US20160024493A1 - Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set - Google Patents
Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set Download PDFInfo
- Publication number
- US20160024493A1 US20160024493A1 US14/777,294 US201414777294A US2016024493A1 US 20160024493 A1 US20160024493 A1 US 20160024493A1 US 201414777294 A US201414777294 A US 201414777294A US 2016024493 A1 US2016024493 A1 US 2016024493A1
- Authority
- US
- United States
- Prior art keywords
- sequence
- immune receptor
- adaptive immune
- unique
- amplicons
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1065—Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/1034—Isolating an individual clone by screening libraries
- C12N15/1093—General methods of preparing gene libraries, not provided for in other subgroups
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6846—Common amplification features
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6881—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2525/00—Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
- C12Q2525/10—Modifications characterised by
- C12Q2525/155—Modifications characterised by incorporating/generating a new priming site
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2535/00—Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
- C12Q2535/122—Massive parallel sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
- C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
- C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/179—Nucleic acid detection characterized by the use of physical, structural and functional properties the label being a nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present disclosure relates generally to quantitative high-throughput sequencing of adaptive immune receptor encoding DNA or RNA (e.g., DNA or RNA encoding T cell receptors and immunoglobulins) in multiplexed nucleic acid amplification reactions.
- DNA or RNA e.g., DNA or RNA encoding T cell receptors and immunoglobulins
- the compositions and methods described herein permit quantitative sequencing of DNA sequences encoding both chains of an adaptive immune receptor heterodimer in a single cell.
- embodiments that overcome undesirable distortions in the quantification of adaptive immune receptor encoding sequences that can result from biased over-utilization and/or under-utilization of specific oligonucleotide primers in multiplexed DNA amplification.
- the adaptive immune system employs several strategies to generate a repertoire of T- and B-cell antigen receptors, i.e., adaptive immune receptors, with sufficient diversity to recognize the universe of potential pathogens.
- TCR T cell antigen receptor
- the ability of T cells to recognize the universe of antigens associated with various cancers or infectious organisms is conferred by its T cell antigen receptor (TCR), which is a heterodimer of an ⁇ (alpha) chain from the TCRA locus and a ⁇ (beta) chain from the TCRB locus, or a heterodimer of a ⁇ (gamma) chain from the TCRG locus and a ⁇ (delta) chain from the TCRD locus.
- TCR T cell antigen receptor
- the proteins which make up these chains are encoded by DNA, which in lymphoid cells employs a unique rearrangement mechanism for generating the tremendous diversity of the TCR.
- This multi-subunit immune recognition receptor associates with the CD3 complex and binds to peptides presented by the major histocompatibility complex (MHC) class I and II proteins on the surface of antigen-presenting cells (APCs). Binding of TCR to the antigenic peptide on the APC is the central event in T cell activation, which occurs at an immunological synapse at the point of contact between the T cell and the APC.
- MHC major histocompatibility complex
- APCs antigen-presenting cells
- Each TCR peptide contains variable complementarity determining regions (CDRs), as well as framework regions (FRs) and a constant region.
- CDRs variable complementarity determining regions
- FRs framework regions
- the sequence diversity of ⁇ T cells is largely determined by the amino acid sequence of the third complementarity-determining region (CDR3) loops of the ⁇ and ⁇ chain variable domains, which diversity is a result of recombination between variable (V ⁇ ), diversity (D ⁇ ), and joining (J ⁇ ) gene segments in the ⁇ chain locus, and between analogous V ⁇ and J ⁇ gene segments in the ⁇ chain locus, respectively.
- V ⁇ variable
- D ⁇ diversity
- J ⁇ joining
- CDR3 sequence diversity is further increased by independent addition and deletion of nucleotides at the V ⁇ -D ⁇ , D ⁇ -J ⁇ , and V ⁇ -J ⁇ junctions during the process of TCR gene rearrangement.
- immunocompetence is reflected in the diversity of TCRs.
- the ⁇ TCR is distinctive from the ⁇ TCR in that it encodes a receptor that interacts closely with the innate immune system, and recognizes antigen in a non-HLA-dependent manner.
- TCR ⁇ is expressed early in development, and has specialized anatomical distribution, unique pathogen and small-molecule specificities, and a broad spectrum of innate and adaptive cellular interactions.
- a biased pattern of TCR ⁇ V and J segment expression is established early in ontogeny. Consequently, the diverse TCR ⁇ repertoire in adult tissues is the result of extensive peripheral expansion following stimulation by environmental exposure to pathogens and toxic molecules.
- Immunoglobulins expressed by B cells, also referred to herein as B cell receptors (BCR) are proteins consisting of four polypeptide chains, two heavy chains (H chains) from the IGH locus and two light chains (L chains) from either the IGK (kappa) or the IGL (lambda) locus, forming an H 2 L 2 structure. Both H and L chains contain complementarity determining regions (CDR) involved in antigen recognition, and a constant domain.
- CDR complementarity determining regions
- the H chains of IGs are initially expressed as membrane-bound isoforms using either the IgM or IgD constant region isoform, but after antigen recognition the H chain constant region can class switch to several additional isotypes, including IgG, IgE and IgA.
- IgG the diversity of na ⁇ ve Igs within an individual is mainly determined by the hypervariable complementarity determining regions (CDR).
- CDR3 domain of IGH chains is created by the combinatorial joining of the V H , D H , and J H gene segments.
- Hypervariable domain sequence diversity is further increased by independent addition and deletion of nucleotides at the V H -D H , D H -J H , and V H -J H junctions during the process of Ig gene rearrangement. Distinct from TCR, Ig sequence diversity is further augmented by somatic hypermutation (SHM) throughout the rearranged IG gene after a na ⁇ ve B cell initially recognizes an antigen.
- SHM somatic hypermutation
- the process of SHM is not restricted to CDR3, and therefore can introduce changes in the germline sequence in framework regions, CDR1 and CDR2, as well as in the somatically rearranged CDR3.
- the adaptive immune system functions in part by clonal expansion of cells expressing unique TCRs or BCRs
- accurately measuring the changes in total abundance of each clone is important to understanding the dynamics of an adaptive immune response.
- a healthy human has a few million unique TCR ⁇ chains, each carried in hundreds to thousands of clonal T-cells out of the roughly trillion T cells in a healthy individual.
- a new field of molecular immunology has recently emerged to profile the vast TCR and BCR repertoires.
- compositions and methods for the sequencing of rearranged adaptive immune receptor gene sequences and for adaptive immune receptor clonotype determination are described, for example, in Robins et al., 2009 Blood 114, 4099; Robins et al., 2010 Sci. Translat. Med. 2:47ra64; Robins et al., 2011 J. Immunol. Meth . doi:10.1016/j.jim.2011.09. 001; Sherwood et al. 2011 Sci. Translat. Med . 3:90ra61; U.S. Ser. No. 13/217,126 (US Pub. No. 2012/0058902), U.S. Ser. No. 12/794,507 (US Pub. No.
- Sequencing mRNA is a potentially easier method than sequencing gDNA, because mRNA splicing events remove the intron between J and C segments. This allows for the amplification of adaptive immune receptors (e.g., TCRs or Igs) having different V regions and J regions using a common 3′ polymerase chain reaction (PCR) amplification primer in the C region.
- adaptive immune receptors e.g., TCRs or Igs
- PCR 3′ polymerase chain reaction
- the thirteen J segments are all less than 60 base pairs (bp) long. Therefore, splicing events bring identical polynucleotide sequences encoding TCR ⁇ constant regions (regardless of which V and J sequences are used) to within less than 100 bp of the rearranged VDJ junction.
- the spliced mRNA can then be reverse transcribed into complementary DNA (cDNA) using poly-dT primers complementary to the poly-A tail of the mRNA, random small primers (usually hexamers or nonamers) or C-segment-specific oligonucleotides.
- This reverse transcription should produce an unbiased library of TCR cDNA (because all cDNAs are primed with the same oligonucleotide, whether poly-dT, random hexamer, or C segment-specific oligo) that may then be sequenced to obtain information on the V and J segment used in each rearrangement, as well as the specific sequence of the CDR3.
- Such sequencing could use single, long reads spanning CDR3 (“long read”) technology, or could instead involve fractionating many copies of the longer sequences and using higher throughput shorter sequence reads.
- T cells activated in vitro have 10-100 times as much mRNA per cell than quiescent T cells.
- quantitation of mRNA in bulk does not necessarily accurately measure the number of cells carrying each clonal TCR.
- T cells have one productively rearranged TCR ⁇ and one productively rearranged TCR ⁇ gene (or two rearranged TCR ⁇ and TCR ⁇ ), and most B cells have one productively rearranged Ig heavy-chain gene and one productively rearranged Ig light-chain gene (either IGK or IGL) so quantification in a sample of genomic DNA encoding TCRs or BCRs should directly correlate with, respectively, the number of T or B cells in the sample.
- Genomic sequencing of polynucleotides encoding any one or more of the adaptive immune receptor chains desirably entails amplifying with equal efficiency all of the many possible rearranged TCR ⁇ encoding sequences that are present in a sample containing DNA from lymphoid cells of a subject, followed by quantitative sequencing, such that a quantitative measure of the relative abundance of each clonotype can be obtained.
- One or more factors can give rise to artifacts that skew sequencing data outputs, compromising the ability to obtain reliable quantitative data from sequencing strategies that are based on multiplexed amplification of a highly diverse collection of TCR or IG gene templates. These artifacts often result from unequal use of diverse primers during the multiplexed amplification step.
- Such biased utilization of one or more oligonucleotide primers in a multiplexed reaction that uses diverse amplification templates may arise as a function of one or more of differences in the nucleotide base composition of templates and/or oligonucleotide primers, differences in template and/or primer length, the particular polymerase that is used, the amplification reaction temperatures (e.g., annealing, elongation and/or denaturation temperatures), and/or other factors (e.g., Kanagawa, 2003 J. Biosci. Bioeng. 96:317; Day et al., 1996 Hum. Mol. Genet. 5:2039; Ogino et al., 2002 J. Mol. Diagnost. 4:185; Barnard et al., 1998 Biotechniques 25:684; Aird et al., 2011 Genome Biol . 12:R18).
- amplification reaction temperatures e.g., annealing, elongation and/
- compositions and methods that will permit accurate quantification of adaptive immune receptor-encoding DNA and RNA sequence diversity in complex samples, in a manner that avoids skewed results such as misleading over- or underrepresentation of individual sequences due to biases in the utilization of one or more oligonucleotide primers in an oligonucleotide primer set used for multiplexed amplification of a complex template DNA population, and in a manner that permits determination of the coding sequences for both chains of a TCR or IG heterodimer that originate from the same lymphoid cell.
- the presently described embodiments address this need and provide other related advantages.
- the invention provides a method of identifying a plurality of cognate pairs comprising a first polypeptide and a second polypeptide that form an adaptive immune receptor heterodimer, said adaptive immune receptor heterodimer comprising a T cell receptor (TCR) or Immunoglobulin (IG) from a single clone in a sample, said sample comprising a plurality of lymphoid cells from a mammalian subject, said method comprising: distributing a plurality of lymphoid cells among a plurality of containers, each container comprising a plurality of lymphoid cells; generating a library of amplicons in said plurality of containers by performing multiplex PCR of cDNA molecules that have been reverse-transcribed from mRNA molecules obtained from said plurality of lymphoid cells, said library of amplicons comprising: i) a plurality of first adaptive immune receptor amplicons encoding said first polypeptide, each comprising a unique variable (V) region encoding sequence, a unique J region encoding
- the method includes determining a container occupancy pattern for each unique first adaptor immune receptor amplicon sequence by assigning each unique first adaptor immune receptor amplicon sequence to one or more containers, and a container occupancy pattern for each unique second adaptor immune receptor amplicon sequence by assigning each unique second adaptor immune receptor amplicon sequence to one or more containers, wherein each barcode sequence in said unique first or second adaptor immune receptor amplicon sequences is associated with a particular container.
- the method also includes for each possible pairing of a unique first and second adaptive immune receptor amplicon sequence to form a putative cognate pair, calculating a statistical probability of observing said container occupancy patterns, or observing any larger proportion of shared containers than expected by chance, given that said first and second adaptor immune receptor amplicon sequences do not originate from the same clonal population of lymphoid cells, and identifying a plurality of a putative cognate pairs based on said statistical probability having a score lower than a predetermined likelihood cutoff.
- the method includes for each identified putative cognate pair, determining a false discovery rate estimation for a possible false pairing of said unique first adaptor immune receptor amplicon sequence and said unique second adaptor immune receptor amplicon sequence; and identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs that encode said adaptive immune receptors in said sample based on said statistical probability and said false discovery rate estimation.
- the statistical score comprises a p-value calculated for pairing each putative cognate pair of unique first and second adaptive immune receptor amplicon sequences. In one embodiment, calculating the statistical score comprises calculating a probability that said unique first and second adaptive immune receptor amplicon sequences should jointly occupy as many or more containers than they are observed to jointly occupy, assuming no true cognate pairing and given the number of containers occupied by said unique first adaptive immune receptor amplicon sequence and the number of containers occupied by said unique second adaptive immune receptor amplicon sequence.
- identifying a plurality of a putative cognate pairs that have a high likelihood of pairing based on said statistical probability comprises for each unique first adaptor immune receptor amplicon sequence identifying the unique second adaptor immune receptor amplicon sequence that has the lowest p-value score of matching, or for each unique second adaptor immune receptor amplicon sequence finding the unique first adaptor immune receptor amplicon sequence that has the lowest p-value score of matching.
- determining a false discovery rate estimation comprises: calculating p-values for each of said plurality of putative cognate pairs identified in said sample; comparing the p-values for all of said plurality of putative cognate pairs with an expected p-value distribution, said expected p-value distribution calculated to represent an experiment where no true cognate pairs are present; and determining for each putative cognate pair, an expected proportion of false positive results such that all p-values at or below the p-value of said putative cognate pair are determined to represent a true cognate pairing.
- calculating said expected p-value distribution comprises: permuting the containers in which each first and second adaptive immune receptor sequence has been observed in an otherwise-identical experiment with no true cognate pairs, and calculating the distribution of p-values associated with each putative cognate pair.
- the method includes identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs by selecting a plurality of putative cognate pairs that have p-values below a threshold calculated based on said false discovery rate estimation.
- the identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 1%.
- the (A) first oligonucleotide reverse transcription primer set comprises primers capable of reverse transcribing a plurality of mRNA sequences encoding said plurality of first and second adaptive immune receptor polypeptides for generating a plurality of first and second reverse-transcribed adaptive immune receptor cDNA amplicons, wherein said plurality of first reverse-transcribed adaptive immune receptor cDNA amplicons encoding said first adaptive immune receptor polypeptide comprise 1) a unique V region encoding gene sequence, and 2) a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, and wherein said plurality of second reverse-transcribed adaptive immune receptor cDNA amplicons encoding said second adaptive immune receptor polypeptide comprise 1) a unique V region
- the method includes contacting each of said plurality of containers, under conditions and for a time sufficient to promote a multiplex PCR amplification of said first and second reverse-transcribed adaptive immune receptor cDNA amplicons with a second (B) and third (C) oligonucleotide primer sets.
- the (B) second oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of first reverse-transcribed adaptor immune receptor cDNA amplicons, wherein said forward and reverse primers each are capable of hybridizing to said first reverse-transcribed adaptive immune receptor cDNA amplicons.
- each pair of forward and reverse primers in said second oligonucleotide primer set is capable of amplifying said first reverse-transcribed adaptive immune receptor cDNA amplicons.
- the forward primers in said second oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to said V region encoding gene sequence.
- the reverse primers in said second oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to said J region encoding gene sequence or said C region encoding gene sequence.
- the (C) third oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of reverse-transcribed second adaptive immune receptor cDNA amplicons.
- each pair of forward and reverse primers in said third oligonucleotide primer set is capable of amplifying said second reverse-transcribed adaptive immune receptor cDNA amplicons.
- the forward primers in said third oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to said V region encoding gene sequence.
- the reverse primers in said third oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to said J region encoding gene sequence or complementary to said C region encoding gene sequence.
- the method also includes generating i) a plurality of third adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and said first and second universal adaptor sequences, and ii) a plurality of fourth adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and said first and second universal adaptor sequences.
- the method includes contacting each of said plurality of containers, under conditions and for a time sufficient to promote a second multiplex PCR amplification of said plurality of third and fourth adaptive immune receptor amplicons with a fourth (D) oligonucleotide primer set and fifth (E) oligonucleotide primer set.
- the (D) fourth oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of third adaptor immune receptor amplicons, wherein said forward and reverse primers each are capable of hybridizing to said third adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said fourth oligonucleotide primer set is capable of amplifying said third adaptor immune receptor amplicons.
- the forward primer in said fourth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said first universal adaptor sequence in said plurality of third adaptive immune receptor amplicon and said reverse primer comprises a sequencing platform tag sequence and a region complementary to said second universal adaptor sequence in said plurality of third adaptive immune receptor amplicons.
- either one or both of said forward and reverse primers in said fourth oligonucleotide primer set comprises a unique barcode sequence associated with said container in which said fourth oligonucleotide primer set is introduced.
- the (E) fifth oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of fourth adaptor immune receptor amplicons, wherein said forward and reverse primers each are capable of hybridizing to said fourth adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said fourth oligonucleotide primer set is capable of amplifying said plurality of fourth adaptor immune receptor amplicons.
- the forward primer in said fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said first universal adaptor sequence in said plurality of fourth adaptive immune receptor amplicons
- said reverse primer in said fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said second universal adaptor sequence in said plurality of fourth adaptive immune receptor amplicons.
- either one or both of said forward and reverse primers of said fourth oligonucleotide primer set comprises a unique barcode sequence associated with said container in which said fourth oligonucleotide primer set is introduced, thereby generating said library of amplicons comprising said plurality of first adaptive immune receptor amplicons and said plurality of second adaptive immune receptor amplicons.
- the method includes combining said library of amplicons from said plurality of containers into a mixture for sequencing.
- the plurality of first adaptive immune receptor amplicons comprise a C region encoding sequence.
- the plurality of second adaptive immune receptor amplicons comprise a C region encoding sequence.
- the sample comprises a blood sample. In another embodiment, the sample comprises a tissue sample. In certain embodiments, the sample comprises a sample purified or cultured human lymphoid cells. In other embodiments, the container comprises at least 10 4 lymphoid cells. In another embodiment, the sample comprises at least 10 4 cells.
- first polypeptide of said adaptive immune receptor heterodimer is a TCR alpha (TCRA) chain and the second polypeptide of said adaptive immune receptor heterodimer is a TCR beta (TCRB) chain.
- first polypeptide of the adaptive immune receptor heterodimer is a TCR gamma (TCRG) chain and said second polypeptide of said adaptive immune receptor heterodimer is a TCR delta (TCRD) chain.
- first polypeptide of said adaptive immune receptor heterodimer is an immunoglobulin heavy (IGH) chain and said second polypeptide of the adaptive immune receptor heterodimer is selected from an immunoglobulin light IGL or an IGK chain.
- first polypeptide of the adaptive immune receptor heterodimer is an IGH chain and the second polypeptide of the adaptive immune receptor heterodimer is both IGL and IGK
- three different amplification primer sets are used comprising: a first oligonucleotide amplification primer set for IGH, a second oligonucleotide amplification primer set for IGK, and a third oligonucleotide amplification primer set for IGL.
- the invention provides a method of identifying a plurality of cognate pairs comprising a first polypeptide and a second polypeptide that form an adaptive immune receptor heterodimer, said adaptive immune receptor heterodimer comprising a T cell receptor (TCR) or Immunoglobulin (IG) from a single clone in a sample, said sample comprising a plurality of lymphoid cells from a mammalian subject.
- the method includes distributing a plurality of lymphoid cells among a plurality of containers, each container comprising a plurality of lymphoid cells and generating a library of amplicons in said plurality of containers by performing multiplex PCR of genomic molecules obtained from said plurality of lymphoid cells.
- the library of amplicons comprises i) a plurality of first adaptive immune receptor amplicons encoding said first polypeptide, each comprising a unique variable (V) region encoding sequence, a unique J region encoding sequence, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence, and ii) a plurality of second adaptive immune receptor amplicons encoding said second polypeptide, each comprising a unique V region encoding sequence, a unique J region encoding, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence.
- V variable
- second adaptive immune receptor amplicons encoding said second polypeptide
- the method includes performing high throughput sequencing of said library of amplicons to obtain a data set of a plurality of first and second adaptive immune receptor amplicon sequences and determining a container occupancy pattern for each unique first adaptor immune receptor amplicon sequence by assigning each unique first adaptor immune receptor amplicon sequence to one or more containers, and a container occupancy pattern for each unique second adaptor immune receptor amplicon sequence by assigning each unique second adaptor immune receptor amplicon sequence to one or more containers, wherein each barcode sequence in said unique first or second adaptor immune receptor amplicon sequences is associated with a particular container.
- the method includes for each possible pairing of a unique first and second adaptive immune receptor amplicon sequence to form a putative cognate pair, calculating a statistical probability of observing said container occupancy patterns, or observing any larger proportion of shared containers than expected by chance, given that said first and second adaptor immune receptor amplicon sequences do not originate from the same clonal population of lymphoid cells. In some embodiments, the method includes identifying a plurality of a putative cognate pairs based on said statistical probability having a score lower than a predetermined likelihood cutoff.
- the method includes for each identified putative cognate pair, determining a false discovery rate estimation for a possible false pairing of said unique first adaptor immune receptor amplicon sequence and said unique second adaptor immune receptor amplicon sequence.
- the method includes identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs that encode said adaptive immune receptors in said sample based on said statistical probability and said false discovery rate estimation.
- the statistical score comprises a p-value calculated for pairing each putative cognate pair of unique first and second adaptive immune receptor amplicon sequences.
- the step of calculating said statistical score comprises calculating a probability that said unique first and second adaptive immune receptor amplicon sequences should jointly occupy as many or more containers than they are observed to jointly occupy, assuming no true cognate pairing and given the number of containers occupied by said unique first adaptive immune receptor amplicon sequence and the number of containers occupied by said unique second adaptive immune receptor amplicon sequence.
- the method includes identifying a plurality of a putative cognate pairs that have a high likelihood of pairing based on said statistical probability comprises for each unique first adaptor immune receptor amplicon sequence identifying the unique second adaptor immune receptor amplicon sequence that has the lowest p-value score of matching, or for each unique second adaptor immune receptor amplicon sequence finding the unique first adaptor immune receptor amplicon sequence that has the lowest p-value score of matching.
- the step of determining a false discovery rate estimation comprises: calculating p-values for each of said plurality of putative cognate pairs identified in said sample; comparing the p-values for all of said plurality of putative cognate pairs with an expected p-value distribution, said expected p-value distribution calculated to represent an experiment where no true cognate pairs are present; and determining for each putative cognate pair, an expected proportion of false positive results such that all p-values at or below the p-value of said putative cognate pair are determined to represent a true cognate pairing.
- the step of calculating said expected p-value distribution comprises: permuting the containers in which each first and second adaptive immune receptor sequence has been observed in an otherwise-identical experiment with no true cognate pairs, and calculating the distribution of p-values associated with each putative cognate pair.
- the method includes identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs by selecting a plurality of putative cognate pairs that have p-values below a threshold calculated based on said false discovery rate estimation.
- an identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 1%.
- the method includes contacting each of said plurality of containers, under conditions and for a time sufficient to promote a multiplex PCR amplification of said first and second adaptive immune receptor cDNA amplicons with a first (A) and second (B) oligonucleotide primer sets.
- the (A) first oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of first adaptor immune receptor amplicons, wherein said forward and reverse primers each are capable of hybridizing to said first adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said first oligonucleotide primer set is capable of amplifying said first adaptive immune receptor amplicons.
- the forward primers in said first oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to said V region encoding gene sequence.
- the reverse primers in said second oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to said J region encoding gene sequence.
- the (B) second oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of second adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said second oligonucleotide primer set is capable of amplifying said second adaptive immune receptor amplicons.
- the forward primers in said second oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to said V region encoding gene sequence.
- the reverse primers in said second oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to said J region encoding gene sequence.
- the method also includes generating i) a plurality of third adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence, or complement thereof, and said first and second universal adaptor sequences, and ii) a plurality of fourth adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence, or complement thereof, and said first and second universal adaptor sequences.
- the method also includes the step of contacting each of said plurality of containers, under conditions and for a time sufficient to promote a second multiplex PCR amplification of said plurality of third and fourth adaptive immune receptor amplicons with a third (C) oligonucleotide primer set and fourth (D) oligonucleotide primer set.
- the (C) third oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of third adaptor immune receptor amplicons, wherein said forward and reverse primers each are capable of hybridizing to said third adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said third oligonucleotide primer set is capable of amplifying said second adaptor immune receptor amplicons.
- the forward primer in said third oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said first universal adaptor sequence in said plurality of third adaptive immune receptor amplicon and said reverse primer in said third oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said second universal adaptor sequence in said plurality of second adaptive immune receptor amplicons.
- either one or both of said forward and reverse primers in said fourth oligonucleotide primer set comprises a unique barcode sequence associated with said container in which said third oligonucleotide primer set is introduced.
- the (D) fourth oligonucleotide primer set comprises forward and reverse primers capable of amplifying said plurality of fourth adaptor immune receptor amplicons, wherein said forward and reverse primers each are capable of hybridizing to said fourth adaptive immune receptor amplicons.
- each pair of forward and reverse primers in said fourth oligonucleotide primer set is capable of amplifying said plurality of fourth adaptor immune receptor amplicons.
- the forward primer in said fourth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said first universal adaptor sequence in said plurality of fourth adaptive immune receptor amplicons
- said reverse primer in said fourth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to said second universal adaptor sequence in said plurality of fourth adaptive immune receptor amplicons.
- either one or both of said forward and reverse primers of said fourth oligonucleotide primer set comprises a unique barcode sequence associated with said container in which said fourth oligonucleotide primer set is introduced, thereby generating said library of amplicons comprising said plurality of first adaptive immune receptor amplicons and said plurality of second adaptive immune receptor amplicons.
- the method includes combining said library of amplicons from said plurality of containers into a mixture for sequencing.
- the sample comprises a blood sample. In one embodiment, the sample comprises a tissue sample. In another embodiment, the sample comprises a sample purified or cultured human lymphoid cells. In some embodiments, each container comprises at least 10 4 lymphoid cells. In other embodiments, the sample comprises at least 10 4 cells.
- the first polypeptide of said adaptive immune receptor heterodimer is a TCR alpha (TCRA) chain and the second polypeptide of said adaptive immune receptor heterodimer is a TCR beta (TCRB) chain.
- the first polypeptide of the adaptive immune receptor heterodimer is a TCR gamma (TCRG) chain and said second polypeptide of said adaptive immune receptor heterodimer is a TCR delta (TCRD) chain.
- the first polypeptide of said adaptive immune receptor heterodimer is an immunoglobulin heavy (IGH) chain and said second polypeptide of the adaptive immune receptor heterodimer is selected from an immunoglobulin light IGL or an IGK chain.
- the first polypeptide of the adaptive immune receptor heterodimer is an IGH chain and the second polypeptide of the adaptive immune receptor heterodimer is both IGL and IGK
- three different amplification primer sets are used comprising: a first oligonucleotide amplification primer set for IGH, a second oligonucleotide amplification primer set for IGK, and a third oligonucleotide amplification primer set for IGL.
- FIG. 1 depicts a schematic representation of certain herein described compositions and methods.
- U1 and U2 represent universal adaptor oligonucleotides.
- BC1 and BC2 represent barcode oligonucleotides.
- J represents an adaptive immune receptor joining (J) region gene and Jpr represents a region of such a gene to which a J-specific oligonucleotide primer specifically anneals.
- V represents an adaptive immune receptor variable (V) region gene and Vpr represents a region of such a gene to which a V-specific oligonucleotide primer specifically anneals.
- NDN represents the diversity (D) region found in some adaptive immune receptor encoding genes, flanked on either side by junctional nucleotides (N) which may include non-templated nucleotides.
- Adap1 and Adap2 represent sequencing platform-specific adapters.
- the segment shown as “n6” represents a spacer nucleotide segment of any nucleotide sequence, in this case, a spacer of six randomly selected nucleotides.
- FIG. 2 depicts a schematic representation of certain herein described compositions and methods in which individual first and second microdroplets are contacted to permit fusion events between single first and second microdroplets, by which fusion events DNA from individual lymphoid cells (e.g., T or B cells) is introduced, within a fused microdroplet, to first and second oligonucleotide amplification primer sets that are capable of amplifying, respectively, DNA encoding sequences (e.g., CDR3 encoding DNA) of first and second adaptive immune receptor polypeptide encoding genes from the same cell.
- fusion events DNA from individual lymphoid cells e.g., T or B cells
- first and second oligonucleotide amplification primer sets that are capable of amplifying, respectively, DNA encoding sequences (e.g., CDR3 encoding DNA) of first and second adaptive immune receptor polypeptide encoding genes from the same cell.
- Amplification and oligonucleotide barcode labeling of at least two rearranged DNA loci from the same cell are thus contemplated as described herein, e.g., [IGH+IGL], [IGH+IGK], [IGH+IGK+IGL], [TCRA+TCRB], [TCRG+TCRG], etc.
- FIG. 3 depicts an exemplary schematic representation of certain herein described compositions and methods according to which, for example, DNA from individual lymphoid cells (e.g., T or B cells), or cDNA that has been reverse transcribed from mRNA of single lymphoid cells, is introduced, within a fused microdroplet, to first and second oligonucleotide amplification primer sets that are capable of amplifying, respectively, DNA encoding sequences (e.g., CDR3 encoding DNA) of first and second adaptive immune receptor polypeptide encoding genes from the same cell, after which the individual microdroplets are disrupted (e.g., by chemical, physical and/or mechanical dissolution, dissociation, breakage, etc.) and the released bar-coded double-stranded DNAs are amplified with universal oligonucleotide primers and sequencing platform-specific adapters to permit large-scale multiplexed quantitative sequencing. See Brief Description of FIG. 1 for abbreviations.
- DNA encoding sequences
- FIG. 4 depicts a schematic representation of labeling adaptive immune receptor polypeptide encoding cDNA during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences into cDNA.
- FIG. 5 depicts a schematic representation of labeling adaptive immune receptor polypeptide encoding cDNA during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences into cDNA.
- FIG. 6 presents a schematic representation of a DNA product that is amenable to sequencing following modification with Illumina sequencing adapters of amplified adaptive immune receptor polypeptide encoding cDNA that has been labeled during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences.
- FIG. 7 shows the number of occupied T cell subsets vs. probability of shared subsets.
- FIG. 8 shows a fixed number of T cells (e.g., 70,000 T cells) that are randomly allocated to each well on a 96-well plate, where the mRNA is extracted, converted to cDNA, and amplified by TCR-specific primers.
- Well-specific bar codes are attached and the TCR molecules are pooled for sequencing, followed by computational de-multiplexing to map each TCR sequence back to the wells in which it originated.
- the immune repertoire is highly diverse, and the probability that two clones will share a well pattern is miniscule, so any TCRA/TCRB pair that shares a well pattern can be inferred to have come from the same clone.
- FIGS. 9A and 9B show the result of a high-throughput pairing experiment, according to an embodiment of the invention.
- FIG. 9A shows false discovery rate curve for the high-throughput pairing experiment with 96 wells and 70,000 T cells per well. A total of 34,763 pairs of TCR sequences were called with FDR ⁇ 1% (red dotted line).
- FIG. 9B shows numbers of sequenced (light grey) and paired (dark) TCRB clones as a function of well occupancy. The inset provides a zoomed-in view of clones seen in >20 wells.
- FIG. 10 shows an exemplary workflow for a high-throughput pairing experiment, according to an embodiment of the invention.
- FIG. 11 shows the well occupancy vs. fraction of paired TCRB sequences, according to an embodiment of the invention. Pairing yield (fraction of paired sequences) for TCRB clones from a high-throughput pairing experiment with 96 wells and 70,000 T cells per well. TCRB clones were grouped by the number of wells in which they were observed (x-axis), and the fraction of these sequences that were paired at FDR ⁇ 1% were computed (y-axis).
- FIG. 12 shows a schematic of two-subject validation experiment, according to an embodiment of the invention.
- Peripheral blood is collected from two subjects, X and Y. Deep immunosequencing is used to characterize the TCRA and TCRB repertoire of each subject.
- PBMCs from the two subjects are then mixed, and the resulting mix is used to perform a high-throughput pairing experiment of the invention.
- True-positive pairs must include a TCRA and a TCRB from the same subject, while approximately half of false-positive results will be cross-subject TCRA/TCRB pairs.
- FIGS. 13A and 13B show validation of the high-throughput pairing approach using two donors.
- FIG. 13A false discovery rate curves for an experiment are shown in which PBMCs from two subjects (‘X’ and ‘Y’) were mixed and 25,000 cells were dispensed to each of 96 wells. Pairs are split into groups named ‘X/X’ (both members of a pair seen only in Subject X), ‘Y/Y’ (both members of a pair seen only in Subject Y), and ‘X/Y’ (one member of a pair seen only in Subject X and one member seen only in Subject Y).
- the dotted vertical line shows the cutoff for an estimated FDR ⁇ 1%; below this threshold, there are 1,115 X/X pairs, 706 Y/Y pairs, and 7 X/Y pairs.
- FIG. 13B the predicted versus empirical log 10 FDR from the sample-mixing experiment are shown. For each possible p-value cutoff, a predicted FDR value was provided by statistical methods of the invention and an empirical FDR value was computed as twice the number of X/Y pairs divided by the number of called pairs, under the assumption that X/Y pairs represent half the total number of errors.
- the vertical dotted line corresponds to the cutoff used in FIG. 13A .
- FIGS. 14A-14D show the well dropout rates in mRNA subsamples and within pairs.
- FIG. 14A shows well dropout rates in the first subsample of mRNA from a high-throughput pairing method of the invention with 70,000 T cells per well. Median dropout rates (dotted vertical lines) are 20% for TCRA and 14% for TCRB.
- FIG. 14B shows the well dropout rates in the second subsample of mRNA from a high-throughput pairing method of the invention. Median dropout rates are 24% for TCRA and 21% for TCRB.
- FIG. 14C shows the well dropout rates estimated from confidently paired sequences (FDR ⁇ 1%) in the first subsample of mRNA (same data as in panel A).
- FIG. 14D shows well dropout rates estimated from confidently paired sequences (FDR ⁇ 1%) in the full combined sample of mRNA, i.e., the data used in our discovery of 35,000 pairs. Median dropout rates are 7% for TCRA and 3% for TCRB; after accounting for bias, we expect that the true median dropout rates are 10% and 5%, respectively.
- FIG. 15 shows simulated well occupancy as a function of clone frequency and number of input T cells.
- a key design parameter in a high-throughput pairing method of the invention is the number of T cells allocated to each well.
- FIG. 15 shows the outcomes of simulated experiments of the invention for a 96-well plate and T cell inputs ranging from 100-100,000 cells per well (x-axis). Different colors depict clones with different repertoire frequencies, and the plot shows the number of wells they occupied in our simulations. To capture clones from different frequency bands, one can simply change the number of input T cells in an experiment. It is also possible to capture multiple frequency bands in a single experiment by varying the number of input T cells across the wells on a plate.
- the present invention provides, in certain embodiments and as described herein, compositions and methods that are useful for reliably quantifying and determining the sequences of large and structurally diverse populations of rearranged genes encoding adaptive immune receptors, such as immunoglobulins (IG) and/or T cell receptors (TCR).
- adaptive immune receptors such as immunoglobulins (IG) and/or T cell receptors (TCR).
- IG immunoglobulins
- TCR T cell receptors
- These rearranged genes may be present in a biological sample containing DNA from lymphoid cells of a subject or biological source, including a human subject, and/or mRNA transcripts of these rearranged genes may be present in such a sample and used as templates for cDNA synthesis by reverse transcription.
- Disclosed herein are unexpectedly advantageous approaches for uniquely and unambiguously labeling individual, sequence-distinct IG and TCR encoding gene segments or mRNA transcripts thereof, or cDNA that has been reverse transcribed from such mRNA transcripts, by performing such labeling prior to conventional steps of expanding a population of such gene segments or transcripts thereof (including reverse transcripts) through established nucleic acid amplification techniques.
- the present embodiments offer unprecedented sensitivity in the detection and quantification of diverse TCR and IG encoding sequences, while at the same time avoiding misleading, inaccurate or incomplete results that may occur due to biases in oligonucleotide primer utilization during multiple rounds of nucleic acid amplification from an original sample, using a sequence-diverse set of amplification primers.
- compositions and methods that permit quantitative determination of the sequences encoding both polypeptides in an adaptive immune receptor heterodimer from a single cell, such as both TCRA and TCRB from a T cell, or both IgH and IgL from a B cell.
- a complex sample such as a sample containing a heterogeneous mixture of T and/or B cells from a subject
- these and related embodiments permit more accurate determination of the relative representation in a sample of particular T and/or B cell clonal populations than has previously been possible.
- Certain embodiments contemplate modifications as described herein to oligonucleotide primer sets that are used in multiplexed nucleic acid amplification reactions to generate a population of amplified rearranged DNA molecules from a biological sample containing rearranged genes encoding adaptive immune receptors, prior to quantitative high throughput sequencing of such amplified products.
- Multiplexed amplification and high throughput sequencing of rearranged TCR and BCR encoding DNA sequences are described, for example, in Robins et al., 2009 Blood 114:4099; Robins et al., 2010 Sci. Translat. Med . 2:47ra64; Robins et al., 2011 J. Immunol. Meth . doi:10.1016/j.jim.2011.09.
- a plurality of sequence-diverse TCR or IG encoding gene segments such as a sample comprising DNA (or mRNA transcribed therefrom or cDNA reverse-transcribed from such mRNA) from lymphoid cells in which DNA rearrangements have taken place to encode functional TCR and/or IG heterodimers (or in which non-functional TCR or IG pseudogenes have been involved in DNA rearrangements)
- a plurality of individual TCR or IG encoding sequences may each be uniquely tagged with a specific oligonucleotide barcode sequence as described herein, through a single round of nucleic acid amplification (e.g., polymerase chain reaction PCR).
- the population of tagged polynucleotides can then be amplified to obtain a library of tagged molecules, which can then be quantitatively sequenced by existing procedures such as those described, for example, in U.S. Ser. No. 13/217,126 (US Pub. No. 2012/0058902), U.S. Ser. No. 12/794,507 (US Pub. No. 2010/0330571), WO/2010/151416, WO/2011/106738 (PCT/US2011/026373), WO2012/027503 (PCT/US2011/049012), U.S. Ser. No. 61/550,311, and U.S. Ser. No. 61/569,118.
- the incorporated barcode tag sequence is sequenced and can be used as an identifier in the course of compiling and analyzing the sequence data so obtained.
- a consensus sequence for the associated TCR or IG sequences may be determined.
- a clustering algorithm can then be applied to identify molecules generated from the same original clonal cell population.
- FIG. 1 An exemplary embodiment is depicted in FIG. 1 , according to which from a starting template population of genomic DNA or cDNA from a lymphoid cell-containing population, two or more cycles of PCR are performed using an oligonucleotide primer composition that contains primers having the general formula U1-B1 n -X as described herein.
- the J-specific primer 110 a contains a J primer sequence 100 that is complementary to a portion of the J segment, a barcode tag (BC1) 101 in FIG.
- the V-specific primer 110 b includes a V primer sequence 103 that is complementary to a portion of the V segment and a second external universal adaptor sequence (U2) 104 .
- the invention need not be so limited, however, and also contemplates related embodiments, such as those where the barcode may instead or may in addition be present as part of the V-specific primer and is situated between the V-sequence and the second universal adaptor. It will be appreciated that based on the present disclosure, those skilled in the art can design other suitable primers by which to introduce the herein described barcode tags to uniquely label individual TCR and/or IG encoding gene segments.
- a large number (up to 4 n , where n is the length of the barcode sequence) of different barcode sequences are present in the oligonucleotide primer composition that contains primers having the general formula U1-B1 n -X as described herein, such that the PCR products of the large number of different amplification events following specific annealing of appropriate V- and J-specific primers are differentially labeled.
- the number of barcode sequences is up to or smaller than 4 n .
- the length of the barcode “n” determines the possible number of barcodes (4 n as described herein), but in some embodiments, a smaller subset is used to avoid closely related barcodes or barcodes with different annealing temperatures.
- sets of m and n barcode sequences are used in subsequent amplification steps (e.g., to individually label each rearranged TCR or IG sequence and then to uniformally label (“tailing”) a set of sequences obtained from the same source, or sample
- the V and J primers 100 and 103 are capable of promoting the amplification of a TCR or Ig encoding sequence that includes the CDR3 encoding sequence, which in FIG. 1 includes the NDN region 111 .
- the first amplification primer set 110 a , 110 b is separated from the double-stranded DNA product.
- contamination of the product preparation by subsequent rounds of amplification is avoided, where contaminants could otherwise be produced by amplifying newly formed double-stranded DNA molecules with amplification primers that are present in the complex reaction but which are primers other than those used to generate the double-stranded DNA in the first one or two amplification cycles.
- a variety of chemical and biochemical techniques are known in the art for separating double-stranded DNA from oligonucleotide amplification primers.
- the tagged double-stranded DNA (dsDNA) products can be amplified using a second amplification primer set 120 a , 120 b as described herein and depicted in FIG. 1 , to obtain a DNA library suitable for sequencing.
- the second amplification primer set advantageously exploits the introduction, during the preceding step, of the universal adaptor sequences 102 , 104 (e.g., U1 and U2 in FIG. 1 ) into the dsDNA products. Accordingly, because these universal adaptor sequences have been situated external to the unique barcode tags (BC1) 101 in FIG.
- the amplification products that comprise the DNA library to be sequenced retain the unique barcode identifier sequences linked to each particular rearranged V-J gene segment combination, whilst being amenable to amplification via the universal adaptors.
- An exemplary set of such a second primer set, also known as “tailing” primers, is shown in Table 7.
- the second amplification primer set 120 a , 120 b may introduce sequencing platform-specific oligonucleotide sequences (Adap1 105 and Adap2 106 in FIG. 1 ), however these are not necessary in certain other related embodiments.
- the second amplification primer set 120 a , 120 b may also optionally introduce a second oligonucleotide barcode identifier tag (BC2 107 in FIG. 1 ), such as a single barcode sequence that may desirably identify all products of the amplification from a particular sample (e.g., as a source subject-identifying code) and ease multiplexing multiple samples to allow for higher throughput.
- BC2 107 second oligonucleotide barcode identifier tag
- the barcode (BC2; 107 in FIG. 1 ) is a modification that increases the throughput of the assay (e.g., allows samples to be multiplexed on the sequencer), but is not required.
- a universal primer without adaptors can be used to amplify the tagged molecules. After amplification, the molecules can be additionally tagged with platform specific oligonucleotide sequences.
- Such inclusion of a second, sample-identifying barcode may beneficially aid in the identification of sample origins when samples from several different subjects are mixed, or in the identification of inadvertent contamination of one sample preparation with material from another sample preparation.
- the second amplification primer set may also, as shown in FIG.
- n6 spacer nucleotide
- the spacer improves the quality of the sequencing data, but is not required or present in certain embodiments.
- the spacer is specifically added to increase the number of random base pairs during the first 12 cycles of the sequencing step of the method. By increasing the diversity of the first 12 cycles, cluster definition and basecalling is improved.
- the spacer nucleotide 108 may be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11-20, 21-30 or more nucleotides of any sequence, typically a randomly generated sequence.
- a relatively small number of amplification cycles typically three, four or five cycles, or optionally 1-6 or no more than eight cycles, to reduce the potential for unevenness in amplification that could skew downstream results.
- the resulting DNA library can then be sequenced according to standard methodologies and using available instrumentation as provided herein and known in the art.
- a second, sample-identifying barcode BC2 107 in FIG. 1
- sequencing that includes reading both such barcodes is performed, with the sequence information (V-J junction including CDR3 encoding sequence, along with the first oligonucleotide barcode BC1 101 that uniquely tags each distinct sequence) between the two occurrences of the sample-identifying barcode 107 also being read.
- Sequencing primers may include, for instance, and with reference to FIG. 1 , the universal primer 102 on the J side of NDN 111 for the first read, followed by a barcode sequence BC1 101 , a J primer sequence 100 and CDR3 sequences.
- the second set of amplification primers include a forward primer comprising the platform-specific primer (Adap1 105 ) on the J side, a spacer sequence comprising random nucleotides (labeled “n6”; 108 in FIG. 1 ), and BC2 sample-identifying barcodes 107 .
- the reverse primer in the second set of amplification primers includes the universal primer 104 on the V side of NDN 111 , a spacer sequence 108 comprising random nucleotides, and a BC2 sample-identifying barcode sequence 107 , and optionally a paired-end read using the reverse second sequencing platform-specific primer (Adap2 106 ).
- the second sequencing platform-specific primer (Adap2 106 ) is used to sequence and “read” the spacer sequence 108 , the sample-identifying barcode sequence BC2 107 , the universal adaptor sequence 104 , the V sequence 103 , and NDN 111 .
- Sequence data may be sorted using the BC2 sample-identifying barcodes 107 and then further sorted according to sequences that contain a common first barcode BC1 101 .
- CDR3 sequences may be clustered to determine whether more than one sequence cluster is present using any of a known variety of algorithms for clustering (e.g., BLASTClust, UCLUST, CD-HIT, or others, or as described in Robins et al., 2009 Blood 114:4099).
- sequence data may be sorted and selected on the basis of those sequences that are found at least twice. Consensus sequences may then be determined by sequence comparisons, for example, to correct for sequencing errors.
- the number of such barcode tags that is identified may be regarded as reflective of the number of molecules in the sample from the same T cell or B cell clone.
- a method for determining rearranged DNA sequences or mRNA sequences transcribed therefrom or cDNA that has been reverse transcribed from such mRNA) encoding first and second polypeptide sequences of an adaptive immune receptor heterodimer in a single lymphoid cell.
- the method includes uniquely labeling each rearranged DNA sequence with a unique barcode sequence for identifying a particular cell and/or sample.
- these and related embodiments comprise a method comprising steps of (1) in each of a plurality of parallel reactions, contacting first and second microdroplets and permitting them to fuse under conditions permissive for nucleic acid amplification, to generate double-stranded DNA products (or single-stranded cDNA products) that all contain an identical barcode oligonucleotide sequence and that correspond to the two chains of an adaptive immune receptor heterodimer; (2) disrupting the fused microdroplets to obtain a heterogeneous mixture of double-stranded (or single-stranded) DNA products; (3) amplifying the heterogeneous mixture of double-stranded DNA (or single-stranded) products to obtain a DNA library for sequencing; and (4) sequencing the library to obtain a data set of DNA sequences encoding the first and second polypeptides of the heterodimer.
- the method comprises contacting and permitting to fuse in pairwise fashion (A) individual first microdroplets that each (or in every n th droplet) contain a single lymphoid cell or genomic DNA isolated therefrom, or cDNA has been reverse transcribed from mRNA, with (B) individual second microdroplets from a plurality of second liquid microdroplets that each contain two oligonucleotide amplification primer sets, the first set for amplifying any rearranged DNA that encodes the first chain of an adaptive immune receptor heterodimer (e.g., an IGH chain, or a TCRA chain), and the second set for amplifying any rearranged DNA that encodes the second chain of the heterodimer (e.g., an IGL chain, or a TCRB chain).
- A individual first microdroplets that each (or in every n th droplet) contain a single lymphoid cell or genomic DNA isolated therefrom, or cDNA has been reverse transcribed from mRNA
- B individual second microdroplets from a
- all oligonucleotide amplification primers will comprise the same barcode oligonucleotide, but within different second microdroplets, the primer sets will comprise different barcode sequences.
- the step of contacting is controlled so that in each of a plurality of events, a single first microdroplet fuses with a single second microdroplet to obtain a fused microdroplet. The contents of each of the first and second microdroplets come into contact with one another in the fused microdroplet.
- Oligonucleotide amplification primer sets capable of amplifying any rearranged DNA encoding a given TCR or IG polypeptide are described elsewhere herein and in the references incorporated for such disclosure.
- microdroplet compositions that have defined contents and properties (such as the ability to controllably undergo fusion) may be prepared, such as the RainDanceTM microdroplet digital PCR system (RainDance Technologies, Lexington, Mass.) or any of the systems described, for example, in Pekin et al., 2011 Lab Chip 11:2156; Miller et al., 2012 Proc. Nat. Acad. Sci. USA 109:378; Brouzes et al., 2009 Proc. Nat. Acad. Sci . USA 106:14195; Joensson et al., 2009 Angew. Chem. Int. Ed.
- Microdroplets may exploit the properties of aqueous phase microdroplets dispersed in an oil phase using microfluidic channels.
- Microdroplets may be water-in-oil emulsions, oil-in-water emulsions, or similar aqueous and non-aqueous emulsion compositions. Microdroplets may also be called microdroplets or micellar microdroplets.
- Conventional water-in-oil (WO) emulsions have found many applications in biology, including next-generation sequencing (Margulies et al., Nature 2005, 437, 376-380), rare mutation detection (Diehl, F. et al. Proc. Natl. Acad. Sci. U.S.A.
- Microfluidic chips with channel diameters of 10-100 ⁇ m are typically fabricated from quartz, silicon, glass, or polydimethylsiloxane (PDMS) using standard soft photolithography techniques (A. Manz, N. Graber and H. M. Widmer: Miniaturized total Chemical Analysis systems: A Novel Concept for Chemical Sensing, Sensors and Actuators, B Chemical (1990) 244-248).
- Droplets are typically generated at rates of ⁇ 1-10 Hz by flowing an aqueous solution in one channel into a stream of oil.
- the use of flow focusing nozzles enables generation of controlled size droplets of aqueous phase.
- the droplet size and rate of droplet generation are controlled by the ratio of oil and aqueous phase flow rates, for a given nozzle geometry.
- the chip channel surface is usually modified to be hydrophobic, for instance, by one of the many published silanization chemistries (Zeng, Y. et al., Anal. Chem. 2010, 82, 3183-3190).
- hydrophobic and lipophobic oils may be beneficial, since the molecular diffusion between droplets is minimized, the oils have low solubility for biological reagents contained in the aqueous phase and have good gas solubility, which ensures viability of encapsulated cells in certain applications.
- surfactants may desirably, according to certain embodiments, be mixed into the oil phase, since droplets tend to coalesce.
- Surfactants may also inhibit adsorption of biomolecules at the microdroplet interfaces.
- a novel class of block copolymer surfactants comprising perfluorinated polyethers (PFPE) coupled to polyethyleneglycol (PEG), has been described for use with fluorocarbon oils, for example, the fluorinated oil FC-40 (Sigma), a mix of perfluoro tri-n-butyl amine with di(perfluoro(n-butyl))perfluoromethyl amine (Holtze, C. et al., Lab Chip, 2008, DOI: 10.1039/b806706f). These compositions have led to very stable, biocompatible emulsions (Brouzes, E., et al., PNAS 2009, 106(34), 14195-14200).
- Droplets traveling in microfluidic channels may be maintained as discrete microdroplets by means of their surface tension.
- Various methods have also been proposed to overcome the surface tension and allow droplets to merge when desired, thus allowing reagent mixing, e.g., by microfabrication of passive, flow reducing elements in channels (Niu, X. et al., Lab Chip 2008, 8, 1837-1841), by the use of electrostatic charge (electrocoalescence) (Zagnoni, M. et al., Langmuir , 2010, 26(18), 14443-14449), or by manipulating microchannel geometry (Dolomite Merger chip; see also WO/2012/083225).
- a method of adding reagents to droplets in microfluidic channels via picoinjectors has recently been published (Abate, A. R. et al., PNAS 2010, 107(45), 19163-19166) and may also be adapted according to certain presently contemplated embodiments as described herein.
- the microdroplet contents and the step of contacting are selected to be permissive for nucleic acid amplification interactions between the genomic DNA and the amplification primers.
- Nucleic acid amplification e.g., PCR
- Such amplification is permitted to proceed at least to obtain first and second double-stranded DNA products that include the nucleotide sequences of the first and second oligonucleotide amplification primers as provided herein, and the complementary sequences thereto.
- any single fused microdroplet may contain (i) a first double-stranded DNA product that comprises at least a first universal adaptor sequence, the barcode sequence, a V region and a J or C region sequence that encode a portion of the first adaptive immune receptor polypeptide of the heterodimer, and a second universal adaptor sequence, and (ii) a second double-stranded DNA product that comprises at least a third universal adaptor sequence, the same barcode sequence as in (i), a V region and a J or C region sequence that encode a portion of the second adaptive immune receptor polypeptide of the heterodimer, and a fourth universal adaptor sequence.
- Conditions for the amplification step in the fused microdroplets are stopped prior to the next step. This can be achieved by changing the temperature of the environment in which the microdroplets are contained (e.g., in a container or well) to stop the amplification process.
- the method comprises disrupting the plurality of fused microdroplets to obtain a heterogeneous mixture of the first and second double-stranded products.
- Disruption may be selected on the basis of the chemical properties and composition of the microdroplets, and may be achieved, for instance, by chemical, biochemical and/or physical manipulations, such as the introduction of a diluent, detergent, chaotrope, surfactant, osmotic agent, or other chemical agent, or by the use of sonication, pressure, electrical field or other disruptive conditions. It will be appreciated that preferred conditions will involve the use of aqueous solvents for the included volumes within the microdroplets and/or for the heterogeneous mixture that is obtained by the step of disrupting.
- microdroplets instead of individual cells as an assay format, one can analyze data on the number of input cells in the sample.
- SHM somatic hypermutation
- the method comprises an ensuing step for contacting the mixture of first and second double-stranded DNA products with the herein described third and fourth amplification primer sets. Conditions for this step may similarly be achieved using accepted methodologies for DNA amplification to obtain a DNA library for sequencing, which may also be achieved according to any of a number of established DNA sequencing technologies.
- each of the first liquid microdroplets contains complementary DNA (cDNA) that has been reverse transcribed from the mRNA of a single lymphoid cell, such as a first cDNA that encodes the first chain of the adaptive immune receptor heterodimer and a second cDNA that encodes the second chain of the heterodimer.
- cDNA complementary DNA
- the individual second microdroplets may each contain a third oligonucleotide primer set that is capable of amplifying additional cDNA sequences that encode a lymphocyte status indicator molecule or molecules,
- the third primer set is labeled with the same barcode sequence that is present in the first and second primer sets that are in the microdroplet.
- the biological status can be determined for the single source cell from which a given TCR or IG heterodimeric sequence is identified.
- the biological status can be activated vs. quiescent, maturational stage, na ⁇ ve vs. memory, regulatory vs. effector, etc.
- lymphocyte status indicator molecules include, e.g., lck, fyn, FoxP3, CD4, CD8, CD11a, CD18, CD25, CD28, CD29, CD44, CD45, CD49d, CD62, CD69, CD71, CD103, CD137 (4-1BB), HLA-DR, etc.
- Certain embodiments include a third oligonucleotide primer set that is capable of amplifying a third cDNA sequence that encodes a lymphocyte status indicator molecule, where the third oligonucleotide primer set is labeled with the same barcode sequence that is present in the first and second primer sets, and where the lymphocyte status indicator molecule comprises one or more of the following: FoxP3, CD4, CD8, CD11a, CD18, CD21, CD25, CD29, CCD30, CD38, CD44, CD45, CD45RA, CD45RO, CD49d, CD62, CD62L, CD69, CD71, CD103, CD137 (4-1BB), CD138, CD161, CD294, CCR5, CXCR4, IgG1-4 H-chain constant region, IgA H-chain constant region, IgE H-chain constant region, IgD H-chain constant region, IgM H-chain constant region, HLA-DR, IL-2, IL-5, IL-6, IL-9, IL-10, IL-12
- a third oligonucleotide primer set that is capable of amplifying a third cDNA sequence that encodes a lymphocyte status indicator molecule, where the third primer set is labeled with the same barcode sequence that is present in the first and second primer sets, and where the lymphocyte status indicator molecule comprises a cell surface receptor.
- cell surface receptors include the following, or the like: CD2 (e.g., GenBank Acc. Nos. Y00023, SEG_HUMCD2, M16336, M16445, SEG_MUSCD2, M14362), 4-1BB (CDw137, Kwon et al., 1989 Proc. Nat. Acad. Sci. USA 86:1963, 4-1BB ligand (Goodwin et al., 1993 Eur. J. Immunol. 23:2361; Melero et al., 1998 Eur. J. Immunol . 3:116), CD5 (e.g., GenBank Acc. Nos. X78985, X89405), CD10 (e.g., GenBank Acc. Nos.
- CD2 e.g., GenBank Acc. Nos. Y00023, SEG_HUMCD2, M16336, M16445, SEG_MUSCD2, M14362
- 4-1BB CDw137, Kwon et al
- CD27 e.g., GenBank Acc. Nos. M63928, L24495, L0809
- CD28 June et al., 1990 Immunol. Today 11:211; see also, e.g., GenBank Acc. Nos. J02988, SEG_HUMCD28, M34563)
- CD152/CTLA-4 e.g., GenBank Acc. Nos. L15006, X05719, SEG_HUMIGCTL
- CD40 e.g., GenBank Acc. Nos.
- interleukin-17 e.g., GenBank Acc. Nos. U32659, U43088
- IL-17R interleukin-17 receptor
- Additional cell surface receptors include the following or the like: CD59 (e.g., GenBank Acc. Nos. SEG_HUMCD590, M95708, M34671), CD48 (e.g., GenBank Acc. Nos. M59904), CD58/LFA-3 (e.g., GenBank Acc. No. A25933, Y00636, E12817; see also JP 1997075090-A), CD72 (e.g., GenBank Acc. Nos. AA311036, S40777, L35772), CD70 (e.g., GenBank Acc. Nos. Y13636, S69339), CD80/B7.1 (Freeman et al., 1989 J. Immunol .
- CD59 e.g., GenBank Acc. Nos. SEG_HUMCD590, M95708, M34671
- CD48 e.g., GenBank Acc. Nos. M59904
- CD58/LFA-3
- CD40 ligand e.g., GenBank Acc. Nos. SEG_HUMCD40L, X67878, X65453, L0741
- IL-17 e.g., GenBank Acc. Nos. U32659, U43088
- CD43 e.g., GenBank Acc. Nos.
- Genbank Acc. No. AH011568 CD3 (e.g., Genbank Acc. Nos. NM — 000073 (gamma subunit), NM — 000733 (epsilon subunit), X73617 (delta subunit)), CD4 (e.g., Genbank Acc. No. NM — 000616), CD25 (e.g., Genbank Acc. No. NM — 000417), CD8 (e.g., Genbank Acc. No. M12828), CD11b (e.g., Genbank Acc. No. J03925), CD14 (e.g., Genbank Acc. No.
- CD56 e.g., Genbank Acc. No. U63041
- CD69 e.g., Genbank Acc. No. NM — 001781
- VLA-4 ⁇ 4 ⁇ 7
- CD19 e.g., GenBank Acc. Nos. SEG_HUMCD19WO, M84371, SEG_MUSCD19W, M62542
- CD20 e.g., GenBank Acc. Nos. SEG_HUMCD20, M62541
- CD22 e.g., GenBank Acc. Nos. I680629, Y10210, X59350, U62631, X52782, L16928
- CD30 e.g., Genbank Acc. Nos. M83554, D86042
- CD153 CD30 ligand, e.g., GenBank Acc. Nos.
- CD37 e.g., GenBank Acc. Nos. SEG_MMCD37X, X14046, X5351
- CD50 IAM-3, e.g., GenBank Acc. No. NM — 002162
- CD106 VCAM-1
- VCAM-1 e.g., GenBank Acc. Nos. X53051, X67783, SEG_MMVCAM1C, see also U.S. Pat. No. 5,596,090
- CD54 IAM-1 (e.g., GenBank Acc. Nos.
- interleukin-12 see, e.g., Reiter et al, 1993 Crit. Rev. Immunol. 13:1, and references cited therein
- CD134 OX40, e.g., GenBank Acc. No. AJ277151
- CD137 41BB, e.g., GenBank Acc. No. L12964, NM — 001561
- CD83 e.g., GenBank Acc. Nos. AF001036, AL021918
- DEC-205 e.g., GenBank Acc. Nos. AF011333, U19271.
- HER1 e.g., GenBank Accession Nos. U48722, SEG_HEGFREXS, KO3193
- HER2 Yoshino et al., 1994 J. Immunol. 152:2393; Disis et al., 1994 Canc. Res. 54:16
- HER3 e.g., GenBank Acc. Nos. U29339, M34309
- HER4 Plowman et al., 1993 Nature 366:473; see also e.g., GenBank Acc.
- EGFR epidermal growth factor receptor
- vascular endothelial cell growth factor e.g., GenBank No. M32977
- vascular endothelial cell growth factor receptor e.g., GenBank Acc. Nos. AF022375, 1680143, U48801, X62568
- insulin-like growth factor-I e.g., GenBank Acc. Nos. X00173, X56774, X56773, X06043, see also European Patent No.
- insulin-like growth factor-II e.g., GenBank Acc. Nos. X03562, X00910, SEG_HUMGFIA, SEG_HUMGFI2, M17863, M17862
- transferrin receptor Trowbridge and Omary, 1981 Proc. Nat. Acad. USA 78:3039; see also e.g., GenBank Acc. Nos. X01060, M11507
- estrogen receptor e.g., GenBank Acc. Nos. M38651, X03635, X99101, U47678, M12674
- progesterone receptor e.g., GenBank Acc. Nos.
- FSH-R follicle stimulating hormone receptor
- GenBank Acc. Nos. Z34260, M65085 follicle stimulating hormone receptor
- retinoic acid receptor e.g., GenBank Acc. Nos. L12060, M60909, X77664, X57280, X07282, X06538,, MUC-1 (Barnes et al., 1989 Proc. Nat. Acad. Sci. USA 86:7159; see also e.g., GenBank Acc. Nos. SEG_MUSMUCIO, M65132, M64928) NY-ESO-1 (e.g., GenBank Acc. Nos.
- NA 17-A e.g., European Patent No. WO 96/40039
- Melan-A/MART-1 Kawakami et al., 1994 Proc. Nat. Acad. Sci. USA 91:3515; see also e.g., GenBank Acc. Nos. U06654, U06452), tyrosinase (Topalian et al., 1994 Proc. Nat. Acad. Sci. USA 91:9461; see also e.g., GenBank Acc. Nos. M26729, SEG_HUMTYR0, see also Weber et al., J. Clin.
- any of the CTA class of receptors including in particular HOM-MEL-40 antigen encoded by the SSX2 gene (e.g., GenBank Acc. Nos. X86175, U90842, U90841, X86174), carcinoembyonic antigen (CEA, Gold and Freedman, 1985 J. Exp. Med. 121:439; see also e.g., GenBank Acc. Nos. SEG_HUMCEA, M59710, M59255, M29540), and PyLT (e.g., GenBank Acc. Nos. J02289, J02038).
- GenBank Acc. Nos. SEG_HUMCEA M59710, M59255, M29540
- PyLT e.g., GenBank Acc. Nos. J02289, J02038.
- a lymphocyte status indicator may also include one or more apoptosis signaling polypeptides, sequences of which are known to the art, as reviewed, for example, in When Cells Die: A Comprehensive Evaluation of Apoptosis and Programmed Cell Death (R. A. Lockshin et al., Eds., 1998 John Wiley & Sons, New York; see also, e.g., Green et al., 1998 Science 281:1309 and references cited therein; Ferreira et al., 2002 Clin. Canc. Res. 8:2024; Gurumurthy et al., 2001 Cancer Metastas. Rev. 20:225; Kanduc et al., 2002 Int. J. Oncol . 21:165).
- an apoptosis signaling polypeptide sequence comprises all or a portion of, or is derived from, a receptor death domain polypeptide, for instance, FADD (e.g., Genbank Acc. Nos. U24231, U43184, AF009616, AF009617, NM — 012115), TRADD (e.g., Genbank Acc. No. NM — 003789), RAIDD (e.g., Genbank Acc. No. U87229), CD95 (FAS/Apo-1; e.g., Genbank Acc. Nos.
- FADD e.g., Genbank Acc. Nos. U24231, U43184, AF009616, AF009617, NM — 012115
- TRADD e.g., Genbank Acc. No. NM — 003789
- RAIDD e.g., Genbank Acc. No. U87229
- CD95 FAS/Ap
- TNFR1 TNF- ⁇ -receptor-1
- DR5 e.g., Genbank Acc. No. AF020501, AF016268, AF012535
- an ITIM domain e.g., Genbank Acc.
- an ITAM domain e.g., Genbank Acc. Nos. NM — 005843, NM — 003473, BC030586; see, e.g., Billadeau et al., 2002
- ITAM domain e.g., Genbank Acc. Nos. NM — 005843, NM — 003473, BC030586; see, e.g., Billadeau et al., 2002
- TNFR2 e.g., Genbank Acc. No. L49431, L49432
- caspase/procaspase-3 e.g., Genbank Acc. No.
- caspase/procaspase-8 e.g., AF380342, NM — 004208, NM — 001228, NM — 033355, NM — 033356, NM — 033357, NM — 033358
- caspase/procaspase-2 e.g., Genbank Acc. No. AF314174, AF314175
- Cells in a biological sample that are suspected of undergoing apoptosis may be examined for morphological, permeability, biochemical, molecular genetic, or other changes that will be apparent to those familiar with the art.
- all oligonucleotide amplification primers will comprise the same barcode oligonucleotide, but within different second microdroplets the primer sets will comprise different barcode sequences.
- the sequences in the data set can be sorted into groups of sequences that have identical barcode sequences, and such barcode groups can be further sorted into those having X1 or X2 sequences (which include portions of V and J or C regions) that will indicate whether a given sequence reflects the amplification product of a first TCR or IG encoding chain (e.g., a TCRA or IGH chain) or a second TCR or IG encoding chain (e.g., a TCRB or IGL chain).
- a first TCR or IG encoding chain e.g., a TCRA or IGH chain
- a second TCR or IG encoding chain e.g., a TCRB or IGL chain
- Sequences that have been so sorted by barcode and by TCR or IG chain may be further subject to cluster analysis using any of a known variety of algorithms for clustering (e.g., BLASTClust, UCLUST, CD-HIT, see also IEEE Rev Biomed Eng. 2010; 3:120-54. doi: 10.1109/RBME.2010.2083647; Clustering algorithms in biomedical research: a review, Xu R, Wunsch D C 2 nd ; Mol Biotechnol. 2005 September; 31(1):55-80; Data clustering in life sciences. Zhao Y, Karypis G; Methods Mol Biol. 2010; 593:81-107. doi: 10.1007/978-1-60327-194-3 — 5; Overview on techniques in cluster analysis.
- BLASTClust UCLUST, CD-HIT
- certain embodiments comprise a method including steps of (a) sorting the data set of sequences (obtained as described above) according to oligonucleotide barcode sequences identified therein to obtain a plurality of barcode sequence sets each having a unique barcode; (b) sorting each barcode sequence set of (a) into an X1 sequence-containing subset and an X2 sequence-containing subset; (c) clustering members of each of the X1 and X2 sequence-containing subsets according to X1 and X2 sequences to obtain one or a plurality of X1 sequence cluster sets and one or a plurality of X2 sequence cluster sets, respectively, and error-correcting single nucleotide barcode sequence mismatches within any one or more of said X1 and X2 sequence cluster sets; and (d) identifying as originating from the same cell sequences that are members of an X1 and an X2 sequence cluster set that belong to the same one or more barcode sequence sets.
- first and second adaptive immune receptor chain encoding sequences that occur with the same set of barcode sequences have an extremely high probability of having originated from the same fused microdroplet, and thus from the same source cell.
- the probability that two independent (i.e., originating from different cells) double-stranded first and second products would be obtained having the same barcode sequence is one in 10 8 .
- first and second adaptive immune receptor polypeptide encoding sequences e.g., X1 and X2
- common barcode sequences e.g., belong to the same barcode sequence set
- analysis of the data set of sequences obtained according to the present methods may also be used to characterize the biological status of the lymphoid cell source of genomic DNA.
- barcode sequence analysis as described herein may reveal multiple single lymphoid cell genomes having the same rearranged IGH sequence but different IGL sequences, indicating origins of these sequences in immunologically na ⁇ ve cells.
- T cells express proteins that are specific to their functions, such as lymphocyte status indicator molecules as described herein.
- regulatory T cells express the protein FOXP3.
- co-amplification products may include cDNA species that reflect other mRNAs encoding phenotypic specific proteins such as FOXP3, along with cDNAs encoding the TCRB and TCRA molecules. This approach may permit identification of the adaptive immune receptors that are expressed by T cells having specific phenotypes, such as T regulatory cells or effector T cells.
- a method for determining rearranged DNA sequences encoding first and second polypeptide sequences of an adaptive immune receptor heterodimer in a single lymphoid cell comprising (1) contacting (A) individual first microdroplets that each contain a single lymphoid cell or genomic DNA isolated therefrom, with (B) individual second microdroplets from a plurality of second liquid microdroplets that each contain (i) a first oligonucleotide amplification primer set that is capable of amplifying a rearranged DNA sequence encoding a first complementarity determining region-3 (CDR3) of a first polypeptide of an adaptive immune receptor heterodimer, and (ii) a second oligonucleotide amplification primer set that is capable of amplifying a rearranged DNA sequence encoding a second complementarity determining region-3 (CDR3) of a second polypeptide of the adaptive immune receptor heterodimer.
- A individual first microdroplets that each contain a single lymphoid cell or genomic DNA isolated
- the first oligonucleotide amplification primer set comprises a composition comprising a plurality of oligonucleotides having a plurality of oligonucleotide sequences of general formula: U1/2-B1-X1, in which U1/2 comprises an oligonucleotide which comprises a first universal adaptor oligonucleotide sequence when B1 is present or a second universal adaptor oligonucleotide sequence when B1 is nothing.
- B1 comprises an oligonucleotide that comprises either nothing or a first oligonucleotide barcode sequence of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides
- X1 comprises an oligonucleotide that is one of: (a) a polynucleotide comprising at least 20, 30, 40 or 50 and not more than 100, 90, 80, 70 or 60 contiguous nucleotides of an adaptive immune receptor variable (V) region encoding gene sequence for said first polypeptide of an adaptive immune receptor heterodimer, or the complement thereof, and in each of the plurality of oligonucleotide sequences of general formula U1/2-B1-X1, X1 comprises a unique oligonucleotide sequence, and (b) a polynucleotide comprising at least 15-30 or 31-50 and not more than 80, 70, 60 or 55 contiguous nucleotides of either (i) an adaptive immune receptor
- the second oligonucleotide amplification primer set can comprise a composition comprising a plurality of oligonucleotides having a plurality of oligonucleotide sequences of general formula: U3/4-B2-X2 in which U3/4 comprises an oligonucleotide which comprises a third universal adaptor oligonucleotide sequence when B2 is present or a fourth universal adaptor oligonucleotide sequence when B2 is nothing, B2 comprises an oligonucleotide that comprises either nothing or a second oligonucleotide barcode sequence of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides that is from the same as B1, and X2 comprises an oligonucleotide that is one of: (a) a polynucleotide comprising at least 20, 30, 40 or 50 and not more than 100, 90, 80, 70 or 60 contiguous nucleotides of an adaptive immune receptor variable (
- the step of contacting can take place under conditions and for a time sufficient for a plurality of fusion events between one of the first microdroplets and one of the second microdroplets to produce a plurality of fused microdroplets in which nucleic acid amplification interactions occur between the genomic DNA and the first and second oligonucleotide amplification primer sets, to obtain in each of one or more of said plurality of fused microdroplets: a first double-stranded DNA product that comprises at least one first universal adaptor oligonucleotide sequence, at least one first oligonucleotide barcode sequence, at least one X1 oligonucleotide V region encoding gene sequence of said first polypeptide of the adaptive immune receptor heterodimer, at least one second universal adaptor oligonucleotide sequence, and at least one X1 oligonucleotide J region or C region encoding gene sequence of said first polypeptide of the adaptive immune receptor heterodimer.
- the conditions also permit obtaining in each of one or more of said plurality of fused microdroplets: a second double-stranded DNA product that comprises at least one third universal adaptor oligonucleotide sequence, at least one second oligonucleotide barcode sequence, at least one X2 oligonucleotide V region encoding gene sequence of said second polypeptide of the adaptive immune receptor heterodimer, at least one fourth universal adaptor oligonucleotide sequence, and at least one X2 oligonucleotide J region or C region encoding gene sequence of said second polypeptide of the adaptive immune receptor heterodimer.
- the method also includes disrupting the plurality of fused microdroplets to obtain a heterogeneous mixture of said first and second double-stranded DNA products and contacting the mixture of first and second double-stranded DNA products with a third amplification primer set and a fourth amplification primer set.
- the third amplification primer set comprises (i) a plurality of first sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the first universal adaptor oligonucleotide and a first sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the first universal adaptor oligonucleotide sequence, and (ii) a plurality of second sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the second universal adaptor oligonucleotide sequence and a second sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the second universal adaptor oligonucleotide sequence.
- the fourth amplification primer set comprises (i) a plurality of third sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the third universal adaptor oligonucleotide and a third sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the third universal adaptor oligonucleotide sequence, and (ii) a plurality of fourth sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the fourth universal adaptor oligonucleotide sequence and a fourth sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the fourth universal adaptor oligonucleotide sequence.
- the contacting step can take place under conditions and for a time sufficient to amplify both strands of the first and second double-stranded DNA products of (2), to obtain a DNA library for sequencing.
- the method also includes sequencing the DNA library obtained in (3) to obtain a data set of sequences encoding the first and second polypeptide sequences of the adaptive immune receptor heterodimer.
- FIG. 2 illustrates one method by which a plurality of first microdroplets 210 that contain a single lymphoid cell or genomic DNA fuse with a plurality of individual second microdroplets 220 to form a plurality of fused microdroplets 230 .
- the second plurality of droplets may comprise amplification primer sets, as described herein, and the fused droplets can be placed under conditions where the amplification primers can amplify the DNA found in the single lymphoid cell or the genomic DNA (or cDNA) within the microdroplet.
- the microdroplets may be disrupted and the ensuing steps that include amplifying and introducing sequencing platform-specific oligonucleotides may be carried out as described herein and shown in FIG. 3 .
- a single tagging barcode may be shared by all J primers (or in certain embodiments by all V primers) and it may be desirable to produce such primers with a finite set of specific and pre-identified barcode sequences. Only a single tagging barcode sequence (BC1) will be present within any given microdroplet during the first step, however.
- analysis of such information may include determination of first and second TCR or Ig heterodimeric polypeptide chain encoding sequences that contain the same tagging barcode (BC1), from which a probabilistic basis would indicate an extremely high likelihood that both chains are the products of the same cell.
- BC1 tagging barcode
- determination of rearranged DNA sequences encoding first and second adaptive immune receptor heterodimer polypeptide sequences in a single cell may be achieved without first preparing separate populations of first and second microdroplets that contain, respectively, single lymphoid cell genomic DNA (or cDNA that has been reverse transcribed from mRNA therefrom) and oligonucleotide amplification primer sets.
- these alternative embodiments contemplate separating the cells of a lymphoid cell-containing cell suspension (e.g., a blood cell preparation from a subject or a cell subpopulation thereof) into subpopulations by distributing the cells to a plurality of containers, such as multiple wells of a multi-well cell culture plate or assay plate (e.g., 96-, 384- or 1536-well formats).
- a lymphoid cell-containing cell suspension e.g., a blood cell preparation from a subject or a cell subpopulation thereof
- a plurality of containers such as multiple wells of a multi-well cell culture plate or assay plate (e.g., 96-, 384- or 1536-well formats).
- FACS fluorescence activated cell sorting
- separated lymphoid cell subpopulations may provide mRNA molecules that are used as templates for reverse transcription to produce cDNA molecules that are concomitantly labeled during the reverse transcription (RT) step (see FIGS. 4 and 5 ).
- FIG. 4 depicts a schematic representation of labeling adaptive immune receptor polypeptide encoding cDNA during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences into cDNA.
- the cDNA strand is amplified with primers comprising a pGEX-Rev sequence, a barcode BC and N6 spacer sequence (BC-N6) and a “Cn-RC” sequence.
- the 3′ end of the amplified cDNA strand includes a pGEX-FRC sequence, a barcode BC-N6 spacer sequence, and a “Smarter UAll” sequence.
- the wells or containers of amplified cDNA are pooled, and SPRI bead purification is performed of the first cDNA strand pool. PCR amplification is performed using a tailing-pGEX F/R sequence.
- the amplicons are purified and selected based on size.
- the resulting cDNA amplicon is shown in FIG. 4 .
- FIG. 5 depicts a schematic representation of labeling adaptive immune receptor polypeptide encoding cDNA during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences into cDNA.
- FIG. 6 presents a schematic representation of a DNA product that is amenable to sequencing following modification with Illumina sequencing adapters of amplified adaptive immune receptor polypeptide encoding cDNA that has been labeled during reverse transcription by using an oligonucleotide reverse transcription primer that directs incorporation of oligonucleotide barcode and universal adaptor oligonucleotide sequences.
- oligonucleotide RT primers in such embodiments include oligonucleotide sequences that specifically hybridize to target adaptive immune receptor encoding regions such as V, J or C region sequences, and also include oligonucleotide barcode sequences as molecular labels, along with universal adaptor oligonucleotide sequences as described herein.
- the process of reverse transcription from adaptive immune receptor encoding mRNA may thus be accompanied by incorporation into cDNA products of (i) oligonucleotide barcode sequences as source identifiers, and (ii) universal adaptors to facilitate automated high throughput sequencing as described herein.
- all RT primers in the oligonucleotide RT primer sets that are contacted with the contents of a single particular container share a common barcode oligonucleotide sequence (B), and a different barcode oligonucleotide sequence (B) is present in each separate container (such as each well of a multi-well plate).
- a cell suspension e.g., blood cells or a fraction thereof, such as nucleated cells, lymphoid cells, etc.
- a cell suspension may be divided by random distribution among different wells of a multi-well plate to physically separate the cells into subsets.
- the subset of cells in each well may then be lysed or otherwise processed according to any of a number of conventional procedures to liberate mRNA present within the cells, which may include mRNA encoding both chains of TCR (e.g., TCRA and TCRB, or TCRG and TCRG) or IG (e.g., IGH and IGL) heterodimers expressed by the cells, and which may also include mRNA encoding one or more lymphocyte status indicator molecules.
- TCR e.g., TCRA and TCRB, or TCRG and TCRG
- IG e.g., IGH and IGL
- the mRNA may then be used as a template for cDNA synthesis by modification of established reverse transcription (RT) protocols, using oligonucleotide reverse transcription primer sets as described herein that are capable of introducing into the cDNA products, in each separate well, a unique oligonucleotide barcode sequence that is linked to the TCR or IG encoding sequence or complement thereof (see, e.g., FIGS. 4-5 ).
- RT reverse transcription
- the oligonucleotide reverse transcription primer sets may also be designed to introduce a universal adaptor oligonucleotide sequence as described herein and/or other known oligonucleotide sequence features such as those that may facilitate downstream amplification, processing and/or other manipulation steps such as those that will be compatible with automated high throughput quantitative sequencing.
- each amplified DNA molecule within a given well of the multi-well plate will have the same oligonucleotide barcode sequence, while the barcode sequences of the amplification products in each different well will be distinct from one another.
- all DNA molecules that encode either chain of an adaptive immune receptor heterodimer e.g., IGH and IGL, TCRA and TCRB, TCRG and TCRD
- IGH and IGL e.g., IGH and IGL, TCRA and TCRB, TCRG and TCRD
- the amplification products may be pooled and quantitatively sequenced using automated high throughput DNA sequencing as described elsewhere herein to obtain a data set of sequences, which include TCR and/or IG sequences along with associated oligonucleotide barcode sequences.
- the data set of sequences may be analyzed by a combinatorics approach, which permits matching particular pairs of adaptive immune receptor heterodimer subunit encoding sequences to identify them as having originated from the same lymphoid cell.
- a hypothetical data set of sequences may be obtained from a set of 100 wells into which a lymphoid cell suspension is distributed.
- the cells' mRNA cDNA is reverse transcribed using first and second oligonucleotide reverse transcription primer sets that are specific, respectively, for portions of TCRA and TCRB encoding sequences.
- the oligonucleotide reverse transcription primer sets also introduce a different oligonucleotide barcode sequence into the cDNA products in each distinct well.
- the sequence data set will include five separate instances in which the unique pair of TCRA and TCRB sequences occurs in DNA amplification products that share an identical barcode sequence.
- the oligonucleotide reverse transcription primer set promotes the generation of cDNAs having identical rearranged TCRA and TCRB sequences, but the cDNA products of each well include a distinct, well-specific barcode sequence.
- the likelihood would be extremely high that the unique TCRA/TCRB sequence pair originates in the same T cell clone, members of which would have been randomly distributed into the five different wells.
- Lymphoid cells are isolated from an anti-coagulated whole blood sample using either density gradient centrifugation (e.g., FicollPaque®, GE Healthcare Bio-Sciences, Piscataway, N.J.), or by binding to antibody-coated magnetic beads, such as CD45 beads from Miltenyi Biotec (Auburn, Calif.).
- density gradient centrifugation e.g., FicollPaque®, GE Healthcare Bio-Sciences, Piscataway, N.J.
- antibody-coated magnetic beads such as CD45 beads from Miltenyi Biotec (Auburn, Calif.).
- T lymphocytes may be purified from a whole blood sample by binding to CD3+ magnetic beads
- B lymphocytes may be purified from a whole blood sample by binding to CD19+ magnetic beads.
- Isolated cell populations may then be checked for viability.
- Dead cells may be removed from the sample with a filter, for example, using a Miltenyi Biotec Dead Cell Removal kit.
- isolated viable lymphoid cells may be cultured in short-tem cell culture, and in certain embodiments cells may be activated by any of a number of known activation paradigms, such as by exposure to one or more of cytokines, chemokines, specific antibodies, mitogens, polyclonal activators, etc.
- the final cell sample may be prepared by resuspending the cells in culture media (e.g., RPMI with 10% fetal bovine serum) or appropriate isotonic buffered solutions (e.g., phosphate buffered saline, PBS), supplemented with agents which prevent cell clumping (e.g., 0.1% BSA, 1% Pluronic® F-68).
- culture media e.g., RPMI with 10% fetal bovine serum
- isotonic buffered solutions e.g., phosphate buffered saline, PBS
- agents which prevent cell clumping e.g., 0.1% BSA, 1% Pluronic® F-68
- whole blood or PBMCs may be utilized without sorting.
- any set of cells present as a suspension in an aqueous solution that contains B or T cells may be used.
- the cell preparation comprising a plurality of lymphoid cells is divided into a plurality of physically separated subsets, for example, by distributing the suspension of cells amongst a plurality of containers or compartments that are capable of containing the cells to obtain a plurality of containers or compartments that each contain a subpopulation of the lymphoid cells, wherein each subpopulation comprises one lymphoid cell or a plurality of lymphoid cells, and wherein each container or compartment is physically separate so that the contents are not in fluid communication with one another.
- the cells are distributed or divided into the plurality of containers so that each container contains a substantially equivalent number of cells, which may result in there being the same number of cells in each container, or in there being in each container a number of cells that is within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21-30, 31-50, 51-70, 71-80, or 81-100 percent of the number of cells in any other container.
- Exemplary containers may be wells of multi-well culture or assay plates such as 6-, 12-, 24-, 48-, 96-, 384- or 1536-well multi-well plates or any other multi-well plate format; arrays of tubes, filters, microfabricated well arrays, laser-generated matrices or any other suitable containers that are capable of containing the cells are also contemplated.
- cells may be distributed amongst the plurality of containers by fluorescence activated cell sorting (FACS): A predetermined number of cells may be isolated, sorted, and deposited into a multi-well (e.g., 96, 384 or 1536) reaction plate using FACS.
- FACS fluorescence activated cell sorting
- flow cytometers that are capable of preparative sorting of cells onto multi-well plates (e.g., Beckton Dickinson FACSAria® III, Beckman MoFloTM XDP, etc.).
- FACS allows for specific subsets of cells to be isolated by antibody staining, viability staining or multicolor combination of specific cell staining reagents.
- Cell sorters may be employed to count target cells and deposit specified numbers of cells into each well of a collection multi-well plate (10-20% CV).
- automated low volume (nl to ⁇ l volumes per well) dispensers capable of preferably non-contact dispensing of uniform cell suspensions onto high density micro-well plates (384, 1536, 3456 wells), such as Beckman Coulter BioRAPTR FRDTM, LambdaJetTM IIIMT (Thermo Fisher Scientific), CyBiTM Drop (Jena Analytik), Furukawa PerflowTM, or similar instruments, may be used to deposit specified numbers of cells into each well of a collection multi-well plate with high precision and reproducibility (10-20% CV).
- the adaptive immune receptor encoding polynucleotide sequences are then amplified from each well, with a unique, well-specific, barcode oligonucleotide attached to all samples.
- One way to do this is to convert cellular mRNA to cDNA by reverse transcription, and to add to the cDNA products a molecular label in the form of an oligonucleotide barcode during the reverse transcription step.
- the same barcode may be added to cDNAs that are complementary to mRNAs encoding both chains of each heterodimeric adaptive immune receptor molecule within the well, for instance, the immunoglobulin heavy and light chains, the TCRA and TCRB chains, and the TCRG and TCRD chains.
- antigen receptor encoding sequences are amplified from cDNA made by reverse transcription from mRNA; genomic DNA (gDNA) is not amplified.
- each well of a microwell plate may contain a medium containing an RNase inhibitor, and a medium designed either to protect RNA in cells (such as Qiagen RNAlaterTM, Qiagen, Valencia, Calif.), or to lyse cells and isolate RNA (Trizol, guanidium isothiocyanate—Qiagen RNeasyTM etc.). Extracted total cellular RNA may then be transferred into another multi-well plate for the reverse transcription reaction using robotic liquid handlers.
- sorted cells may be lysed directly in a reverse-transcription reaction mix containing an RNase inhibitor.
- Reverse transcription reaction may be initiated by exposing cellular RNA to a reaction mix containing an appropriate buffer, dNTPs, an enzyme (reverse transcriptase) and a set of oligonucleotide reverse transcription primers.
- primers will generally comprise a multiplicity of subsets of primers that may anneal to IgG, IgM, IgA, IgD, IgE, Ig kappa, Ig lambda, TCR alpha, beta, gamma and delta constant region (C-segment) gene-specific oligonucleotide sequences, as well as a universal template switching oligonucleotide (e.g., Clontech SmarterTM UAII oligonucleotide, Clontech, Mountain View, Calif.).
- a universal template switching oligonucleotide e.g., Clontech SmarterTM UAII oligonucleotide, Clontech, Mountain View, Calif.
- either the C-segment gene specific primers, or the SmarterTM UAII oligonucleotide, or both, will be uniquely tagged with a DNA barcode, which will be a unique sequence 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, . . . etc. base pairs long.
- a DNA barcode which will be a unique sequence 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, . . . etc. base pairs long.
- Each well of the RT reaction plate will contain the same multiplicity of primers, where each primer in the mix will be tagged with the same DNA barcode, but a different barcode will be used in each well.
- each first strand cDNA molecule in a given well will be barcoded with an identical DNA barcode sequence.
- each of the containers is contacted, under conditions and for a time sufficient to promote reverse transcription of mRNA in the lymphoid cells in the plurality of containers, with a first and a second oligonucleotide reverse transcription primer set, wherein (A) the first oligonucleotide reverse transcription primer set is capable of reverse transcribing a plurality of first mRNA sequences encoding a plurality of first polypeptides of an adaptive immune receptor heterodimer, and (B) the second oligonucleotide reverse transcription primer set is capable of reverse transcribing a plurality of second mRNA sequences encoding a plurality of second polypeptides of the adaptive immune receptor heterodimer, and wherein: (I) the first oligonucleotide reverse transcription primer set comprises a composition comprising a plurality of oligonucleotides having a plurality of oligonucleotide sequences of
- U1/2 comprises an oligonucleotide which comprises a first universal adaptor oligonucleotide sequence when B1 is present or a second universal adaptor oligonucleotide sequence when B1 is nothing
- B1 comprises an oligonucleotide that comprises either nothing or a first oligonucleotide barcode sequence of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides
- X1 comprises an oligonucleotide that is one of: (a) a polynucleotide comprising at least 20, 30, 40 or 50 and not more than 100, 90, 80, 70 or 60 contiguous nucleotides of an adaptive immune receptor variable (V) region encoding gene sequence for said first polypeptide of an adaptive immune receptor heterodimer, or the complement thereof, and in each of the plurality of oligonucleotide sequences of general formula U1/2-B1-X1, X1 comprises a unique oligonucleot
- U3/4 comprises an oligonucleotide which comprises a third universal adaptor oligonucleotide sequence when B2 is present or a fourth universal adaptor oligonucleotide sequence when B2 is nothing
- B2 comprises an oligonucleotide that comprises either nothing or a second oligonucleotide barcode sequence of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 contiguous nucleotides that is, for each of the first and second reverse transcription primer sets that are contacted with a single one of the plurality of containers, the same as B1
- X2 comprises an oligonucleotide that is one of: (a) a polynucleotide comprising at least 20, 30, 40 or 50 and not more than 100, 90, 80, 70 or 60 contiguous nucleotides of an adaptive immune receptor variable (V) region encoding gene sequence for said second polypeptide of an adaptive immune receptor heterodimer, or the complement thereof, and in each of the plurality
- step of contacting After the step of contacting, there is performed a step of combining the first and second reverse-transcribed cDNA products from the plurality of containers to obtain a mixture of reverse-transcribed cDNA products.
- the combining step is followed by contacting the mixture of first and second reverse-transcribed cDNA products with a first oligonucleotide amplification primer set and a second oligonucleotide amplification primer set, wherein the first amplification primer set comprises (i) a plurality of first sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the first universal adaptor oligonucleotide and a first sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the first universal adaptor oligonucleotide sequence, and (ii) a plurality of second sequencing platform tag-containing oligonucleotides that each comprise an oligonucleotide sequence that is capable of specifically hybridizing to the second universal adaptor oligonucleotide sequence and a second sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to the second
- Analysis of the data set of sequences may then proceed essentially as described elsewhere herein, to determine rearranged DNA sequences encoding first and second polypeptides of an adaptive immune receptor heterodimer that originate in a single (i.e., the same) lymphoid cell.
- the method may further comprise the steps of: (a) sorting the data set of sequences according to oligonucleotide barcode sequences identified therein to obtain a plurality of barcode sequence sets each having a unique barcode; (b) sorting each barcode sequence set of (a) into an X1 sequence-containing subset and an X2 sequence-containing subset; (c) clustering members of each of the X1 and X2 sequence-containing subsets according to X1 and X2 sequences to obtain one or a plurality of X1 sequence cluster sets and one or a plurality of X2 sequence cluster sets, respectively, and error-correcting single nucleotide barcode sequence mismatches within any one or more of said X1 and X2 sequence cluster sets; (d) identifying each first and second adaptive immune receptor heterodimer polypeptide encoding sequence based on known X1 and X2 sequences, wherein each X1 sequence and each X2 sequence is associated with one or a plurality
- sequencing adapters may be put onto each end of all reverse transcribed/amplified TCR and/or IG encoding segments, for instance, by synthesizing universal adaptor sequences onto each end of each cDNA molecule outside of the well-specific barcode. Then, the adapters can be synthesized onto each molecule in a tailing PCR reaction.
- fusion RT primers may be synthesized and used for the first cDNA strand synthesis. These primers will all contain the same unique DNA barcode, as well as universal (e.g., pGEX) priming sites.
- the contents of all plate wells will be recovered in a quantitative manner and pooled (e.g., by an inverted centrifugation onto a trough), purified and consequently split into a multiplicity of wells for PCR with universal adapter primers (pGEX) containing “tail” sequences designed to incorporate sequences to be used for amplification and sequencing using a next-generation sequence analysis system (e.g., Illumina, San Diego, Calif.).
- the sequencing platform specific adapters can be ligated onto the ends of tagged molecules (e.g., Illumina TrueSeqTM sample preparation method).
- the molecules from all the wells are pooled thus generating a high-complexity sequencing library of uniquely tagged BCR or TCR ds-cDNA products.
- the molecules are all sequenced using high-throughput sequencing.
- Universal sequencing primers complementary to the sequencing platform-specific adapters may desirably be used. This will allow sample indexing of multiple samples, where a sample specific index will be used for each pool of uniquely tagged IGH/TCR products, originating from 96, 384, 1536 etc. original RT reaction wells. Or, a multiplex PCR with a mix of a universal UAII-Forward/multiplex V, J or C reverse primers may be used to amplify specific target fragments while preserving the original cell transcripts barcoding.
- Illumina sequencing platform (MiSeqTM)
- a paired end sequencing of 2 ⁇ 250 bp would span the majority of the whole BCR/TCR heavy and light (alpha/beta; gamma/delta) chain sequences, thus allowing recovery of the whole coding sequence of each receptor domain.
- sequencing platforms with extended read length (Roche 454, Life Ion Torrent, OGT etc.) may be used to read through all library fragments in a single sequencing read in one direction.
- the reads from each sample may be demultiplexed, provided that more than one sample were in the same sequencing lane. Demultiplexing may be performed by assigning sequencing reads to one of multiple indexes used as part of the universal sequencing adapters. For each sample demultiplexed sequence reads, all reads may be divided by the well specific barcodes. Each set of reads with a specific barcode may be clustered separately to correct PCR and sequencing errors and determine the unique sequences for each barcode:
- Sequences that have been so sorted by barcode and by TCR or IG chain may be further subject to cluster analysis using any of a known variety of algorithms for clustering (e.g., BLASTClust, UCLUST, CD-HIT) and error correction in the case of sequences that fail to cluster with other sequences having shared barcode sequences but which instead would cluster with sequences having a barcode that differs by a single nucleotide.
- the unique sequences can be identified as IG heavy or light (kappa or lambda) chain, or as TCR (alpha or beta; gamma or delta) chains, by sequence match to known receptor sequences. Each heavy and light chain sequence may thus be associated with a list of barcodes corresponding to an original sample well position.
- the data can then be reordered by sequence. Associated to each unique sequence will be the set of multi-well plate well-specific barcodes within which set that sequence is found. For every B or T cell clone, the heavy and light chain sequences may be associated with the barcodes from all the wells for which one or more copies of the clone is present. Combinatorics may then be used to match heavy and light chains from the same clone.
- this particular pair of heavy and light chains may be assumed to have originated from the same clone, insofar as the probability of two sequences randomly having the exact same 12 barcodes out of 96 is infinitesimally small.
- first and second adaptive immune receptor chain encoding sequences that occur with the same set of barcode sequences have a high probability of having originated from the same plate well, and thus from the same source cell.
- the probability that two independent (i.e., originating from different cells) double-stranded cDNA first and second products would be obtained having the same barcode sequence is one in 10 6 , if one cell per each plate well were sorted.
- first and second adaptive immune receptor polypeptide encoding sequences e.g., X1 and X2
- common barcode sequences e.g., belong to the same barcode sequence set
- barcode oligonucleotides B may optionally comprise a first and a second oligonucleotide barcode sequence, wherein the first barcode sequence is selected to identify uniquely a particular V oligonucleotide sequence and the second barcode sequence is selected to identify uniquely a particular J oligonucleotide sequence.
- the relative positioning of the barcode oligonucleotides B1 and B2 and universal adaptors (U) advantageously permits rapid identification and quantification of the amplification products of a given unique template oligonucleotide by short sequence reads and paired-end sequencing on automated DNA sequencers (e.g., Illumina HiSeqTM or Illumina MiSEQ®, or GeneAnalyzerTM-2, Illumina Corp., San Diego, Calif.).
- automated DNA sequencers e.g., Illumina HiSeqTM or Illumina MiSEQ®, or GeneAnalyzerTM-2, Illumina Corp., San Diego, Calif.
- these and related embodiments permit rapid high-throughput determination of specific combinations of a V and a J sequence that are present in an amplification product, thereby to characterize the relative representation of annealing targets for each combination of a V-specific primer and a J-specific primer that may be present in a sample such as a sample comprising rearranged TCR or BCR encoding DNA. Verification of the identities and/or quantities of the amplification products may be accomplished by longer sequence reads.
- V region and joining (J) region gene sequences are known as nucleotide and/or amino acid sequences, including non-rearranged genomic DNA sequences of TCR and Ig loci, and productively rearranged DNA sequences at such loci and their encoded products. See, e.g., U.S. Ser. No. 13/217,126; U.S. Ser. No. 12/794,507; PCT/US2011/026373; PCT/US2011/049012. These and other sequences known to the art may be used according to the present disclosure for the design and production of oligonucleotides to be included in the presently provided compositions and methods.
- V region-specific oligonucleotides may include a polynucleotide sequence of at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or 450 and not more than 1000, 900, 800, 700, 600 or 500 contiguous nucleotides of an adaptive immune receptor (e.g., TCR or BCR) variable (V) region gene sequence, or the complement thereof, and in each of the plurality of oligonucleotide sequences V comprises a unique oligonucleotide sequence.
- an adaptive immune receptor e.g., TCR or BCR
- V variable
- V region gene sequences include polynucleotide sequences that encode the products of expressed, rearranged TCR and BCR genes and also include polynucleotide sequences of pseudogenes that have been identified in the V region loci.
- the diverse V polynucleotide sequences that may be incorporated into the presently disclosed oligonucleotides may vary widely in length, in nucleotide composition (e.g., GC content), and in actual linear polynucleotide sequence, and are known, for example, to include “hot spots” or hypervariable regions that exhibit particular sequence diversity.
- the polynucleotide V may thus includes sequences to which members of oligonucleotide primer sets specific for TCR or BCR genes can specifically anneal.
- Primer sets that are capable of amplifying rearranged DNA encoding a plurality of TCR or BCR are described, for example, in U.S. Ser. No. 13/217,126; U.S. Ser. No.
- PCT/US2011/026373; or PCT/US2011/049012; or the like; or as described therein may be designed to include oligonucleotide sequences that can specifically hybridize to each unique V gene and to each J gene in a particular TCR or BCR gene locus (e.g., TCRA, TCRB, TCRG, TCRD, IGH, IGK or IGL).
- TCRA TCRA, TCRB, TCRG, TCRD, IGH, IGK or IGL.
- an oligonucleotide primer of an oligonucleotide primer amplification set that is capable of amplifying rearranged DNA encoding one or a plurality of TCR or BCR may typically include a nucleotide sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides, or more, and may specifically anneal to a complementary sequence of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides of a V or a J polynucleotide as provided herein.
- the primers may comprise at least 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides, and in certain embodiment the primers may comprise sequences of no more than 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 contiguous nucleotides. Primers and primer annealing sites of other lengths are also expressly contemplated, as disclosed herein.
- the V polynucleotide may thus, in certain embodiments, comprise a nucleotide sequence having a length that is less than, the same or similar to that of the length of a typical V gene from its start codon to its CDR3 encoding region and may, but need not, include a nucleotide sequence that encodes the CDR3 region.
- the V polynucleotide includes all or a portion of a CDR3 encoding nucleotide sequence or the complement thereto and CDR3 sequence lengths may vary considerably and have been characterized by several different numbering schemes (e.g., Lefranc, 1999 The Immunologist 7:132; Kabat et al., 1991 In: Sequences of Proteins of Immunological Interest , NIH Publication 91-3242; Chothia et al., 1987 J. Mol. Biol. 196:901; Chothia et al., 1989 Nature 342:877; Al-Lazikani et al., 1997 J. Mol. Biol. 273:927; see also, e.g., Rock et al., 1994 J. Exp. Med. 179:323; Saada et al., 2007 Immunol. Cell Biol. 85:323).
- the numbering schemes for CDR3 encoding regions described above denote the positions of the conserved cysteine, phenylalanine and tryptophan codons, and these numbering schemes may also be applied to pseudogenes in which one or more codons encoding these conserved amino acids may have been replaced with a codon encoding a different amino acid.
- the CDR3 length may be defined relative to the corresponding position at which the conserved residue would have been observed absent the substitution, according to one of the established CDR3 sequence position numbering schemes referenced above.
- the polynucleotide J may comprise a polynucleotide comprising at least 15-30, 31-50, 51-60, 61-90, 91-120, or 120-150, and not more than 600, 500, 400, 300 or 200 contiguous nucleotides of an adaptive immune receptor joining (J) region encoding gene sequence, or the complement thereof, and in each of the plurality of oligonucleotide sequences J comprises a unique oligonucleotide sequence.
- the polynucleotide J (or its complement) includes sequences to which members of oligonucleotide primer sets specific for TCR or BCR genes can specifically anneal.
- Primer sets that are capable of amplifying rearranged DNA encoding a plurality of TCR or BCR are described, for example, in U.S. Ser. No. 13/217,126; U.S. Ser. No. 12/794,507; PCT/US2011/026373; or PCT/US2011/049012; or the like; or as described therein may be designed to include oligonucleotide sequences that can specifically hybridize to each unique V gene and to each unique J gene in a particular TCR or BCR gene locus (e.g., TCR ⁇ , ⁇ , ⁇ or ⁇ , or IgH ⁇ , ⁇ , ⁇ , ⁇ or ⁇ , or IgL ⁇ or ⁇ ).
- the plurality of J polynucleotides that are present in the herein described primer compositions have lengths that simulate the overall lengths of known, naturally occurring J gene nucleotide sequences.
- the J region lengths in the herein described templates may differ from the lengths of naturally occurring J gene sequences by no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 percent.
- the J polynucleotide may thus, in certain embodiments, comprise a nucleotide sequence having a length that is the same or similar to that of the length of a typical naturally occurring J gene and may, but need not, include a nucleotide sequence that encodes the CDR3 region, as discussed above.
- J region gene sequences include polynucleotide sequences that encode the products of expressed and unexpressed rearranged TCR and BCR genes.
- the diverse J polynucleotide sequences that may be incorporated into the presently disclosed primers may vary widely in length, in nucleotide composition (e.g., GC content), and in actual linear polynucleotide sequence.
- V and J sequences described herein for use in construction of the herein described V-segment and J-segment oligonucleotide primers, may be selected by a skilled person based on the present disclosure using knowledge in the art regarding published gene sequences for the V- and J-encoding regions of the genes for each TCR and Ig subunit.
- Reference Genbank entries for human adaptive immune receptor sequences include: TCR ⁇ : (TCRA/D): NC — 000014.8 (chr14:22090057..23021075); TCR ⁇ : (TCRB): NC — 000007.13 (chr7:141998851..142510972); TCR ⁇ : (TCRG): NC — 000007.13 (chr7:38279625..38407656); immunoglobulin heavy chain, IgH (IGH): NC — 000014.8 (chr14: 106032614..107288051); immunoglobulin light chain-kappa, IgL ⁇ (IGK): NC — 000002.11 (chr2: 89156874..90274235); and immunoglobulin light chain-lambda, IgL ⁇ (IGL): NC — 000022.10 (chr22: 22380474..23265085).
- Reference Genbank entries for mouse adaptive immune receptor loci sequences include: TCR ⁇ : (TCRB): NC — 000072.5 (chr6: 40841295..41508370), and immunoglobulin heavy chain, IgH (IGH): NC — 000078.5 (chr12:114496979..117248165).
- Primer design analyses and target site selection considerations can be performed, for example, using the OLIGO primer analysis software and/or the BLASTN 2.0.5 algorithm software (Altschul et al., Nucleic Acids Res. 1997, 25(17):3389-402), or other similar programs available in the art.
- oligonucleotide design methodologies for inclusion in the instant oligonucleotides those skilled in the art can design a plurality of V region-specific and J region-specific polynucleotide sequences that each independently contain oligonucleotide sequences that are unique to a given V and J gene, respectively.
- a primer set comprising a plurality of V region-specific and J region-specific oligonucleotide primers that are each independently capable of annealing to a specific sequence that is unique to a given V and J gene, respectively, whereby the plurality of primers is capable of amplifying substantially all V genes and substantially all J genes in a given adaptive immune receptor-encoding locus (e.g., a human TCR or IGH locus).
- a given adaptive immune receptor-encoding locus e.g., a human TCR or IGH locus
- Such primer sets permit generation, in multiplexed (e.g., using multiple forward and reverse primer pairs) PCR, of amplification products that have a first end that is encoded by a rearranged V region-encoding gene segment and a second end that is encoded by a J region-encoding gene segment.
- such amplification products may include a CDR3-encoding sequence although the invention is not intended to be so limited and contemplates amplification products that do not include a CDR3-encoding sequence.
- the primers may be preferably designed to yield amplification products having sufficient portions of V and J sequences and in certain preferred embodiments also of barcode (B) sequences as described herein, such that by sequencing the products (amplicons), it is possible to identify on the basis of sequences that are unique to each gene segment (i) the particular V gene, and (ii) the particular J gene in the proximity of which the V gene underwent rearrangement to yield a rearranged adaptive immune receptor-encoding gene.
- the PCR amplification products will not be more than 600 base pairs in size, which according to non-limiting theory will exclude amplification products from non-rearranged adaptive immune receptor genes. In certain other preferred embodiments the amplification products will not be more than 500, 400, 300, 250, 200, 150, 125, 100, 90, 80, 70, 60, 50, 40, 30 or 20 base pairs in size, such as may advantageously provide rapid, high-throughput quantification of sequence-distinct amplicons by short sequence reads.
- oligonucleotide primers are provided in an oligonucleotide primer set that comprises a plurality of V-segment primers and a plurality of J-segment primers, where the primer set is capable of amplifying rearranged DNA encoding adaptive immune receptors in a biological sample that comprises lymphoid cell DNA.
- Suitable primer sets are known in the art and disclosed herein, for example, the primer sets in US 2012/0058902, U.S. Ser. No. 13/217,126; U.S. Ser. No. 12/794,507; PCT/US2011/026373; or PCT/US2011/049012; or the like; or those shown in Table 1.
- the primer set is designed to include a plurality of V sequence-specific primers that includes, for each unique V region gene (including pseudogenes) in a sample, at least one primer that can specifically anneal to a unique V region sequence; and for each unique J region gene in the sample, at least one primer that can specifically anneal to a unique J region sequence.
- Primer design may be achieved by routine methodologies in view of known TCR and BCR genomic sequences. Accordingly, the primer set is preferably capable of amplifying every possible V-J combination that may result from DNA rearrangements in the TCR or BCR locus. As also described below, certain embodiments contemplate primer sets in which one or more V primers may be capable of specifically annealing to a “unique” sequence that may be shared by two or more V regions but that is not common to all V regions, and/or in which in which one or more J primers may be capable of specifically annealing to a “unique” sequence that may be shared by two or more J regions but that is not common to all J regions.
- oligonucleotide primers for use in the compositions and methods described herein may comprise or consist of a nucleic acid of at least about 15 nucleotides long that has the same sequence as, or is complementary to, a 15 nucleotide long contiguous sequence of the target V- or J-segment (i.e., portion of genomic polynucleotide encoding a V-region or J-region polypeptide).
- primers e.g., those of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, or 50, nucleotides long that have the same sequence as, or sequence complementary to, a contiguous sequence of the target V- or J-region encoding polynucleotide segment, will also be of use in certain embodiments. All intermediate lengths of the presently described oligonucleotide primers are contemplated for use herein.
- the primers may have additional sequence added (e.g., nucleotides that may not be the same as or complementary to the target V- or J-region encoding polynucleotide segment), such as restriction enzyme recognition sites, adaptor sequences for sequencing, barcode sequences, and the like (see e.g., primer sequences provided in the Tables and sequence listing herein).
- the length of the primers may be longer, such as about 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 80, 85, 90, 95, 100 or more nucleotides in length or more, depending on the specific use or need.
- adaptive immune receptor V-segment or J-segment oligonucleotide primer variants that may share a high degree of sequence identity to the oligonucleotide primers for which nucleotide sequences are presented herein, including those set forth in the Sequence Listing.
- adaptive immune receptor V-segment or J-segment oligonucleotide primer variants may have substantial identity to the adaptive immune receptor V-segment or J-segment oligonucleotide primer sequences disclosed herein, for example, such oligonucleotide primer variants may comprise at least 70% sequence identity, preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity compared to a reference polynucleotide sequence such as the oligonucleotide primer sequences disclosed herein, using the methods described herein (e.g., BLAST analysis using standard parameters).
- oligonucleotide primer variants will contain one or more substitutions, additions, deletions and/or insertions, preferably such that the annealing ability of the variant oligonucleotide is not substantially diminished relative to that of an adaptive immune receptor V-segment or J-segment oligonucleotide primer sequence that is specifically set forth herein.
- Table 2 presents as a non-limiting example an oligonucleotide primer set that is capable of amplifying productively rearranged DNA encoding TCR ⁇ -chains (TCRB) in a biological sample that comprises DNA from lymphoid cells of a subject.
- TCRB TCR ⁇ -chains
- the J segment primers share substantial sequence homology, and therefore may cross-prime amongst more than one target J polynucleotide sequence, but the V segment primers are designed to anneal specifically to target sequences within the CDR2 region of V and are therefore unique to each V segment.
- V6-2 and V6-3 are identical at the nucleotide level throughout the coding sequence of the V segment, and therefore may have a single primer, TRB2V6-2/3).
- the V-segment and J-segment oligonucleotide primers as described herein are designed to include nucleotide sequences such that adequate information is present within the sequence of an amplification product of a rearranged adaptive immune receptor (TCR or Ig) gene to identify uniquely both the specific V and the specific J genes that give rise to the amplification product in the rearranged adaptive immune receptor locus (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 base pairs of sequence upstream of the V gene recombination signal sequence (RSS), preferably at least about 22, 24, 26, 28, 30, 32, 34, 35, 36, 37, 38, 39 or 40 base pairs of sequence upstream of the V gene recombination signal sequence (RSS), and in certain preferred embodiments greater than 40 base pairs of sequence upstream of the V gene recombination signal sequence (RSS), and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18,
- This feature stands in contrast to oligonucleotide primers described in the art for amplification of TCR-encoding or Ig-encoding gene sequences, which rely primarily on the amplification reaction merely for detection of presence or absence of products of appropriate sizes for V and J segments (e.g., the presence in PCR reaction products of an amplicon of a particular size indicates presence of a V or J segment but fails to provide the sequence of the amplified PCR product and hence fails to confirm its identity, such as the common practice of spectratyping).
- Oligonucleotides can be prepared by any suitable method, including direct chemical synthesis by a method such as the phosphotriester method of Narang et al., 1979 , Meth. Enzymol. 68:90-99; the phosphodiester method of Brown et al., 1979 , Meth. Enzymol. 68:109-151; the diethylphosphoramidite method of Beaucage et al., 1981 , Tetrahedron Lett. 22:1859-1862; and the solid support method of U.S. Pat. No. 4,458,066, each incorporated herein by reference.
- a review of synthesis methods of conjugates of oligonucleotides and modified nucleotides is provided in Goodchild, 1990 , Bioconjugate Chemistry 1(3): 165-187, incorporated herein by reference.
- primer refers to an oligonucleotide capable of acting as a point of initiation of DNA synthesis under suitable
- Such conditions include those in which synthesis of a primer extension product complementary to a nucleic acid strand is induced in the presence of four different nucleoside triphosphates and an agent for extension (e.g., a DNA polymerase or reverse transcriptase) in an appropriate buffer and at a suitable temperature.
- an agent for extension e.g., a DNA polymerase or reverse transcriptase
- a primer is preferably a single-stranded DNA.
- the appropriate length of a primer depends on the intended use of the primer but typically ranges from 6 to 50 nucleotides, or in certain embodiments, from 15-35 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template.
- a primer need not reflect the exact sequence of the template nucleic acid, but must be sufficiently complementary to hybridize with the template. The design of suitable primers for the amplification of a given target sequence is well known in the art and described in the literature cited herein.
- primers can incorporate additional features which allow for the detection or immobilization of the primer but do not alter the basic property of the primer, that of acting as a point of initiation of DNA synthesis.
- primers may contain an additional nucleic acid sequence at the 5′ end which does not hybridize to the target nucleic acid, but which facilitates cloning, detection, or sequencing of the amplified product.
- the region of the primer which is sufficiently complementary to the template to hybridize is referred to herein as the hybridizing region.
- a primer is “specific,” for a target sequence if, when used in an amplification reaction under sufficiently stringent conditions, the primer hybridizes primarily to the target nucleic acid.
- a primer is specific for a target sequence if the primer-target duplex stability is greater than the stability of a duplex formed between the primer and any other sequence found in the sample.
- salt conditions such as salt conditions as well as base composition of the primer and the location of the mismatches, will affect the specificity of the primer, and that routine experimental confirmation of the primer specificity will be needed in many cases.
- Hybridization conditions can be chosen under which the primer can form stable duplexes only with a target sequence.
- the use of target-specific primers under suitably stringent amplification conditions enables the selective amplification of those target sequences which contain the target primer binding sites.
- primers for use in the methods described herein comprise or consist of a nucleic acid of at least about 15 nucleotides long that has the same sequence as, or is complementary to, a 15 nucleotide long contiguous sequence of the target V or J segment.
- Longer primers e.g., those of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 45, or 50, nucleotides long that have the same sequence as, or sequence complementary to, a contiguous sequence of the target V or J segment, will also be of use in certain embodiments. All intermediate lengths of the aforementioned primers are contemplated for use herein.
- the primers may have additional sequence added (e.g., nucleotides that may not be the same as or complementary to the target V or J segment), such as restriction enzyme recognition sites, adaptor sequences for sequencing, barcode sequences, and the like (see e.g., primer sequences provided herein and in the sequence listing). Therefore, the length of the primers may be longer, such as 55, 56, 57, 58, 59, 60, 65, 70, 75, nucleotides in length or more, depending on the specific use or need.
- the forward and reverse primers are both modified at the 5′ end with the universal forward primer sequence compatible with a DNA sequencer.
- adaptive immune receptor V-segment or J-segment oligonucleotide primer variants that may share a high degree of sequence identity to the oligonucleotide primers for which nucleotide sequences are presented herein, including those set forth in the Sequence Listing.
- adaptive immune receptor V-segment or J-segment oligonucleotide primer variants may have substantial identity to the adaptive immune receptor V-segment or J-segment oligonucleotide primer sequences disclosed herein, for example, such oligonucleotide primer variants may comprise at least 70% sequence identity, preferably at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity compared to a reference polynucleotide sequence such as the oligonucleotide primer sequences disclosed herein, using the methods described herein (e.g., BLAST analysis using standard parameters).
- oligonucleotide primer variants will contain one or more substitutions, additions, deletions and/or insertions, preferably such that the annealing ability of the variant oligonucleotide is not substantially diminished relative to that of an adaptive immune receptor V-segment or J-segment oligonucleotide primer sequence that is specifically set forth herein.
- adaptive immune receptor V-segment and J-segment oligonucleotide primers are designed to be capable of amplifying a rearranged TCR or IGH sequence that includes the coding region for CDR3.
- the primers for use in the multiplex PCR methods of the present disclosure may be functionally blocked to prevent non-specific priming of non-T or B cell sequences.
- the primers may be blocked with chemical modifications as described in U.S. patent application publication US2010/0167353.
- the use of such blocked primers in the present multiplex PCR reactions involves primers that may have an inactive configuration wherein DNA replication (i.e., primer extension) is blocked, and an activated configuration wherein DNA replication proceeds.
- the inactive configuration of the primer is present when the primer is either single-stranded, or when the primer is specifically hybridized to the target DNA sequence of interest but primer extension remains blocked by a chemical moiety that is linked at or near to the 3′ end of the primer.
- the activated configuration of the primer is present when the primer is hybridized to the target nucleic acid sequence of interest and is subsequently acted upon by RNase H or another cleaving agent to remove the 3′ blocking group, thereby allowing an enzyme (e.g., a DNA polymerase) to catalyze primer extension in an amplification reaction.
- an enzyme e.g., a DNA polymerase
- the kinetics of the hybridization of such primers are akin to a second order reaction, and are therefore a function of the T cell or B cell gene sequence concentration in the mixture.
- Blocked primers minimize non-specific reactions by requiring hybridization to the target followed by cleavage before primer extension can proceed.
- a primer hybridizes incorrectly to a sequence that is related to the desired target sequence but which differs by having one or more non-complementary nucleotides that result in base-pairing mismatches, cleavage of the primer is inhibited, especially when there is a mismatch that lies at or near the cleavage site.
- This strategy to improve the fidelity of amplification reduces the frequency of false priming at such locations, and thereby increases the specificity of the reaction.
- reaction conditions can be optimized to maximize the difference in cleavage efficiencies between highly efficient cleavage of the primer when it is correctly hybridized to its true target sequence, and poor cleavage of the primer when there is a mismatch between the primer and the template sequence to which it may be incompletely annealed.
- a number of blocking groups are known in the art that can be placed at or near the 3′ end of the oligonucleotide (e.g., a primer) to prevent extension.
- a primer or other oligonucleotide may be modified at the 3′-terminal nucleotide to prevent or inhibit initiation of DNA synthesis by, for example, the addition of a 3′ deoxyribonucleotide residue (e.g., cordycepin), a 2′,3′-dideoxyribonucleotide residue, non-nucleotide linkages or alkane-diol modifications (U.S. Pat. No. 5,554,516).
- a 3′ deoxyribonucleotide residue e.g., cordycepin
- 2′,3′-dideoxyribonucleotide residue e.g., non-nucleotide linkages or alkane-diol modifications
- blocking groups include 3′ hydroxyl substitutions (e.g., 3′-phosphate, 3′-triphosphate or 3′-phosphate diesters with alcohols such as 3-hydroxypropyl), 2′3′-cyclic phosphate, 2′ hydroxyl substitutions of a terminal RNA base (e.g., phosphate or sterically bulky groups such as triisopropyl silyl (TIPS) or tert-butyl dimethyl silyl (TBDMS)).
- 2′-alkyl silyl groups such as TIPS and TBDMS substituted at the 3′-end of an oligonucleotide are described by Laikhter et al., U.S. patent application Ser. No. 11/686,894, which is incorporated herein by reference.
- Bulky substituents can also be incorporated on the base of the 3′-terminal residue of the oligonucleotide to block primer extension.
- the oligonucleotide may comprise a cleavage domain that is located upstream (e.g., 5′ to) of the blocking group used to inhibit primer extension.
- the cleavage domain may be an RNase H cleavage domain, or the cleavage domain may be an RNase H2 cleavage domain comprising a single RNA residue, or the oligonucleotide may comprise replacement of the RNA base with one or more alternative nucleosides. Additional illustrative cleavage domains are described in US2010/0167353.
- a multiplex PCR system may use 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or more forward primers, wherein each forward primer is complementary to a single functional TCR or Ig V segment or a small family of functional TCR or Ig V segments, e.g., a TCR V ⁇ segment, (see e.g., the TCRBV primers as shown in Table 2, SEQ ID NOS:1644-1695), and, for example, thirteen reverse primers, each specific to a TCR or Ig J segment, such as TCR J ⁇ segment (see e.g., TCRBJ primers in Table 2, SEQ ID NOS:1631-1643).
- a multiplex PCR reaction may use four forward primers each specific to one or more functional TCR ⁇ V segment and four reverse primers each specific for one or more TCR ⁇ J segments. In another embodiment, a multiplex PCR reaction may use 84 forward primers each specific to one or more functional V segments and six reverse primers each specific for one or more J segments.
- Thermal cycling conditions may follow methods of those skilled in the art. For example, using a PCR ExpressTM thermal cycler (Hybaid, Ashford, UK), the following cycling conditions may be used: 1 cycle at 95° C. for 15 minutes, 25 to 40 cycles at 94° C. for 30 seconds, 59° C. for 30 seconds and 72° C. for 1 minute, followed by one cycle at 72° C. for 10 minutes.
- thermal cycling conditions may be optimized, for example, by modifying annealing temperatures, annealing times, number of cycles and extension times.
- the amount of primer and other PCR reagents used, as well as PCR parameters may be optimized to achieve desired PCR amplification efficiency.
- digital PCR methods can be used to quantitate the number of target genomes in a sample, without the need for a standard curve.
- digital PCR the PCR reaction for a single sample is performed in a multitude of more than 100 microcells or droplets, such that each droplet either amplifies (e.g., generation of an amplification product provides evidence of the presence of at least one template molecule in the microcell or droplet) or fails to amplify (evidence that the template was not present in a given microcell or droplet).
- each droplet either amplifies (e.g., generation of an amplification product provides evidence of the presence of at least one template molecule in the microcell or droplet) or fails to amplify (evidence that the template was not present in a given microcell or droplet).
- Digital PCR methods typically use an endpoint readout, rather than a conventional quantitative PCR signal that is measured after each cycle in the thermal cycling reaction (see, e.g., Pekin et al., 2011 Lab. Chip 11(13):2156; Zhong et al., 2011 Lab. Chip 11(13):2167; Tewhey et al., 2009 Nature Biotechnol. 27:1025; 2010 Nature Biotechnol. 28:178).
- compositions e.g., adaptive immune receptor gene-specific oligonucleotide primer sets
- methods may be adapted for use in such digital PCR methodology, for example, the ABI QuantStudioTM 12K Flex System (Life Technologies, Carlsbad, Calif.), the QuantaLifeTM digital PCR system (BioRad, Hercules, Calif.) or the RainDanceTM microdroplet digital PCR system (RainDance Technologies, Lexington, Mass.).
- oligonucleotides may in certain embodiments comprise first (U1) and second (U2) (and optionally third (U3) and fourth (U4)) universal adaptor oligonucleotide sequences, or may lack either or both of U1 and U2 (or U3 or U4).
- a universal adaptor oligonucleotide U thus may comprise either nothing or an oligonucleotide having a sequence that is selected from (i) a first universal adaptor oligonucleotide sequence, and (ii) a first sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to a first universal adaptor oligonucleotide sequence, and U2 may comprise either nothing or an oligonucleotide having a sequence that is selected from (i) a second universal adaptor oligonucleotide sequence, and (ii) a second sequencing platform-specific oligonucleotide sequence that is linked to and positioned 5′ to a second universal adaptor oligonucleotide sequence.
- U3 and U4 A similar relationship pertains for U3 and U4.
- U1 and/or U2 may, for example, comprise universal adaptor oligonucleotide sequences and/or sequencing platform-specific oligonucleotide sequences that are specific to a single-molecule sequencing technology being employed, for example the HiSeqTM or GeneAnalyzerTM-2 (GA-2) systems (Illumina, Inc., San Diego, Calif.) or another suitable sequencing suite of instrumentation, reagents and software.
- HiSeqTM or GeneAnalyzerTM-2 (GA-2) systems Illumina, Inc., San Diego, Calif.
- Another suitable sequencing suite of instrumentation, reagents and software e.g., a single-molecule sequencing technology
- Inclusion of such platform-specific adaptor sequences permits direct quantitative sequencing of the presently described dsDNA amplification products into which U has been incorporated as described herein, using a nucleotide sequencing methodology such as the HiSeqTM or GA2 or equivalent. This feature therefore advantageously permits qualitative and quantitative characterization of the dsDNA
- dsDNA amplification products may be generated that have universal adaptor sequences at both ends, so that the adaptor sequences can be used to further incorporate sequencing platform-specific oligonucleotides at each end of each template.
- platform-specific oligonucleotides may be added onto the ends of such dsDNA using 5′ (5′-platform sequence-universal adaptor-1 sequence-3′) and 3′ (5′-platform sequence-universal adaptor-2 sequence-3′) oligonucleotides in three cycles of denaturation, annealing and extension, so that the relative representation in the dsDNA composition of each of the component dsDNAs is not quantitatively altered.
- Unique identifier sequences e.g., barcode sequences B that are associated with and thus identify individual V and/or J regions, or sample-identifier barcodes as described herein
- barcode sequences B that are associated with and thus identify individual V and/or J regions, or sample-identifier barcodes as described herein
- sample-identifier barcodes as described herein
- oligonucleotide sequences contemplate designing oligonucleotide sequences to contain short signature sequences that permit unambiguous identification of the polynucleotide sequence into which they are incorporated, and hence of at least one primer responsible for amplifying that product, without having to sequence the entire amplification product.
- such barcodes B are each either nothing or each comprise an oligonucleotide B that comprises an oligonucleotide barcode sequence of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50 or more contiguous nucleotides (including all integer values therebetween), wherein in each of the plurality of oligonucleotide sequences B comprises a unique oligonucleotide sequence which uniquely identifies a particular V and/or J oligonucleotide primer sequence.
- Exemplary barcodes may comprise a first barcode oligonucleotide of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides that uniquely identifies each oligonucleotide primer (e.g., a V or a J primer) in the primer composition, and optionally in certain embodiments a second barcode oligonucleotide of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides that uniquely identifies each partner primer in a primer set (e.g., a J or a V primer), to provide barcodes of, respectively, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 or 32 nucleotides in length, but these and related embodiments are not intended to be so limited.
- a first barcode oligonucleotide of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 nucleotides that uniquely identifies each oligonucleotide primer (e.g
- Barcode oligonucleotides may comprise oligonucleotide sequences of any length, so long as a minimum barcode length is obtained that precludes occurrence of a given barcode sequence in two or more product polynucleotides having otherwise distinct sequences (e.g., V and J sequences).
- the minimum barcode length to avoid such redundancy amongst the barcodes that are used to uniquely identify different V-J sequence pairings, is X nucleotides, where 4 x is greater than the number of distinct template species that are to be differentiated on the basis of having non-identical sequences.
- barcode oligonucleotide sequence read lengths may be limited only by the sequence read-length limits of the nucleotide sequencing instrument to be employed.
- different barcode oligonucleotides that will distinguish individual species of template oligonucleotides should have at least two nucleotide mismatches (e.g., a minimum hamming distance of 2) when aligned to maximize the number of nucleotides that match at particular positions in the barcode oligonucleotide sequences.
- oligonucleotide barcode sequences of, for instance, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35 or more contiguous nucleotides, including all integer values therebetween.
- oligonucleotide barcode sequence identification strategies see, e.g., de Carcer et al., 2011 Adv. Env. Microbiol. 77:6310; Parameswaran et al., 2007 Nucl. Ac. Res. 35(19):330; Roh et al., 2010 Trends Biotechnol. 28:291.
- barcodes are placed in oligonucleotides at locations where they are not found naturally, i.e., barcodes comprise nucleotide sequences that are distinct from any naturally occurring oligonucleotide sequences that may be found in the vicinity of the sequences adjacent to which the barcodes are situated (e.g., V and/or J sequences).
- barcode sequences may be included, according to certain embodiments described herein, as elements B1 and/or B2 of the presently disclosed oligonucleotides.
- certain of the herein described oligonucleotide compositions may in certain embodiments comprise one, two or more barcodes, while in certain other embodiments some or all of these barcodes may be absent.
- all barcode sequences will have identical or similar GC content (e.g., differing in GC content by no more than 20%, or by no more than 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10%).
- Sequencing may be performed using any of a variety of available high throughput single molecule sequencing machines and systems.
- Illustrative sequence systems include sequence-by-synthesis systems such as the Illumina Genome Analyzer and associated instruments (Illumina, Inc., San Diego, Calif.), Helicos Genetic Analysis System (Helicos BioSciences Corp., Cambridge, Mass.), Pacific Biosciences PacBio RS ( Pacific Biosciences, Menlo Park, Calif.), or other systems having similar capabilities. Sequencing is achieved using a set of sequencing oligonucleotides that hybridize to a defined region within the amplified DNA molecules.
- the sequencing oligonucleotides are designed such that the V- and J-encoding gene segments can be uniquely identified by the sequences that are generated, based on the present disclosure and in view of known adaptive immune receptor gene sequences that appear in publicly available databases. See, e.g., U.S. Ser. No. 13/217,126; U.S. Ser. No. 12/794,507; PCT/US2011/026373; or PCT/US2011/049012.
- Exemplary TCRB J-region sequencing primers are set forth in Table 4:
- gene means the segment of DNA involved in producing a polypeptide chain such as all or a portion of a TCR or Ig polypeptide (e.g., a CDR3-containing polypeptide); it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons), and may also include regulatory elements (e.g., promoters, enhancers, repressor binding sites and the like), and may also include recombination signal sequences (RSSs) as described herein.
- RLSs recombination signal sequences
- the nucleic acids of the present embodiments may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
- the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
- a coding sequence which encodes a TCR or an immunoglobulin or a region thereof for use according to the present embodiments may be identical to the coding sequence known in the art for any given TCR or immunoglobulin gene regions or polypeptide domains (e.g., V-region domains, CDR3 domains, etc.), or may be a different coding sequence, which, as a result of the redundancy or degeneracy of the genetic code, encodes the same TCR or immunoglobulin region or polypeptide.
- the amplified J-region encoding gene segments may each have a unique sequence-defined identifier tag of 2, 3, 4, 5, 6, 7, 8, 9, 10 or about 15, 20 or more nucleotides, situated at a defined position relative to a RSS site.
- a four-base tag may be used, in the J ⁇ -region encoding segment of amplified TCR ⁇ CDR3-encoding regions, at positions +11 through +14 downstream from the RSS site.
- these and related embodiments need not be so limited and also contemplate other relatively short nucleotide sequence-defined identifier tags that may be detected in J-region encoding gene segments and defined based on their positions relative to an RSS site. These may vary between different adaptive immune receptor encoding loci.
- the recombination signal sequence consists of two conserved sequences (heptamer, 5′-CACAGTG-3′, and nonamer, 5′-ACAAAAACC-3′), separated by a spacer of either 12+/ ⁇ 1 bp (“12-signal”) or 23+/ ⁇ 1 bp (“23-signal”).
- a number of nucleotide positions have been identified as important for recombination including the CA dinucleotide at position one and two of the heptamer, and a C at heptamer position three has also been shown to be strongly preferred as well as an A nucleotide at positions 5, 6, 7 of the nonamer.
- the sequencing oligonucleotides may hybridize adjacent to a four base tag within the amplified J-encoding gene segments at positions +11 through +14 downstream of the RSS site.
- sequencing oligonucleotides for TCRB may be designed to anneal to a consensus nucleotide motif observed just downstream of this “tag”, so that the first four bases of a sequence read will uniquely identify the J-encoding gene segment (see, e.g., WO/2012/027503).
- the average length of the CDR3-encoding region, for the TCR defined as the nucleotides encoding the TCR polypeptide between the second conserved cysteine of the V segment and the conserved phenylalanine of the J segment, is 35+/ ⁇ 3 nucleotides. Accordingly and in certain embodiments, PCR amplification using V-segment oligonucleotide primers with J-segment oligonucleotide primers that start from the J segment tag of a particular TCR or IgH J region (e.g., TCR J ⁇ , TCR J ⁇ or IgH JH as described herein) will nearly always capture the complete V-D-J junction in a 50 base pair read.
- the average length of the IgH CDR3 region is less constrained than at the TCR ⁇ locus, but will typically be between about 10 and about 70 nucleotides. Accordingly and in certain embodiments, PCR amplification using V-segment oligonucleotide primers with J-segment oligonucleotide primers that start from the IgH J segment tag will capture the complete V-D-J junction in a 100 base pair read.
- the TCR and Ig J-segment reverse PCR primers may be designed to minimize overlap with the sequencing oligonucleotides, in order to minimize promiscuous priming in the context of multiplex PCR.
- the TCR and Ig J-segment reverse primers may be anchored at the 3′ end by annealing to the consensus splice site motif, with minimal overlap of the sequencing primers.
- the TCR and Ig V and J-segment primers may be selected to operate in PCR at consistent annealing temperatures using known sequence/primer design and analysis programs under default parameters.
- the exemplary IGHJ sequencing primers extend three nucleotides across the conserved CAG sequences as described in WO/2012/027503.
- the subject or biological source, from which a test biological sample may be obtained may be a human or non-human animal, or a transgenic or cloned or tissue-engineered (including through the use of stem cells) organism.
- the subject or biological source may be known to have, or may be suspected of having or being at risk for having, a circulating or solid tumor or other malignant condition, or an autoimmune disease, or an inflammatory condition, and in certain preferred embodiments of the invention the subject or biological source may be known to be free of a risk or presence of such disease.
- Certain preferred embodiments contemplate a subject or biological source that is a human subject such as a patient that has been diagnosed as having or being at risk for developing or acquiring cancer according to art-accepted clinical diagnostic criteria, such as those of the U.S. National Cancer Institute (Bethesda, Md., USA) or as described in DeVita, Hellman, and Rosenberg's Cancer: Principles and Practice of Oncology (2008, Lippincott, Williams and Wilkins, Philadelphia/Ovid, New York); Pizzo and Poplack, Principles and Practice of Pediatric Oncology (Fourth edition, 2001, Lippincott, Williams and Wilkins, Philadelphia/Ovid, New York); and Vogelstein and Kinzler, The Genetic Basis of Human Cancer (Second edition, 2002, McGraw Hill Professional, New York); certain embodiments contemplate a human subject that is known to be free of a risk for having, developing or acquiring cancer by such criteria.
- non-human subject or biological source for example a non-human primate such as a macaque, chimpanzee, gorilla, vervet, orangutan, baboon or other non-human primate, including such non-human subjects that may be known to the art as preclinical models, including preclinical models for solid tumors and/or other cancers.
- a non-human primate such as a macaque, chimpanzee, gorilla, vervet, orangutan, baboon or other non-human primate
- preclinical models including preclinical models for solid tumors and/or other cancers.
- Certain other embodiments contemplate a non-human subject that is a mammal, for example, a mouse, rat, rabbit, pig, sheep, horse, bovine, goat, gerbil, hamster, guinea pig or other mammal; many such mammals may be subjects that are known to the art as preclinical models for certain diseases or disorders, including circulating or solid tumors and/or other cancers (e.g., Talmadge et al., 2007 Am. J. Pathol. 170:793; Kerbel, 2003 Canc. Biol. Therap. 2(4 Suppl 1):5134; Man et al., 2007 Canc. Met. Rev. 26:737; Cespedes et al., 2006 Clin. Transl. Oncol.
- a mammal for example, a mouse, rat, rabbit, pig, sheep, horse, bovine, goat, gerbil, hamster, guinea pig or other mammal
- many such mammals may be subjects that are known to the
- the subject or biological source may be a non-mammalian vertebrate, for example, another higher vertebrate, or an avian, amphibian or reptilian species, or another subject or biological source.
- Biological samples may be provided by obtaining a blood sample, biopsy specimen, tissue explant, organ culture, biological fluid or any other tissue or cell preparation from a subject or a biological source.
- the sample comprises DNA from lymphoid cells of the subject or biological source, which, by way of illustration and not limitation, may contain rearranged DNA at one or more TCR or BCR loci.
- a test biological sample may be obtained from a solid tissue (e.g., a solid tumor), for example by surgical resection, needle biopsy or other means for obtaining a test biological sample that contains a mixture of cells.
- lymphoid cells e.g., T cells and/or B cells
- isolated lymphoid cells are those that have been removed or separated from the tissue, environment or milieu in which they naturally occur.
- B cells and T cells can thus be obtained from a biological sample, such as from a variety of tissue and biological fluid samples including bone marrow, thymus, lymph glands, lymph nodes, peripheral tissues and blood, but peripheral blood is most easily accessed. Any peripheral tissue can be sampled for the presence of B and T cells and is therefore contemplated for use in the methods described herein.
- Tissues and biological fluids from which adaptive immune cells may be obtained include, but are not limited to skin, epithelial tissues, colon, spleen, a mucosal secretion, oral mucosa, intestinal mucosa, vaginal mucosa or a vaginal secretion, cervical tissue, ganglia, saliva, cerebrospinal fluid (CSF), bone marrow, cord blood, serum, serosal fluid, plasma, lymph, urine, ascites fluid, pleural fluid, pericardial fluid, peritoneal fluid, abdominal fluid, culture medium, conditioned culture medium or lavage fluid.
- adaptive immune cells may be isolated from an apheresis sample.
- Peripheral blood samples may be obtained by phlebotomy from subjects.
- Peripheral blood mononuclear cells PBMC are isolated by techniques known to those of skill in the art, e.g., by Ficoll-Hypaque® density gradient separation. In certain embodiments, whole PBMCs are used for analysis.
- total genomic DNA may be extracted from cells using methods known in the art and/or commercially available kits, e.g., by using the QIAamp® DNA blood Mini Kit (QIAGEN®).
- the approximate mass of a single haploid genome is 3 pg.
- at least 100,000 to 200,000 cells are used for analysis, i.e., about 0.6 to 1.2 ⁇ g DNA from diploid T or B cells.
- the number of T cells can be estimated to be about 30% of total cells.
- the number of B cells can also be estimated to be about 30% of total cells in a PBMC preparation.
- the Ig and TCR gene loci contain many different variable (V), diversity (D), and joining (J) gene segments, which are subjected to rearrangement processes during early lymphoid differentiation.
- Ig and TCR V, D and J gene segment sequences are known in the art and are available in public databases such as GENBANK.
- the V-D-J rearrangements are mediated via a recombinase enzyme complex in which the RAG1 and RAG2 proteins play a key role by recognizing and cutting the DNA at the recombination signal sequences (RSS), which are located downstream of the V gene segments, at both sides of the D gene segments, and upstream of the J gene segments. Inappropriate RSS reduce or even completely prevent rearrangement.
- RSS recombination signal sequences
- the recombination signal sequence (RSS) consists of two conserved sequences (heptamer, 5′-CACAGTG-3′, and nonamer, 5′-ACAAAAACC-3′), separated by a spacer of either 12+/ ⁇ 1 bp (“12-signal”) or 23+/ ⁇ 1 bp (“23-signal”).
- a number of nucleotide positions have been identified as important for recombination including the CA dinucleotide at position one and two of the heptamer, and a C at heptamer position three has also been shown to be strongly preferred as well as an A nucleotide at positions 5, 6, 7 of the nonamer.
- the spacer although more variable, also has an impact on recombination, and single-nucleotide replacements have been shown to significantly impact recombination efficiency (Fanning et. al. 1996 Cell. Immunol. Immunopath. 79:1, Larijani et al. 1999 Nucl. Ac. Res. 27:2304; Nadel et al. 1998 J. Immunol. 161:6068; Nadel et al., 1998 J. Exp. Med. 187:1495). Criteria have been described for identifying RSS polynucleotide sequences having significantly different recombination efficiencies (Ramsden et al 1994 Nucl. Ac. Res. 22:1785; Akamatsu et. al. 1994 J. Immunol . 153:4520; Hesse et al. 1989 Genes Dev. 3:1053, and Lee et al., 2003 PLoS 1(1):E1).
- the rearrangement process generally starts with a D to J rearrangement followed by a V to D-J rearrangement in the case of Ig heavy chain (IgH), TCR beta (TCRB), and TCR delta (TCRD) genes or concerns direct V to J rearrangements in case of Ig kappa (IgK), Ig lambda (IgL), TCR alpha (TCRA), and TCR gamma (TCRG) genes.
- the sequences between rearranging gene segments are generally deleted in the form of a circular excision product, also called TCR excision circle (TREC) or B cell receptor excision circle (BREC).
- V, D, and J gene segments represent the so-called combinatorial repertoire, which is estimated to be ⁇ 2 ⁇ 10 6 for Ig molecules, ⁇ 3 ⁇ 10 6 for TCR ⁇ and ⁇ 5 ⁇ 10 3 for TCR ⁇ molecules.
- deletion and random insertion of nucleotides occurs during the rearrangement process, resulting in highly diverse junctional regions, which significantly contribute to the total repertoire of Ig and TCR molecules, estimated to be >10 12 .
- Mature B-lymphocytes further extend their Ig repertoire upon antigen recognition in follicle centers via somatic hypermutation, a process, leading to affinity maturation of the Ig molecules.
- the somatic hypermutation process focuses on the V- (D-) J exon of IgH and Ig light chain genes and concerns single nucleotide mutations and sometimes also insertions or deletions of nucleotides. Somatically-mutated Ig genes are also found in mature B-cell malignancies of follicular or post-follicular origin.
- V-segment and J-segment primers may be employed in a PCR reaction to amplify rearranged TCR or BCR CDR3-encoding DNA regions in a test biological sample, wherein each functional TCR or Ig V-encoding gene segment comprises a V gene recombination signal sequence (RSS) and each functional TCR or Ig J-encoding gene segment comprises a J gene RSS.
- RSS V gene recombination signal sequence
- each amplified rearranged DNA molecule may comprise (i) at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 (including all integer values therebetween) or more contiguous nucleotides of a sense strand of the TCR or Ig V-encoding gene segment, with the at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000 or more contiguous nucleotides being situated 5 ′ to the V gene RSS and/or each amplified rearranged DNA molecule may comprise (ii) at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500 (including all integer values therebetween) or more contiguous nucleotides of a sense strand of the TCR or Ig J-encoding gene segment, with the at least about 10, 20, 30, 40, 50, 60, 70, 80, 90
- isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally occurring tissue, cell, nucleic acid or polypeptide present in its original milieu in a living animal is not isolated, but the same tissue, cell, nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated.
- Such nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide.
- gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region “leader and trailer” as well as intervening sequences (introns) between individual coding segments (exons).
- the singular forms “a,” “an” and “the” include plural references unless the content clearly dictates otherwise.
- the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 5%, 6%, 7%, 8% or 9%. In other embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 10%, 11%, 12%, 13% or 14%. In yet other embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 15%, 16%, 17%, 18%, 19% or 20%.
- the single molecule labeling process used a Polymerase Chain Reaction approach to tag adaptive immune receptor encoding sequences with a unique barcode and a universal primer.
- the PCR reaction to tag the individual barcodes used QIAGEN Multiplex PCR master mix (QIAGEN part number 206145, Qiagen, Valencia, Calif.), 10% Q-solution (QIAGEN), and 300 ng of template DNA.
- QIAGEN QIAGEN Multiplex PCR master mix
- QIAGEN Qiagen, Valencia, Calif.
- QIAGEN Qiagen, Valencia, Calif.
- QIAGEN Q-solution
- the forward primers were composed of nucleotide sequence portions that annealed to V genes (segments that annealed to the V genes are shown in Table 2) and at the 5′ end a universal primer (pGEX f, Table 3).
- the aggregate primer is listed in Table 6.
- These primers may, for greater specificity, have a random nucleotide insertion between the 3′ end of the V primer and the 5′ end of the universal primer sequence.
- the reverse primers have a section of nucleotides that can anneal to the J gene region (Table 2), on the 5′ end of the J primer an 8 bp barcode composed of random nucleotides, and on the 5′ end of the 8 bp random barcode a universal primer (pGEXr, Table 3). An example of these primers is listed in Table 5.
- the 8 bp barcode made of random nucleotides may be shorter or longer, additional basepairs increase the number of unique barcodes.
- the nucleotide tags were incorporated onto the molecules in a 7 cycle PCR reaction.
- the thermocycle conditions were: 95° C. for 5 minutes, followed by 7 cycles of 95° for 30 sec, 68° for 90 sec, and 72° for 30 sec. Following cycling, the rxn is held for 10 minutes at 72°.
- ExoSAP-IT is a product from Affymetrix that uses Exonuclease I and Shrimp Alkaline Phosphatase activities; the Exonuclease I destroys single stranded DNA and SAP degrades dNTPs.
- 10 ul of PCR reagents and 4 ul of exoSAP-IT were used. The reaction was incubated for 15 minutes at 37° C. and the ExoSAP-it was inactivated by a 15 minute incubation at 80° C.
- the molecules were uniquely tagged with a barcode and a universal primer.
- another PCR reaction was performed with the universal pGEX primers.
- This reaction used QIAGEN Multiplex PCR master mix (QIAGEN part number 206145, Qiagen, Valencia, Calif.), 10% Q-solution (QIAGEN), and 6 ul of cleaned PCR reaction as template.
- the forward universal (pGEXf) primer was added to the mix so the final concentration was 2 uM and the reverse universal primer (pgEXr) was added to the reaction so its final concentration was 2 uM.
- an Illumina adapter was incorporated using the pGEX primers.
- the reaction conditions were the same as above, except that the primers were replaced with the tailing primers (Table 7 below (SEQ ID NOs: 5686-5877).
- the Illumina adapters which also included an 8 bp tag and a 6 bp random set of nucleotides, were incorporated onto the molecules in a 7 cycle PCR reaction.
- the thermocycle conditions were: 95° C. for 5 minutes, followed by 7 cycles of 95° for 30 sec, 68° for 90 sec, and 72° for 30 sec. Following cycling, the reaction was held for 10 minutes at 72°.
- sequenced molecules were “tailed” with Illumina adaptors, they were amenable to sequencing. For this example, sequencing was conducted through the 8 bp randomer into the adaptive immune receptor encoding sequence on an Illumina HISEQTM sequencing platform. The sequenced molecules included an 8 bp random tag. Every sequenced molecule having identical CDR3 and 8 bp random tag sequences was amplified from the adaptive immune receptor encoding polynucleotide sequences of a single cell.
- Table 5 shows the J primers for the single molecule sequencing (reverse primers) and Table 6 shows the V primers (forward primers).
- the PCR protocol is short: 1st PCR (5 cycles) with the above primers to uniquely tag each molecule, followed by a second PCR (35 cycles) with a universal primer (PGEX) to amplify the molecules. These reactions are followed by a PCR reaction to tail on the Illumina adapters.
- Tailing Primers SEQ ID Sequence NO: AAT GAT ACG GCG ACC ACC GAG ATC TAC ACC GGT CTC GGC ATT CCT 5686 GCT GAA CCG CTC TTC CGA TCT NNN NNN CAA GGT CAC CGG GAG CTG CAT GTG TCA GAG G AAT GAT ACG GCG ACC ACC GAG ATC TAC ACC GGT CTC GGC ATT CCT 5687 GCT GAA CCG CTC TTC CGA TCT NNN NNN GCA TAA CTC CGG GAG CTG CAT GTG TCA GAG G AAT GAT ACG GCG ACC ACC GAG ATC TAC ACC GGT CTC GGC ATT CCT 5688 GCT GAA CCG CTC TTC CGA TCT NNN NNN CTC TGA TTC CGG GAG CTG CAT GTG TCA GAG G AAT GAT ACG GCG ACC ACC GAG ATC TAC ACC GGT CTC GGC ATT CCT
- This example describes single cell labeling of immunoglobulin and T cell receptor heavy and light chain encoding sequences by RT-PCR.
- Freshly drawn blood from healthy human volunteers is used as a source of leukocytes. The amount of whole blood required to obtain 100,000-300,000 leukocytes is less than 1 mL; 1-3 mL of blood are used for isolation of blood cells.
- Peripheral blood mononuclear cells (PBMC) are isolated from blood by density gradient centrifugation on Histopaque®-1077 (Sigma, St. Louis, Mo.) according to the supplier's instructions.
- CD45 + hematopoietic cells are isolated by binding to anti-CD45 coated magnetic beads using Whole Blood CD45 Microbeads (Miltenyi Biotec, Auburn, Calif.) as instructed by the manufacturer and essentially as described in Koehl et al. (2003 Leukemia 17:232).
- Leukocyte cell suspensions are washed in phosphate-buffered saline solution (PBS) and adjusted to a concentration of 1 ⁇ 10 6 cells/mL.
- Aliquots of 1-3 ⁇ L (1-3 ⁇ 10 3 cells) are distributed into wells of 96-well PCR multiwell plates held on ice in pre-chilled plate racks. Immediately after all plate wells are filled, the plates are sealed and placed on dry ice to freeze and lyse the cells. Plates are held on dry ice during the reverse transcription preparation steps below.
- Reverse transcription is performed using the SMARTerTM Ultra Low RNA kit for Illumina sequencing (Clontech, Mountain View, Calif.) essentially according to the supplier's instructions.
- Stock Reaction Buffer is prepared by mixing 380 ⁇ l of Dilution Buffer with 20 ⁇ l of RNase inhibitor (40 U/ ⁇ l).
- Reaction Buffer 250 ⁇ l of Reaction Buffer is then mixed with 100 ⁇ l of a 12 ⁇ M solution of the 3′ SmarterTM CDS II oligonucleotide (5′-Bio-AAGCAGTGGTATCAACGCAGAGTACT (30) NN-3′ [SEQ ID NO: 5878], where Bio is a biotin moiety; AAGCAGTGGTATCAACGCAGAGTAC [SEQ ID NO: 5879] is a universal adapter sequence, T (30) (SEQ ID NO: 5880) is a 30-mer of thymine residues, and N is any nucleotide (A, C, G or T).
- 3′ SmarterTM CDS II oligonucleotide 5′-Bio-AAGCAGTGGTATCAACGCAGAGTACT (30) NN-3′ [SEQ ID NO: 5878], where Bio is a biotin moiety; AAGCAGTGGTATCAACGCAGAGTAC [SEQ ID NO: 5879] is
- the first-step annealing reactions for reverse transcription are set up by adding 3.5 ⁇ l of the Reaction Buffer containing the 3′ SmarterTM CDS II oligonucleotide primer to each well of the 96-well plate containing the lysed cells, sealing the plate and incubating it for 3 minutes at 72° C., after which it is returned to a chilled rack on ice.
- Reverse Transcription Master Mix (450 ⁇ l for 100 rxns) is prepared by combining 200 ⁇ l of 5 ⁇ First Strand Buffer, 25 ⁇ l of 100 mM dithithreitol (DTT), 100 ⁇ l of dNTPs (10 mM), 25 ⁇ l of RNase inhibitor (40 U/ ⁇ l), and 100 ⁇ l of reverse transcriptase.
- a 96-well working plate is prepared containing 1.0 ⁇ l of a barcoded 3′-SmartTM CDSII oligonucleotide per well.
- the 3′-Smart CDSII oligo sequence is: 5′-AAGCAGTGGTATCAACGCAGAGTACBBBBBBrGrGrG-P-3′ [SEQ ID NO: 5881] where AAGCAGTGGTATCAACGCAGAGTAC [SEQ ID NO: 5879] is a universal adapter sequence; BBBBBBBB is an 8-nucleotide barcode (see list below for examples of barcodes); rG is riboguanine; and P is a 3′ phosphate blocking moiety.
- each well of the 96-well working plate containing 1.0 ⁇ l of a barcoded 3′-SmartTM CDSII oligonucleotide is added 4.5 ⁇ l of the Master Mix, and following completion of the annealing reaction, 5.5 ⁇ l of the Master Mix containing barcoded 3′-SmartTM CDSII oligonucleotide is transferred from each well of the 96-well working plate to the correspondingly positioned (respective) wells of the reverse transcription annealing plate.
- the reverse transcription annealing plate is placed onto a thermocycler and a program is run with the steps 42° C. for 90 minutes followed by 70° C. for 10 minutes.
- each cDNA molecule in a well contains universal adaptor sequences at both the 5′ and 3′ ends, and is uniquely tagged with an 8-nt barcode at the 5′ end.
- the barcoded cDNA molecules from all 96 reactions can be pooled at this step, and re-aliquoted onto a PCR plate where PCR amplification of immunoglobulin or T cell receptor cDNA takes place.
- the combining and splitting step permit substantially all barcoded cDNA molecules to be substantially evenly represented in subsequent PCR amplification reactions with adaptive immune receptor encoding (e.g., IG or TCR) C-segment gene specific primers.
- adaptive immune receptor encoding e.g., IG or TCR
- the products of reverse transcription/cDNA first strand synthesis are next isolated by Solid Phase Reversible Immobilization Purification (SPRI) by mixing the contents of each well from the reverse transcription reaction plate with 25 ⁇ l of a suspension of AmpureTM XP SPRI magnetic beads (Beckman-Coulter Inc., Brea, Calif.) and incubating for 8 minutes at room temperature, followed by bead separation using a MagnaBotTM magnetic separator (Promega, Madison, Wis.) at room temperature according to the suppliers' instructions.
- SPRI Solid Phase Reversible Immobilization Purification
- SPRI bead-immobilized cDNA first strands are immediately added to 5′RACE (rapid amplification of cDNA ends) PCR amplification reactions using Advantage 2TM PCR reagents (Clontech) according to the manufacturer's instructions.
- Advantage 2TM PCR reagents (Clontech) according to the manufacturer's instructions.
- 50 ⁇ l of PCR Master Mix is added containing dNTPs, UPM primer mix, IG/TCR primer mix as described elsewhere herein, and Advantage 2TM polymerase and PCR buffer.
- the thermocycling conditions are: 95° C. for 1 minute; 30 cycles of 95° C. for 30 seconds, 63° C. for 30 seconds, and 72° C. for 3 minutes; 72° C. for 7 minutes; and then reactions are held at 10° C. prior to preparation for Illumina sequencing.
- PCR primer sequences are:
- PCR products are pooled by inverted centrifugation of the 96-well plates and the pooled products are purified to remove DNA fragments shorter than 200-300 bp using Beckman Coulter AmpureTM XP beads according to the supplier's instructions. DNA purity is assessed by capillary electrophoresis using a Caliper Bioanalyzer (Perkin Elmer, Norwalk, Conn.) to confirm that most of the dsDNA is within a size range of 600-700 bp. dsDNA products are quantified fluorometrically or by A260 UV absorbance.
- Sequencing library construction is conducted using 1 ⁇ g of purified DNA as an input for the Illumina TruSeq® sample preparation protocol (Illumina Inc., San Diego, Calif.) according to the Illumina TruSeq® DNA Sample Preparation Guide (Part number 15026486 Rev. C, July 2012, Illumina, Inc., San Diego, Calif.). This protocol generates a sequencing library that can be sequenced using the paired-end flow cell on the Illumina MiSeq®, HiSeq®2000, and HiSeq®2500 sequencers.
- Illumina sequencing is conducted according to a sequencing protocol on the Illumina MiSeq® sequencer that utilizes the MiSeq® reagents kit v2, for 500 cycles.
- This chemistry provides kitted reagents for up to 525 cycles of sequencing on the MiSeq® instrument and provides sufficient reagents for a 251-cycle paired-end run, plus two eight-cycle indexed reads.
- the Illumina sequencing protocol is described in MiSeq® ReagentKit v2 ReagentPrepGuide, Part number 15034097 Rev. B, October 2012 (Illumina Inc., San Diego, Calif.).
- FIG. 6 A schematic representation of the structure of DNA targets to be sequenced is shown in FIG. 6 (in which Ig heavy chain is used as an example).
- TCR T cell receptor
- the ⁇ T cell receptor (TCR) protein which determines the antigenic specificity of an ⁇ T cell, is a heterodimer composed of two peptides: a longer ⁇ chain (TCRB) and a shorter ⁇ chain (TCRA) (1-6).
- TCRB a longer ⁇ chain
- TCRA shorter ⁇ chain
- high-throughput sequencing assays have been developed to profile TCR ⁇ and ⁇ chains and immunoglobulin heavy and light chains, with multiple diagnostic applications (7-15), including clinical diagnostics for the detection of cancer clones and the measurement of minimal residual disease in lymphoid malignancies (13, 16-20).
- the invention provides a method for pairing ⁇ and ⁇ chain sequences at high throughput without the need for single-cell methods using a combinatorics approach, rather than physical isolation, to match the pairs.
- Applicants have applied the technology to peripheral blood from a healthy donor to identify ⁇ 35,000 paired ⁇ and ⁇ TCR gene sequences in a single experiment.
- the method can also be applied to tissue samples or both blood and tissue samples from a subject.
- the method of the invention relies on the observation that rearranged TCRA and TCRB nucleotide sequences are nearly unique for each clonal population of T cells. Distinctive TCR sequences arise through recombination of gene segments and template-independent deletion or insertion of nucleotides at the V-J, V-D, and D-J junctions in somatic cells during lymphocyte development (32). This extraordinary diversity means that mRNAs encoding the TCRA and TCRB chains of a specific T cell clone will usually be present only in sets of cells that include that clone.
- the method can involve extracting genomic DNA, rather than mRNA from cells in a sample, to amplify up the polypeptide chains of a specific adaptive immune receptor heterodimer.
- Pairing the TCRA and TCRB chains then becomes a statistical problem: to declare a unique pairing, one must show that it is highly improbable for a given clone to occupy the same collection of T cell subsets as another clone. The probability that a given clone occupies the same collection of T cell subsets as another clone is close to zero for thousands of clones in an experiment using the methods of the invention.
- FIG. 7 shows a graph of the number of occupied T cell subsets vs. the probability of shared subsets. For a simulated experiment using the methods of the invention, in which T cells are divided into 96 subsets containing 70,000 T cells each, this plot gives the probability (y-axis) that any clones present in a given number of subsets (x-axis) will occur in exactly the same subsets.
- the methods of the invention provide a way to pair a clone's TCRA and TCRB sequences as a function of the frequency of that clone in the original sample, the total number of T cells in each subset, and the number of subsets created.
- the last two parameters are part of the experimental design, and they can be tuned to choose which range of T cell clonal frequencies will be accurately paired.
- FIG. 8 shows a schematic of the methods of the invention, according to an embodiment of the invention.
- a fixed number of T cells e.g., 70,000 peripheral blood mononuclear cells (PBMCs)
- PBMCs peripheral blood mononuclear cells
- the total cellular RNA is extracted, and cDNA is reverse transcribed form the RNA in the wells.
- the TCRA and TCRB sequences are PCR-amplified within each well and well-specific oligonucleotide DNA bar codes are attached to the amplified receptor molecules.
- the barcoded TCRA and TCRB amplicons are pooled together.
- pairs of TCRA/TCRB sequences consistently observed in the same libraries represent sequences carried by clones of the same cell.
- the amplified molecules are pooled and high-throughput DNA sequencing is performed, reading both the receptor sequence and the bar code for each strand.
- Sequenced bar codes are used to assign the receptor sequences to wells of origin, and we identify putative pairs by finding TCRA sequences that share many more wells with specific TCRB sequences than expected by chance. This involves computational de-multiplexing to map each TCR sequence back to the wells in which it originated.
- the immune repertoire is highly diverse, and the probability that two clones will share a well pattern is miniscule, so any TCRA/TCRB pair that shares a well pattern can be inferred to have come from the same clone.
- the well occupancy pattern can also be referred to as a container occupancy pattern.
- the well occupancy pattern of every TCRB sequence is compared against that of every TCRA sequence.
- the TCRB that produced the smallest p-value with a given TCRA was marked as a possible pairing partner.
- FDR false discovery rate
- FIGS. 9A and 9B The results of our experiment are shown in FIGS. 9A and 9B .
- FDR 1%
- FIG. 9A shows the false discovery rate curve for an experiment with 96 wells and 70,000 T cells per well.
- the FDR curve is L-shaped, which implies that most of the TCRA/TCRB pairs stood out clearly from the background noise. Most of these pairs were called with extremely high confidence.
- FIG. 9B illustrates the completeness of this pairing experiment.
- the grey (light shaded) bars show the total number of observed TCRB sequences as a function of well occupancy, and the dark shaded bars show how many of these were paired at FDR ⁇ 1%.
- FIG. 10 shows an example workflow that was used for this experiment.
- FIG. 11 illustrates the well occupancy vs. fraction of paired TCRB sequences.
- FIG. 11 shows the pairing yield (fraction of paired sequences) for TCRB clones from an experiment with 96 wells and 70,000 T cells per well.
- FIG. 12 shows the schematic of the two-subject validation experiment.
- Peripheral blood was collected from two healthy adult subjects, labeled ‘X’ and ‘Y’.
- Deep immunosequencing was used to characterize the TCRA and TCRB repertoires (14, 15, 33) of each subject.
- PBMCs from the two subjects were then mixed, and the resulting mix was used to perform the methods of the invention.
- True-positive pairs must include a TCRA and a TCRB from the same subject, while approximately half of false-positive results will be cross-subject TCRA/TCRB pairs.
- True pairings must include a TCRA and a TCRB from the unique repertoire of a single subject, and roughly half of false pairings should include a TCRA sequence from one subject and a TCRB sequence from the other, so this experiment directly assesses the credibility of the identified pairs and the method's ability to control the rate of false pairings.
- FIG. 13 An FDR analysis of our sample-mixing experiment is shown in FIG. 13 , where we divided the pairs into three categories: (i) pairs in which both TCR sequences were exclusive to Subject X (“X/X”); (ii) pairs in which both TCR sequences were exclusive to Subject Y (“Y/Y”); and (iii) pairs in which one sequence was exclusive to Subject X and the other to Subject Y (“X/Y”).
- the vertical dotted line in FIG. 13A shows the cutoff for an estimated FDR ⁇ 1%. At a predicted FDR of 1%, we observed 1,115 X/X pairs, 706Y/Y pairs, and 7X/Y pairs.
- FIG. 13B extends this false pairing analysis to predicted FDR values ranging from 0.1% to 20%. The predicted values closely track the empirical values across this range, which shows that our analysis framework provides valid FDR estimates that can be tuned to balance specificity and sensitivity for different applications.
- FIGS. 14A-D the well dropout rates in mRNA subsamples and within pairs are shown.
- FIG. 14A shows the well dropout rates in the first subsample of mRNA from the experiment using the methods described herein with 70,000 T cells per well. Median dropout rates (dotted vertical lines) are 20% for TCRA and 14% for TCRB.
- FIG. 14B shows the well dropout rates in the second subsample of mRNA from a experiment using the methods described herein. Median dropout rates are 24% for TCRA and 21% for TCRB.
- FIG. 14C shows the well dropout rates estimated from confidently paired sequences (FDR ⁇ 1%) in the first subsample of mRNA (same data as in FIG. 14A ).
- FIG. 14D shows the dropout rates estimated from confidently paired sequences (FDR ⁇ 1%) in the full combined sample of mRNA, i.e., the data used in our discovery of 35,000 pairs. Median dropout rates are 7% for TCRA and 3% for TCRB. After accounting for bias, we expect that the true median dropout rates are 10% and 5%, respectively
- FIG. 15 shows the simulated well occupancy as a function of clone frequency and number of input T cells.
- a key design parameter in an experiment using the methods of the invention is the number of T cells allocated to each well.
- FIG. 15 shows the outcomes of simulated experiments for a 96-well plate and T cell inputs ranging from 100-100,000 cells per well (x-axis). Different colors depict clones with different repertoire frequencies, and the plot shows the number of wells they occupied in our simulations. To capture clones from different frequency bands, one can simply change the number of input T cells in an experiment using the methods of the invention. It is also possible to capture multiple frequency bands in a single experiment by varying the number of input T cells across the wells on a plate.
- venous blood was drawn from each donor into 10 ml EDTA blood tubes (Beckton Dickinson, Franklin Lakes, N.J.). Fresh anticoagulated blood was separated on Ficoll Histopaque gradients (Sigma, St. Louis, Mo.) and the peripheral blood mononuclear cell (PBMC) layer was aspirated. Red blood cells were lysed using 1 ⁇ RBC Lysis solution (Miltenyi Biotec, Auburn, Calif.). Cells were washed in 1 ⁇ PBS pH 7.2 (Ambion—Life Technologies, Foster City, Calif.) and resuspended in RNAlater (Qiagen, Valencia, Calif.).
- PBMC peripheral blood mononuclear cell
- RNAlater concentration of cell suspensions was adjusted using RNAlater. Cell suspensions were stored at 4° C. until use. Prior to cell aliquoting, cell suspensions were adjusted to a concentration of 500 or 2,000 cells/ ⁇ l in RNAlater and 50 ⁇ l aliquots were distributed into wells of 0.8 ml deep well plates (Axygen, Union City, Calif.) by the Biomek FX liquid handler (Beckman Coulter, Danvers, Mass.).
- the robotic method for distributing an equal volume of cell suspensions onto 96-well plates from a common, homogeneous cell suspension reservoir ensured that similar numbers of cells were deposited into each plate well.
- the final number of mononuclear cells deposited in each well was 100,000 for our initial pairing experiment (results in FIG. 9 ), 25,000 for our sample-mixing experiment (schematic in FIG. 12 and results in FIG. 13 ), and 50,000 for our Jurkat T-ALL spike-in experiment.
- RNA Fifteen microliters (equivalent to 4-5 ng of RNA) of RNA were reverse transcribed into single stranded cDNA using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, Calif.) according to the manufacturer's protocol. During RNA isolation and reverse transcription reaction, well identity was maintained relative to the original source plate with 96 cell suspension aliquots.
- Multiplex PCR using either TCRA or TCRB gene-specific primers was performed on two 96-well plate replicates of the cDNA plate, using multiple V gene-specific primers for TCRA and TCRB and a single C segment reverse primer for each isotype (for lists of PCR primers, see Table 51 and Table S2).
- the Multiplex PCR Plus reagents (Qiagen) were used in 50 ⁇ l reactions and 35 cycles of PCR amplification under the following conditions: 95° C. denaturation for 300 s, followed by 35 cycles of denaturation at 90° C. for 30 s, annealing at 60° C. for 90 s and extension at 72° C. for 90 s.
- PCR products were purified using the SPRI Select magnetic beads (Beckman Coulter) and a 5 ⁇ l aliquot of each PCR reaction was used in a nested PCR.
- the eight cycles of the second nested PCR incorporated Illumina paired-end adaptor sequences at each end of the amplicon, allowing the samples to be sequenced on Illumina MiSeq or HiSeq sequencers (Illumina, San Diego, Calif.).
- well-specific eight-base DNA barcodes were incorporated into each PCR product as described previously (33). For a complete list of barcodes, see Table S3.
- the DNA concentration of each pool was determined by fluorometry and the DNA products were separated using the Caliper DNA 1K assay (PerkinElmer) to verify correct amplicon sizes and the absence of excess primer and primer-dimer.
- the two pools (TCRA and TCRB) were combined in equimolar ratio to a final sequencing library sample, now containing 192 individually barcoded DNA species.
- One sequencing library was prepared per one starting 96-well plate with cells, according to the method described above. Sequencing libraries were diluted, denatured and loaded onto the Illumina HiSeq 2500 sequencer flow cell as per Illumina protocols, for on-board cluster generation and sequencing by synthesis in a Rapid Run format. This run format analyzed DNA from one donor per sequencing run, using a single read sequencing (15 cycles of an index read followed by 150 cycles of sequencing through the V(D)JC receptor domain). The TCR sequencing reads were primed from the TCRA and TCRB constant regions with two sequencing primers specific to TCRA and TCRB, respectively.
- T-ALL human T cell leukemia
- Jurkat Clone E6-1 ATCC® TIB-152TM
- the sequences of Jurkat TCRA and TCRB are known and were also confirmed by deep sequencing (34).
- Jurkat cells were propagated in HyClone RPMI 1640 media (Thermo Scientific, San Jose, Calif.) supplemented with 10% fetal bovine serum (Fischer Scientific, Waltham, Mass.) in T25 flasks at 37° C. and 5% CO2.
- TCRB chain Transcription levels of TCRB chain were compared across T-cell subsets using next-generation sequencing of TCRB cDNA and determined to be similar across na ⁇ ve, activated and memory CD8 T-cell subsets, ranging from 3-12 TCRB transcripts per cell (37). Based on the literature data, we expected that Jurkat clone sequences would be present in wells at levels below those of TCR repertoire sequences originating from PBMC. Relative expression of TCRA and TCB mRNA by the Jurkat clone is another biological characteristic that would have an impact on our ability to recover the expected clone TCR ⁇ pair.
- RNAlater a high salt, ammonium based RNA preservative that is known to protect RNA from degradation and to preserve mRNA expression profiles in stored tissue or cell samples (40)
- Samples of the cell suspensions were distributed across 96 wells of a microtiter plate using a robotic liquid handler. We varied the number of cells placed in each well between 25,000 and 100,000, depending on experimental setup. The well-to-well variability in cell counts across the plate was thus dependent on pipetting precision of the liquid handler and was estimated to be below 25% CV.
- the first plate contained cells from donor X
- the second plate contained cells from donor Y
- the third plate contained cells prepared by mixing samples from both donors in a 1:1 ratio.
- Each 96-well plate of donor cells sample analyzed was processed as a unit (all 96 wells in parallel) through the first two workflow steps: total cellular RNA isolation and cDNA synthesis. All 96 cDNA pools were then replicated for specific PCR amplification of TCRA and TCRB cDNA on two separate 96-well plates while preserving the well coordinates.
- a short, 15 cycle read determined the unique well barcode first, followed by a 150 cycle sequencing read which spanned the V(D)JC domains. Sequencing primers for the second read were positioned in the TCRA and TCRB C-segments, 14 nucleotides from the J-C splice junction. The read length of 150 bases thus allowed us to resolve all V, D (in case of TCRB), and J genes. The residual 14 bases of the C segment gene were specific to either TCRA or TCRB isotype, confirming a read belonging to either isotype independently of the well barcodes.
- TCR sequences in different numbers of wells have different probabilities of overlapping by chance, and it captures departures from chance pairing without requiring perfect overlap between occupied wells.
- Imperfect well overlap is common among the members of a TCR pair because low numbers of mRNA transcripts per cell can lead to well dropouts (see section on “Well dropout rates in mRNA subsamples and within pairs” below), so it is essential to use a statistic that accounts for this feature of the data.
- This analysis can be performed for other TCR or IG pairings, such as TCRG/TCRD and IGH with IGK or IGL.
- the null distribution of p-values in an analysis using the methods of the invention is neither continuous nor uniform. Discrete well occupancy patterns lead to discrete p-values, and the p-value for each TCR sequence is chosen as the smallest seen in many comparisons with possible pairing partners, which skews the null distribution toward smaller p-values. TCR clones with different well occupancies also have different null distributions: more extreme p-values can be observed in clones that occupy a moderate number of wells, but such wells also tend to be involved in relatively few comparisons that could generate extreme p-values.
- a permutation algorithm of the invention was used to fully model the structure of an experiment using the methods of the invention.
- TCRA TCRA
- We started by counting the number of target sequences Ti that occupy i wells for i 1, . . . , 96.
- One permutation involved the following steps:
- ⁇ i For each occupancy level j, use ⁇ i to determine the number of shared wells N ij in a cumulative distribution function for sequences that occupy i and j wells. This represents the largest number of wells that a sequence in j wells would share with the best sequence in i wells after sampling T i random configurations.
- the simulated null distributions described above were used to estimate false discovery rates in an exemplary experiment. Clones at each well occupancy level have different null p-value distributions, so they also require separate FDR estimates.
- the approach follows that of Bancroft et al. (41) who developed a method for estimating false discovery rates with sequential permutation p-values. Like the p-values in the high-throughput pairing experiment, sequential permutation p-values are discrete and non-uniform, so their method is directly applicable to our scenario.
- the steps of the method were as follows:
- determining a false discovery rate estimation for a possible false pairing of a unique first adaptor immune receptor amplicon sequence and a unique second adaptor immune receptor amplicon sequence comprises calculating p-values for each of the plurality of putative cognate pairs identified in the sample; comparing the p-values for all of the plurality of putative cognate pairs with an expected p-value distribution, where the expected p-value distribution calculated to represent an experiment where no true cognate pairs are present; and determining for each putative cognate pair, an expected proportion of false positive results such that all p-values at or below the p-value of the putative cognate pair are determined to represent a true cognate pairing.
- the pairing approach of the invention depends on reliably detecting the TCRA and TCRB sequences from a T cell clone in each well it occupies.
- a given T cell will typically carry just a few mRNA copies (possibly just 5-10) of each TCR rearrangement, and experimental inefficiencies can cause either locus to go unobserved in a subset of wells.
- the experiment was structured with 70,000 T cells per well to include two separate draws from the same pools of RNA on the plate. By processing each RNA draw separately, the effects of imperfect mRNA sampling by design were characterized, which is a proxy for imperfect mRNA sampling due to experimental inefficiencies.
- FIG. 13 shows estimated rates of well dropouts for each of the two mRNA subsamples in this experiment.
- the well dropout rate for each TCR sequence was determined by comparing the number of wells it occupied in one RNA draw against the combined data from both draws.
- the median dropout rates in this split experiment ranged from 20-24% for TCRA (Y/Y) and from 14-21% for TCRB (X/X).
- the high rates of well dropouts in these subsamples underscore the importance of thoroughly sampling the mRNA pool from the cells in an experiment.
- the dropout rates tended to be lower for TCRB than TCRA, which could reflect higher numbers of TCRB mRNA molecules per cell.
- FIGS. 14A-D show the results of using a different estimator of well dropout rates.
- a dropout rate by comparing the well overlap within confidently paired (FDR ⁇ 1%) sequences. Wells that are seen in one member of a TCR pair but not the other are considered missing.
- FIG. 14C shows the results of applying this estimator to the mRNA subsample that was used for FIG. 14A .
- the pairing-based estimates are biased downward since the power to detect pairs declines as wells drop out.
- the apparent dropout rate from paired sequences was 30% lower than the rate seen by comparison to the complete mRNA sample ( FIG. 14A ).
- the application of the methods of the invention was focused on the ability of this approach to accurately pair TCR sequences at high throughput, but the methods of the invention can be used as a flexible tool that can broaden the scope of immune repertoire analysis in a variety of ways.
- the method can be tuned to pair cognate TCR chains in any desired frequency range simply by changing the number of input T cells per well.
- the method can be used to accurately pair TCR or IG sequences at high throughput.
- the methods of the invention can be used to pair a first polypeptide chain of an adaptive immune receptor heterodimer comprising a TCR alpha (TCRA) chain and a second polypeptide of the adaptive immune receptor heterodimer comprising a TCR beta (TCRB) chain.
- the methods of the invention can be used to pair a first polypeptide of the adaptive immune receptor heterodimer comprising a TCR gamma (TCRG) chain and a second polypeptide of the adaptive immune receptor heterodimer comprising a TCR delta (TCRD) chain.
- TCRA TCR alpha
- TCRB TCR beta
- TCRG TCR gamma
- TCRD TCR delta
- the methods of the invention can be used to pair a first polypeptide of an adaptive immune receptor heterodimer comprising an immunoglobulin heavy (IGH) chain and a second polypeptide of the adaptive immune receptor heterodimer that is selected from an immunoglobulin light IGL or an IGK chain.
- IGH immunoglobulin heavy
- the method provides steps for identifying a plurality of cognate pairs comprising a first polypeptide and a second polypeptide that form an adaptive immune receptor heterodimer, said adaptive immune receptor heterodimer comprising a T cell receptor (TCR) or Immunoglobulin (IG) from a single clone in a sample, the sample comprising a plurality of lymphoid cells from a mammalian subject.
- TCR T cell receptor
- IG Immunoglobulin
- the method includes steps for distributing a plurality of lymphoid cells among a plurality of containers, each container comprising a plurality of lymphoid cells; generating a library of amplicons in the plurality of containers by performing multiplex PCR of cDNA molecules that have been reverse-transcribed from mRNA molecules obtained from the plurality of lymphoid cells.
- the library of amplicons include: i) a plurality of first adaptive immune receptor amplicons encoding the first polypeptide, each comprising a unique variable (V) region encoding sequence, a unique J region encoding sequence or both a unique J region encoding sequence and a unique C region encoding sequence, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence, and ii) a plurality of second adaptive immune receptor amplicons encoding the second polypeptide, each comprising a unique V region encoding sequence, a unique J region encoding sequence or both a unique J region encoding sequence and a unique C region encoding sequence, at least one barcode sequence, at least one universal adaptor sequence, and a sequencing platform tag sequence.
- the method also includes steps for performing high throughput sequencing of the library of amplicons to obtain a data set of a plurality of first and second adaptive immune receptor amplicon sequences.
- the method includes determining a container occupancy pattern for each unique first adaptor immune receptor amplicon sequence by assigning each unique first adaptor immune receptor amplicon sequence to one or more containers, and a container occupancy pattern for each unique second adaptor immune receptor amplicon sequence by assigning each unique second adaptor immune receptor amplicon sequence to one or more containers, wherein each barcode sequence in the unique first or second adaptor immune receptor amplicon sequences is associated with a particular container.
- the method For each possible pairing of a unique first and second adaptive immune receptor amplicon sequence to form a putative cognate pair, the method involves calculating a statistical probability of observing the container occupancy patterns, or observing any larger proportion of shared containers than expected by chance, given that the first and second adaptor immune receptor amplicon sequences do not originate from the same clonal population of lymphoid cells, and identifying a plurality of a putative cognate pairs based on the statistical probability having a score lower than a predetermined likelihood cutoff.
- a false discovery rate estimation is determined for a possible false pairing of the unique first adaptor immune receptor amplicon sequence and the unique second adaptor immune receptor amplicon sequence.
- the method includes steps for identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs that encode said adaptive immune receptors in said sample based on said statistical probability and said false discovery rate estimation.
- the statistical score can be a p-value calculated for pairing each putative cognate pair of unique first and second adaptive immune receptor amplicon sequences.
- calculating the statistical score comprises calculating a probability that the unique first and second adaptive immune receptor amplicon sequences should jointly occupy as many or more containers than they are observed to jointly occupy, assuming no true cognate pairing and given the number of containers occupied by said unique first adaptive immune receptor amplicon sequence and the number of containers occupied by the unique second adaptive immune receptor amplicon sequence.
- the method analyzes whether the two sequences co-occur in more containers than would be expected by chance. Given a total of N containers, a first adaptive immune receptor sequence (A) observed in a total of X containers, a second adaptive immune receptor sequence (B) observed in a total of Y containers, and Z containers in which both adaptive immune receptor sequences (A) and (B) are observed, the method provides that given sequence (A) is found in X out of N containers (X/N) and sequence (B) is found in Y out of N (Y/N) containers, a calculation of the probability that both sequences are found in Z or more containers.
- identifying a plurality of a putative cognate pairs that have a high likelihood of pairing based on the statistical probability can comprise for each unique first adaptor immune receptor amplicon sequence identifying the unique second adaptor immune receptor amplicon sequence that has the lowest p-value score of matching, or for each unique second adaptor immune receptor amplicon sequence finding the unique first adaptor immune receptor amplicon sequence that has the lowest p-value score of matching.
- determining a false discovery rate estimation comprises: calculating p-values for each of the plurality of putative cognate pairs identified in the sample; comparing the p-values for all of the plurality of putative cognate pairs with an expected p-value distribution, said expected p-value distribution calculated to represent an experiment where no true cognate pairs are present; and determining for each putative cognate pair, an expected proportion of false positive results such that all p-values at or below the p-value of the putative cognate pair are determined to represent a true cognate pairing.
- calculating the expected p-value distribution comprises: permuting the containers in which each first and second adaptive immune receptor sequence has been observed in an otherwise-identical experiment with no true cognate pairs, and calculating the distribution of p-values associated with each putative cognate pair.
- the method includes identifying a plurality of cognate pairs of unique first and second adaptive immune receptor sequences as true cognate pairs by selecting a plurality of putative cognate pairs that have p-values below a threshold calculated based on the false discovery rate estimation.
- the identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 1%. In other embodiments, the identified cognate pair of unique first and second adaptive immune receptor amplicon sequences has a false discovery rate estimation of less than 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.
- the method can also include contacting each of said plurality of containers, under conditions and for a time sufficient to promote reverse transcription of mRNA molecules obtained from said plurality of lymphoid cells, with a first reverse transcription primer set.
- the (A) first oligonucleotide reverse transcription primer set comprises primers capable of reverse transcribing a plurality of mRNA sequences encoding the plurality of first and second adaptive immune receptor polypeptides for generating a plurality of first and second reverse-transcribed adaptive immune receptor cDNA amplicons, wherein the plurality of first reverse-transcribed adaptive immune receptor cDNA amplicons encoding the first adaptive immune receptor polypeptide comprise 1) a unique V region encoding gene sequence, and 2) a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, and wherein the plurality of second reverse-transcribed adaptive immune receptor cDNA amplicons encoding the second adaptive immune receptor polypeptide comprise 1) a unique V
- the first and second reverse-transcribed adaptive immune receptor cDNA amplicons are then amplified in a second reaction.
- the reaction begins by contacting each of said plurality of containers, under conditions and for a time sufficient to promote a multiplex PCR amplification of the first and second reverse-transcribed adaptive immune receptor cDNA amplicons with a second (B) and third (C) oligonucleotide primer sets.
- the (B) second oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of first reverse-transcribed adaptor immune receptor cDNA amplicons, wherein said forward and reverse primers each are capable of hybridizing to the first reverse-transcribed adaptive immune receptor cDNA amplicons.
- Each pair of forward and reverse primers in the second oligonucleotide primer set is capable of amplifying the first reverse-transcribed adaptive immune receptor cDNA amplicons.
- the forward primers in the second oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to the V region encoding gene sequence.
- the reverse primers in the second oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to the J region encoding gene sequence or the C region encoding gene sequence.
- the (C) third oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of reverse-transcribed second adaptive immune receptor cDNA amplicons. Each pair of forward and reverse primers in the third oligonucleotide primer set is capable of amplifying the second reverse-transcribed adaptive immune receptor cDNA amplicons.
- the forward primers in the third oligonucleotide primer set comprise a first universal adaptor sequence and a region complementary to the V region encoding gene sequence.
- the reverse primers in the third oligonucleotide primer set comprise a second universal adaptor sequence and a region complementary to the J region encoding gene sequence or complementary to the C region encoding gene sequence.
- the method also includes generating i) a plurality of third adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and the first and second universal adaptor sequences, and ii) a plurality of fourth adaptive immune receptor amplicons each comprising a unique V region encoding gene sequence, or complement thereof, a unique J region encoding gene sequence or both a unique J region encoding gene sequence and a unique C region encoding gene sequence, or complement thereof, and the first and second universal adaptor sequences.
- the plurality of third adaptive immune receptor amplicons and the plurality of fourth adaptive immune receptor amplicons are then amplified with additional primers.
- the method includes contacting each of the plurality of containers, under conditions and for a time sufficient to promote a second multiplex PCR amplification of the plurality of third and fourth adaptive immune receptor amplicons with a fourth (D) oligonucleotide primer set and fifth (E) oligonucleotide primer set.
- the (D) fourth oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of third adaptor immune receptor amplicons, wherein the forward and reverse primers each are capable of hybridizing to the third adaptive immune receptor amplicons.
- Each pair of forward and reverse primers in the fourth oligonucleotide primer set is capable of amplifying said third adaptor immune receptor amplicons.
- the forward primer in the fourth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the first universal adaptor sequence in the plurality of third adaptive immune receptor amplicon and the reverse primer comprises a sequencing platform tag sequence and a region complementary to the second universal adaptor sequence in the plurality of third adaptive immune receptor amplicons.
- either one or both of the forward and reverse primers in the fourth oligonucleotide primer set comprises a unique barcode sequence associated with the container in which the fourth oligonucleotide primer set is introduced.
- the (E) fifth oligonucleotide primer set comprises forward and reverse primers capable of amplifying the plurality of fourth adaptor immune receptor amplicons, wherein the forward and reverse primers each are capable of hybridizing to the fourth adaptive immune receptor amplicons.
- Each pair of forward and reverse primers in said fourth oligonucleotide primer set is capable of amplifying said plurality of fourth adaptor immune receptor amplicons.
- the forward primer in the fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the first universal adaptor sequence in the plurality of fourth adaptive immune receptor amplicons
- the reverse primer in the fifth oligonucleotide primer set comprises a sequencing platform tag sequence and a region complementary to the second universal adaptor sequence in the plurality of fourth adaptive immune receptor amplicons.
- Either one or both of the forward and reverse primers of the fourth oligonucleotide primer set comprises a unique barcode sequence associated with the container in which the fourth oligonucleotide primer set is introduced, thereby generating the library of amplicons comprising the plurality of first adaptive immune receptor amplicons and the plurality of second adaptive immune receptor amplicons.
- the method includes combining the library of amplicons from the plurality of containers into a mixture for sequencing.
- Methods for high throughput sequencing are described in detail above and in U.S. Ser. No. 13/217,126, U.S. Ser. No. 12/794,507, PCT/US2011/026373, or PCT/US2011/049012, which are incorporated by reference in their entireties.
- the plurality of first adaptive immune receptor amplicons comprise a C region encoding sequence. In some aspects, the plurality of second adaptive immune receptor amplicons comprise a C region encoding sequence.
- the sample comprises a blood sample. In another embodiment, the sample comprises a tissue sample. In certain embodiments, the sample comprises a sample purified or cultured human lymphoid cells. In other embodiments, the container comprises at least 10 4 lymphoid cells. In another embodiment, the sample comprises at least 10 4 cells.
- the method is applicable to various adaptive immune receptor loci, as described above, such as pairing of a TCR alpha (TCRA) chain and a TCR beta (TCRB) chain, a TCR gamma (TCRG) chain and a TCR delta (TCRD) chain, or an immunoglobulin heavy (IGH) chain and an immunoglobulin light IGL or an IGK chain.
- TCRA TCR alpha
- TCRB TCR beta
- TCRG TCR gamma
- TCRD TCR delta
- IGH immunoglobulin heavy chain and an immunoglobulin light IGL or an IGK chain.
- first polypeptide of the adaptive immune receptor heterodimer is an IGH chain and the second polypeptide of the adaptive immune receptor heterodimer is both IGL and IGK
- three different amplification primer sets are used comprising: a first oligonucleotide amplification primer set for IGH, a second oligonucleotide amplification primer set for IGK, and a third oligonucleotide amplification primer set for IGL.
- the methods and compositions of the invention can be found useful in many applications in immunology, medicine, and therapeutic development.
- the methods of the invention offer opportunities for investigating connections between the primary sequences of a collection of selected immune receptors and the target(s) (and epitopes) that caused their selection.
- the methods of the invention can be a useful approach for identifying critical TCRs from tumor-infiltrating lymphocytes, for establishing new criteria for responsiveness to routine or experimental vaccination, and for epidemiological analysis of public exposures and shared responses.
- the methods of the invention also provide information on the relative contribution of each independent chain to a given response.
- our approach provides data on whether there might be physical TCR chain attributes that govern a particular immune response.
- constraints on the length or biophysical parameters of one or both chains for a given type of response to a given type of antigenic challenge can be run with standard laboratory supplies and equipment, without the need for specialized expertise, and the starting sample type has a broad potential range (tumor samples, sorted cells, cells in suspension, etc.). This technology is designed to be scalable and accessible to a variety of laboratories.
- the methods of the invention can be applied to and will work equally well for TCR ⁇ / ⁇ , and for linking the immunoglobulin heavy and light chains (IGH with IGK or IGL). Given the practical interest in monoclonal antibody development, as well as the general importance of the humoral immune response, the methods of the invention have the potential to become an important technology for biomedical discovery.
- TCRA and TCRB C-gene reverse PCR primers TCRA and TCRB C-segment primers Sequence Name Sequence TCRA_C50 ACAGACTTGTCACTGGATTTAGAGTCTCTCAGCTGGT ACACGGCAGGGTC TCRB_C50 GAGATCTCTGCTTCTGATGGCTCAAACACAGCGACCT CGGGTGGGAACAC
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Bioinformatics & Computational Biology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/777,294 US20160024493A1 (en) | 2013-03-15 | 2014-03-17 | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set |
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201361789408P | 2013-03-15 | 2013-03-15 | |
| PCT/US2013/045994 WO2013188831A1 (en) | 2012-06-15 | 2013-06-14 | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set |
| USPCT/US2013/045994 | 2013-06-14 | ||
| PCT/US2014/030859 WO2014145992A1 (en) | 2013-03-15 | 2014-03-17 | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set |
| US14/777,294 US20160024493A1 (en) | 2013-03-15 | 2014-03-17 | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| US20160024493A1 true US20160024493A1 (en) | 2016-01-28 |
Family
ID=51538155
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US14/777,294 Abandoned US20160024493A1 (en) | 2013-03-15 | 2014-03-17 | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set |
| US18/646,564 Pending US20250043272A1 (en) | 2013-03-15 | 2024-04-25 | Uniquely Tagged Rearranged Adaptive Immune Receptor Genes in a Complex Gene Set |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US18/646,564 Pending US20250043272A1 (en) | 2013-03-15 | 2024-04-25 | Uniquely Tagged Rearranged Adaptive Immune Receptor Genes in a Complex Gene Set |
Country Status (10)
| Country | Link |
|---|---|
| US (2) | US20160024493A1 (https=) |
| EP (1) | EP2971105B1 (https=) |
| JP (1) | JP6431895B2 (https=) |
| KR (1) | KR20150132479A (https=) |
| CN (1) | CN105452483B (https=) |
| AU (2) | AU2014232314B2 (https=) |
| CA (1) | CA2906218A1 (https=) |
| IL (1) | IL241394B (https=) |
| SG (2) | SG11201506991VA (https=) |
| WO (1) | WO2014145992A1 (https=) |
Cited By (33)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016161273A1 (en) | 2015-04-01 | 2016-10-06 | Adaptive Biotechnologies Corp. | Method of identifying human compatible t cell receptors specific for an antigenic target |
| WO2018132635A1 (en) * | 2017-01-12 | 2018-07-19 | Massachusetts Institute Of Technology | Methods for analyzing t cell receptors and b cell receptors |
| CN108374203A (zh) * | 2018-03-01 | 2018-08-07 | 艾吉泰康生物科技(北京)有限公司 | 一种用于双向测序的扩增子文库的构建方法 |
| US10077473B2 (en) | 2013-07-01 | 2018-09-18 | Adaptive Biotechnologies Corp. | Method for genotyping clonotype profiles using sequence tags |
| US10150996B2 (en) | 2012-10-19 | 2018-12-11 | Adaptive Biotechnologies Corp. | Quantification of adaptive immune cell genomes in a complex mixture of cells |
| US10202640B2 (en) * | 2014-05-07 | 2019-02-12 | The Board Of Trustees Of The Leland Stanford Junior University | Single cell analysis of T cells using high-throughput multiplex amplification and deep sequencing |
| US10214770B2 (en) | 2012-05-08 | 2019-02-26 | Adaptive Biotechnologies Corp. | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
| US10392663B2 (en) | 2014-10-29 | 2019-08-27 | Adaptive Biotechnologies Corp. | Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples |
| US10428325B1 (en) | 2016-09-21 | 2019-10-01 | Adaptive Biotechnologies Corporation | Identification of antigen-specific B cell receptors |
| US10435745B2 (en) | 2014-04-01 | 2019-10-08 | Adaptive Biotechnologies Corp. | Determining antigen-specific T-cells |
| WO2020041702A1 (en) * | 2018-08-24 | 2020-02-27 | Swift Biosciences, Inc. | Asymmetric targeted amplification methods |
| US10816543B2 (en) | 2018-02-12 | 2020-10-27 | 10X Genomics, Inc. | Methods and systems for analysis of major histocompatability complex |
| US10941453B1 (en) * | 2020-05-20 | 2021-03-09 | Paragon Genomics, Inc. | High throughput detection of pathogen RNA in clinical specimens |
| WO2021046121A1 (en) * | 2019-09-03 | 2021-03-11 | The Regents Of The University Of California | Method to sequence mrna in single cells in parallel with quantification of intracellular phenotype |
| US10954562B2 (en) | 2016-12-22 | 2021-03-23 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US20210164047A1 (en) * | 2017-01-17 | 2021-06-03 | Life Technologies Corporation | Compositions and methods for immune repertoire sequencing |
| US20210180106A1 (en) * | 2016-02-12 | 2021-06-17 | Curevac Ag | Method for analyzing rna |
| US11047008B2 (en) | 2015-02-24 | 2021-06-29 | Adaptive Biotechnologies Corporation | Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing |
| WO2021217077A1 (en) * | 2020-04-24 | 2021-10-28 | The Board Of Trustees Of The Leland Stanford Junior University | Novel t-cell specificities and uses thereof |
| US11248253B2 (en) | 2014-03-05 | 2022-02-15 | Adaptive Biotechnologies Corporation | Methods using randomer-containing synthetic molecules |
| US11254980B1 (en) | 2017-11-29 | 2022-02-22 | Adaptive Biotechnologies Corporation | Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements |
| US11306356B2 (en) * | 2016-06-01 | 2022-04-19 | Roche Sequencing Solutions, Inc. | Immuno-PETE |
| US20220251654A1 (en) * | 2019-06-06 | 2022-08-11 | Natera, Inc. | Methods for detecting immune cell dna and monitoring immune system |
| US11680293B1 (en) | 2022-04-21 | 2023-06-20 | Paragon Genomics, Inc. | Methods and compositions for amplifying DNA and generating DNA sequencing results from target-enriched DNA molecules |
| US20230220453A1 (en) * | 2016-03-01 | 2023-07-13 | Universal Sequencing Technology Corporation | Methods and Kits for Tracking Nucleic Acid Target Origin for Nucleic Acid Sequencing |
| US11820979B2 (en) | 2016-12-23 | 2023-11-21 | Visterra, Inc. | Binding polypeptides and methods of making the same |
| US11920174B2 (en) | 2016-03-03 | 2024-03-05 | CureVac SE | RNA analysis by total hydrolysis and quantification of released nucleosides |
| US12049621B2 (en) | 2018-05-10 | 2024-07-30 | 10X Genomics, Inc. | Methods and systems for molecular composition generation |
| EP4211239A4 (en) * | 2020-09-08 | 2024-09-11 | Seqwell, Inc. | Sequencing oligonucleotides and methods of use thereof |
| US12091715B2 (en) | 2022-04-21 | 2024-09-17 | Paragon Genomics, Inc. | Methods and compositions for reducing base errors of massive parallel sequencing using triseq sequencing |
| US12110549B2 (en) | 2016-12-22 | 2024-10-08 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12449419B1 (en) | 2020-02-12 | 2025-10-21 | 10X Genomics, Inc. | Methods for detecting binding of peptide-MHC monomers to T cells |
| US12486501B2 (en) | 2021-01-06 | 2025-12-02 | Think Therapeutics, Inc. | Multiplexed testing of lymphocytes for antigen specificity |
Families Citing this family (37)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9506119B2 (en) | 2008-11-07 | 2016-11-29 | Adaptive Biotechnologies Corp. | Method of sequence determination using sequence tags |
| ES2726702T3 (es) | 2009-01-15 | 2019-10-08 | Adaptive Biotechnologies Corp | Perfilado de la inmunidad adaptativa y métodos para la generación de anticuerpos monoclonales |
| EP3372694A1 (en) | 2012-03-05 | 2018-09-12 | Adaptive Biotechnologies Corporation | Determining paired immune receptor chains from frequency matched subunits |
| US11390921B2 (en) | 2014-04-01 | 2022-07-19 | Adaptive Biotechnologies Corporation | Determining WT-1 specific T cells and WT-1 specific T cell receptors (TCRs) |
| EP3517625B1 (en) | 2014-05-22 | 2021-01-20 | The University of British Columbia | Methods for determining lymphocyte receptor chain pairs |
| US10246701B2 (en) | 2014-11-14 | 2019-04-02 | Adaptive Biotechnologies Corp. | Multiplexed digital quantitation of rearranged lymphoid receptors in a complex mixture |
| AU2015353581A1 (en) | 2014-11-25 | 2017-06-15 | Adaptive Biotechnologies Corporation | Characterization of adaptive immune response to vaccination or infection using immune repertoire sequencing |
| CN104562215B (zh) * | 2014-12-29 | 2017-03-22 | 北京诺禾致源科技股份有限公司 | 扩增子文库的构建方法 |
| US10760120B2 (en) * | 2015-01-23 | 2020-09-01 | Qiagen Sciences, Llc | High multiplex PCR with molecular barcoding |
| WO2016138488A2 (en) | 2015-02-26 | 2016-09-01 | The Broad Institute Inc. | T cell balance gene expression, compositions of matters and methods of use thereof |
| AU2016253964B2 (en) * | 2015-04-27 | 2022-07-07 | Abvitro Llc | Methods of sequencing, determining, pairing, and validating therapeutic agents and disease specific antigens |
| US10539564B2 (en) | 2015-07-22 | 2020-01-21 | Roche Sequencing Solutions, Inc. | Identification of antigen epitopes and immune sequences recognizing the antigens |
| EP3325646B1 (en) | 2015-07-22 | 2020-08-19 | F.Hoffmann-La Roche Ag | Identification of antigen epitopes and immune sequences recognizing the antigens |
| GB201516269D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516274D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516275D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516277D0 (en) | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR libraries |
| GB201516265D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516276D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516270D0 (en) * | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| GB201516272D0 (en) | 2015-09-15 | 2015-10-28 | Adaptimmune Ltd And Immunocore Ltd | TCR Libraries |
| JP7064439B2 (ja) * | 2015-11-04 | 2022-05-10 | アトレカ インコーポレイテッド | 単一細胞に関連する核酸の解析のための、核酸バーコードの組み合わせセット |
| JP7129343B2 (ja) * | 2016-05-02 | 2022-09-01 | ベクトン・ディキンソン・アンド・カンパニー | 正確な分子バーコーディング |
| CN106283201B (zh) * | 2016-09-20 | 2019-08-06 | 中国医学科学院肿瘤医院 | 基于高通量测序的tcr多样性检测和文库构建 |
| CN110234772B (zh) * | 2017-01-31 | 2024-01-19 | 路德维格癌症研究所有限公司 | 增强的免疫细胞受体测序方法 |
| WO2019046817A1 (en) | 2017-09-01 | 2019-03-07 | Life Technologies Corporation | COMPOSITIONS AND METHODS FOR IMMUNOLOGICAL REPERTOIRE SEQUENCING |
| CN109536594B (zh) * | 2017-09-20 | 2022-11-01 | 深圳华大智造科技股份有限公司 | 一种用于Small RNA的测序方法、测序试剂和应用 |
| JP7101419B2 (ja) * | 2017-10-27 | 2022-07-15 | ザ リージェンツ オブ ザ ユニバーシティ オブ カリフォルニア | 内因性t細胞受容体の標的置換 |
| WO2020018837A1 (en) * | 2018-07-18 | 2020-01-23 | Life Technologies Corporation | Compositions and methods for immune repertoire sequencing |
| WO2020018836A1 (en) | 2018-07-18 | 2020-01-23 | Life Technologies Corporation | Compositions and methods for immune repertoire sequencing |
| KR102662493B1 (ko) * | 2019-05-10 | 2024-04-30 | 더 차이니즈 유니버시티 오브 홍콩 | 중합효소를 사용하여 부위를 연결시키는 프라이머 및 검정 |
| US11149322B2 (en) * | 2019-06-07 | 2021-10-19 | Chapter Diagnostics, Inc. | Methods and compositions for human papillomaviruses and sexually transmitted infections detection, identification and quantification |
| JP2024512608A (ja) | 2021-03-24 | 2024-03-19 | ジェネンテック, インコーポレイテッド | Tリンパ球における効率的なtcr遺伝子編集 |
| WO2022207682A1 (en) * | 2021-04-01 | 2022-10-06 | F. Hoffmann-La Roche Ag | Immune cell counting of sars-cov-2 patients based on immune repertoire sequencing |
| CN114561454B (zh) * | 2022-03-03 | 2025-11-14 | 中国人民解放军陆军军医大学 | 一种基于高通量测序对TCR β进行定量的方法 |
| TWI867406B (zh) * | 2022-10-27 | 2024-12-21 | 醫華生技股份有限公司 | 生物微粒分析方法 |
| EP4603595A1 (en) * | 2024-02-13 | 2025-08-20 | ImmuneDiscover Sweden AB | A method for typing the immune genes and the allelic variants thereof |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US6031091A (en) | 1987-09-21 | 2000-02-29 | Gen-Probe Incorporated | Non-nucleotide linking reagents for nucleotide probes |
| KR920003787B1 (ko) | 1990-03-05 | 1992-05-14 | 한국과학기술 연구원 | 신규 플라스미드 제조 및 그를 함유한 균주를 배양하여 아이 지 에프-1(igf-1)을 생산하는 방법 |
| KR100249110B1 (ko) | 1992-05-06 | 2000-04-01 | 다니엘 엘. 캐시앙 | 핵산 서열 증폭 방법, 이에 이용되는 조성물 및 키트 |
| US5596090A (en) | 1992-07-24 | 1997-01-21 | The United States Of America As Represented By The Secretary Of The Navy | Antisense oligonucleotides directed against human VCAM-1 RNA |
| US5571711A (en) | 1993-06-17 | 1996-11-05 | Ludwig Institute For Cancer Research | Isolated nucleic acid molecules coding for BAGE tumor rejection antigen precursors |
| DK0668350T4 (da) | 1994-02-16 | 2009-02-23 | Us Gov Health & Human Serv | Melanomassocieret antigen, epitoper deraf samt vacciner mod melanom |
| US5821122A (en) | 1995-06-07 | 1998-10-13 | Inserm (Institute Nat'l De La Sante Et De La Recherche . .) | Isolated nucleic acid molecules, peptides which form complexes with MHC molecule HLA-A2 and uses thereof |
| JPH0975090A (ja) | 1995-09-13 | 1997-03-25 | Kanegafuchi Chem Ind Co Ltd | 細胞付着部材 |
| EP3257949A1 (en) * | 2005-06-15 | 2017-12-20 | Complete Genomics Inc. | Nucleic acid analysis by random mixtures of non-overlapping fragments |
| US8911948B2 (en) | 2008-04-30 | 2014-12-16 | Integrated Dna Technologies, Inc. | RNase H-based assays utilizing modified RNA monomers |
| EP2364368B1 (en) * | 2008-11-07 | 2014-01-15 | Sequenta, Inc. | Methods of monitoring conditions by sequence analysis |
| US20120058902A1 (en) | 2009-06-25 | 2012-03-08 | Livingston Robert J | Method of measuring adaptive immunity |
| WO2010151416A1 (en) | 2009-06-25 | 2010-12-29 | Fred Hutchinson Cancer Research Center | Method of measuring adaptive immunity |
| WO2011106738A2 (en) | 2010-02-25 | 2011-09-01 | Fred Hutchinson Cancer Research Center | Use of tcr clonotypes as biomarkers for disease |
| EP2567226B1 (en) * | 2010-05-06 | 2016-08-10 | Adaptive Biotechnologies Corporation | Monitoring health and disease status using clonotype profiles |
| WO2012012703A2 (en) * | 2010-07-23 | 2012-01-26 | Esoterix Genetic Laboratories, Llc | Identification of differentially represented fetal or maternal genomic regions and uses thereof |
| US9193997B2 (en) * | 2010-12-15 | 2015-11-24 | The Board Of Trustees Of The Leland Stanford Junior University | Measuring and monitoring of cell clonality |
| WO2012083225A2 (en) | 2010-12-16 | 2012-06-21 | Gigagen, Inc. | System and methods for massively parallel analysis of nycleic acids in single cells |
| JP6211931B2 (ja) * | 2011-03-09 | 2017-10-11 | セル・シグナリング・テクノロジー・インコーポレイテツド | モノクローナル抗体を作製するための方法および試薬 |
| PL3892295T3 (pl) * | 2011-05-24 | 2023-07-24 | BioNTech SE | Zindywidualizowane szczepionki przeciwnowotworowe |
| EP3372694A1 (en) * | 2012-03-05 | 2018-09-12 | Adaptive Biotechnologies Corporation | Determining paired immune receptor chains from frequency matched subunits |
-
2014
- 2014-03-17 KR KR1020157029634A patent/KR20150132479A/ko not_active Withdrawn
- 2014-03-17 JP JP2016502574A patent/JP6431895B2/ja active Active
- 2014-03-17 EP EP14722474.5A patent/EP2971105B1/en active Active
- 2014-03-17 WO PCT/US2014/030859 patent/WO2014145992A1/en not_active Ceased
- 2014-03-17 AU AU2014232314A patent/AU2014232314B2/en active Active
- 2014-03-17 SG SG11201506991VA patent/SG11201506991VA/en unknown
- 2014-03-17 US US14/777,294 patent/US20160024493A1/en not_active Abandoned
- 2014-03-17 CA CA2906218A patent/CA2906218A1/en not_active Abandoned
- 2014-03-17 CN CN201480025490.9A patent/CN105452483B/zh active Active
- 2014-03-17 SG SG10201707394PA patent/SG10201707394PA/en unknown
-
2015
- 2015-09-09 IL IL241394A patent/IL241394B/en active IP Right Grant
-
2020
- 2020-08-06 AU AU2020213348A patent/AU2020213348B2/en active Active
-
2024
- 2024-04-25 US US18/646,564 patent/US20250043272A1/en active Pending
Cited By (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10214770B2 (en) | 2012-05-08 | 2019-02-26 | Adaptive Biotechnologies Corp. | Compositions and method for measuring and calibrating amplification bias in multiplexed PCR reactions |
| US10894977B2 (en) | 2012-05-08 | 2021-01-19 | Adaptive Biotechnologies Corporation | Compositions and methods for measuring and calibrating amplification bias in multiplexed PCR reactions |
| US10150996B2 (en) | 2012-10-19 | 2018-12-11 | Adaptive Biotechnologies Corp. | Quantification of adaptive immune cell genomes in a complex mixture of cells |
| US10077473B2 (en) | 2013-07-01 | 2018-09-18 | Adaptive Biotechnologies Corp. | Method for genotyping clonotype profiles using sequence tags |
| US10526650B2 (en) | 2013-07-01 | 2020-01-07 | Adaptive Biotechnologies Corporation | Method for genotyping clonotype profiles using sequence tags |
| US11248253B2 (en) | 2014-03-05 | 2022-02-15 | Adaptive Biotechnologies Corporation | Methods using randomer-containing synthetic molecules |
| US12351872B2 (en) | 2014-04-01 | 2025-07-08 | Adaptive Biotechnologies Corporation | Determining antigen-specific T-cells |
| US11261490B2 (en) | 2014-04-01 | 2022-03-01 | Adaptive Biotechnologies Corporation | Determining antigen-specific T-cells |
| US10435745B2 (en) | 2014-04-01 | 2019-10-08 | Adaptive Biotechnologies Corp. | Determining antigen-specific T-cells |
| US10202640B2 (en) * | 2014-05-07 | 2019-02-12 | The Board Of Trustees Of The Leland Stanford Junior University | Single cell analysis of T cells using high-throughput multiplex amplification and deep sequencing |
| US10392663B2 (en) | 2014-10-29 | 2019-08-27 | Adaptive Biotechnologies Corp. | Highly-multiplexed simultaneous detection of nucleic acids encoding paired adaptive immune receptor heterodimers from a large number of samples |
| US11047008B2 (en) | 2015-02-24 | 2021-06-29 | Adaptive Biotechnologies Corporation | Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing |
| US12428682B2 (en) | 2015-02-24 | 2025-09-30 | Adaptive Biotechnologies Corporation | Methods for diagnosing infectious disease and determining HLA status using immune repertoire sequencing |
| US11041202B2 (en) | 2015-04-01 | 2021-06-22 | Adaptive Biotechnologies Corporation | Method of identifying human compatible T cell receptors specific for an antigenic target |
| WO2016161273A1 (en) | 2015-04-01 | 2016-10-06 | Adaptive Biotechnologies Corp. | Method of identifying human compatible t cell receptors specific for an antigenic target |
| US20210180106A1 (en) * | 2016-02-12 | 2021-06-17 | Curevac Ag | Method for analyzing rna |
| US12612654B2 (en) * | 2016-02-12 | 2026-04-28 | CureVac SE | Method for analyzing RNA |
| US20230220453A1 (en) * | 2016-03-01 | 2023-07-13 | Universal Sequencing Technology Corporation | Methods and Kits for Tracking Nucleic Acid Target Origin for Nucleic Acid Sequencing |
| US11920174B2 (en) | 2016-03-03 | 2024-03-05 | CureVac SE | RNA analysis by total hydrolysis and quantification of released nucleosides |
| US11725307B2 (en) | 2016-06-01 | 2023-08-15 | Roche Sequencing Solutions, Inc. | Immuno-PETE |
| US11306356B2 (en) * | 2016-06-01 | 2022-04-19 | Roche Sequencing Solutions, Inc. | Immuno-PETE |
| US12043919B2 (en) | 2016-06-01 | 2024-07-23 | Roche Sequencing Solutions, Inc. | Immune profiling by primer extension target enrichment |
| US11773511B2 (en) | 2016-06-01 | 2023-10-03 | Roche Sequencing Solutions, Inc. | Immune profiling by primer extension target enrichment |
| US10428325B1 (en) | 2016-09-21 | 2019-10-01 | Adaptive Biotechnologies Corporation | Identification of antigen-specific B cell receptors |
| US11732302B2 (en) | 2016-12-22 | 2023-08-22 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US12110549B2 (en) | 2016-12-22 | 2024-10-08 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11248267B2 (en) | 2016-12-22 | 2022-02-15 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US10954562B2 (en) | 2016-12-22 | 2021-03-23 | 10X Genomics, Inc. | Methods and systems for processing polynucleotides |
| US11820979B2 (en) | 2016-12-23 | 2023-11-21 | Visterra, Inc. | Binding polypeptides and methods of making the same |
| WO2018132635A1 (en) * | 2017-01-12 | 2018-07-19 | Massachusetts Institute Of Technology | Methods for analyzing t cell receptors and b cell receptors |
| US11970787B2 (en) * | 2017-01-17 | 2024-04-30 | Life Technologies Corporation | Compositions and methods for immune repertoire sequencing |
| US20210164047A1 (en) * | 2017-01-17 | 2021-06-03 | Life Technologies Corporation | Compositions and methods for immune repertoire sequencing |
| US11254980B1 (en) | 2017-11-29 | 2022-02-22 | Adaptive Biotechnologies Corporation | Methods of profiling targeted polynucleotides while mitigating sequencing depth requirements |
| US11131664B2 (en) | 2018-02-12 | 2021-09-28 | 10X Genomics, Inc. | Methods and systems for macromolecule labeling |
| US11002731B2 (en) | 2018-02-12 | 2021-05-11 | 10X Genomics, Inc. | Methods and systems for antigen screening |
| US10816543B2 (en) | 2018-02-12 | 2020-10-27 | 10X Genomics, Inc. | Methods and systems for analysis of major histocompatability complex |
| CN108374203A (zh) * | 2018-03-01 | 2018-08-07 | 艾吉泰康生物科技(北京)有限公司 | 一种用于双向测序的扩增子文库的构建方法 |
| US12049621B2 (en) | 2018-05-10 | 2024-07-30 | 10X Genomics, Inc. | Methods and systems for molecular composition generation |
| WO2020041702A1 (en) * | 2018-08-24 | 2020-02-27 | Swift Biosciences, Inc. | Asymmetric targeted amplification methods |
| US12365937B2 (en) | 2018-08-24 | 2025-07-22 | Integrated Dna Technologies, Inc. | Asymmetric targeted amplification methods |
| US20220251654A1 (en) * | 2019-06-06 | 2022-08-11 | Natera, Inc. | Methods for detecting immune cell dna and monitoring immune system |
| US12305235B2 (en) * | 2019-06-06 | 2025-05-20 | Natera, Inc. | Methods for detecting immune cell DNA and monitoring immune system |
| WO2021046121A1 (en) * | 2019-09-03 | 2021-03-11 | The Regents Of The University Of California | Method to sequence mrna in single cells in parallel with quantification of intracellular phenotype |
| US12449419B1 (en) | 2020-02-12 | 2025-10-21 | 10X Genomics, Inc. | Methods for detecting binding of peptide-MHC monomers to T cells |
| WO2021217077A1 (en) * | 2020-04-24 | 2021-10-28 | The Board Of Trustees Of The Leland Stanford Junior University | Novel t-cell specificities and uses thereof |
| US10941453B1 (en) * | 2020-05-20 | 2021-03-09 | Paragon Genomics, Inc. | High throughput detection of pathogen RNA in clinical specimens |
| EP4211239A4 (en) * | 2020-09-08 | 2024-09-11 | Seqwell, Inc. | Sequencing oligonucleotides and methods of use thereof |
| US12486501B2 (en) | 2021-01-06 | 2025-12-02 | Think Therapeutics, Inc. | Multiplexed testing of lymphocytes for antigen specificity |
| US12091715B2 (en) | 2022-04-21 | 2024-09-17 | Paragon Genomics, Inc. | Methods and compositions for reducing base errors of massive parallel sequencing using triseq sequencing |
| US11680293B1 (en) | 2022-04-21 | 2023-06-20 | Paragon Genomics, Inc. | Methods and compositions for amplifying DNA and generating DNA sequencing results from target-enriched DNA molecules |
Also Published As
| Publication number | Publication date |
|---|---|
| SG11201506991VA (en) | 2015-10-29 |
| US20250043272A1 (en) | 2025-02-06 |
| KR20150132479A (ko) | 2015-11-25 |
| EP2971105B1 (en) | 2018-08-01 |
| WO2014145992A1 (en) | 2014-09-18 |
| JP2016512685A (ja) | 2016-05-09 |
| JP6431895B2 (ja) | 2018-12-05 |
| AU2014232314B2 (en) | 2020-05-14 |
| IL241394B (en) | 2019-12-31 |
| CN105452483B (zh) | 2019-01-11 |
| AU2020213348A1 (en) | 2020-08-27 |
| CN105452483A (zh) | 2016-03-30 |
| SG10201707394PA (en) | 2017-10-30 |
| IL241394A0 (en) | 2015-11-30 |
| AU2020213348B2 (en) | 2022-05-19 |
| EP2971105A1 (en) | 2016-01-20 |
| AU2014232314A1 (en) | 2015-09-17 |
| CA2906218A1 (en) | 2014-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250043272A1 (en) | Uniquely Tagged Rearranged Adaptive Immune Receptor Genes in a Complex Gene Set | |
| AU2013273987B2 (en) | Uniquely tagged rearranged adaptive immune receptor genes in a complex gene set | |
| US11591652B2 (en) | System and methods for massively parallel analysis of nucleic acids in single cells | |
| US20150154352A1 (en) | System and Methods for Genetic Analysis of Mixed Cell Populations | |
| EP4001410A1 (en) | Systems and methods for massively parallel combinatorial analysis of single cells | |
| US10428325B1 (en) | Identification of antigen-specific B cell receptors | |
| US20240287606A1 (en) | Immume cell counting based on immune repertoire sequencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AS | Assignment |
Owner name: ADAPTIVE BIOTECHNOLOGIES CORPORATION, WASHINGTON Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ROBINS, HARLAN SAUL;REEL/FRAME:033121/0452 Effective date: 20140613 |
|
| AS | Assignment |
Owner name: FRED HUTCHINSON CANCER RESEARCH CENTER, WASHINGTON Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ADAPTIVE BIOTECHNOLOGIES CORP.;REEL/FRAME:038460/0364 Effective date: 20160427 |
|
| AS | Assignment |
Owner name: ADAPTIVE BIOTECHNOLOGIES CORP., WASHINGTON Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:FRED HUTCHINSON CANCER RESEARCH CENTER;REEL/FRAME:039585/0498 Effective date: 20160804 |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: DOCKETED NEW CASE - READY FOR EXAMINATION |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: NON FINAL ACTION MAILED |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: RESPONSE TO NON-FINAL OFFICE ACTION ENTERED AND FORWARDED TO EXAMINER |
|
| STPP | Information on status: patent application and granting procedure in general |
Free format text: FINAL REJECTION MAILED |
|
| STCV | Information on status: appeal procedure |
Free format text: NOTICE OF APPEAL FILED |
|
| STCV | Information on status: appeal procedure |
Free format text: APPEAL BRIEF (OR SUPPLEMENTAL BRIEF) ENTERED AND FORWARDED TO EXAMINER |
|
| STCV | Information on status: appeal procedure |
Free format text: EXAMINER'S ANSWER TO APPEAL BRIEF MAILED |
|
| STCV | Information on status: appeal procedure |
Free format text: APPEAL READY FOR REVIEW |
|
| STCV | Information on status: appeal procedure |
Free format text: ON APPEAL -- AWAITING DECISION BY THE BOARD OF APPEALS |
|
| AS | Assignment |
Owner name: ORBIMED ROYALTY & CREDIT OPPORTUNITIES IV, LP, NEW YORK Free format text: SECURITY INTEREST;ASSIGNOR:ADAPTIVE BIOTECHNOLOGIES CORPORATION;REEL/FRAME:061449/0689 Effective date: 20220912 |
|
| STCV | Information on status: appeal procedure |
Free format text: BOARD OF APPEALS DECISION RENDERED |
|
| STCB | Information on status: application discontinuation |
Free format text: ABANDONED -- AFTER EXAMINER'S ANSWER OR BOARD OF APPEALS DECISION |