP5705329B2 (ja) 2012-07-24 2015-04-22 パナソニックヘルスケアホールディングス株式会社 分析用デバイス
JP2015527889A (ja) 2012-07-25 2015-09-24 ザ ブロード インスティテュート， インコーポレイテッド 誘導可能なｄｎａ結合タンパク質およびゲノム撹乱ツール、ならびにそれらの適用
US10279012B2 (en) * 2013-03-11 2019-05-07 Healthpartners Research & Education Methods of treating and preventing social communication disorder in patients by intranasal administration of insulin
US20150057505A1 (en) * 2013-08-22 2015-02-26 Elwha Llc Method for Administering a Medicament to a Fetus
TWI521870B (zh) 2013-11-14 2016-02-11 瑞昱半導體股份有限公司 電流平衡裝置與方法
WO2016183209A1 (fr) 2015-05-11 2016-11-17 Yale University Formulation topique de particules recouvertes de polymère hyperramifié
EP3140269B1 (fr) 2014-05-09 2023-11-29 Yale University Particules enrobées dans un polyglycérol hyper-ramifié, leurs procédés de production et d'utilisation

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
Burd et al., Nanomedicine: NBM, 2014, 10: 1343-1351. *
David et al., Methods in Molecular Biology, 2012, 891: 10-39. *
Staff, Acta Obstet. Gynecol. Scand., 2001, 80: 485-491. *
Waddington et al., Blood, 2013, 101: 1359-1366. *
Zhang et al., Chem. Eng. Prog., 2013, 103: 1-11. *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11136597B2 (en) 2016-02-16 2021-10-05 Yale University Compositions for enhancing targeted gene editing and methods of use thereof
US11654410B2 (en) 2019-05-16 2023-05-23 Gem Innov Method for preparing biodegradable microcapsules and microcapsules thus obtained
CN114832114A (zh) * 2022-05-06 2022-08-02 黑龙江中医药大学 Atra-pbae前药共聚物及其制备方法和应用
WO2023220358A3 (fr) * 2022-05-12 2024-02-29 The Research Institute At Nationwide Children's Hospital Procédé de ciblage de gène utilisant une vésicule de membrane externe

Also Published As

Publication number Publication date
US20240207172A1 (en) 2024-06-27
WO2018187493A1 (fr) 2018-10-11

Similar Documents

Publication Publication Date Title
US20200113821A1 (en) Compositions and methods for in utero delivery
US11136597B2 (en) Compositions for enhancing targeted gene editing and methods of use thereof
US20200308590A1 (en) Compositions and methods for treatment of cystic fibrosis
US10709664B2 (en) Nanolipogel comprising a polymeric matrix and a lipid shell
Conley et al. Nanoparticles for retinal gene therapy
US9173853B2 (en) Composition for gene delivery
US9241898B2 (en) Compositions and methods for controlled delivery of inhibitory ribonucleic acids
US20210189431A1 (en) Compositions and methods for embryonic gene editing in vitro
US20110268810A1 (en) Polymeric materials loaded with mutagenic and recombinagenic nucleic acids
JP7523209B2 (ja) 内耳感覚有毛細胞の再生／置換のための併用療法
Ullrich et al. Nanoparticles for delivery of agents to fetal lungs
ES2686708T3 (es) Composición basada en microesferas para prevenir y/o revertir la diabetes autoinmune de nueva aparición
US9822364B2 (en) Compositions and methods for controlled delivery of inhibitory ribonucleic acids
Lin et al. Neural cell membrane-coated DNA nanogels as a potential target-specific drug delivery tool for the central nervous system
US20220243211A1 (en) Peptide nucleic acid compositions with modified hoogsteen binding segments and methods of use thereof
US20220280656A1 (en) Compositions and methods for treating sickle cell disease
US20220372474A1 (en) Hydroxymethyl-modified gamma-pna compositions and methods of use thereof
CN113993881A (zh) 用于递送阴离子材料的肽
Sainz Ramos Development and characterization of non-viral vectors based on cationic niosomes to address cystic fibrosis disease by gene therapy approach
Macks Combinatorial Therapy of Rolipram and RhoA siRNA by Multifunctional Polymeric Nanocarrier for Traumatic Brain Injury
TW202417019A (zh) 用於細胞選擇性表現之經工程化多核苷酸
EP4433031A1 (fr) Composition comprenant un agent thérapeutiquement actif enrobé dans un véhicule d'administration de médicament

Legal Events

Date Code Title Description
STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

AS Assignment

Owner name: YALE UNIVERSITY, CONNECTICUT

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:KAUFFMAN, AMY;REEL/FRAME:052321/0739

Effective date: 20190910

Owner name: YALE UNIVERSITY, CONNECTICUT

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:SALTZMAN, W. MARK;GLAZER, PETER M.;RICCIARDI, ADELE S.;AND OTHERS;SIGNING DATES FROM 20180420 TO 20190808;REEL/FRAME:052321/0673

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: FINAL REJECTION MAILED

STPP Information on status: patent application and granting procedure in general

Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION

STPP Information on status: patent application and granting procedure in general

Free format text: NON FINAL ACTION MAILED

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION