US20170182171A1 - Multiple oligonucleotide moieties on peptide carrier - Google Patents

Multiple oligonucleotide moieties on peptide carrier Download PDF

Info

Publication number
US20170182171A1
US20170182171A1 US15/313,405 US201515313405A US2017182171A1 US 20170182171 A1 US20170182171 A1 US 20170182171A1 US 201515313405 A US201515313405 A US 201515313405A US 2017182171 A1 US2017182171 A1 US 2017182171A1
Authority
US
United States
Prior art keywords
pmo
cpp
linker
aon
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US15/313,405
Other languages
English (en)
Inventor
Timothy E. Weeden
Carol A. Nelson
Bruce M. Wentworth
Nicholas P. CLAYTON
Andrew Leger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genzyme Corp
Original Assignee
Genzyme Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corp filed Critical Genzyme Corp
Priority to US15/313,405 priority Critical patent/US20170182171A1/en
Assigned to GENZYME CORPORATION reassignment GENZYME CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: LEGER, ANDREW, WEEDEN, TIMOTHY E., NELSON, CAROL A., CLAYTON, Nicholas P., WENTWORTH, BRUCE M.
Publication of US20170182171A1 publication Critical patent/US20170182171A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A61K47/48092
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088Compounds having three or more nucleosides or nucleotides
    • A61K31/712Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/62Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being a protein, peptide or polyamino acid
    • A61K47/64Drug-peptide, drug-protein or drug-polyamino acid conjugates, i.e. the modifying agent being a peptide, protein or polyamino acid which is covalently bonded or complexed to a therapeutically active agent
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K19/00Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • C12N2310/3145Phosphoramidates with the nitrogen in 3' or 5'-position
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3513Protein; Peptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/30Special therapeutic applications
    • C12N2320/32Special delivery means, e.g. tissue-specific

Definitions

  • the present disclosure relates to antisense oligonucleotides (AONs), such as, but not limited to, phosphorodiamidate morpholino oligonucleotides (PMOs).
  • AONs antisense oligonucleotides
  • PMOs phosphorodiamidate morpholino oligonucleotides
  • the present disclosure further relates to the conjugation of multiple PMOs to cationic cell penetrating peptides (CPPs) to enhance the uptake of PMOs into tissues of interest, such as skeletal and cardiac muscle cells.
  • CPPs cationic cell penetrating peptides
  • the present disclosure encompasses such conjugates, as well as methods of their use, including for example, using them to modulate gene expression.
  • the present disclosure further includes methods of treating various disease states by administering to a human or animal in need thereof said multiple PMO-CPP conjugates.
  • AONs have been shown to successfully modulate gene expression both in vitro and in vivo in various disease states, including for example Duchenne muscular dystropy (DMD).
  • DMD Duchenne muscular dystropy
  • PMOs designed to target and remove the in-frame exon 23 have been successful at restoring dystrophin function in the mdx mouse model of DMD.
  • AONs have also been shown to exhibit a poor uptake profile in skeletal and cardiac muscle cells, which hampers their ability to affect mRNA transcription and translation.
  • PMOs, 2-O-methyl oligonucleotides, and peptide nucleic acids (PNAs) do not appreciably accumulate in skeletal muscle and their uptake in heart muscle is negligible.
  • CPPs Cell penetrating peptides
  • WO 2009/144481 relates to a construct comprising a cell delivery peptide in a complex with a biologically active compound, such as an AON, including for example a PMO.
  • WO 2004/097017 (US 2004/0265879 and US 2009/0082547) relates to method for enhancing delivery of molecules, including disclosing a conjugate of a biological agent, such as a PMO, and a peptide transporter.
  • WO 2009/147368 discloses novel CPPs, which may be conjugated to for example PNAs and PMOs.
  • US 2010/0130591 discloses PMOs capable of binding to a selected target site in the human dystrophin gene that may be conjugated to a CPP.
  • the conjugates possess an increased toxicity compared to the naked PMOs.
  • the maximum tolerated dose for the mdx mouse exon 23 skipping studies using CPP-PMO23B or CPP-PMO23K was shown to be 30 mg/kg. At amounts of 60 mg/kg, the mice lost weight and doses of 150 mg/kg were lethal.
  • the naked PMO23 could be administered in amounts as high as 250 mg/kg without any noticeable toxic effects [Op. Cit.].
  • WO 2009/005793 discloses that CPPs having below four X (6-aminohexanoic acid) residues, including CPP “B” exhibited lower toxicity than previously identified CPPs. As shown above, however, these CPPs coupled to a single PMO still exhibit unacceptable toxicity compared to the naked PMOs [Op Cit. and Moulton and Moulton Biochemica et Biophysica Acta 2010].
  • Multiple conjugation sites on the CPP are introduced by adding glutamic acid in the D- or L-enantiomeric position to reduce stearic hindrance of multiple PMOs in close proximity at the termini of the CPP.
  • the use of a peptidase cleavage site with the amino acids Phenylalanine-Lysine at the P1, ⁇ P1 positions is introduced between the CPP and the PMO. Cleavage of the peptidase cleavage site releases the PMO from the CPP.
  • the CPP may be attached to the PMO via a maleimide esterized linker with an enzyme cleavage site Phenylalanine-Lysine or Valine-Citruline that could be introduced at a cysteine position.
  • the CPP may also be attached via an amide bond.
  • the present disclosure also contemplates a method for increasing the safety margin of a single PMO-CPP conjugate by substituting conjugates according to the present disclosure.
  • the present disclosure further includes methods of modulating gene expression, such as those encoding for glycogen synthase (GYS1 or GYS2), transforming growth factor (TGF ⁇ ), matrix metallopeptidase (MMP2 or MMP9), osteopontin, myotonic dystrophy protein kinase (DMPK), Elav-Like Family Member 2 (also known as CUG Triplet Repeat RNA-Binding Protein or CUGBP), double homeobox 4 (DUX4), and/or (Frzl).
  • glycogen synthase GYS1 or GYS2
  • TGF ⁇ transforming growth factor
  • MMP2 or MMP9 matrix metallopeptidase
  • osteopontin myotonic dystrophy protein kinase
  • DMPK Elav-Like Family Member 2 (also known as CUG Triplet Repeat RNA-Binding Protein or CUGBP), double homeobox 4 (DUX4), and/or (Frzl)
  • GYS1 or GYS2 transforming growth factor
  • MMP2 or MMP9 matrix metallopeptidase
  • osteopontin myotonic dystrophy protein kinase
  • DMPK Elav-Like Family Member 2
  • DUX4 double homeobox 4
  • Frzl double homeobox 4
  • the present disclosure also includes within its scope the use of multiple PMO-CPP conjugates for the suppression of microRNAs in various disease states.
  • the present disclosure includes methods of treating various diseases and/or conditions, such as
  • FIG. 1 is a schematic of the configurations of the multiple AONs attached to a single CPP.
  • FIG. 2 is a schematic of the various antisense oligonucleotide subunits that could be oligomerized and used in a multiple AON configuration of the instant invention.
  • FIG. 3 is depicts the effects of some of the CPP-PMO conjugates on exon 23 skipping in wild-type mice.
  • the efficacious dose was found to be 30 mg/kg and the NOAEL was also 30 mg/kg. As a result, there was little or no safety margin.
  • the multiple PMO-CPP conjugate has a safety margin that is better than the mdx/exon 23 experiments described above, such as better than 2-fold, such as better than 5-fold, such as better than 6-fold, such as better than 10-fold.
  • a 10-fold safety margin means that the efficacious dose is 10 times lower than the NOAEL.
  • the multiple PMO-CPP conjugates according to the present disclosure may have a safety margin of at least 2-fold better than the corresponding single PMO-CPP conjugate.
  • the present invention comprises multiple AON, including PMO AON, attached to a single CPP.
  • the multiple AON-CPP conjugate further comprises a cleavable linker.
  • the linker is a sequence that contains a cleavage motif.
  • the cleavage motif can be cleaved by any hydrolytic enzyme.
  • the cleavage motif can be cleaved by a peptidase or protease such as cathepsin or trypsin.
  • the linker can be designed to include a cleavage motif recognized by a particular serine protease, threonine protease, cysteine protease, aspartate protease, glutamic acid protease, or metalloprotease, or a group of more than one peptidase.
  • the linker may include two or more cleavage motifs that are overlapping or nonoverlapping.
  • the linker may contain no cleavage motifs.
  • the linker may be designed so that less than 100%, less than 75%, less than 50%, or less than 10% of the linkers are cleaved. In some embodiments, the linker is designed so that greater than 90% or 99% of the linkers are cleaved.
  • the multiple AON-CPP conjugate further comprises a cleavable linker, such as FK at the P1/P1′ position or in another embodiment, FX at the P1/P1′ position where X is any naturally occurring amino acid.
  • the cleavable linker wherein said linker is cleavable by a hydrolytic enzyme such as for example cathepsin, can occur in between the AON and the CPP or it can occur in a sequence such as AON-cleavable linker-AON-cleavable linker-CPP.
  • the multiple PMO-CPP conjugate further comprises a cleavable linker, such as cathepsin, or FK at the P1/P1′ position or in another embodiment, FX at the P1/P1′ position where X is any naturally occurring amino acid.
  • the cleavable linker can occur in between the PMO and the CPP or it can occur in a sequence such as PMO-cleavable linker-PMO-cleavable linker-CPP, e.g. as PMO-cathepsin linker-PMO-cathepsin linker-CPP.
  • the present disclosure does not limit the order of the AONs (including PMOs), cleavable linkers, and CPP, and one skilled in the art will be able to design a suitable multiple AON-CPP conjugate having at least one cathepsin cleavage site according to the claims using the information disclosed herein.
  • a multiple PMO-CPP conjugate has at least one cleavable linker site.
  • a multiple PMO-CPP conjugate has at least one cathepsin cleavable linker site.
  • the present disclosure further includes methods of modulating gene expression, such as those encoding for glycogen synthase (GYS1 or GYS2), transforming growth factor (TGF ⁇ ), matrix metallopeptidase (MMP2 or MMP9), osteopontin, myotonic dystrophy protein kinase (DMPK), Elav-Like Family Member 2 (also known as CUG Triplet Repeat RNA-Binding Protein or CUGBP), double homeobox 4 (DUX4), and/or (Frzl), wherein the multiple AON-CPP conjugates of the present invention to mediate exon skipping to create a frame shift mutation. Any frame shift mutation could result in the knock-down of mRNA targeted.
  • GYS1 or GYS2 glycogen synthase
  • TGF ⁇ transforming growth factor
  • MMP2 or MMP9 matrix metallopeptidase
  • osteopontin osteopontin
  • DMPK myotonic dystrophy protein kinase
  • the present disclosure also includes within its scope the use of multiple PMO-CPP conjugates for the suppression of microRNAs in various disease states.
  • the present disclosure includes methods of treating various diseases and/or conditions, such as those associated with the genes and microRNAs mentioned above.
  • the multiple CPP-PMO conjugates of the present disclosure may be administered to a human or animal in need thereof by any suitable means. Administration to a human or animal subject may be selected from parenteral, intramuscular, intracerebral, intravasulcar, subcutaneous, or transdermal.
  • the route of administration is by injection, such as intravenously or intramuscularly. A treating physician will be able to determine the appropriate route of administration.
  • the multiple CPP-PMO conjugates antisense oligonucleotides disclosed herein can be formulated with a pharmaceutically acceptable excipient or carriers to be formulated into a pharmaceutical composition.
  • the multiple CPP-PMO conjugates antisense oligonucleotides can be administered in the form of pharmaceutical compositions.
  • These compounds can be administered by a variety of routes including oral, rectal, transdermal, subcutaneous, intravenous, intramuscular, and intranasal. These compounds are effective as both injectable and oral compositions.
  • Such compositions are prepared in a manner well known in the pharmaceutical art and comprise at least one active compound.
  • compositions which contain, as the active ingredient, one or more of the multiple CPP-PMO conjugates antisense oligonucleotides associated with one or more pharmaceutically acceptable excipients or carriers.
  • the active ingredient is usually mixed with an excipient or carrier, diluted by an excipient or carrier or enclosed within such an excipient or carrier which can be in the form of a capsule, sachet, paper or other container.
  • the excipient or carrier serves as a diluent, it can be a solid, semi-solid, or liquid material, which acts as a vehicle, carrier or medium for the active ingredient.
  • compositions can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, aerosols (as a solid or in a liquid medium), ointments containing, for example, up to 10% by weight of the active compound, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and sterile packaged powders.
  • the active compound In preparing a formulation, it may be necessary to mill the active compound to provide the appropriate particle size prior to combining with the other ingredients. If the active compound is substantially insoluble, it ordinarily is milled to a particle size of less than 200 mesh. If the active compound is substantially water soluble, the particle size is normally adjusted by milling to provide a substantially uniform distribution in the formulation, e.g. about 40 mesh.
  • excipients or carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose.
  • the formulations can additionally include: lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents.
  • the compositions of the invention can be formulated so as to provide quick, sustained or delayed release of the active ingredient after administration to the patient by employing procedures known in the art.
  • compositions are preferably formulated in a unit dosage form, each dosage containing from about 5 mg to about 100 mg or more, such as any of about 5 mg to about 10 mg, about 5 mg to about 20 mg, about 5 mg to about 30 mg, about 5 mg to about 40 mg, about 5 mg to about 50 mg, about 5 mg to about 60 mg, about 5 mg to about 70 mg, about 5 mg to about 80 mg, or about 5 mg to about 90 mg, inclusive, including any range in between these values, of the active ingredient.
  • unit dosage forms refers to physically discrete units suitable as unitary dosages for individuals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient or carrier.
  • the multiple CPP-PMO conjugates antisense oligonucleotides are effective over a wide dosage range and are generally administered in a therapeutically effective amount. It will be understood, however, that the amount of the multiple CPP-PMO conjugates antisense oligonucleotides actually administered will be determined by a physician, in the light of the relevant circumstances, including the condition to be treated, the chosen route of administration, the actual compound administered, the age, weight, and response of the individual patient, the severity of the patient's symptoms, and the like.
  • the principal active ingredient/multiple CPP-PMO conjugates antisense oligonucleotide is mixed with a pharmaceutical excipient or carrier to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention.
  • a pharmaceutical excipient or carrier to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention.
  • these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.
  • the tablets or pills of the present invention may be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action.
  • the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
  • the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permit the inner component to pass intact into the duodenum or to be delayed in release.
  • enteric layers or coatings such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.
  • liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as corn oil, cottonseed oil, sesame oil, coconut oil, or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
  • compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders.
  • the liquid or solid compositions may contain suitable pharmaceutically acceptable excipients as described supra.
  • the compositions can be administered by the oral or nasal respiratory route for local or systemic effect.
  • Compositions in pharmaceutically acceptable solvents may be nebulized by use of inert gases. Nebulized solutions may be inhaled directly from the nebulizing device or the nebulizing device may be attached to a face mask tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may also be administered, orally or nasally, from devices which deliver the formulation in an appropriate manner.
  • the multiple CPP-AON, including CPP-PMO, conjugates according to the present disclosure may be administered in a daily dose ranging from 1-200 mg/kg, such as from 10-50 mg/kg.
  • the CPP-AON conjugate, including CPP-PMO may be administered in bolus form or over a prolonged injection period.
  • the daily dosage can be administered in one bolus dose.
  • the daily dosage can be administered via injection, such as intravenously, or subcutaneously.
  • the daily dosage can be divided into several administrations, such as two times, three times, or four times a day. Dosing may be repeated daily as needed as determined by the treating physician.
  • Treatment may be short-term, such as for less than 6 months.
  • treatment may be long-term, such as greater than 6 months, such as greater than 1 year, such as greater than 10 years, such as over the lifetime of the human or animal in need of treatment.
  • the multiple AON conjugate, including PMO-CPP, conjugates of the present disclosure specifically hybridize with one or more of pre-mRNA, mRNA, and/or microRNA or long non-coding RNA transcribed from a target gene or locus.
  • a multiple PMO-CPP conjugate specifically hybridizes to a target polynucleotide, such as pre-mRNA or mRNA, when the multiple PMO-CPP conjugate hybridizes to the target under physiological conditions.
  • hybridization occurs via hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary purine and pyrimidine bases.
  • adenine (A) and thymine (T) are complementary nucleobases which pair through the formation of hydrogen bonds.
  • the PMO portion of the multiple PMO-CPP conjugate specifically hybridizes to the target nucleotide.
  • the CPP moiety can remain tethered to the multiple PMO-CPP conjugate or it can be cleaved prior to hybridization, such as for example at a cathepsin cleavage site.
  • PMO compounds of the present disclosure are complementary to a target polynucleotide, such as pre-mRNA, mRNA, or microRNA, or long non-coding RNA when hybridization occurs according to generally accepted base-pairing rules, e.g., adenine (A)-thymine (T), cytosine (C)-guanine (G), adenine (A)-uracil (U).
  • base-pairing rules e.g., adenine (A)-thymine (T), cytosine (C)-guanine (G), adenine (A)-uracil (U).
  • base-pairing rules e.g., adenine (A)-thymine (T), cytosine (C)-guanine (G), adenine (A)-uracil (U).
  • base-pairing rules e.g., adenine (A)-thymine (T), cytosine (C)-guanine (
  • a base (B) at a certain position of a PMO compound is capable of hydrogen binding with a nucleotide at the same position of a pre-mRNA or mRNA molecule
  • the PMO and the target polynucleotide molecule are considered to be complementary to each other at that position.
  • the PMO compound and target polynucleotide molecule are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by bases that can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the PMO and the polynucleotide target.
  • Absolute complementarity i.e., a 100% complementary base pair match, is not necessary as long as the heteroduplex formed between the target polynucleotide molecule and the PMO has the desired stability sufficient to provoke the desired effect.
  • a PMO is specifically hybridizable when binding of the PMO compound to the target polynucleotide molecule changes the normal function of the target polynucleotide molecule, and there is a sufficient degree of complementarity to avoid undesirable non-specific binding of the PMO to a non-target sequence under conditions in which specific binding is desired, for example under physiological conditions for in vivo applications or under conditions in which assays are performed for in vitro applications.
  • hybridization between a PMO and a target polynucleotide molecule interferes with their normal functions, such as translation of protein from the mRNA and splicing of the pre-mRNA to yield one or more mRNA species.
  • the hybridization between the PMO and pre-mRNA affects the splicing of the pre-mRNA to form RNA.
  • the hybridization affects the translation of a protein from mRNA.
  • the hybridization of the multiple CPP-AON conjugate to a micro RNA binding site on a pre-mRNA or mRNA can relieve the target pre-mRNA or mRNA from subsequent regulation by the micro RNA.
  • the effect could be to enhance expression of the gene product encoded by the pre mRNA or mRNA.
  • the multiple CPP-AON for example, a multiple-CPP PMO
  • the effect would probably be to enhance expression of a variety of gene products under repression by that particular micro RNA.
  • modulation means either an increase (stimulation) or a decrease (inhibition) in the expression of a gene.
  • AONs include PMO compounds as well as PNA compounds, phosphoramidate compounds, methylene methylimino (“MMI”) compounds, 2-O-methyl compounds and 2-methoxy ethyl compounds, wherein the oligonucleobase of each subunit are set forth in FIG. 1 .
  • the oligonucleotide compounds are synthetic analogs of natural nucleic acids.
  • the oligonucleotide compounds instead of deoxyribose rings and phosphate-linkages, the oligonucleotide compounds comprise subunits comprised of the respective oligonucleotide subunits shown below:
  • B is a nucleotide base.
  • the primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine (DNA and RNA), thymine (DNA) and uracil (RNA), abbreviated as C, G, A, T, and U, respectively.
  • A, G, C, and T appear in DNA, these molecules are called DNA-bases;
  • A, G, C, and U are called RNA-bases.
  • Uracil replaces thymine in RNA.
  • Adenine and guanine belong to the double-ringed class of molecules called purines (abbreviated as R). Cytosine, thymine, and uracil are all pyrimidines (abbreviated as Y).
  • PMO compounds possess subunits comprised of morpholine rings and phosphorodiamidate-linking groups, respectively.
  • the present disclosure includes a PMO compound comprising from 15 to 30 subunits of Formula (II):
  • R is an alkyl group and B is a naturally occurring purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • PNA compounds possess subunits comprised of subunits of Formula I.
  • a PMO compound comprising from 15 to 30 subunits of Formula I:
  • B is a purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • Phosphoramidate compounds possess subunits comprised of subunits of Formula III.
  • a phosphoramidate compound comprising from 15 to 30 subunits of Formula III:
  • B is a purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • MMI compounds possess subunits comprised of the subunits of Formula IV.
  • the present disclosure includes an MMI compound comprising from 15 to 30 subunits of Formula (IV):
  • B is a purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • 2-OMe compounds possess subunits comprised of Formula V.
  • the present disclosure includes a 2-OMe compound comprising from 15 to 30 subunits of Formula (V):
  • B is a purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • 2-MOE compounds possess subunits comprised of Formula VI.
  • the present disclosure includes a 2MOE compound comprising from 15 to 30 subunits of Formula (VI):
  • B is a purine or pyrimidine nucleotide base selected from cytosine (C), guanine (G), adenine (A), or thymine (T).
  • AON-CPP is set forth in the description, e.g. 2MOE-CPP, MMI-CPP, 2-OMe-CPP, PNA-CPP, and Phosphoramidate-CPP.
  • the AON compound has from 15-25 subunits of formula (I), (II), (Ill), (IV), (V), or (VI). In another embodiment, the AON compound has from 20-25 subunits of formula (I), (II), (Ill), (IV), (V), or (VI). In yet another embodiment, the AON compound has about 25 subunits of formula (I), (II), (III), (IV), (V), or (VI), such as from 24-26 subunits.
  • the multiple PMO-CPP conjugates have less than 60% of PMO subunits where the nucleobase (B) is C or G. In at least one embodiment, the multiple PMO-CPP conjugate has less than 50% of PMO subunits where the nucleobase is C or G.
  • the multiple AON-CPP conjugates have less than 60% of AON (of formula (I), (II), (Ill), (IV), (V), or (VI)) subunits where the nucleobase (B) is C or G. In at least one embodiment, the multiple AON-CPP conjugate has less than 50% of AON subunits where the nucleobase is C or G.
  • the multiple PMO-CPP conjugates of the present disclosure have at least two PMO compounds having from 0 to 3 repeating subunits where the nucleobase is G. In at least one embodiment, the multiple PMO-CPP conjugate has 0 repeating subunits where B is G. In another embodiment the multiple PMO-CPP conjugate has 1, 2, or 3 repeating subunits where B is G. Multiple conjugation sites on the CPP are introduced by adding glutamic acid in the D- or L-enantiomeric position to reduce stearic hindrance of multiple PMOs in close proximity at the termini of the CPP.
  • a peptidase cleavage site with the amino acids Phenylalanine-Lysine at the P1, ⁇ P1 positions is introduced between the CPP and the PMO. Cleavage of the peptidase cleavage site releases the PMO from the CPP.
  • the CPP may be attached to the PMO via a maleimide esterized linker with an enzyme cleavage site Phenylalanine-Lysine or Valine-Citruline that could be introduced at a cysteine position.
  • the CPP may be attached by an amide linkage.
  • the multiple AON-CPP conjugates of the present disclosure have at least two AON compounds having from 0 to 3 repeating subunits where the nucleobase is G. In at least one embodiment, the multiple AON-CPP conjugate has 0 repeating subunits where B is G. In another embodiment the multiple AON-CPP conjugate has 1, 2, or 3 repeating subunits where B is G. Multiple conjugation sites on the CPP are introduced by adding glutamic acid in the D- or L-enantiomeric position to reduce stearic hindrance of multiple AONs in close proximity at the termini of the CPP.
  • a peptidase cleavage site with the amino acids Phenylalanine-Lysine at the P1, ⁇ P1 positions is introduced between the CPP and the AON. Cleavage of the peptidase cleavage site releases the AON from the CPP.
  • the CPP may be attached to the AON via a maleimide esterized linker with an enzyme cleavage site Phenylalanine-Lysine or Valine-Citruline that could be introduced at a cysteine position.
  • the CPP may be attached by an amide linkage.
  • the CPP component of the multiple PMO-CPP conjugate can be selected from known CPPs, such as those named A-N, having the sequences in Tables 1, 2, FIG. 1 or the K Series or B series CPPs described herein.
  • the CPP component of the multiple AON-CPP conjugate can be selected from known CPPs, such as those named A-N, having the sequences in Tables 1, 2, FIG. 1 or the K Series or B series CPPs described herein.
  • the CPP component is peptide K: RXRRXRRXRRXRXB (SEQ ID NO: 43), where R is D-arginine, X is 6-aminohexanoic acid and B is ⁇ -alanine.
  • the CPP component is peptide B: RXRRBRRXRRBRXB (SEQ ID NO: 44), wherein R, X, and B are hereinabove defined.
  • the CPP component of the multiple PMO-CPP, or AON-CPP, conjugates of the present disclosure may also be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl.
  • the linker is a sequence that contains a cleavage motif.
  • the cleavage motif can be cleaved by any hydrolytic enzyme.
  • the cleavage motif can be cleaved by a peptidase or protease such as cathepsin or trypsin.
  • the linker can be designed to include a cleavage motif recognized by a particular serine protease, threonine protease, cysteine protease, aspartate protease, glutamic acid protease, or metalloprotease, or a group of more than one peptidase.
  • the linker may include two or more cleavage motifs that are overlapping or nonoverlapping. In some embodiments, the linker may contain no cleavage motifs.
  • the linker may be designed so that less than 100%, less than 75%, less than 50%, or less than 10% of the linkers are cleaved. In some embodiments, the linker is designed so that greater than 90% or 99% of the linkers are cleaved.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the variable sequence comprises an ⁇ -, ⁇ -, ⁇ -, or ⁇ -amino acid, or a cycloalkane structure.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the variable sequence causes the compound to be targeted to the nucleus.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the variable sequence causes the compound to be targeted to the cytosol.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the variable sequence causes the compound to be targeted to the mitochondria.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the spacer comprises an aminohexanoic acid (Ahx).
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the spacer comprises (Ahx)B, wherein B is selected from ⁇ -alanine or ⁇ -glycine.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the linker comprises a cleavage motif.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; wherein the linker comprises a cleavage motif; and wherein the cleavage motif is cleavable by a hydrolytic enzyme.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the linker comprises FS.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the linker comprises FSQ.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the linker comprises FSQK.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine.
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine; and wherein y is a non-natural analog of glutamic acid.
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine; and wherein y is a non-natural analog of aspartic acid.
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine, and wherein y is a non-natural analog of lysine.
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine, and wherein y is a non-natural analog of serine.
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine, and wherein y is a non-natural analog of E, D, K, S or T
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl; and wherein the spacer comprises an aminohexanoic acid (Ahx); and wherein the linker comprises FSQG-OH.
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, and wherein the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D), lysine (K), serine (S), and threonine (T), and B is ⁇ -alanine, and wherein y is a non-natural analog of threonine; and wherein n is 7, and the spacer is (Ahx).
  • the linker comprises FxyB, x is any amino acid, y is selected from glutamic acid (E), aspartic acid (D),
  • the CPP may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, wherein the variable sequence, the spacer, and the linker comprise a sequence selected from: SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11.
  • the CPP-PMO, or CPP-AON may be a comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, further comprising a cargo conjugated to the linker, wherein the cargo comprises a phosphorodiamidate morpholino oligomer (PMO).
  • PMO phosphorodiamidate morpholino oligomer
  • the CPP-PMO, or CPP-AON may be a compound comprising the formula variable sequence-spacer-linker, wherein the variable sequence is Ac-R(O)nR, wherein n ⁇ 7; wherein O is a sequence of residues selected from R, X, and Z; wherein R is L-arginine, X is 3-cis-aminocyclohexane, and Z is cis-2-aminocyclopentane-1-carbonyl, further comprising a cargo conjugated to the linker, wherein the cargo further comprises one or more additional PMOs.
  • the CPP may include a variable sequence-spacer-linker according to any of the sequences of Table 1:
  • the CPP may include the following sequences set forth in Table 2
  • NOAEL means the dosage level where no untoward effects are observed. In other words, the NOAEL is the maximum safe dose.
  • the linker is a sequence that contains a cleavage motif.
  • the cleavage motif can be cleaved by any hydrolytic enzyme.
  • the cleavage motif can be cleaved by a peptidase or protease such as cathepsin or trypsin.
  • cathepsin cleavable linker is synonymous with cathepsin cleavage site.
  • the cleavable linker according to the present disclosure is capable of being cleaved, i.e., chemically degraded, by intracellular enzymes.
  • the linker can be designed to include a cleavage motif recognized by a particular serine protease, threonine protease, cysteine protease, aspartate protease, glutamic acid protease, or metalloprotease, or a group of more than one peptidase.
  • the linker may include two or more cleavage motifs that are overlapping or nonoverlapping.
  • the linker may contain no cleavage motifs.
  • the linker may be designed so that less than 100%, less than 75%, less than 50%, or less than 10% of the linkers are cleaved. In some embodiments, the linker is designed so that greater than 90% or 99% of the linkers are cleaved.
  • the linker includes the sequence FS (SEQ ID NO.:45. In some embodiments, the linker includes the sequence FSQ (SEQ ID NO.: 46) or FSQK (SEQ ID NO.:47). In some embodiments, the linker includes the sequence FxyB (SEQ ID NO.: 48), where x is any amino acid, standard or nonstandard, y is glutamic acid (E), aspartic acid (D), and lysine (K), serine (S), or threonine (T), and B is ⁇ -alanine or ⁇ -glycine.
  • suitable cathepsin cleavage sites include FKE (SEQ ID NO.: 49), FAE (SEQ ID NO.: 50), FVE (SEQ ID NO.: 51), FLE (SEQ ID NO.: 52), FSE (SEQ ID NO.: 53), and V[Cit]E (SEQ ID NO.: 54), wherein F is phenylalanine, K is lysine, E is glutamic acid, A is alanine, V is valine, L is leucine, S is serine, and Cit is citruline.
  • F phenylalanine
  • K is lysine
  • E glutamic acid
  • A is alanine
  • V valine
  • L leucine
  • S serine
  • Cit citruline
  • Peptides were synthesized using a Ranin Symphony automated peptide synthesizer using standard Fmoc-chemistry on pre-loaded CLEAR (Cross-Linked Ethoxylate Acrylate Resin) (Peptides International, Louisville, Ky.). Amino acids (EMD Biosciences, San Diego, Calif. or Anaspec, San Jose, Calif.) were orthogonally protected with tert-butoxycarbonyl (BOC), tert-butyl (tBu) 2,2,4,6,7-pentamethyldihydro-benzofuran-5-sulfonyl (Pbf), or Trityl (Trt) groups.
  • BOC tert-butoxycarbonyl
  • tBu tert-butyl
  • Trt 2,2,4,6,7-pentamethyldihydro-benzofuran-5-sulfonyl
  • Trt Trityl
  • Couplings were performed using an amino acid/HCTU/N-Methylmorpholine/resin molar ration of 5/5/10/1. 20% piperidine, 2% 1,8-diazabicyclo[5.4.0]-undec-7-ene (DBU) in DMF was used to remove Fmoc from the amine terminus during each cycle. N-terminal acetylation was performed on resin using acetic anhydride/NMM/resin in DMF in a molar ratio of 30/8/1. Deprotection/cleavage from resin was performed using a mixture of 15 ml/0.1 mM resin of 2.5% water/2.5% TIS/5% Anisole/90% TFA v/v ratio for 3 hr.
  • DBU 1,8-diazabicyclo[5.4.0]-undec-7-ene
  • PMOs were ordered with a 5′-end primary amine and peptides were synthesized as described above.
  • peptide was used in 2-fold molar excess compared to PMO, and in multiple PMO-CPP conjugates, moles of PMOs were calculated using the following equation: (1.2-fold) x (Number of Conjugates) x (moles of peptide).
  • the PMOs were dissolved in DMSO (5 mM) and set aside.
  • Peptides were dissolved in DMF (50 mM) and mixed with a molar equivalent of the aminium-based coupling reagent 2-(6-chloro-1-H-benzotriazole-1-yl)-1,1,3,3-tetramethylaminium hexafluorophosphate.
  • 4-Methylmorpholine (NMM) at 2 molar equivalents was added to the peptide mixture and immediately added to the PMO solution. Reaction proceeded for 1.5 hr at 37° C. and was stopped using 4 volume equivalents of water.
  • the mixture was added to a CM sepharose (Sigma Aldrich, St. Louis, Mo.) column and washed with 10 column volumes to remove unconjugated PMO and reactants.
  • CM sepharose Sigma Aldrich, St. Louis, Mo.
  • Peptide CPP-PMO conjugates were eluted from the column with 1M guanidium-HCL, 1M NaCl and dialyzed against 100 mM NH 4 HCO 3 with 3 buffer exchanges to remove salts and unconjugated peptide. Dialyzed material was lyophilized and analyzed with analytical HPLC.
  • Ac is acetyl
  • R is D-arginine
  • X is 6-aminohexanoic acid
  • B is ⁇ -alanine
  • FK is a cathepsin cleavage site
  • E is glutamic acid
  • G is glycine
  • Biot is biotin
  • FITC fluorescein isothiocyanate.
  • No. 1215 Ac-(RXRRBR) 2 XFKE(PMO)G(PMO) (SEQ ID NO.: 69)
  • No. 1216 Ac-(RXRRBR) 2 XFD(d-Glu)(PMO)E(PMO)G(PMO) (SEQ ID NO.: 70)
  • No. 1217 Ac-E(PMO)(RXRRBR) 2 XFKG (SEQ ID NO.: 71)
  • No. 1218 Ac-E(PMO)(RXRRBR) 2 XFKG(PMO) (SEQ ID NO.: 72)
  • No. 1219 Ac-E(PMO)(RXRRBR) 2 XFKE(PMO)G(PMO) (SEQ ID NO.: No.
  • RNA samples were quantified using a nanodrop ND1000 spectrophotometer. Samples were further diluted to a concentration of 15 ng/ ⁇ l. Samples were amplified using primers having the following sequences: CAGAATTCTGCCAATTGCTGAG (SEQ ID NO.: 83) and TTCTTCAGCTTGTGTCATCC (SEQ ID NO.: 84). PCR was conducted with a run sequence of 55° C./30 min.; 94° C./2 min; 94° C./15 s x 30 times; 55° C./30 s, 68° C./1.5 min.
  • Conjugate No. 1212 did not perform as well as the K-peptide conjugate No. 1120.
  • No. 1225-B performed better than No. 1226-B.
  • X can also include other types of residues, such as proline, glycine, or alanine, or additional modified or nonstandard amino acids.
  • the variable sequence includes alpha, beta, gamma, or delta amino acids, or cycloalkane structures.
  • the linker includes the sequence FS (SEQ ID NO.: 45).
  • the linker includes the sequence FSQ (SEQ ID NO.: 46) or FSQK (SEQ ID NO.: 47), wherein F is phenyalanine, S is serine, K is lysine and Q is glutamine.
  • the linker includes the sequence FxyB (SEQ ID NO.: 48), where x is any amino acid, standard or nonstandard, y is glutamic acid (E), aspartic acid (D), and lysine (K), serine (S), or threonine (T), and B is ⁇ -alanine or ⁇ -glycine
  • FxyB SEQ ID NO.: 48
  • x is any amino acid, standard or nonstandard
  • y is glutamic acid (E), aspartic acid (D), and lysine (K), serine (S), or threonine (T)
  • B is ⁇ -alanine or ⁇ -glycine
  • Wild-type mice were intravenously administered conjugate Nos. 1204, 1119, 1120, 1239, and 1215 at a dose of 2.84 ⁇ M/kg. Tissues were harvested and RNA was isolated as described above. The percentage of exon 23 skipped is shown in Table 4.
  • FIG. 3 also depicts the effects of some of the multiple CPP-PMO conjugates on exon 23 skipping in wild-type mice.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Preparation (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Saccharide Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
US15/313,405 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier Abandoned US20170182171A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/313,405 US20170182171A1 (en) 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US201462002296P 2014-05-23 2014-05-23
PCT/US2015/032142 WO2015179742A1 (en) 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier
US15/313,405 US20170182171A1 (en) 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/032142 A-371-Of-International WO2015179742A1 (en) 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US16/265,883 Continuation US11103587B2 (en) 2014-05-23 2019-02-01 Multiple oligonucleotide moieties on peptide carrier

Publications (1)

Publication Number Publication Date
US20170182171A1 true US20170182171A1 (en) 2017-06-29

Family

ID=53366294

Family Applications (2)

Application Number Title Priority Date Filing Date
US15/313,405 Abandoned US20170182171A1 (en) 2014-05-23 2015-05-22 Multiple oligonucleotide moieties on peptide carrier
US16/265,883 Expired - Fee Related US11103587B2 (en) 2014-05-23 2019-02-01 Multiple oligonucleotide moieties on peptide carrier

Family Applications After (1)

Application Number Title Priority Date Filing Date
US16/265,883 Expired - Fee Related US11103587B2 (en) 2014-05-23 2019-02-01 Multiple oligonucleotide moieties on peptide carrier

Country Status (15)

Country Link
US (2) US20170182171A1 (enExample)
EP (1) EP3151841B1 (enExample)
JP (2) JP6825914B2 (enExample)
KR (1) KR102487942B1 (enExample)
CN (1) CN106459975B (enExample)
AR (1) AR101542A1 (enExample)
AU (1) AU2015263963B2 (enExample)
BR (1) BR112016027236A2 (enExample)
CA (1) CA2949104C (enExample)
IL (1) IL249064B (enExample)
MX (1) MX381946B (enExample)
RU (2) RU2020142530A (enExample)
SG (2) SG10202004611SA (enExample)
TW (1) TWI726844B (enExample)
WO (1) WO2015179742A1 (enExample)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111542606A (zh) * 2017-09-22 2020-08-14 科罗拉多州立大学董事会法人团体 硫吗啉代寡核苷酸用于治疗肌肉营养不良
US10765760B2 (en) * 2018-05-29 2020-09-08 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy
US11103587B2 (en) 2014-05-23 2021-08-31 Genzyme Corporation Multiple oligonucleotide moieties on peptide carrier
US12305189B2 (en) 2017-08-03 2025-05-20 Voyager Therapeutics, Inc. Compositions and methods for delivery of AAV

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019170731A1 (en) * 2018-03-07 2019-09-12 Sanofi Nucleotide precursors, nucleotide analogs and oligomeric compounds containing the same
JP7667775B2 (ja) * 2019-09-05 2025-04-23 サノフイ ヌクレオチド類似体を含有するオリゴヌクレオチド
WO2021211572A1 (en) * 2020-04-14 2021-10-21 Oregon State University Antisense therapeutics for the treatment of coronavirus
US20250011777A1 (en) * 2021-09-03 2025-01-09 Sarepta Therapeutics, Inc. Delivery of anitsense oligomers by mirror image peptides

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1995006056A1 (en) * 1993-08-20 1995-03-02 University Of Medicine & Dentistry Of New Jersey Bridged polycationic polymer-oligonucleotide conjugates and methods for preparing same
DE19935302A1 (de) * 1999-07-28 2001-02-08 Aventis Pharma Gmbh Konjugate und Verfahren zu deren Herstellung sowie deren Verwendung zum Transport von Molekülen über biologische Membranen
EP1629105B1 (en) 2003-04-29 2010-09-01 AVI BioPharma, Inc. Compositions for enhancing transport and antisense efficacy of nucleic acid analog into cells
WO2009005793A2 (en) 2007-06-29 2009-01-08 Avi Biopharma, Inc. Tissue specific peptide conjugates and methods
US20100016215A1 (en) 2007-06-29 2010-01-21 Avi Biopharma, Inc. Compound and method for treating myotonic dystrophy
US20110130346A1 (en) 2008-05-30 2011-06-02 Isis Innovation Limited Peptide conjugates for delvery of biologically active compounds
EP2283029A1 (en) 2008-06-04 2011-02-16 Medical Research Council Peptides
CN105779453A (zh) 2008-10-24 2016-07-20 萨雷普塔治疗公司 用于dmd的多外显子跳跃组合物
WO2012177639A2 (en) * 2011-06-22 2012-12-27 Alnylam Pharmaceuticals, Inc. Bioprocessing and bioproduction using avian cell lines
JP6129844B2 (ja) 2011-09-14 2017-05-17 ラナ セラピューティクス インコーポレイテッド 多量体オリゴヌクレオチド化合物
KR102240217B1 (ko) * 2012-09-25 2021-04-14 젠자임 코포레이션 근긴장성 이영양증의 치료용 펩티드-결합 모르폴리노 안티센스 올리고뉴클레오티드
JP2017505623A (ja) * 2014-01-30 2017-02-23 エフ.ホフマン−ラ ロシュ アーゲーF. Hoffmann−La Roche Aktiengesellschaft 生物切断性コンジュゲートを有するポリオリゴマー化合物
JP6825914B2 (ja) 2014-05-23 2021-02-03 ジェンザイム・コーポレーション ペプチド担体上の多重オリゴヌクレオチド部分

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11103587B2 (en) 2014-05-23 2021-08-31 Genzyme Corporation Multiple oligonucleotide moieties on peptide carrier
US12305189B2 (en) 2017-08-03 2025-05-20 Voyager Therapeutics, Inc. Compositions and methods for delivery of AAV
CN111542606A (zh) * 2017-09-22 2020-08-14 科罗拉多州立大学董事会法人团体 硫吗啉代寡核苷酸用于治疗肌肉营养不良
US10765760B2 (en) * 2018-05-29 2020-09-08 Sarepta Therapeutics, Inc. Exon skipping oligomer conjugates for muscular dystrophy

Also Published As

Publication number Publication date
AU2015263963B2 (en) 2021-02-18
CN106459975A (zh) 2017-02-22
RU2016150629A3 (enExample) 2018-12-24
RU2739987C2 (ru) 2020-12-30
CA2949104A1 (en) 2015-11-26
CA2949104C (en) 2023-09-26
US20190388547A1 (en) 2019-12-26
RU2016150629A (ru) 2018-06-25
EP3151841B1 (en) 2022-10-19
WO2015179742A1 (en) 2015-11-26
MX2016015156A (es) 2017-03-27
SG10202004611SA (en) 2020-06-29
TW201617373A (zh) 2016-05-16
IL249064A0 (en) 2017-01-31
EP3151841A1 (en) 2017-04-12
CN106459975B (zh) 2020-03-27
AU2015263963A1 (en) 2016-12-01
KR20170005118A (ko) 2017-01-11
RU2020142530A (ru) 2021-04-26
KR102487942B1 (ko) 2023-01-11
JP2017517253A (ja) 2017-06-29
IL249064B (en) 2021-07-29
SG11201608880VA (en) 2016-11-29
BR112016027236A2 (pt) 2017-10-17
TWI726844B (zh) 2021-05-11
MX381946B (es) 2025-03-13
JP2021063128A (ja) 2021-04-22
AR101542A1 (es) 2016-12-28
JP7269968B2 (ja) 2023-05-09
JP6825914B2 (ja) 2021-02-03
US11103587B2 (en) 2021-08-31

Similar Documents

Publication Publication Date Title
US11103587B2 (en) Multiple oligonucleotide moieties on peptide carrier
CN109996807B (zh) Scn9a反义寡核苷酸
US20240390508A1 (en) Human transferrin receptor binding peptide-drug conjugate
CN105451743B (zh) 用于在活体中递送RNAi触发子至肿瘤细胞的聚偶联物
JP2004533414A5 (enExample)
US20240269302A1 (en) Nanoparticle comprising peptide-lipid conjugate for delivering oligonucleotide into target cell and pharmaceutical composition comprising same
CN103998458A (zh) 具有中央疏水域的细胞穿透肽
US7598421B2 (en) Materials for the delivery of biologically-active material to cells
WO1995006056A1 (en) Bridged polycationic polymer-oligonucleotide conjugates and methods for preparing same
US20040072743A1 (en) Pharmaceutical composition of modified pna molecules
ES2303636T3 (es) Metodo para la inhibicion selectiva del gen humano n-myc a traves de acidos nucleicos peptidicos (pna) en tumores que expresan n-myc a traves de proteinas pna sentido y antisentido.
US12502432B2 (en) Bicyclic peptide oligonucleotide conjugates
HK1236387A1 (en) Multiple oligonucleotide moieties on peptide carrier
HK1236387B (en) Multiple oligonucleotide moieties on peptide carrier
US11898145B2 (en) Enhanced oligonucleotides for inhibiting RTEL1 expression
EP4631528A1 (en) Nanoparticle comprising peptide-based conjugate for delivering oligonucleotide into target cell and pharmaceutical composition comprising same
WO2002053574A2 (en) Modified pna molecules
US20250171776A1 (en) Non-canonical cell-penetrating peptides for antisense oligomer delivery
TWI565476B (zh) 基於肽之活體內siRNA傳遞系統

Legal Events

Date Code Title Description
AS Assignment

Owner name: GENZYME CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:WEEDEN, TIMOTHY E.;NELSON, CAROL A.;WENTWORTH, BRUCE M.;AND OTHERS;SIGNING DATES FROM 20150120 TO 20150205;REEL/FRAME:040957/0025

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION