WO2010123983A1 - Compositions et procédés de thérapie génique ciblée - Google Patents

Compositions et procédés de thérapie génique ciblée Download PDF

Info

Publication number
WO2010123983A1
WO2010123983A1 PCT/US2010/031888 US2010031888W WO2010123983A1 WO 2010123983 A1 WO2010123983 A1 WO 2010123983A1 US 2010031888 W US2010031888 W US 2010031888W WO 2010123983 A1 WO2010123983 A1 WO 2010123983A1
Authority
WO
WIPO (PCT)
Prior art keywords
triplex
composition
cells
target
molecules
Prior art date
Application number
PCT/US2010/031888
Other languages
English (en)
Inventor
Peter M. Glazer
Jacob Del Campo
Original Assignee
Yale University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yale University filed Critical Yale University
Publication of WO2010123983A1 publication Critical patent/WO2010123983A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/15—Nucleic acids forming more than 2 strands, e.g. TFOs
    • C12N2310/152—Nucleic acids forming more than 2 strands, e.g. TFOs on a single-stranded target, e.g. fold-back TFOs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3181—Peptide nucleic acid, PNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C12N2310/3183—Diol linkers, e.g. glycols or propanediols
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/331—Universal or degenerate base
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3511—Conjugate intercalating or cleaving agent
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3513—Protein; Peptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/34—Allele or polymorphism specific uses

Definitions

  • the present disclosure generally relates to the field of compositions that bind to DNA and methods of using these compositions in targeted gene therapy.
  • oligonucleotide- directed triple helix formation has emerged as a valuable tool in molecular biology.
  • Current knowledge suggests that oligonucleotides can bind as third strands of DNA in a sequence specific manner in the major groove in polypurine/polypyrimidine stretches in duplex DNA.
  • a polypyrimidine oligonucleotide binds in a direction parallel to the purine strand in the duplex, as described by Moser and Dervan, Science 238:645 (1987), Praseuth et al., Proc, Natl Acad. ScI USA 85:1349 (1988), and
  • TFOs triplex forming oligonucleotides
  • triplex forming oligonucleotides designed to bind to sites in gene promoters have been used to block DNA binding proteins and to block transcription both in vitro and in vivo.
  • Gene therapy can be defined by the methods used to introduce heterologous DNA into a host cell or by the methods used to alter the expression of endogenous genes within a cell. As such, gene therapy methods can be used to alter the phenotype and/or genotype of a cell.
  • Targeted modification of the genome by gene replacement is of value as a research tool and in gene therapy.
  • the frequency of homologous integration is limited (Hanson et a ⁇ ., MoI. Cell. Biol 15(1), 45-51 (1995), and isolation of cells with site-specific gene insertion typically requires a selection procedure (Capecchi, MR., (1989) Science 244(4910), 1288-1292).
  • Site-specific DNA damage in the form of double-strand breaks produced by rare cutting endonucleases can promote homologous recombination at chromosomal loci in several cell systems, but this approach requires the prior insertion of the recognition sequence into the locus.
  • Methods which alter the genotype of a cell typically rely on the introduction into the cell of an entire replacement copy of a defective gene, a heterologous gene, or a small nucleic acid molecule such as an oligonucleotide, to treat human, animal and plant genetic disorders.
  • the introduced gene or nucleic acid molecule via genetic recombination, replaces the endogenous gene.
  • This approach requires complex delivery systems to introduce the replacement gene into the cell, such as genetically engineered viruses, or viral vectors.
  • gene therapy methods can be used to alter the expression of an endogenous gene.
  • One example of this type of method is antisense therapy.
  • antisense therapy a nucleic acid molecule is introduced into a cell, the nucleic acid molecule being of a specific nucleic acid sequence so as to hybridize or bind to the mRNA encoding a specific protein. The binding of the antisense molecule to an mRNA species decreases the efficiency and rate of translation of the mRNA.
  • Gene therapy is being used on an experimental basis to treat well known genetic disorders of humans such as retinoblastoma, cystic fibrosis, and globinopathies such as sickle cell anemia.
  • retinoblastoma retinoblastoma
  • cystic fibrosis CAD
  • globinopathies such as sickle cell anemia.
  • in vivo efficiency is low due to the limited number of recombination events actually resulting in replacement of the defective gene.
  • TFO' s triplex-forming oligonucleotides
  • PNAs peptide nucleic acids
  • compositions containing molecules that bind to duplex DNA in a sequence-specific manner to form a triple-stranded structure are disclosed.
  • the compositions include triplex-forming molecules that displace the polypyrimidine strand of the target duplex and form a triple-stranded structure and hybrid duplex in a sequence specific manner with the polypurine strand of the target duplex.
  • Triplex-forming molecules can include a pair of molecules, or a pair of molecules connected by a linker, that facilitate strand displacement and triplex formation, referred to as a "clamp," in which one molecule binds to the target strand by Hoogsteen binding and the other molecule binds to the target strand by Watson-Crick binding in a sequence specific manner.
  • the triplex-forming molecules also include a Watson-Crick binding "tail" added to the end of the Watson-Crick binding portion of the clamp.
  • the tail includes additional nucleobases that bind to the target strand outside the triple helix formed at the site of duplex stand displacement, and hybridize as a duplex with the polypurine strand of the target duplex.
  • the tail increases the stringency of binding to the target duplex, improves the frequency of modification at the target site, and reduces the requirement for a polypurine:polypyrimidine stretch compared to triplex forming oligonucleotides (TFOs) or peptide nucleic acids (PNAs), thereby increasing the number of potential binding sites.
  • TFOs triplex forming oligonucleotides
  • PNAs peptide nucleic acids
  • Triplex-forming molecules may be composed of peptide nucleic acids, or a suitable substitute oligonucleotide with a backbone having low negative charge, no charge or positive charge to facilitate clamp formation at the target site. Methods for using triplex-forming molecules to induce site- specific homologous recombination in mammalian cells are also disclosed. The binding of the triplex-forming molecules to the target region stimulates cellular DNA synthesis, recombination, and repair mechanisms. When administered in combination with a donor oligonucleotide, triplex-forming molecules can enhance recombination of the donor oligo at the target site. This method can be used to introduce a mutation into the target duplex DNA.
  • the mutation generated can activate, inactivate, or alter the activity and function of a target gene.
  • the target gene contains a mutation that is the cause of a genetic disorder
  • compositions containing triplex-forming molecules and donor oligonucleotides are useful for mutagenic repair that restores the DNA sequence of the target gene to normal.
  • tcPNAs and a donor oligonucleotide can be used to correct a mutation in the human beta-globin gene.
  • Ex vivo and in vivo methods of gene correction in patients are disclosed.
  • cells are isolated from a subject and contacted ex vivo with the compositions to produce cells containing mutations in or adjacent to genes. The corrected cells are then returned to the patient to reduce, alleviate, or cure the disorder.
  • the disclosed compositions including triplex-forming molecules such as tcPNAs and donor fragment can also be employed for therapeutic uses in vivo in combination with a suitable pharmaceutical carrier.
  • FIG. 1 is a diagram of the HBB tc816 tail-clamp PNA bound to a homopurine stretch of the beta-globin gene at sequence 5' GTGGAGACAGAGAAGA 3 ' (SEQ ID NO: 1).
  • HBB tc816 is a 24 nucleotide PNA dimer of sequence Lys-Lys-Lys-TJTJTTJT-o-o-o- TCTTCTCTGTCTCCAC -Lys-Lys-Lys (SEQ ID NO:2), where the first 8 nucleotides are the Hoogsteen binding portion, the second 8 nucleotides are the Watson-Crick binding portion, and the final 8 nucleotides are Watson- Crick binding tail, and where J ⁇ pseudoisocytosine and o- flexible 8-amino- 3,6-dioxaoctanoic acid, 6-aminohexanoic acid monomers.
  • FIG. 2 is a diagram of the 5' portion of the human beta-globin gene. The diagram illustrates, as labeled from left to right, the relative locations of the 5' untranslated region (UTR), Exon 1 (including the ATG "start” codon, position 0), the location of the SCA mutation (20 base pairs downstream of the ATG), Intron 1 (including the PNA binding site 147 base pairs downstream of the ATG), and Exon 2,
  • triplex-forming molecules Disclosed herein are compositions containing molecules, referred to as triplex-forming molecules, that bind to duplex DNA in a sequence-specific manner to form a triple-stranded structure.
  • the triplex-forming molecules can be used to induce site-specific homologous recombination in mammalian cells when combined with donor DNA molecules.
  • the donor DNA molecules can contain mutated nucleic acids relative to the target DNA sequence. This is useful to activate, inactivate, or otherwise alter the function of a polypeptide or protein encoded by the targeted duplex DNA.
  • triplex-forming molecules refer to a pair of single-stranded molecules, or a pair of molecules connected by a linker, that facilitate strand displacement and triplex formation, referred to as a "clamp," in which one molecule binds to the target strand by Hoogsteen binding and the other molecule binds to the target strand by Watson-Crick binding in a sequence specific manner.
  • the pair of single-stranded triplex-forming molecules may be referred to individually as the Watson-Crick binding portion, and the Hoogsteen binding portion.
  • the triplex- forming molecules also have a Watson-Crick binding "tail" added to the end of the Watson-Crick binding portion of the clamp.
  • the "tail” includes additional nucelobases that bind to the target strand outside the triple helix formed at the site of duplex strand displacement.
  • suitable triplex-forming molecules include, but are not limited to a pair of peptide nucleic acids (PNAs), or bis-PNAs.
  • PNAs peptide nucleic acids
  • the triplex-forming molecules are two PNA molecules, the Watson-Crick portion includes a tail, and the two PNA molecules are linked by an O-linker.
  • the triplex-forming molecules are peptide nucleic acids (PNAs).
  • Peptide nucleic acids are molecules in which the phosphate backbone of oligonucleotides is replaced in its entirety by repeating N-(2- aminoethyl)-glycine units and phosphodiester bonds are replaced by peptide bonds.
  • the various heterocyclic bases are linked to the backbone by methylene carbonyl bonds.
  • PNAs maintain spacing of heterocyclic bases that is similar to oligonucleotides, but are achiral and neutrally charged molecules.
  • Peptide nucleic acids are comprised of peptide nucleic acid monomers.
  • the heterocyclic bases can be any of the standard bases (uracil, thymine, cytosine, adenine and guanine) or any of the modified heterocyclic bases described below.
  • PNAs can bind to DNA via Watson-Crick hydrogen bonds, but with binding affinities significantly higher than those of a corresponding nucleotide composed of DNA or RNA.
  • the neutral backbone of PNAs decreases electrostatic repulsion between the PNA and target DNA phosphates.
  • PNAs Under in vitro or in vivo conditions that promote opening of the duplex DNA, PNAs can mediate strand invasion of duplex DNA resulting in displacement of one DNA strand to form a D-loop.
  • Highly stable triplex PNA:DNA:PNA structures can be formed from a homopurine DNA strand and two PNA strands.
  • the two PNA strands may be two separate PNA molecules, or two PNA molecules linked together by a linker of sufficient flexibility to form a bis-PNA.
  • the PNA molecule(s) forms a triplex "clamp" with one of the strands of the target duplex while displacing the other strand of the duplex target.
  • one strand forms Watson-Crick base pairs with the DNA strand in the anti-parallel orientation (the Watson-Crick binding portion), whereas the other strand forms Hoogsteen base pairs to the DNA strand in the DNA-PNA duplex (the Hoogsteen binding portion).
  • a homopurine strand allows formation of a stable PN A/DNA/PNA triplex.
  • PNA clamps can form at shorter homopurine sequences than those required by triplex-forming oligonucleotides (TFOs) and also do so with greater stability.
  • Suitable molecules for use in linkers of bis-PNA molecules include, but are not limited to 8-amino-3,6-dioxaoctanoic acid, referred to as an O- linker, and 6-aminohexanoic acid.
  • Poly(ethylene) glycol monomers can also be used in bis-PNA linkers.
  • a bis-PNA linker can contain multiple linker molecule monomers in any combination.
  • PNAs can also include other positively charged moieties to increase the solubility of the PNA and increase the affinity of the PNA for duplex DNA.
  • Commonly used positively charged moieties include the amino acids lysine and argmine, although other positively charged moieties may also be useful. Lysine and argmine residues can be added to a bis-PNA linker or can be added to the carboxy or the N-terminus of a PNA strand.
  • the triplex-forming molecules including PNAs and other suitable oligonucleotides may include one or more modifications or substitutions to the nucleobases or linkages. Modifications should not prevent, and preferably enhance, duplex invasion, strand displacement, and/or stabilize triplex formation as described above by increasing specificity or binding affinity of the triplex-forming molecules to the target site. Modified bases and base analogues, modified sugars and sugar analogues and/or various suitable linkages known in the art are also suitable for use in triplex-forming molecules such as PNAs. a. Heterocyclic bases
  • the principal naturally-occurring nucleotides comprise uracil, thymine, cytosine, adenine and guanine as the heterocyclic bases.
  • Triplex- forming molecules such as PNAs can include chemical modifications to their nucleotide constituents.
  • target sequences with adjacent cytosines can be problematic.
  • Triplex stability is greatly compromised by runs of cytosines, thought to be due to repulsion between the positive charge resulting from the N protonation or perhaps because of competition for protons by the adjacent cytosines.
  • Chemical modification of nucleotides comprising triplex-forming molecules such as PNAs may be useful to increase binding affinity of triplex-forming molecules and/or triplex stability under physiologic conditions.
  • heterocyclic bases or heterocyclic base analogs may be effective to increase the binding affinity of a nucleotide or its stability in a triplex.
  • Chemically-modified heterocyclic bases include, but are not limited to, inosine, S-(l-propynyl) uracil (pU), 5-(l-propynyl) cytosine (pC), 5-methylcytosine, 8-oxo-adenine, pseudocytosine, pseudoisocytosine, 5 and 2-amino-5-(2'-deoxy- ⁇ -D-ribofuranosyl)pyridine (2-aminopyridine), and various pyrrolo- and pyrazolopyrimidine derivatives.
  • PNAs Peptide nucleic acids
  • PNAs are synthetic DNA mimics in which the phosphate backbone of the oligonucleotide is replaced in its entirety by repeating N-(2 ⁇ aminoethyl)- glycine units and phosphodiester bonds are typically replaced by peptide bonds.
  • the various heterocyclic bases are linked to the backbone by methylene carbonyl bonds, which allow them to form PNA-DNA or PNA- RNA duplexes via Watson-Crick base pairing with high affinity and sequence-specificity.
  • PNAs maintain spacing of heterocyclic bases that is similar to conventional DNA oligonucleotides, but are achiral and neutrally charged molecules.
  • Peptide nucleic acids are comprised of peptide nucleic acid monomers.
  • Other backbone modifications, particularly those relating to PNAs, include peptide and amino acid variations and modifications.
  • the backbone constituents of PNAs may be peptide linkages, or alternatively, they may be non-peptide linkages. Examples include acetyl caps, amino spacers such as 8-amino-3 5 6-dioxaoctanoic acid (referred to herein as O- linkers), amino acids such as lysine are particularly useful if positive charges are desired in the PNA, and the like.
  • Oligonucleotides comprise a chain of nucleotides which are linked to one another. Each nucleotide typically comprises a heterocyclic base (nucleic acid base), a sugar moiety attached to the heterocyclic base, and a phosphate moiety which esterifies a hydroxyl function of the sugar moiety.
  • the principal naturally-occurring nucleotides comprise uracil, thymine, cytosine, adenine and guanine as the heterocyclic bases, and ribose or deoxyribose sugar linked by phosphodiester bonds.
  • modified nucleotide or "chemically modified nucleotide” defines a nucleotide that has a chemical modification of one or more of the heterocyclic base, sugar moiety or phosphate moiety constituents.
  • charge of the modified nucleotide is reduced compared to DNA or RNA oligonucleotides of the same nucleobase sequence.
  • triplex-forming molecules have low negative charge, no charge, or positive charge such that electrostatic repulsion with the nucleotide duplex at the target site is reduced compared to DKA or RNA oligonucleotides with the corresponding nucleobase sequence.
  • modified nucleotides with reduced charge examples include modified internucleotide linkages such as phosphate analogs having achiral and uncharged intersubunit linkages (e.g., Sterchak, E. P. et al., Organic Chem., 52:4202, (1987)), and uncharged morpholino-based polymers having achiral intersubunit linkages (see, e.g., U.S. Patent No. 5,034,506).
  • Some internucleotide linkage analogs include morpholidate, acetal, and polyamide- linked heterocycles.
  • Locked nucleic acids are modified RNA nucleotides (see, for example, Braasch, et al., Chem.
  • LNAs form hybrids with DNA which are more stable than DNA/DNA hybrids, a property similar to that of peptide nucleic acid (PNA)/DNA hybrids. Therefore, LNA can be used just as PNA molecules would be. LNA binding efficiency can be increased in some embodiments by adding positive charges to it.
  • PNA peptide nucleic acid
  • Triplex-forming molecules may also include nucleotides with modified heterocyclic bases, sugar moieties or sugar moiety analogs.
  • Modified nucleotides may include modified heterocyclic bases or base analogs as described above with respect to peptide nucleic acids.
  • Sugar moiety modifications include, but are not limited to, 2'-0-aminoethoxy, T- O-amonioethyl (2'-OAE), 2'-O-methoxy, 2'-O-methyl, 2-guanidoethyl (T- OGE), 2'-0,4 > -C-methylene (LNA), 2'-O-(methoxyethyl) (2'-0ME) and T- O-(N-(methyl)acetamido) (2'-OMA).
  • 2'-O-aminoethyl sugar moiety substitutions are especially preferred because they are protonated at neutral pH and thus suppress the charge repulsion between the triplex-forming molecule and the target duplex.
  • This modification stabilizes the C3'-endo conformation of the ribose or deoxyribose and also forms a bridge with the i- J phosphate in the purine strand of the duplex.
  • Triplex-forming molecules such as PNAs may optionally include one or more terminal amino acids at either or both termini to increase stability, and/or affinity of the PNAs or modified nucleotides for DNA, or increase solubility of PNAs or modified nucleotides.
  • Commonly used positively charged moieties include the amino acids lysine and arginine, although other positively charged moieties may also be useful.
  • lysine and arginine residues can be added to the carboxy or the N-terminus of a PNA strand.
  • Triplex-forming molecules may further be modified to be end capped to prevent degradation using a 3' propylamine group. Procedures for 3' or 5* capping oligonucleotides are well known in the art. B.
  • Tail clamp Although polypurinetpolypyrimidine stretches do exist in mammalian genomes, it is desirable to target triplex formation in the absence of this requirement.
  • the triplex-forming molecules include a "tail” added to the end of the Watson-Crick binding portion. Adding additional nucleobases, known as a “tail” or “tail clamp”, to the Watson-Crick binding portion that bind to target strand outside the triple helix further reduces the requirement for a polypurine:polypyrimidine stretch and increases the number of potential target sites. This molecule therefore mediates a mode of binding to DNA that encompasses both triplex and duplex formation (Kaihatsu, et al.
  • the triplex-forming molecules are tail clamp PNA (tcPNA)
  • the PNA/DNA/PNA triple helix and the PNA/DNA duplex both produce displacement of the pyrimidine-rich strand, creating an altered helical structure that strongly provokes the nucleotide excision repair pathway and activating the site for recombination with a donor DNA molecule (Rogers, et al., Proc. Natl. Acad. ScL U.S.A., 99(26): 16695-700 (2002)).
  • Tail clamps added to PNAs have been described by Kaihatsu, et al., Biochemistry, 42(47): 13996-4003 (2003); Bentin, et al., Biochemistry, 42(47): 13987-95 (2003), and are known to bind to DNA more efficiently due to low dissociation constants.
  • the addition of the tail also increases binding specificity and binding stringency of the triplex-forming molecules to the target duplex. It has also been found that the addition of a tail to clamp PNA improves the frequency of recombination of the donor oligonucleotide at the target site. Tail clamps can be added to any of the triplex-forming molecules described herein.
  • the triplex-forming molecules such as tcPNAs bind to a predetermined target region referred to herein as the "target sequence", "target region", or "target site".
  • the target sequence for the triplex-forming molecules can be within or adjacent to a human gene in need of gene correction.
  • the target sequence can be within the coding DNA sequence of the gene or within an intron.
  • the target sequence can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences.
  • the tail-clamp bis-PNAs are designed to target a specific sequence of the target duplex nucleotide.
  • the nucleotide sequences of the triplex- forming molecules are selected based on the sequence of the target sequence, the physical constraints, and the need to have a low dissociation constant (K d ) for the triplex-forming molecules/target sequence.
  • the molecules will have a base composition which is conducive to triple-helix formation and may also take into consideration the structural motifs for third strand binding.
  • the most stable complexes are formed on polypurine elements, however, as discussed above this requirement is reduced by the inclusion of a tail sequence on the Watson-Crick binding portion.
  • the triplex-forming molecules such as tcPNAs bind to or hybridize to the target sequence under conditions of high stringency and specificity.
  • the triplex-forming molecules bind in a sequence-specific manner to the target sequence. Reaction conditions for in vitro triple helix formation of triplex-forming molecules to a nucleic acid sequence vary from molecule to molecule, depending on factors such as nucleotide length, the number of G:C and A:T base pairs, and the composition of the buffer utilized in the hybridization reaction.
  • triplex-helix forming molecules are substantially complementary to the target sequence.
  • both the Waston-Crick and Hoogsteen binding portions of the triplex forming molecules are substantially complementary to the target sequence.
  • triplex- forming molecules are said to be substantially complementary to a target region when the molecules have a heterocyclic base composition which allows for duplex strand displacement and the formation of a triple-helix with the target region.
  • triplex-forming molecules are substantially complementary to a target region even when there are non-complementary bases present in the molecules.
  • structural motifs available which can be used to determine the nucleotide sequence of the substantially complementary molecules.
  • the triplex-forming molecules are between 6 and 50 nucleotides in length.
  • the Watson-Crick portion should be 9 or more nucleobases in length, including the tail sequence. More preferably, the Watson-Crick binding portion is between about 9 and 30 nucleobases in length, including a tail sequence of between 0 and about 15 nucleobases. More preferably, the Watson-Crick binding portion is between about 10 and 25 nucleobases in length, including a tail sequence of between 0 and about 10 nucleobases. In the most preferred embodiment, the Watson-Crick binding portion is between 15 and 25 nucleobases in length, including a tail sequence of between 5 and 10 nucleobases.
  • the Hoogsteen binding portion should be 6 or more nucleobases in length. Most preferably, the Hoogsteen binding portion is between about 6 and 15 nucleobases, inclusive.
  • the triplex-forming molecules are designed to target the polypurine strand of a polypurine ⁇ olypyrimidme stretch in the target duplex nucleotide. Therefore, the base composition of the triplex-forming molecules may be homopyrimidine. Alternatively, the base composition may be polypyrimidine. The addition of a "tail” reduces the requirement for polypurine :polypyriraidine run. Adding additional nucleobases, known as a "tail,” to the Watson-Crick binding portion of the triplex-forming molecules allows the Watson-Crick binding portion to bind/hybridize to the target strand outside the site of strand displacement.
  • TFOs Triplex- forming oligonucleotides
  • TFOs may require stretch of at least 15 and preferably 30 or more nucleotides.
  • Peptide nucleic acids require fewer purines to a form a triple helix, although at least 10 or preferably more may be needed.
  • Peptide nucleic acids including a tail also referred to tail clamp PNAs, or tcPNAs, require even fewer purines to a form a triple helix.
  • triple helix may be formed with a target sequence containing fewer than 8 purines. Therefore, triplex-forming molecules including PNAs should be designed to target a site on duplex nucleic acid containing between 6-30 polypurine: polypyrimidmes, preferably, 6-25 polypurine:polypyrimidines, more preferably 6-20 polypurine:polypyrimidines.
  • a "mixed-sequence" tail to the Watson-Crick-bindmg strand of the triplex-forming molecules such as PNAs also increases the length of the triplex-forming molecule and, correspondingly, the length of the binding site. This increases the target specificity and size of the lesion created at the target site and disrupts the helix in the duplex nucleic acid, while maintaining a low requirement for a stretch of polypurine:polypyrimidines. Increasing the length of the target sequence improves specificity for the target, for example, a target of 16 to 17 base pairs will statistically be unique in the human genome.
  • the target region is a polypurine site within or adjacent to a gene encoding a human beta-globin gene.
  • the target region is a homopurine site within the first intron of the human beta-globin gene. A homopurine site can be found 127 bases pairs downstream from common mutation in the first exon of the human beta-globin gene.
  • the missense mutation is A to T substitution 20 nucleotides downstream from the ATG "start site,” of the human beta-globin gene which results in a glutamic acid to valine substitute in the amino acid sequence in codon 6 and which is the cause of the disorder, sickle cell anemia. PNAs that bind to this target site are particularly useful.
  • Watson-Crick binding portion of 16 nucleobase including an 8 nucleobase tail, and a Hoogsteen binding portion of 8 nucleobases. It is designed to form a PNA/DNA/PNA triplex clamp on the purine-rich DNA strand of the 147 site, 127 base pairs from position 20 of the first exon of the human beta- globin.
  • a gel mobility shift assay used to test the affinity of HBB tc816 to its binding site revealed strong binding by this molecule to its target site in the human beta-globin gene.
  • Allele-specific PCR shows that HBB tc81 ⁇ delivered to B-lymphoblast human cells in combination with a DNA donor, significantly enhances genetic modification of the beta-globin locus, reverting the sickle-cell mutation back to wildtype.
  • the Watson-Crick binding portion and the Hoogsteen binding portion are delivered as separate molecules.
  • a Hoogsteen binding portion of sequence TJTJTTJT and a Watson-Crick binding portion of sequence TCTTCTCTGTCTCCAC (SEQ ID NO: 3) (sequences are oriented N-termimis to C-terminus) can be delivered as two separate molecules.
  • the two molecules can be linked by a linker other than 8-amino-3 f 6-dioxaoctanoic acid, 6-aminohexanoic acid monomers, for example poly(ethylene) glycol monomers, or other linkers known in the art.
  • the donor DNA oligonucleotide is tethered to the triplex-forming PNA.
  • triple-forming molecules are preferably generated using known synthesis procedures. In one embodiment, triplex-forming molecules are generated synthetically. Triplex-forming molecules can also be chemically modified using standard methods that are well known in the art,
  • a useful measure of triple helix formation is the equilibrium dissociation constant, K d , of the triplex, which can be estimated as the concentration of triplex-forming molecules at which triplex formation is half- maximal.
  • the triplex-forming molecules have a binding affinity for the target sequence in the range of physiologic interactions.
  • Preferred triplex-forming molecules have a K d less than or equal to approximately 10 "7 M. Most preferably, the K d is less than or equal to 2 X 10 "8 M in order to achieve significant intramolecular interactions.
  • K d was estimated using a gel mobility shift assay (R.H. Durland et ah, Biochemistry 30, 9246 (1991)).
  • the dissociation constant (K d ) can be determined as the concentration of triplex-forming molecules in which half was bound to the target sequence and half was unbound.
  • the triplex-forming molecules such as peptide nucleic acids may be administered in combination with, or tethered to, a donor oligonucleotide via a mixed sequence linker or used in conjunction with a non-tethered donor oligonucleotide that is substantially homologous to the target sequence.
  • Triplex-forming molecules can induce recombination of a donor oligonucleotide sequence up to several hundred base pairs away. It is preferred that the donor oligonucleotide sequence is between 1 to 800 bases from the target binding site of the triplex-forming molecules. More preferably the donor oligonucleotide sequence is between 25 to 75 bases from the target binding site of the triplex-forming molecules. Most preferably that the donor oligonucleotide sequence is about 50 nucleotides from the target binding site of the triplex-forming molecules.
  • the donor sequence can contain one or more nucleic acid sequence alterations compared to the sequence of the region targeted for recombination, for example, a substitution, a deletion, or an insertion of one or more nucleotides. Successful recombination of the donor sequence results in a change of the sequence of the target region.
  • Donor oligonucleotides are also referred to herein as donor fragments, donor nucleic acids, donor DNA, or donor DNA fragments. This strategy exploits the ability of a triplex to provoke DNA repair, potentially increasing the probability of recombination with the homologous donor DNA.
  • Tethering of a donor oligonucleotide to a triplex-forming molecule facilitates target site recognition via triple helix formation while at the same time positioning the tethered donor fragment for possible recombination and information transfer.
  • Triplex-forming molecules also effectively induce homologous recombination of non-tethered donor oligonucleotides.
  • recombinagenic as used herein, is used to define a DNA fragment, oligonucleotide, peptide nucleic acid, or composition as being able to recombine into a target site or sequence or induce recombination of another DNA fragment, oligonucleotide, or composition.
  • Non-tethered or unlinked fragments may range in length from 20 nucleotides to several thousand.
  • the donor oligonucleotide molecules, whether linked or unlinked, can exist in single stranded or double stranded form.
  • the donor fragment to be recombined can be linked or un-linked to the triplex forming molecules.
  • the linked donor fragment may range in length from 4 nucleotides to 100 nucleotides, preferably from 4 to 80 nucleotides in length.
  • the unlinked donor fragments have a much broader range, from 20 nucleotides to several thousand.
  • the olignucleotide donor is between 25 and 80 nucleobases.
  • the non-tethered donor nucleotide is about 50 to 60 nucleotides in length.
  • the donor oligonucleotides contain at least one mutated, inserted or deleted nucleotide relative to the target DNA sequence.
  • Target sequences can be within the coding DNA sequence of the gene or within introns.
  • Target sequences can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences.
  • the target sequence is preferably within or is adjacent to a portion of the human beta-globin gene.
  • the donor oligonucleotide is designed to target the sickle cell anemia associated mutation 20 base pairs from the ATG start codon in the first exon of the human beta-globin gene.
  • the donor oligonucleotides can contain a variety of mutations relative to the target sequence.
  • Representative types of mutations include, but are not limited to, point mutations, deletions and insertions. Point mutations can cause missense or nonsense mutations. Deletions and insertions can result in frameshift mutations or deletions. These mutations may disrupt, reduce, stop, increase, improve, or otherwise alter the expression of the target gene. For example, it may be desirable to reduce or stop expression of an oncogene. Alternatively, it may be desirable to alter the polypeptide encoded by the target gene, for example, a human beta- globin gene with a sickle cell anemia mutation in the first exon.
  • compositions including triplex-forming molecules such as tcPNA may include one or more donor oligonucleotides. More than one donor oligonucleotides may be administered with triplex-forming molecules in a single transfection, or sequential transfections. Use of more than one donor oligonucleotide may be useful, for example, to create a heterozygous target gene where the two alleles contain different modifications.
  • Donor oligonucleotides are preferably DNA oligonucleotides, composed of the principal naturally-occurring nucleotides (uracil, thymine, cytosine, adenine and guanine) as the heterocyclic bases, deoxyribose as the sugar moiety, and phosphate ester linkages.
  • Donor oligonucleotides may include modifications to nucleobases, sugar moieties, or backbone/linkages, as described above, depending on the desired structure of the replacement sequence at the site of recombination or to provide some resistance to degradation by nucleases. Modifications to the donor oligonucleotide should not prevent the donor oligonucleotide from successfully recombining at the recombination target sequence in the presence of triplex-forming molecules.
  • allele-specific PCR is a preferred method for determining if a recombination event has occurred.
  • PCR primers are designed to distinguish between the original allele, and the new predicted sequence following recombination.
  • Other methods of determining if a recombination event has occurred are known in the art and may be selected based on the type of modification made. Methods include, but are not limited to, analysis of genomic DNA, for example by sequencing; analysis of mRNA transcribed from the target gene, for example, by Northern blot, in situ hybridization, real-time or quantitative reverse transcriptase (RT) PCT; and analysis of the polypeptide encoded by the target gene, for example, by ⁇ mmunostaming, ELISA, or FACS.
  • modified cells will be compared to parental controls.
  • Other methods may include testing for changes in the function of the RNA transcribed by, or the polypeptide encoded by, the target gene. For example, if the target gene encodes an enzyme, an assay designed to test enzyme function may be used.
  • Formulations of the triplex-forming molecules embrace fusions of the triplex-forming molecules or modifications of the triplex-forming molecules, wherein the triplex-forming molecules are fused to another mo ⁇ ety or moieties. Such analogs may exhibit improved properties such as increased cell membrane permeability, activity and/or stability.
  • moieties which may be linked or unlinked to the triplex-forming molecules, or donor oligonucleotides include, for example, targeting moieties which provide for the delivery of molecules or oligonucleotides to specific cells, e.g., antibodies to hematopoeitic stem cells, CD34 + cells, T cells or any other preferred cell type, as well as receptor and ligands expressed on the preferred cell type.
  • the moieties target hematopoeitic stem cells.
  • Other moieties that may be provided with the triplex-forming molecules or oligonucleotides include protein transduction domains (PTDs), which are short basic peptide sequences present in many cellular and viral proteins that mediate translocation across cellular membranes. Exemplary protein transduction domains that are well-known in the art include the
  • the triplex-forming molecules can be used alone or in combination with other mutagenic agents.
  • two agents are said to be used in combination when the two agents are co-administered, or when the two agents are administered in a fashion so that both agents are present within the cell or blood simultaneously.
  • the additional mutagenic agents are conjugated or linked to the triplex-forming molecule.
  • Additional mutagenic agents that can be used in combination with triplex- forming molecules include agents that are capable of directing mutagenesis, nucleic acid crosslinkers, radioactive agents, or alkylating groups, or molecules that can recruit DNA-damaging cellular enzymes.
  • Other suitable mutagenic agents include, but are not limited to, chemical mutagenic agents such as alkylating, bialkylating or intercalating agents.
  • a preferred agent for co-administration is psoralen-linked molecules as described in PCT/US/94/07234 by Yale University. I. Additional prophylactic or therapeutic agents
  • the triplex-forming molecules can be used alone or in combination with other prophylactic or therapeutic agents.
  • two agents are said to be used in combination when the two agents are co-administered, or when the two agents are administered in a fashion so that both agents are present within the cell or serum simultaneously.
  • Suitable additional prophylactic or therapeutic agents will be known to one of skill in the art and will depend on the parameters such as the patient and condition to be treated.
  • compositions containing triplex-forming molecules in combination with agents that further enhance the frequency of gene correction in cells.
  • the compositions can be administered in combination with a histone deacetylase (HDAC) inhibitor, such as suberoylanilide hydroxamic acid (SAHA), which has been found to promote increased levels of gene targeting in asynchronous cells.
  • HDAC histone deacetylase
  • SAHA suberoylanilide hydroxamic acid
  • the nucleotide excision repair pathway is also known to facilitate triplex- forming molecule-mediated recombination. Therefore, the compositions can be administered in combination with an agent that enhances or increases the nucleotide excision repair pathway, for example, an agent that increases the expression, activity, or localization to the target site, of the endogenous damage recognition factor XPA.
  • compositions may also be administered in combination with a second active agent that enhances uptake or delivery of the triplex-forming molecules or the donor oligonucleotides.
  • a second active agent that enhances uptake or delivery of the triplex-forming molecules or the donor oligonucleotides.
  • the lysosomotropic agent chloroquine has been shown to enhance delivery of PNAs into cells (Abes, et al. ⁇ J. Contrail ReI, 110:595-604 (2006).
  • Triplex-forming molecules bind/hybridize to a target sequence within or adjacent to a human gene, thereby displacing the polyprimidine strand, and forming a triplex structure and hybrid duplex with the porypurine strand.
  • the binding of the triple-forming molecule to the target region stimulates mutations within or adjacent to the target region using cellular DNA synthesis, recombination, and repair mechanisms.
  • a triplex forming molecule is administered to a cell in combination with a separate donor oligonucleotide fragment which minimally contains a sequence substantially complementary to the target region or a region adjacent to the target region, referred to herein as the donor fragment.
  • the donor fragment can further contain nucleic acid sequences which are to be inserted within the target region.
  • the co-administration of a triplex forming molecules with the fragment to be recombined increases the frequency of insertion of the donor fragment within the target region when compared to procedures which do not employ a triplex forming molecules.
  • the oligonucleotide is useful for mutagenic repair that restores the DNA sequence of the target gene to normal. If the target gene is a viral gene needed for viral survival or reproduction or an oncogene causing unregulated proliferation, such as in a cancer cell, then the mutagenic oligonucleotide is useful for causing a mutation that inactivates the gene to incapacitate or prevent reproduction of the virus or to terminate or reduce the uncontrolled proliferation of the cancer cell.
  • the mutagenic oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation.
  • compositions containing triplex-forming molecules are particularly useful as a molecular biology research tool to cause targeted mutagenesis.
  • Targeted mutagenesis has been shown to be a very useful tool when employed to not only elucidate functions of genes and gene products, but alter known activities of genes and gene products as well.
  • Targeted mutagenesis is also useful for targeting a normal gene and for the study of mechanisms such as DNA repair.
  • Targeted mutagenesis of a specific gene in an animal oocyte, such as a mouse oocyte provides a useful and powerful tool for genetic engineering for research and therapy and for generation of new strains of "transmutated" animals and plants for research and agriculture.
  • the induction of targeted recombination may be used to correct a mutation in a target gene that is the cause of a genetic disorder.
  • the target gene is a viral gene needed for viral survival or reproduction or an oncogene causing unregulated proliferation, such as in a cancer cell
  • recombinagenic triplex-forming molecules such as tcPNAs
  • the triplex-forming molecules can further be used to stimulate homologous recombination of an exogenously supplied, donor oligonucleotide, into a target region. Specifically, by activating cellular mechanisms involved in DNA synthesis, repair and recombination, the triplex-forming molecules can be used to increase the efficiency of targeted recombination.
  • triplex forming molecules are administered to a cell in combination with a separate donor fragment which minimally contains a sequence essentially complementary to the target region or a region adjacent to the target region, referred to herein as the donor fragment.
  • the triplex-forming molecules in conjunction with donor oligonucleotides can induce any of a range of mutations, including corrective mutations, in or adjacent to the target sequence.
  • Representative types of mutations include, but are not limited to point mutations, deletions and insertions. Point mutations can cause missense or nonsense mutations.
  • Deletions and insertions can result in frameshift mutations or deletions.
  • the donor fragment can differ from the target sequence at the one or more base positions that are desired to be substituted, inserted, deleted, or otherwise altered.
  • the donor fragment contains nucleic acid sequences which are to be inserted within the target region.
  • the coadministration of a triplex forming molecules with the fragment to be recombined increases the frequency of insertion of the donor fragment within the target region when compared to procedures which do not employ a triplex forming molecules.
  • the triplex-forming molecules in combination with the donor oligonucleotide induces site-specific mutations or alterations of the nucleic acid sequence within or adjacent to the target sequence.
  • the target sequence is preferably within or is adjacent to a portion of human beta-globin gene.
  • Target sequences can be within the coding DNA sequence of the gene or within introns.
  • Target sequences can also be within DNA sequences which regulate expression of the target gene, including promoter or enhancer sequences.
  • a solution containing the triplex-forming molecules is added directly to a solution containing the DNA molecules of interest in accordance with methods well known to those skilled in the art and described in more detail in the examples below.
  • the target duplex sequence may be episomal DNA, such as nonintegrated plasmid DNA.
  • the target duplex sequence may also be exogenous DNA, such as plasmid DNA or DNA from a viral construct, which has been integrated into the cell's chromosomes.
  • the target duplex sequence may also be a sequence endogenous to the cell.
  • the transfected cells may be in suspension or in a monolayer attached to a solid phase, or may be cells within a tissue wherein the triplex-forming molecules are in the extracellular fluid.
  • triplex-forming molecules Targeted DNA repair and recombination induced by triplex-forming molecules is especially useful to treat genetic deficiencies, disorders and diseases caused by mutations in single genes.
  • Triplex-forming molecules are also especially useful to correct genetic deficiencies, disorders and diseases caused by point mutations.
  • globinopathies account for significant morbidity and mortality. Over 1,200 different known genetic mutations affect the DNA sequence of the human alpha-like (HBZ 5 HBA2, HBAl, and HBQl) and beta-like (HBEl, HBGl, HBD, and HBB) globin genes.
  • HBZ 5 HBA2, HBAl, and HBQl human alpha-like globin genes
  • beta-like globinopathies Two of the more prevalent and well-studied globinopathies are sickle cell anemia and ⁇ - thalassemia. Substitution of valine for glutamic acid at position 6 of the ⁇ - globin chain in patients with sickle cell anemia predisposes to hemoglobin polymerization, leading to sickle cell rigidity and vasoocclusion with resulting tissue and organ damage.
  • globinopathies represent the most common single-gene disorders in man.
  • Triplex forming molecules are particularly well suited to treat globinopathies, as they are single gene disorders caused by point mutations.
  • triplex-forming molecules such as tcPNAs are effective at binding to the human ⁇ -globin both in vitro and in living cells.
  • the Example further demonstrates, the tcPNAs targeted to specific target sites in the human ⁇ -globin gene and effectively induce repair of known mutations when co-administered with appropriate donor oligonucleotides.
  • the oligonucleotide is useful for causing a mutation that inactivates the gene and terminates or reduces the uncontrolled proliferation of the cell.
  • the oligonucleotide is also a useful anti-cancer agent for activating a repressor gene that has lost its ability to repress proliferation.
  • the oligonucleotide is useful as an antiviral agent when the oligonucleotide is specific for a portion of a viral genome necessary for proper proliferation or function of the virus.
  • ex vivo gene therapy of cells is used for the treatment of a genetic disorder in a subject.
  • cells are isolated from a subject and contacted ex vivo with the compositions to produce cells containing mutations in or adjacent to genes.
  • the cells are isolated from the subject to be treated or from a syngenic host.
  • Target cells are removed from a subject prior to contacting with triplex-forming molecules and donor oligonucleotides.
  • the cells can be hematopoietic progenitor or stem cells.
  • the target cells are CD34 + hematopoietic stem cells.
  • HSCs Hematopoietic stem cells
  • CD34+ cells are multipotent stem cells that give rise to all the blood cell types including erythrocytes. Therefore, CD34+ cells can be isolated from a patient with sickle cell anemia, the beta-globin gene altered or repaired ex-vivo using the disclosed compositions and methods, and the cells reintroduced back into the patient as a treatment or a cure.
  • stem cells can be isolated and enriched by one of skill in the art. Methods for such isolation and enrichment of CD34 + and other cells are known in the art and disclosed for example in U.S. Patent Nos. 4,965,204; 4,714,680; 5,061,620; 5,643,741; 5,677,136; 5,716,827; 5,750,397 and 5,759,793.
  • enriched indicates a proportion of a desirable element (e.g. hematopoietic progenitor and stem cells) which is higher than that found in the natural source of the cells.
  • a composition of cells may be enriched over a natural source of the cells by at least one order of magnitude, preferably two or three orders, and more preferably 10, 100, 200 or 1000 orders of magnitude.
  • CD34 ⁇ cells can be recovered from cord blood, bone marrow or from blood after cytokine mobilization effected by injecting the donor with hematopoietic growth factors such as granulocyte colony stimulating factor (G-CSF), granulocyte-monocyte colony stimulating factor (GM-CSF), stem cell factor (SCF) subcutaneously or intravenously in amounts sufficient to cause movement of hematopoietic stem cells from the bone marrow space into the peripheral circulation.
  • G-CSF granulocyte colony stimulating factor
  • GM-CSF granulocyte-monocyte colony stimulating factor
  • SCF stem cell factor
  • bone marrow cells may be obtained from any suitable source of bone marrow, e.g. tibiae, femora, spine, and other bone cavities.
  • an appropriate solution may be used to flush the bone, which solution will be a balanced salt solution, conveniently supplemented with fetal calf serum or other naturally occurring factors, in conjunction with an acceptable buffer at low concentration, generally from about 5 to 25 mM.
  • Convenient buffers include Hepes, phosphate buffers, lactate buffers, etc.
  • Cells can be selected by positive and negative selection techniques.
  • Cells can be selected using commercially available antibodies which bind to hematopoietic progenitor or stem cell surface antigens, e.g. CD34, using methods known to those of skill in the art.
  • the antibodies may be conjugated to magnetic beads and immunogenic procedures utilized to recover the desired cell type.
  • Other techniques involve the use of fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • the CD34 antigen which is found on progenitor cells within the hematopoietic system of non-leukemic individuals, is expressed on a population of cells recognized by the monoclonal antibody My-IO (i.e., express the CD34 antigen) and can be used to isolate stem cell for bone marrow transplantation.
  • HB-8483 My- 10 has been deposited with the American Type Culture Collection (Rockville, Md.) as HB-8483 is commercially available as anti-HPCA 1. Additionally, negative selection of differentiated and "dedicated" cells from human bone marrow can be utilized, to select against substantially any desired cell marker.
  • progenitor or stem cells most preferably CD34 + cells, can be characterized as being any of CD3 ⁇ CD7 " , CD8 ⁇ CDlO ' , CD14 ⁇ CD15 " , CDl 9 " , CD20; CD33 " , Class II HLA + and Thy- 1 + .
  • progenitor or stem cells may be propagated by growing in any suitable medium.
  • progenitor or stem cells can be grown in conditioned medium from stromal cells, such as those that can be obtained from bone marrow or liver associated with the secretion of factors, or in medium comprising cell surface factors supporting the proliferation of stem cells.
  • Stromal cells may be freed of hematopoietic cells employing appropriate monoclonal antibodies for removal of the undesired cells.
  • the isolated cells are contacted ex vivo with a combination of triplex- forming molecules and donor oligonucleotides in amounts effective to cause the desired mutations in or adjacent to genes in need of repair or alteration, for example the human beta-globin gene. These cells are referred to herein as modified cells.
  • Methods for transfection of cells with oligonucleotides and peptide nucleic acids are well known in the art (Koppelhus, et al., Adv. Drug Deliv, Rev., 55(2): 267-280 (2003)). It may be desirable to synchronize the cells in S-phase to further increase the frequency of gene correction.
  • Methods for synchronizing cultured cells for example, by double thymidine block, are known in the art (Zielke, et al., Methods Cell Biol, 8:107-121 (1974)).
  • the modified cells can be maintained or expanded in culture prior to administration to a subject.
  • Culture conditions are generally known in the art depending on the cell type. Conditions for the maintenance of CD34 + in particular have been well studied, and several suitable methods are available.
  • a common approach to ex vivo multi-potential hematopoietic cell expansion is to culture purified progenitor or stem cells in the presence of early-acting cytokines such as interleuk ⁇ n-3.
  • TPO thrombopoietin
  • SCF stem cell factor
  • Flt-3L flt3 Hgand
  • cells can be maintained ex vivo in a nutritive medium (e.g., for minutes, hours, or 3, 6, 9, 13, or more days) comprising murine prolactin-like protein E (mPLP-E) or murine prolactin-like protein F (mPIP-F; collectively mPLP- E/IF) (U.S. Patent No. 6,261 ,841).
  • a nutritive medium e.g., for minutes, hours, or 3, 6, 9, 13, or more days
  • mPLP-E murine prolactin-like protein E
  • mPIP-F murine prolactin-like protein F
  • the modified hematopoietic stem cells are differentiated ex vivo into CD4 + cells culture using specific combinations of interleukins and growth factors prior to administration to a subject using methods well known in the art.
  • the cells may be expanded ex vivo in large numbers, preferably at least a 5-fold, more preferably at least a 10-fold and even more preferably at least a 20-fold expansion of cells compared to the original population of isolated hematopoietic stem cells.
  • cells for ex vivo gene therapy the cells to be used can be dedifferentiated somatic cells. Somatic cells can be reprogrammed to become pluripotent stem-like cells that can be induced to become hematopoietic progenitor cells.
  • the hematopoietic progenitor cells can then be treated with triplex-forming molecules and donor oligonucleotides as described above with respect to CD34 + cells to produce recombinant cells having one or more modified genes.
  • Representative somatic cells that can be reprogrammed include, but are not limited to fibroblasts, adipocytes, and muscles cells. Hematopoietic progenitor cells from induced stem-like cells have been successfully developed in the mouse (Hanna, J. et al. Science, 318:1920-1923 (2007)).
  • somatic cells are harvested from a host.
  • the somatic cells are autologous fibroblasts.
  • the cells are cultured and transduced with vectors encoding Oct4, Sox2, Klf4, and c-Myc transcription factors.
  • the transduced cells are cultured and screened for embryonic stem cell (ES) morphology and ES cell markers including, but not limited to AP > SSEAl , and Nanog.
  • ES embryonic stem cell
  • the transduced ES cells are cultured and induced to produce induced stem-like cells.
  • Cells are then screened for CD41 and c-kit markers (early hematopoietic progenitor markers) as well as markers for myeloid and erythroid differentiation.
  • the modified hematopoietic stem cells or modified induced hematopoietic progenitor cells are then introduced into a subject. Delivery of the cells may be effected using various methods and includes most preferably intravenous administration by infusion as well as direct depot injection into periosteal, bone marrow and/or subcutaneous sites.
  • the subject receiving the modified cells may be treated for bone marrow conditioning to enhance engraftment of the cells.
  • the recipient may be treated to enhance engraftment, using a radiation or chemotherapeutic treatment prior to the administration of the cells.
  • the cells will generally require a period of time to engraft. Achieving significant engraftment of hematopoietic stem or progenitor cells typically takes a period week to months. A high percentage of engraftment of modified hematopoietic stem cells cells is not envisioned to be necessary to achieve significant prophylactic or therapeutic effect. It is expected that the engrafted cells will expand over time following engraftment to increase the percentage of modified cells.
  • the modified cells have a corrected beta-globin gene. Therefore, in a subject with sickle cell anemia or other globinopathies, the modified cells are expected to improve or cure the condition. It is expected that engraftment of only a small number or small percentage of modified hematopoietic stem cells will be required to provide a prophylactic or therapeutic effect.
  • the cells to be administered to a subject will be autologous, e.g. derived from the subject, or syngenic. Nevertheless, allogeneic cell transplants are also envisioned, and allogeneic bone marrow transplants are carried out routinely.
  • Allogeneic cell transplantation can be offered to those patients who lack an appropriate sibling donor by using bone marrow from antigenically matched, genetically unrelated donors (identified through a national registry), or by using hematopoietic progenitor or stem- cells obtained or derived from a genetically related sibling or parent whose transplantation antigens differ by one to three of six human leukocyte antigens from those of the patient.
  • the triplex-forming molecules are administered directly to a subject in need of gene alteration.
  • the disclosed compositions including triplex-forming molecules such as tcPNAs, and one or more donor fragments are preferably employed for therapeutic uses in combination with a suitable pharmaceutical carrier.
  • Such compositions include an effective amount of triplex-forming molecules and donor fragment, and a pharmaceutically acceptable carrier or excipient
  • An effective amount of triplex-forming molecules may be enough molecules to induce strand displacement and formation of a triple helix at the target site.
  • An effective amount of triplex-forming molecules may also be an amount effective to increase the rate of recombination of a donor fragment relative to administration of the donor fragment in the absence of triplex-forming molecules.
  • compositions should include an amount of donor fragment effective to recombine at the target site in the presence of triplex-forming molecules.
  • the formulation is made to suit the mode of administration.
  • Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions containing the nucleic acids.
  • nucleotides administered in vivo are taken up and distributed to cells and tissues (Huang, et al, FEBS Lett, 558(1 -3):69-73 (2004)).
  • Nyce 5 et al. have shown that antisense oligodeoxynucleotides (ODNs) when inhaled bind to endogenous surfactant (a lipid produced by lung cells) and are taken up by lung cells without a need for additional carrier lipids (Nyce, et al., Nature, 385:721-725 (1997)).
  • small nucleic acids are readily taken up into T24 bladder carcinoma tissue culture cells (Ma, et al., Antisense Nucleic Acid DrugDev., 8:415-426 (1998)).
  • compositions including triplex-forming molecules, such as tcPNAs and donor fragments may be in a formulation for administration topically, locally or systemically in a suitable pharmaceutical carrier.
  • Remington's Pharmaceutical Sciences, 15th Edition by E. W. Martin discloses typical carriers and methods of preparation.
  • the compound may also be encapsulated in suitable biocompatible microcapsules, microparticles,, nanoparticles, or microspheres formed of biodegradable or non-biodegradable polymers or proteins or liposomes for targeting to cells.
  • Such systems are well known to those skilled in the art and may be optimized for use with the appropriate nucleic acid.
  • nucleic acid delivery systems comprise the desired nucleic acid, by way of example and not by limitation, in either "naked” form as a "naked” nucleic acid, or formulated in a vehicle suitable for delivery, such as in a complex with a cationic molecule or a liposome forming lipid, or as a component of a vector, or a component of a pharmaceutical composition.
  • the nucleic acid delivery system can be provided to the cell either directly, such as by contacting it with the cell, or indirectly, such as through the action of any biological process.
  • the nucleic acid delivery system can be provided to the cell by endocytosis, receptor targeting, coupling with native or synthetic cell membrane fragments, physical means such as electroporation, combining the nucleic acid delivery system with a polymeric carrier such as a controlled release film or nanoparticle or microparticle, using a vector, injecting the nucleic acid delivery system into a tissue or fluid surrounding the cell, simple diffusion of the nucleic acid delivery system across the cell membrane, or by any active or passive transport mechanism across the cell membrane. Additionally, the nucleic acid delivery system can be provided to the cell using techniques such as antibody-related targeting and antibody-mediated immobilization of a viral vector.
  • Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, or thickeners can be used as desired.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and nonaqueous sterile suspensions, solutions or emulsions that can include suspending agents, solubilizers, thickening agents, dispersing agents, stabilizers, and preservatives.
  • aqueous and non-aqueous, isotonic sterile injection solutions which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient
  • aqueous and nonaqueous sterile suspensions, solutions or emulsions that can include suspending agents, solubilizers, thickening agents, dispersing agents, stabilizers, and preservatives.
  • Formulations for injection may be presented in unit dosage form, e.g., in ampules or in multi-dose containers, optionally with an added preservative.
  • the compositions may take such forms as sterile aqueous or nonaqueous solutions, suspensions and emulsions, which can be isotonic with the blood of the subject in certain embodiments.
  • nonaqueous solvents are polypropylene glycol, polyethylene glycol, vegetable oil such as olive oil, sesame oil, coconut oil, arachis oil, peanut oil, mineral oil, injectable organic esters such as ethyl oleate, or fixed oils including synthetic mono or di-glycerides.
  • Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
  • Parenteral vehicles include sodium chloride solution, 1,3- butandiol, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's or fixed oils.
  • Intravenous vehicles include fluid and nutrient replenishers, and electrolyte replenishers (such as those based on Ringer's dextrose). Preservatives and other additives may also be present such as, for example, antimicrobials, antioxidants, chelating agents and inert gases.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil including synthetic mono- or di-glycerides may be employed.
  • fatty acids such as oleic acid may be used in the preparation of injectables.
  • Carrier formulation can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. Those of skill in the art can readily determine the various parameters for preparing and formulating the compositions without resort to undue experimentation.
  • the triplex-forming molecules alone or in combination with other suitable components can also be made into aerosol formulations (i.e., they can be "nebulized") to be administered via inhalation.
  • Aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, nitrogen, and air.
  • pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen, and air.
  • the compounds are delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant.
  • the triplex-forming molecules and donor oligonucleotides described above may include pharmaceutically acceptable carriers with formulation ingredients such as salts, carriers, buffering agents, emulsifiers, diluents, excipients, chelating agents, fillers, drying agents, antioxidants, antimicrobials, preservatives, binding agents, bulking agents, silicas, solubilizers, or stabilizers.
  • the triplex-forming molecules and/or donor oligonucleotides are conjugated to lipophilic groups like cholesterol and lauric and Iithocholic acid derivatives with C32 functionality to improve cellular uptake. For example, cholesterol has been demonstrated to enhance uptake and serum stability of siRNA in vitro
  • acridine derivatives include acridine derivatives; cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin; artificial endonucleases; metal complexes such as EDTA-Fe(II) and porphyrin-Fe(II); alkylating moieties; nucleases such as alkaline phosphatase; terminal transferases; abzymes; cholesteryl moieties; lipophilic carriers; peptide conjugates; long chain alcohols; phosphate esters; radioactive markers; non-radioactive markers; carbohydrates; and polylysine or other polyamines.
  • cross-linkers such as psoralen derivatives, azidophenacyl, proflavin, and azidoproflavin
  • artificial endonucleases such as EDTA-Fe(II) and porphyrin-Fe(II)
  • alkylating moieties include nucleases
  • Patent No. 6,919,208 to Levy, et a!. also describes methods for enhanced delivery.
  • These pharmaceutical formulations may be manufactured in a manner that is itself known, e.g., by means of conventional mixing, dissolving, granulating, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.
  • compositions including triplex-forming molecules and donor oligonucleotides can be administered by a number of routes including, but not limited to: oral, intravenous, intraperitoneal, intramuscular, transdermal, subcutaneous, topical, sublingual, or rectal means.
  • the preferred route of administration is intravenous.
  • Triplex-forming molecules and oligonucleotides can also be administered via liposomes. Such administration routes and appropriate formulations are generally known to those of skill in the art.
  • Administration of the formulations may be accomplished by any acceptable method which allows the triplex-forming molecules and a donor nucleotide, to reach their targets.
  • any acceptable method known to one of ordinary skill in the art may be used to administer a formulation to the subject.
  • the administration may be localized (i.e., to a particular region, physiological system, tissue, organ, or cell type) or systemic, depending on the condition being treated.
  • Injections can be e.g., intravenous, intradermal, subcutaneous, intramuscular, or intraperitoneal. In some embodiments, the injections can be given at multiple locations.
  • Implantation includes inserting implantable drug delivery systems, e.g., microspheres, hydrogels, polymeric reservoirs, cholesterol matrixes, polymeric systems, e.g., matrix erosion and/or diffusion systems and non-polymeric systems, e.g., compressed, fused, or partially- fused pellets.
  • Inhalation includes administering the composition with an aerosol in an inhaler, either alone or attached to a carrier that can be absorbed. For systemic administration, it may be preferred that the composition is encapsulated in liposomes.
  • the triplex-forming molecules and donor oligonucleotide may be delivered in a manner which enables tissue-specific uptake of the agent and/or nucleotide delivery system.
  • Techniques include using tissue or organ localizing devices, such as wound dressings or transdermal delivery systems, using invasive devices such as vascular or urinary catheters, and using interventional devices such as stents having drug delivery capability and configured as expansive devices or stent grafts.
  • the formulations may be delivered using a bioerodible implant by way of diffusion or by degradation of the polymeric matrix, hi certain embodiments, the administration of the formulation may be designed so as to result in sequential exposures to the triplex-forming molecules, and donor oligonucleotides, over a certain time period, for example, hours, days, weeks, months or years. This may be accomplished, for example, by repeated administrations of a formulation or by a sustained or controlled release delivery system in which the compositions are delivered over a prolonged period without repeated administrations. Administration of the formulations using such a delivery system may be, for example, by oral dosage forms, bolus injections, transdermal patches or subcutaneous implants. Maintaining a substantially constant concentration of the composition may be preferred in some cases.
  • release delivery systems include time-release, delayed release, sustained release, or controlled release delivery systems. Such systems may avoid repeated administrations in many cases, increasing convenience to the subject and the physician.
  • release delivery systems include, for example, polymer-based systems such as polylactic and/or polyglycolic acids, polyanhydrides, polycaprolactones, copolyoxalates, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and/or combinations of these.
  • Microcapsules of the foregoing polymers containing nucleic acids are described in, for example, U.S. Patent No. 5,075,109.
  • Non-polymer systems that are lipid-based including sterols such as cholesterol, cholesterol esters, and fatty acids or neutral fats such as mono-, di- and triglycerides; hydrogel release systems; liposome-based systems; phospholipid based-systems; silastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; or partially fused implants.
  • Specific examples include erosional systems in which the oligonucleotides are contained in a formulation within a matrix (for example, as described in U.S. Patent Nos.
  • the formulation may be as, for example, microspheres, hydrogels, polymeric reservoirs, cholesterol matrices, or polymeric systems.
  • the system may allow sustained or controlled release of the composition to occur, for example, through control of the diffusion or erosion/degradation rate of the formulation containing the triplex-forming molecules and donor oligonucleotides.
  • a pump-based hardware delivery system may be used to deliver one or more embodiments.
  • systems in which release occurs in bursts include systems in which the composition is entrapped in liposomes which are encapsulated in a polymer matrix, the liposomes being sensitive to specific stimuli, e.g., temperature, pH, light or a degrading enzyme and systems in which the composition is encapsulated by an ionically-coated microcapsule with a microcapsule core degrading enzyme.
  • Examples of systems in which release of the inhibitor is gradual and continuous include, e.g., erosional systems in which the composition is contained in a form within a matrix and effusional systems in which the composition permeates at a controlled rate, e.g., through a polymer.
  • Such sustained release systems can be in the form of pellets, or capsules.
  • long-term release implant may be particularly suitable in some embodiments.
  • Long-term release means that the implant containing the composition is constructed and arranged to deliver therapeutically effective levels of the composition for at least 30 or 45 days, and preferably at least 60 or 90 days, or even longer in some cases.
  • Long- term release implants are well known to those of ordinary skill in the art, and include some of the release systems described above. Compositions including triplex-forming molecules and donor oligonucleotides and methods of their use will be further understood in view of the following non-limiting example.
  • Example 1 Sequence specific tail-clamp PNA targeting human beta- globin gene to correct sickle cell mutation back to wildtype.
  • PNA was incubated at various concentrations with 1 ,5ug plasmid DNA containing the PNA binding site, 1OmM KCl, and Tris-EDTA (TE) overnight at 37 0 C, digested with restriction enzymes Nhel and Hindlll. flanking the binding site for two hours at 37°C. Reactions were run on an 8% native bis-acylamide gel and silver stained.
  • SC-I cells were counted and 2x10 cells were used for a single electroporation.
  • Cells were washed in Ix PBS, resuspended in lOO ⁇ l RPMI- 1640 with or without donor/pna mixture, and incubated at room temperature for 5 minutes prior to electroporation.
  • Cells were electroporated using a Bio Rad Gene Pulser at 200V and 95OuF.
  • 90OmL of complete SC-I media RPMI- 1640/10% Fetal bovine serum, 1% Pen-Strep, 1% L-Glutamine
  • Cells were then plated in one well of a 6- well dish with 3ml of prewarmed media and placed in a humidified incubator at 37 0 C and 5% CO 2 for 48 hours. Allele specific PCR
  • genomic DNA was harvested from 1x10 SC-I cells which were either mock-treated or treated with codon- modified globin donor and tc816 PNA using the Promega Wizard® Genomic DNA Purification Kit. 450ng of genomic DNA were used in a single allele specific PCR reaction using Platinum Taq as a polymerase. Forward and reverse primers were HBBWTCMF: 5' TTA ACG CCG GAA GAA AAA 3' (SEQ ID NO:4) HBBRl: 5' CGTGCAGCTTGTCACAGTGC 3' (SEQ ID NO: 5), respectively. Betaine was used as a supplement at IM final concentration. Reverse touchdown PCR was employed to generate allele specific product. The conditions were as follows:
  • HBB tc81 ⁇ A sequence specific tail-clamp PNA, called HBB tc81 ⁇ , was designed to target the human beta-globin (HBB) gene and facilitate correction of the sickle cell mutation back to wildtype ( Figure 1).
  • HBB tc816 binds within the first intron of the gene and sits 127 base pairs downstream from the mutation site in the first exon (HBB) ( Figure 2).
  • Gel shift analysis shows a concentration dependent band shift when duplex DNA is incubated with increasing amounts (between 0 and 1.2 ⁇ M) of HBB tc816, confirming the formation of a triplex.
  • HBB tc816 shows excellent binding at nanomolar concentrations making it a thermodynamically robust molecule.
  • HBB tc816 was delivered in combination with a donor nucleotide containing wildtype HBB sequence by co-electroporation to B- lymphoblast cells (SC-I cells) homozygous for the mutation described above.
  • Antisense codon-modified globin donor sequence is as follows: s'CTTGCCCCACAGGGCAGTAACGGCAGATTTTTCTTCCGGCGTTA
  • AATGCACCATGGTGTCTGTTTGAGGT 3' (SEQ ID NO:6).
  • the nucleotides in bold font represent changes to the genomic DNA but not to the encoded amino acid.
  • the three boxed nucleotides represent the corrected codon 6 which reverts the mutant Valine back to the wildtype Glutamic acid.
  • Allele specific PCT shows HBB tc816 successfully reverted the sickle cell mutation (GTG: Valine 6) to wildtype (GAG: Glutamic acid 6) in the B- lymphoblast cells.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention porte sur des compositions qui contiennent des molécules qui se lient à de l'ADN duplex d'une manière spécifique de séquence pour former une structure triple brin. Des molécules formant un triplex facilitent le déplacement de brin et la formation de triplex, désigné en tant que « clamp », dans lequel une molécule se lie au brin cible par liaison Hoogsteen et l'autre molécule se lie au brin cible par liaison Watson-Crick d'une manière spécifique de séquence. Une « queue » de liaison Watson-Crick ajoutée à la fin de la parte de liaison Watson-Crick du « clamp » augmente la stringence de liaison du duplex cible, améliore la fréquence de modification au niveau du site cible, et réduit la nécessité d'une extension de poly-purine:poly-pyrimidine par comparaison à des oligonucléotides formant un triplex (TFO) ou des acides nucléiques peptidiques (PNA). Lorsqu'elles sont administrées en combinaison avec un oligonucléotide donneur, les molécules formant un triplex peuvent améliorer la recombinaison d'un oligonucléotide donneur au niveau du site cible. L'invention porte également sur des procédés ex vivo et in vivo de correction génique chez des patients à l'aide des compositions décrites.
PCT/US2010/031888 2009-04-21 2010-04-21 Compositions et procédés de thérapie génique ciblée WO2010123983A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US17111609P 2009-04-21 2009-04-21
US61/171,116 2009-04-21

Publications (1)

Publication Number Publication Date
WO2010123983A1 true WO2010123983A1 (fr) 2010-10-28

Family

ID=42341420

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/031888 WO2010123983A1 (fr) 2009-04-21 2010-04-21 Compositions et procédés de thérapie génique ciblée

Country Status (1)

Country Link
WO (1) WO2010123983A1 (fr)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011053989A3 (fr) * 2009-11-02 2012-03-01 Yale University Matériels polymères chargés d'acides nucléiques mutagènes et recombinagènes
WO2017143042A2 (fr) 2016-02-16 2017-08-24 Yale University Compositions permettant d'améliorer l'édition ciblée de gènes et leurs procédés d'utilisation
WO2017143061A1 (fr) 2016-02-16 2017-08-24 Yale University Compositions et procédés pour le traitement de la mucoviscidose
WO2018187493A1 (fr) 2017-04-04 2018-10-11 Yale University Compositions et procédés d'administration in utero
WO2019022434A1 (fr) * 2017-07-24 2019-01-31 Olipass Corporation Oligonucléotides antisens de la tyrosinase
WO2020033951A1 (fr) 2018-08-10 2020-02-13 Yale University Compositions et procédés d'édition de gène embryonnaire in vitro
WO2020047344A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et méthodes permettant d'améliorer l'édition génique à base d'oligonucléotides donneur
WO2020047353A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et procédés pour améliorer l'édition de gènes à base de triplex et de nucléase
WO2020112195A1 (fr) 2018-11-30 2020-06-04 Yale University Compositions, technologies et procédés d'utilisation de plérixafor pour améliorer l'édition de gènes
WO2020257776A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions d'acides nucléiques peptidiques ayant des segments de liaison de type hoogsteen modifiés et leurs procédés d'utilisation
WO2020257779A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions pna à gamma-hydroxyméthyle modifiée et leurs procédés d'utilisation
WO2021050568A1 (fr) 2019-09-09 2021-03-18 Yale University Nanoparticules pour absorption sélective de tissu ou cellulaire
US11739124B2 (en) 2018-08-14 2023-08-29 Olipass Corporation Acetyl-CoA carbosylase2 antisense oligonucleotides
US11896686B2 (en) 2014-05-09 2024-02-13 Yale University Hyperbranched polyglycerol-coated particles and methods of making and using thereof
US11918695B2 (en) 2014-05-09 2024-03-05 Yale University Topical formulation of hyperbranched polymer-coated particles

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070219122A1 (en) * 2005-11-23 2007-09-20 Glazer Peter M Modified triple-helix forming oligonucleotides for targeted mutagenesis
WO2008086529A2 (fr) * 2007-01-11 2008-07-17 Yale University Compositions et méthodes destinées à l'inactivation ciblée de récepteurs de surface cellulaire pour le vih

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070219122A1 (en) * 2005-11-23 2007-09-20 Glazer Peter M Modified triple-helix forming oligonucleotides for targeted mutagenesis
WO2008086529A2 (fr) * 2007-01-11 2008-07-17 Yale University Compositions et méthodes destinées à l'inactivation ciblée de récepteurs de surface cellulaire pour le vih

Non-Patent Citations (49)

* Cited by examiner, † Cited by third party
Title
ABES ET AL., J. CONTROLL. RED., vol. 110, 2006, pages 595 - 604
BEAL; DERVAN, NUC. ACIDS RES., vol. 11, 1992, pages 2773
BEAL; DERVAN, SCIENCE, vol. 251, 1991, pages 1360
BENTIN ET AL., BIOCHEMISTRY, vol. 42, no. 47, 2003, pages 13987 - 95
BENTIN T ET AL: "Combined Triplex/Duplex Invasion of Double-Stranded DNA by Tail Clamp Peptide Nucleic Acid", BIOCHEMISTRY, vol. 42, no. 47, 1 January 2003 (2003-01-01), pages 13987 - 13995, XP002988578, ISSN: 0006-2960 *
BLUME ET AL., NUCLEIC ACIDS RES., vol. 20, 1992, pages 1777
BRAASCH ET AL., CHEM. BIOL., vol. 8, no. 1, 2001, pages 1 - 7
CAPECCHI, M.R., SCIENCE, vol. 244, no. 4910, 1989, pages 1288 - 1292
CHIN JOANNA Y ET AL: "Correction of a splice-site mutation in the beta-globin gene stimulated by triplex-forming peptide nucleic acids", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 105, no. 36, September 2008 (2008-09-01), pages 13514 - 13519, XP002597005, ISSN: 0027-8424 *
COONEY ET AL., SCIENCE, vol. 241, 1988, pages 456
DURLAND ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 9246
DUVAL-VALENTIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 504
FELSENFELD ET AL., J AM. CHEM. SOC., vol. 79, 1957, pages 2023
FRANCOIS ET AL., PROC. NATL. ACAD SCI. USA, vol. 86, 1989, pages 9702
GRIGORIEV ET AL., J OFBIOLOGICAL CHEM., vol. 267, 1992, pages 3389
GRIGORIEV ET AL., J. OF BIOLOGICAL CHEM., vol. 267, 1992, pages 3389
HANNA, J. ET AL., SCIENCE, vol. 318, 2007, pages 1920 - 1923
HANSON ET AL., MOL. CELL. BIOL., vol. 15, no. 1, 1995, pages 45 - 51
HUANG ET AL., FEBSLETT., vol. 558, no. 1-3, 2004, pages 69 - 73
ITO ET AL., PROC. NATL. ACAD SCI. USA, vol. 89, 1992, pages 495
KAIHATSU ET AL., BIOCHEMISTRY, vol. 42, no. 47, 2003, pages 13996 - 4003
KAIHATSU KUNIHIRO ET AL: "Extending recognition by peptide nucleic acids (PNAs): Binding to duplex DNA and inhibition of transcription by tail-clamp PNA-peptide conjugates.", BIOCHEMISTRY, vol. 42, no. 47, 2 December 2003 (2003-12-02), pages 13996 - 14003, XP002597006, ISSN: 0006-2960 *
KOPPELHUS ET AL., ADV. DRUG DELIV. REV., vol. 55, no. 2, 2003, pages 267 - 280
LIN ET AL., BIOCHEMISTRY, vol. 28, 1989, pages 1054
LORENZ ET AL., BIOORG. MED CHERN. LETT., vol. 14, no. 19, 2004, pages 4975 - 4977
LUENS ET AL., BLOOD, vol. 91, 1998, pages 1206 - 1215
MA ET AL., ANTISENSE NUCLEIC ACID DRUG DEV., vol. 8, 1998, pages 415 - 426
MAHER ET AL., BIOCHEMISTRY, vol. 31, 1992, pages 70
MAHER ET AL., SCIENCE, vol. 245, 1989, pages 725
MERGNY ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 9791
MOSER; DERVAN, SCIENCE, vol. 238, 1987, pages 645
NYCE ET AL., NATURE, vol. 385, 1997, pages 721 - 725
ORSON ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 3435
PEI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 9858
PERROUAULT ET AL.: "344", NATURE, 1990, pages 358
POSTAL ET AL., PROC. NATL. ACAD SCI. USA, vol. 88, 1991, pages 8227
POSVIC; DERVAN, J, AM. CHEM SOC., vol. 112, 1992, pages 9428
PRASEUTH ET AL., PROC. NATL. ACAD SCI. USA, vol. 85, 1988, pages 1349
R.H. DURLAND ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 9246
ROGERS ET AL., PROC. NATL. ACAD SCI. U.S.A., vol. 99, no. 26, 2002, pages 16695 - 700
ROGERS F A ET AL: "SITE-DIRECTED RECOMBINATION VIA BIFUNCTIONAL PNA-DNA CONJUGATES", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES (PNAS), vol. 99, no. 26, 24 December 2002 (2002-12-24), pages 16695 - 16700, XP001164177, ISSN: 0027-8424 *
RUMP ET AL., BIOCHEM. PHARMACOL., vol. 59, no. 11, 2000, pages 1407 - 1416
SOUTSCHEK ET AL., NATURE, vol. 432, no. 7014, 2004, pages 173 - 178
STERCHAK, E. P. ET AL., ORGANIC CHEM., vol. 52, 1987, pages 4202
STROBEL ET AL., SCIENCE, vol. 254, 1991, pages 1639
TAKASUGI ET AL., PROC. NATL. ACAD SCI. USA, vol. 88, 1991, pages 5602
TAKASUGI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 5602
YOUNG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10023
ZIELKE ET AL., METHODS CELL BIOL., vol. 8, 1974, pages 107 - 121

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011053989A3 (fr) * 2009-11-02 2012-03-01 Yale University Matériels polymères chargés d'acides nucléiques mutagènes et recombinagènes
US11918695B2 (en) 2014-05-09 2024-03-05 Yale University Topical formulation of hyperbranched polymer-coated particles
US11896686B2 (en) 2014-05-09 2024-02-13 Yale University Hyperbranched polyglycerol-coated particles and methods of making and using thereof
US11136597B2 (en) 2016-02-16 2021-10-05 Yale University Compositions for enhancing targeted gene editing and methods of use thereof
WO2017143042A2 (fr) 2016-02-16 2017-08-24 Yale University Compositions permettant d'améliorer l'édition ciblée de gènes et leurs procédés d'utilisation
WO2017143061A1 (fr) 2016-02-16 2017-08-24 Yale University Compositions et procédés pour le traitement de la mucoviscidose
WO2017143042A3 (fr) * 2016-02-16 2017-10-19 Yale University Compositions permettant d'améliorer l'édition ciblée de gènes et leurs procédés d'utilisation
CN109476706A (zh) * 2016-02-16 2019-03-15 耶鲁大学 用于促进靶向基因编辑的组合物及其使用方法
WO2018187493A1 (fr) 2017-04-04 2018-10-11 Yale University Compositions et procédés d'administration in utero
WO2019022434A1 (fr) * 2017-07-24 2019-01-31 Olipass Corporation Oligonucléotides antisens de la tyrosinase
WO2020033951A1 (fr) 2018-08-10 2020-02-13 Yale University Compositions et procédés d'édition de gène embryonnaire in vitro
US11739124B2 (en) 2018-08-14 2023-08-29 Olipass Corporation Acetyl-CoA carbosylase2 antisense oligonucleotides
WO2020047344A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et méthodes permettant d'améliorer l'édition génique à base d'oligonucléotides donneur
WO2020047353A1 (fr) 2018-08-31 2020-03-05 Yale University Compositions et procédés pour améliorer l'édition de gènes à base de triplex et de nucléase
WO2020112195A1 (fr) 2018-11-30 2020-06-04 Yale University Compositions, technologies et procédés d'utilisation de plérixafor pour améliorer l'édition de gènes
WO2020257779A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions pna à gamma-hydroxyméthyle modifiée et leurs procédés d'utilisation
WO2020257776A1 (fr) 2019-06-21 2020-12-24 Yale University Compositions d'acides nucléiques peptidiques ayant des segments de liaison de type hoogsteen modifiés et leurs procédés d'utilisation
WO2021050568A1 (fr) 2019-09-09 2021-03-18 Yale University Nanoparticules pour absorption sélective de tissu ou cellulaire

Similar Documents

Publication Publication Date Title
WO2010123983A1 (fr) Compositions et procédés de thérapie génique ciblée
US20100172882A1 (en) Compositions and methods for targeted inactivation of hiv cell surface receptors
US20110262406A1 (en) Compositions and methods for targeted inactivation of hiv cell surface receptors
US8309356B2 (en) Pseudocomplementary oligonucleotides for targeted gene therapy
ES2852998T3 (es) Oligonucleótidos para inducir la expresión de UBE3A paterno
US20110293585A1 (en) Compositions and methods for treatment of lysosomal storage disorders
US8658608B2 (en) Modified triple-helix forming oligonucleotides for targeted mutagenesis
US20150232846A1 (en) Pseudocircularization oligonucleotides for modulating rna
WO2014203518A1 (fr) Acide nucléique antisens a double brin ayant un effet de saut d'exon
JP2016531570A (ja) ユークロマチン領域を標的とするオリゴヌクレオチド
JP2016521556A (ja) Ｆｏｘｐ３発現を調節するための組成物及び方法
CA3103756A1 (fr) Oligonucleotides pour moduler l'expression de scn9a
US11066669B2 (en) Oligonucleotides for modulating ATXN2 expression
US20190365795A1 (en) Oligonucleotides for modulating atxn2 expression
WO2022261115A1 (fr) Acides nucléiques peptidiques pour la régulation spatio-temporelle de la liaison de crispr-cas
JP7499267B2 (ja) Ａｔｘｎ２発現を調節するためのオリゴヌクレオチド
EP4083208A1 (fr) Acide nucléique antisens qui induit le saut de l'exon 50
US11286485B2 (en) Oligonucleotides for modulating ATXN2 expression
JP2024088642A (ja) プログラム可能ヌクレアーゼのあるゲノム編集及びプログラム可能ヌクレアーゼのないゲノム編集のための改善された方法
WO2020112195A1 (fr) Compositions, technologies et procédés d'utilisation de plérixafor pour améliorer l'édition de gènes
WO2020257779A1 (fr) Compositions pna à gamma-hydroxyméthyle modifiée et leurs procédés d'utilisation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 10715635

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 10715635

Country of ref document: EP

Kind code of ref document: A1