US20110130338A1 - Use of serine protease inhibitors in the treatment of skin diseases - Google Patents

Use of serine protease inhibitors in the treatment of skin diseases Download PDF

Info

Publication number
US20110130338A1
US20110130338A1 US12/863,651 US86365109A US2011130338A1 US 20110130338 A1 US20110130338 A1 US 20110130338A1 US 86365109 A US86365109 A US 86365109A US 2011130338 A1 US2011130338 A1 US 2011130338A1
Authority
US
United States
Prior art keywords
seq
act
group
inhibitor
syndrome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/863,651
Other languages
English (en)
Inventor
David Deperthes
Christoph Kundig
Alain Hovnanian
Celine Deraison
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Institut National de la Sante et de la Recherche Medicale INSERM
Dermadis SA
Original Assignee
Institut National de la Sante et de la Recherche Medicale INSERM
Dermadis SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Institut National de la Sante et de la Recherche Medicale INSERM, Dermadis SA filed Critical Institut National de la Sante et de la Recherche Medicale INSERM
Priority to US12/863,651 priority Critical patent/US20110130338A1/en
Assigned to DERMADIS SA, INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE MEDICALE (INSERM) reassignment DERMADIS SA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: KUNDIG, CHRISTOPH, DEPERTHES, DAVID, DERAISON, CELINE, HOVNANIAN, ALAIN
Publication of US20110130338A1 publication Critical patent/US20110130338A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/49—Urokinase; Tissue plasminogen activator
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/4826—Trypsin (3.4.21.4) Chymotrypsin (3.4.21.1)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/484—Plasmin (3.4.21.7)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/4853—Kallikrein (3.4.21.34 or 3.4.21.35)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/482—Serine endopeptidases (3.4.21)
    • A61K38/486—Elastase (3.4.21.36 or 3.4.21.37)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/55—Protease inhibitors
    • A61K38/57—Protease inhibitors from animals; from humans
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/04—Antipruritics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/10—Anti-acne agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C12Q1/37—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving peptidase or proteinase
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/502—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing non-proliferative effects
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
    • A61K2800/74—Biological properties of particular ingredients
    • A61K2800/78—Enzyme modulators, e.g. Enzyme agonists
    • A61K2800/782—Enzyme inhibitors; Enzyme antagonists
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/948—Hydrolases (3) acting on peptide bonds (3.4)
    • G01N2333/95—Proteinases, i.e. endopeptidases (3.4.21-3.4.99)
    • G01N2333/964—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue
    • G01N2333/96425—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals
    • G01N2333/96427—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general
    • G01N2333/9643—Proteinases, i.e. endopeptidases (3.4.21-3.4.99) derived from animal tissue from mammals in general with EC number
    • G01N2333/96433—Serine endopeptidases (3.4.21)
    • G01N2333/96441—Serine endopeptidases (3.4.21) with definite EC number
    • G01N2333/96455—Kallikrein (3.4.21.34; 3.4.21.35)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/04—Screening involving studying the effect of compounds C directly on molecule A (e.g. C are potential ligands for a receptor A, or potential substrates for an enzyme A)

Definitions

  • This invention relates to therapeutic compounds which are inhibitors of serine proteases, to pharmaceutical compositions thereof and to their use in the treatment of the human or animal body. More specifically, the present invention relates to a method for the treatment, diagnosis or prognosis of skin diseases comprising the administration to a subject in need thereof of a therapeutically effective amount of a Serine protease inhibitor.
  • Proteases or proteolytic enzymes are essential in organisms, from bacteria and viruses to mammals. Proteases digest and degrade proteins by hydrolyzing peptide bonds. Serine proteases (EC. 3.4.21) have common features in the active site, primarily an active serine residue. There are two main types of serine proteases; the chymotrypsin/trypsin/elastase-like and subtilisin-like, which have an identical spatial arrangement of catalytic His, Asp, and Ser but in quite different protein scaffolds. However, over twenty families (S1-S27) of serine proteases have been identified that are grouped into 6 clans on the basis of structural similarity and other functional evidence, SA, SB, SC, SE, SF & SG.
  • the family of chymotrypsin/trypsin/elastase-like serine proteases have been subdivided into two classes.
  • the “large” class (ca 230 residues) includes mostly mammalian enzymes such as trypsin, chymotrypsin, elastase, kallikrein, and thrombin.
  • the “small” class (ca 190 residues) includes the bacterial enzymes.
  • the catalytic His, Asp and Ser are flanked by substrate amino acid side chain residue binding pockets termed S1′, S2′, S3′ etc on the C-terminal or ‘prime’ side of the substrate and S1, S2, S3 etc on the N-terminal side.
  • This nomenclature is as described in Structure and Mechanism in Protein Science: A Guide to Enzyme Catalysis and Protein Folding, Alan Fersht, 1999 (W.H. Freeman and Company) pages 40-43 and Brik et al, Org. Biomol. Chem., 2003, 1, 5-14.
  • the chymotrypsin/trypsin/elastase-like serine proteases can also be further subdivided by the residues present in the S1 pocket as described in Introduction to Protein Structure, Carl Branden and John Tooze, 1991 (Garland Publishing Inc) pages 231-241.
  • the subdivisions are chymotrypsin-like (Gly-226, Ser-189 and Gly-216 in S1 pocket), trypsin-like (Gly-226, Asp-189 and Gly-216 in S1) and elastase-like (Val-226 and Thr-216 in S1) where the residues numbering is taken from the standard chymotrypsin numbering.
  • the trypsin-like serine proteases prefer substrates which place either Lys or Arg in the S1 pocket.
  • the serine proteases have a common catalytic mechanism characterized by a particularly reactive Ser residue at position 195 using the chymotrypsin numbering system.
  • serine proteases include trypsin, tryptase, chymotrypsin, elastase, thrombin, plasmin, kallikrein, Complement C1, acrosomal protease, lysosomal protease, cocoonase, ⁇ -lytic protease, protease A, protease B, serine carboxypeptidase t, subtilisin, urokinase (uPA), Factor Vila, Factor IXa, and Factor Xa.
  • the serine proteases have been investigated extensively for many years and are a major focus of research as a drug target due to their role in regulating a wide variety of physiological processes.
  • Processes involving serine proteases include coagulation, fibrinolysis, fertilization, development, malignancy, neuromuscular patterning and inflammation. It is well known that these compounds inhibit a variety of circulating proteases as well as proteases that are activated or released in tissue. It is also known that serine protease inhibitors inhibit critical cellular processes, such as adhesion, migration, free radical production and apoptosis. In addition, animal experiments indicate that intravenously administered serine protease inhibitors, variants or cells expressing serine protease inhibitors, provide protection against tissue damage.
  • KLK5 and 7 were originally isolated and cloned from the stratum corneum (Hansson et al., 1994; Brattsand and Egelrud, 1999) and were shown to be involved in skin desquamation through processing of extracellular adhesive proteins of the corneodesmosomes, i.e. corneodesmosin (CDSN), desmoglein 1 (DSG1), and desmocollin 1 (DSC1) (Caubet et al., 2004; Descargues et al., 2005).
  • CDSN corneodesmosin
  • DSG1 desmoglein 1
  • DSC1 desmocollin 1
  • KLK5 was shown to cleave all three components, while KLK7 was able to digest only CDSN and DSC1 (Caubet et al., 2004). Further IHC studies supported the proposed role of KLK7 in desquamation (Sondell et al., 1995). In-vitro studies demonstrated an potential activation mechanism of KLK7 through a proteolytic cascade, involving KLK5, and 14 (Brattsand et al., 2005).
  • KLK14 is believed to play a major role in skin remodeling as it contributes to approximately half of the total trypsin-like proteolytic activity in the SC layer (Stefansson et al., 2006).
  • KLK8 is suggested to play an overlapping function in skin desquamation processing DSG1 and CDSN (Kishibe et al., 2006).
  • An additional antimicrobial function KLKs in skin through the regulation of cathelicidin peptides was shown in vitro and in vivo (Yamasaki et al., 2006).
  • KLKs The expression of multiple KLKs is significantly upregulated in psoriasis, atopic dermatitis, peeling skin syndrome type-B, and chronic lesions of atopic dermatitis ( Komatsu et al., 2005b; Komatsu et al., 2006; Hansson et al., 2002).
  • LEKTI being a serine protease inhibitor with activity against several KLKs, including KLK5, 6, 7, 13, and 14 (Borgono et al., 2006; Egelrud et al., 2005; Deraison et al., 2007).
  • KLK5 serine protease inhibitor with activity against several KLKs, including KLK5, 6, 7, 13, and 14
  • PARs 1-4 are G protein-coupled receptors, activated by various proteases including kallikreins.
  • PAR2 is of special interest, as it is activated by trypsin cleavage and is co-localized with tissue kallikreins in skin tissue. In skin lesions from atopic dermatitis and Netherton syndrome patients, PAR2 receptors were found overexpressed and co-localized with human tissue kallikreins (Descargues et al., 2006). This lead to the hypothesis that such a KLK-PAR pathway is involved in the pathogenesis of these diseases and that KLKs induce inflammation in these skin disorders via PAR2 activation.
  • PAR2 receptors are attractive research targets for dermatologists and cosmeticians due to implication in skin inflammation, cell proliferation, tumor suppression, skin pigmentation, and skin moisture.
  • kallikreins are of increasing interest to researchers investigating the above-mentioned skin processes.
  • Natural non-denatured soybean-derived trypsin inhibitors are used as ingredients of cosmetic products targeting skin pigmentation, UV exposure, and skin moisture.
  • Soybean-derived soy seeds and soymilk contain soybean trypsin inhibitor (STI) and Bowman-Birk inhibitor (BBI), respectively (Paine et al., 2001). The desired effects of these products are attributed to trypsin inhibition leading to blockade of PAR2 activation.
  • STI soybean trypsin inhibitor
  • BBI Bowman-Birk inhibitor
  • KLK5 and KLK7 have been shown to be overexpressed under UVB irradiation concomitantly to a decrease of LEKTI expression, suggesting a contribution of these skin kallikreins in stratum corneum desquamation under UVB stress (Nin M et al., 2008).
  • STI reduces UV light-induced skin cancer, as topical application of STI halts tumor progression in mice exposed to UVB for long periods (Huang et al., 2004). It is suggested that products containing natural soybean extracts block PAR2 activation by kallikrein inhibition. STI has been proven to inhibit trypsin-like KLK5 and 14 with high efficiency (Brattsand et al., 2005). Reduced KLK5 and 7 expression in the upper SC of dry skin and elevated KLK activity following UV radiation have been reported (Voegeli et al., 2007).
  • Serine protease inhibitors have also been predicted to have potential beneficial uses in the treatment of disease a wide variety of clinical areas such as oncology, neurology, hematology, pulmonary medicine, immunology, inflammation and infectious disease. Serine protease inhibitors may also be beneficial in the treatment of thrombotic diseases, asthma, emphysema, cirrhosis, arthritis, carcinoma, melanoma, restenosis, atheroma, trauma, shock and reperfusion injury. A useful review is found in Expert Opin. Ther. Patents (2002), 12(8). Serine protease inhibitors are disclosed in US published patent applications US 2003/0100089 and 2004/0180371 and in U.S. Pat. Nos. 6,784,182, 6,656,911, 6,656,910, 6,608,175, 6,534,495 and 6,472,393.
  • Skin diseases such as contact hypersensitivity, atopic dermatitis, rare genetic skin diseases (e.g. Netherton syndrome) and psoriasis are characterized by hyperproliferative and inflammatory skin reactions. A large population suffers from these diseases. For example, atopic dermatitis, a hereditary chronic disease of the skin, affects approximately 8 million adults and children in the United States. It is believed that a combination of multiple factors including genetic, environmental, and immunological factors may cause skin diseases. Although most skin diseases are not fatal, they significantly affect quality of life of those who suffer from the diseases.
  • steroid-containing ointment or anti-histamine agents for treating skin diseases frequently cause considerable side effects.
  • steroids of external or oral application make the skin layer thin, cause osteoporosis, and inhibit growth in children upon long-term use. It was also observed that the termination of steroid application is often followed by lesion recurrence.
  • the present invention provides an improved and reliable method for the treatment, diagnosis or prophylaxis of skin diseases comprising the administration to a subject in need thereof of a therapeutically effective amount of a Serine protease inhibitor.
  • the present invention concerns a method of treating or preventing as skin disease comprising administering to a mammal a pharmaceutical composition comprising a recombinant Serine protease inhibitor.
  • Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.
  • Another object of the invention is a kit for treating or preventing as skin disease comprising a pharmaceutical composition of a recombinant Serine protease inhibitor.
  • FIG. 1 represents the DNA and protein sequences of hK2 protease inhibitor MD 820
  • FIG. 2 represents the DNA and protein sequences of hK2 protease inhibitor MD 62
  • FIG. 3 represents the DNA and protein sequences of hK2 protease inhibitor MD 83
  • FIG. 4 represents the DNA and protein sequences of hK2 protease inhibitor MD 67
  • FIG. 5 represents the DNA and protein sequences of hK2 protease inhibitor MD 61
  • FIG. 6 represents the DNA and protein sequences of hK2 protease inhibitor MD 518
  • FIG. 7 represents the DNA and protein sequences of hK2 protease inhibitor MDCI
  • FIG. 8 represents the DNA and protein sequences of ACT-wildtype.
  • FIG. 9 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1.
  • FIG. 10 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G1G
  • FIG. 11 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11.
  • FIG. 12 represents the DNA and protein sequences of hK14 protease inhibitor ACT-C11G.
  • FIG. 13 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E5.
  • FIG. 14 represents the DNA and protein sequences of hK14 protease inhibitor ACT-E8.
  • FIG. 15 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F11.
  • FIG. 16 represents the DNA and protein sequences of hK14 protease inhibitor ACT-F3.
  • FIG. 17 represents the DNA and protein sequences of hK14 protease inhibitor ACT-G9.
  • FIG. 18 represents the DNA and protein sequences of AAT-wildtype.
  • FIG. 19 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1.
  • FIG. 20 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1G
  • FIG. 21 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11.
  • FIG. 22 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11G.
  • FIG. 23 represents the DNA and protein sequences of hK14 protease inhibitor AAT
  • FIG. 24 represents the DNA and protein sequences of hK14 protease inhibitor AAT-E8.
  • FIG. 25 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F11.
  • FIG. 26 represents the DNA and protein sequences of hK14 protease inhibitor AAT-F3.
  • FIG. 27 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G9.
  • FIG. 28 represents the DNA and protein sequences of hK14 protease inhibitor AAT-G1V.
  • FIG. 29 represents the DNA and protein sequences of hK14 protease inhibitor AAT-C11D.
  • FIG. 30 shows the grading system for skin lesions on transgeninc hKLK5 mouse Netherton Model.
  • FIG. 31 shows the skin lesion size development on Netherton Syndrom mouse model. Monitoring of lesion sizes and lesion grade after 1, 15 and 28 days of topical application of 2% Natrosol (group 1, control) or MDPK67b in 2% Natrosol (group 2).
  • the present invention relates to the use of a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.
  • Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said medicament.
  • serine proteases of the chymotrypsin superfamily including t-PA, plasmin, u-PA and the proteases of the blood coagulation cascade are large molecules that contain, in addition to the serine protease catalytic domain, other structural domains responsible in part for regulation of their activity (Barrett, 1986; Gerard et al, 1986; Blasi et al., 1986).
  • serine proteases include trypsin-like enzymes, such as trypsin, tryptase, thrombin, kallikrein, and factor Xa.
  • the serine protease targets are associated with processes such as blood clotting; complement mediated lysis, the immune response, glomerulonephritis, pain sensing, inflammation, pancreatitis, cancer, regulating fertilization, bacterial infection and viral maturation.
  • processes such as blood clotting; complement mediated lysis, the immune response, glomerulonephritis, pain sensing, inflammation, pancreatitis, cancer, regulating fertilization, bacterial infection and viral maturation.
  • Serine proteinase inhibitors comprise a diverse group of proteins that form a superfamily already including more than 100 members, from such diverse organisms as viruses, plants and humans. Serpins have evolved over 500 million years and diverged phylogenetically into proteins with inhibitory function and non-inhibitory function (Hunt and Dayhoff, 1980). Non-inhibitory serpins such as ovalbumin lack protease inhibitory activity (Remold-O'Donnell, 1993). The primary function of serpin family members appears to be neutralizing overexpressed serine proteinase activity (Potempa et al., 1994). Serpins play a role in extracellular matrix remodeling, modulation of inflammatory response and cell migration (Potempa et al., 1994).
  • Serine protease inhibitors are divided into the following families: the bovine pancreatic trypsin inhibitor (Kunitz) family, also known as basic protease inhibitor (Ketcham et al., 1978); the Kazal family; the Streptomyces subtilisin inhibitor family; the serpin family; the soybean trypsin inhibitor (Kunitz) family; the potato inhibitor family; and the Bowman-Birk family (Laskowski et al., 1980; Read et al., 1986; Laskowski et al., 1987).
  • Serine protease inhibitors belonging to the serpin family include the plasminogen activator inhibitors PAI-1, PAI-2 and PAI-3, Cl esterase inhibitor, alpha-2-antiplasmin, contrapsin, alpha-1-antitrypsin, antithrombin III, protease nexin I, alpha-1-antichymotrypsin, protein C inhibitor, heparin cofactor II and growth hormone regulated protein (Carrell et al., 1987; Sommer et al., 1987; Suzuki et al., 1987; Stump et al., 1986).
  • serine protease inhibitors have a broad specificity and are able to inhibit both the chymotrypsin superfamily of proteases, including the blood coagulation serine proteases, and the Streptomyces subtilisin superfamily of serine proteases (Laskowski et al., 1980).
  • the inhibition of serine proteases by serpins has been reviewed in Travis et al. (1983); Carrell et al. (1985); and Sprengers et al. (1987).
  • Crystallographic data are available for a number of intact inhibitors including members of the BPTI, Kazal, SSI, soybean trypsin and potato inhibitor families, and for a cleaved form of the serpin alpha-1-antitrypsin (Read et al., 1986).
  • these serine protease inhibitors are proteins of diverse size and sequence
  • the intact inhibitors studied to date all have in common a characteristic loop, termed the reactive site loop, extending from the surface of the molecule that contains the recognition sequence for the active site of the cognate serine protease (Levin et al., 1983).
  • the structural similarity of the loops in the different serine protease inhibitors is remarkable (Papamokos et al., 1982).
  • each inhibitor is thought to be determined primarily by the identity of the amino acid that is immediately amino-terminal to the site of potential cleavage of the inhibitor by the serine protease. This amino acid, known as the Pi site residue, is thought to form an acyl bond with the serine in the active site of the serine protease (Laskowski et al., 1980). Whether or not a serpin possesses inhibitory function depends strongly on the consensus sequence located in the hinge region of the reactive site loop near the carboxy-terminus of the coding region. Outside of the reactive site loop, the serine protease inhibitors of different families are generally unrelated structurally, although the Kazal family and Streptomyces subtilisin family of inhibitors display some structural and sequence similarity.
  • protein As used herein, the terms “protein”, “polypeptide”, “polypeptidic”, “peptide” and “peptidic” or “peptidic chain” are used interchangeably herein to designate a series of amino acid residues connected to the other by peptide bonds between the alpha-amino and carboxy groups of adjacent residues.
  • the Serine protease inhibitor is a recombinant Serine protease inhibitor and is selected from the group comprising the SEQ ID No 2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.
  • the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID No 39 to 59 or a biologically active fragment thereof having a Serine protease inhibitor activity.
  • amino acid residue means any amino acid residue known to those skilled in the art. This encompasses naturally occurring amino acids (including for instance, using the three-letter code, Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr, Val), as well as rare and/or synthetic amino acids and derivatives thereof (including for instance Aad, Abu, Acp, Ahe, Aib, Apm, Dbu, Des, Dpm, Hyl, McLys, McVal, Nva, and the like).
  • Said amino acid residue or derivative thereof can be any isomer, especially any chiral isomer, e.g. the L- or D-isoform.
  • amino acid derivative we hereby mean any amino acid derivative as known in the art.
  • amino acid derivatives include residues derivable from natural amino acids bearing additional side chains, e.g. alkyl side chains, and/or heteroatom substitutions.
  • Bioly active fragments refer to sequences sharing at least 40% amino acids in length with the respective sequence of the substrate active site. These sequences can be used as long as they exhibit the same properties as the native sequence from which they derive. Preferably these sequences share more than 70%, preferably more than 80%, in particular more than 90% amino acids in length with the respective sequence the substrate active site.
  • the present invention also includes variants of a Serine protease inhibitor sequence.
  • variants refer to polypeptides having amino acid sequences that differ to some extent from a native sequence polypeptide that is amino acid sequences that vary from the native sequence by conservative amino acid substitutions, whereby one or more amino acids are substituted by another with same characteristics and conformational roles.
  • the amino acid sequence variants possess substitutions, deletions, and/or insertions at certain positions within the amino acid sequence of the native amino acid sequence.
  • Conservative amino acid substitutions are herein defined as exchanges within one of the following five groups:
  • administering refers to contact of a pharmaceutical, therapeutic, diagnostic agent or composition, to the subject, preferably a human.
  • kallikrein relates to glandular or tissue kallikreins. Glandular or tissue kallikreins are a sub-family of serine proteases, with a high degree of substrate specificity and diverse expression in various tissues and biological fluids.
  • the term “kallikrein” appeared in the literature for the first time in the 1930s, when large amounts of protease enzymes were found in pancreas isolates (pancreas is “Kallikreas” in Greek) (Kraut et al. 1930, Werle 1934).
  • kallikrein enzymes are divided into two groups, plasma and tissue kallikreins, which differ significantly in their molecular weight, substrate specificity, immunological characteristics, gene structure, and type of the kinin released.
  • Kallikreins comprise a family of 15 homologous single chain, secreted serine endopeptidases of ⁇ 25-30 kDa, with orthologues present in species from at least six mammalian orders. These kallikreins are hK2, hK3, hK2, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 and hK15.
  • kallikreins to be inhibited are selected from the group comprising hK2, hK5, hK7, and hK14.
  • Disease refers to a pathological condition of a part, organ, or system of an organism resulting from various causes, such as infection, genetic defect, or environmental stress, and characterized by an identifiable group of signs or symptoms.
  • the epidermis has been shown to express several serine proteases including kallikrein, urokinase, plasmin, typtase-like and neutrophile elastase enzymes. These serine proteases are involved in multiple activities in the skin including epidermal cell proliferation, cell differentiation, skin and lipid barrier homeostasis and tissue remodelling. Most importantly, proteolysis of stratum corneum (SC) corneodesmosomes by serine proteases together with other enzymes is a crucial event prior to shedding of the outermost skin layer, called desquamation. Furthermore, increased protease activity, including kallikrein, plasmin and urokinase enzymes are implicated in inflammatory reactions of the skin. A list with inflammatory skin diseases is shown in TABLE XX.
  • Increased protease activity was also observed as stress response to various stimuli including environmental factors as ultraviolet radiation exposure and temperature changes or as reaction to different surfactants.
  • kallikreins notably hK5, hK7 and hK14 have been implicated in the proteolytic cascade in skin desquamation. This proteolytic process is controlled through a complex inhibition and activation process and its deregulation can cause serious skin disorders. Rare genetic diseases (Netherton Syndrome, peeling skin syndrome) as well as more common skin diseases like atopic dermatitis or psoriasis are characterized by increased desquamation of the skin caused at least in part by an increased kallikrein activity.
  • the present invention also relates to the use of a Serine protease in the preparation of a cosmetic or cosmeceutical agent for the treatment or improvement of an undesirable skin condition.
  • Biologically active fragments of a Serine protease inhibitor are also useful in the preparation of said cosmetic or cosmeceutical agent.
  • An undesirable skin condition refers, in the present invention, to a problem affecting the skin or the appearance of the skin which might not always be considered as a disease.
  • Cosmetics are compositions used to enhance or protect the appearance of the human skin.
  • Cosmetics include skin-care creams, lotions, powders, perfumes, lipsticks, fingernail and toenail polishes, eye and facial makeup, permanent waves, hair colors, hair sprays and gels, deodorants, baby products, bath oils, bubble baths, bath salts, butters and many other types of products.
  • Cosmeceuticals are cosmetic products that are thought to have drug-like benefits. Examples of products typically labeled as cosmeceuticals include anti-aging creams and moisturizers. Cosmeceuticals may contain purported active ingredients such as vitamins, phytochemicals, enzymes, antioxidants, and essential oils.
  • Skin disease relates to conditions affecting the skin.
  • the skin disease is selected from Table XX.
  • the invention is suitable for treatment of skin diseases, such as atopic dermatitis, contact dermatitis (allergy), contact dermatitis (irritant), eczema, psoriasis, acne, epidermal hyperkeratosis, acanthosis, epidermal inflammation, dermal inflammation or pruritus, rosacea, netherton syndrome, peeling skin syndrome type A and B, hereditary ichtyosis, hidradenitis suppurativa and erythroderma (generalized exfoliative dermatitis).
  • the skin disease is selected from the group comprising Netherton syndrome, Atopic dermatitis, Psoriasis and Peeling Skin Syndrome.
  • Netherton syndrome is a rare autosomal recessive genodermatosis caused by mutations in SPINK5 (LEKTI) one of the major inhibitor of the skin kallikrein cascade. Increased kallikrein activities have been shown to be causative for its clinical symptoms.
  • NS a multisystem ichthyosiform syndrome, is characterized by ichthyosis, erythroderma, hair shaft defects and atopic features. Multiple infections due to the seriously impaired barrier function of the skin are very common.
  • NS is very rare, but little data on frequency is available, probably in part due to the difficulty to identify NS.
  • Treatment options are very limited and non-curative. They concentrate mainly on management of the various cutaneous infections and reduction of itching and pain (e.g. corticosteroid).
  • Excessive kallikrein activity (hK5, hK7, hK14) was proven causative for symptoms of the skin disorder. Decreased activity of the natural kallikrein inhibitor (LEKTI) could be replaced by alternative kallikrein inhibitors.
  • Applicants have shown, e.g. in example 4, that the application of Serine protease inhibitors including MD67 (SEQ ID No 8) mouse model (orthotopic hK5 overexpressing) considerably decreased the severity of the symptoms, which were observed in the untreated skin disease (e.g. NS) models.
  • the symptoms are characterized by severe peeling of the skin, due to premature desmosomal protein degradation resulting in splitting of corneodesmosomes and stratum corneum detachment. This causes a severe loss of skin barrier functions leading to severe dehydratation, erythema and intense scratching.
  • Atopic dermatitis is a pruritic disease of not well defined origin that usually starts in early infancy and is typified by itching, eczematous lesions and dry, thick skin. AD is associated with other atopic diseases (eg, asthma, allergic reactions in about 30% of patients) and cutaneous infections are common.
  • AD The pathophysiology of AD is poorly understood. There appears to be a genetic component. An immune defect involving an abnormality of TH2 cells is suggested and a dysregulation of protease activity was found to be involved in the disease. This dysregulation is believed to cause a defective barrier function in the stratum corneum leading to the entry of antigens, which results in the production of various inflammatory cytokines.
  • the prevalence rate in US is 10-12% in children and 0.9% in adults. In other developed countries the prevalence rate is as high as 18% and is rising, especially in developed countries. The disease is chronic, but the majority of patients improve from childhood to adult age.
  • Psoriasis is a chronic disease, it is noncontagious and commonly appears as inflamed, edematous skin lesions, but also occurs on the oral mucosa. Joints (arthritis) also are affected in 10% of patients. Flares are related to various systemic and environmental factors including stress events or infections. There is a genetic predisposition for psoriasis and there is mounting evidence for signs of an autoimmune disorder. Increased protease (e.g. kallikrein) activity is involved in the typical excessive desquamation of the skin. In the US 2 to 3% of the population are affected and over 200′000 new cases occur annually.
  • protease e.g. kallikrein
  • “Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, monkeys etc. Preferably, the mammal is human.
  • Treatment refers to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Hence, the mammal to be treated herein may have been diagnosed as having the disorder or may be predisposed or susceptible to the disorder.
  • subject refers to patients of human or other mammal and includes any individual it is desired to examine or treat using the methods according to the present invention. However, it will be understood that “patient” does not automatically imply that symptoms or diseases are present.
  • phrases “pharmaceutically acceptable” refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human.
  • protease refers to a class of enzymes which recognizes a molecule and cleaves an activation sequence in the molecule.
  • the protease can be an endopeptidase which cleaves internal peptide bonds.
  • the protease can be an exopeptidase which hydrolyzes the peptide bonds from the N-terminal end or the C-terminal end of the polypeptide or protein molecule. The protease folds into a conformation to form a catalytic site which receives and cleaves the activation sequence.
  • “Inhibitors” refer to a polypeptide, or a chemical compound, that specifically inhibit the function of a kallikrein or serine protease by, preferably, binding to said kallikrein or serine protease.
  • Reactive Serpin Loop or “Reactive Site Loop” or RSL refers to an exposed flexible reactive-site loop found in serpin and which is implicated in the interaction with the putative target protease. From the residue on the amino acid side of the scissile bond, and moving away from the bond, residues are conventionally called P1, P2, P3, etc. Residues that follow the scissile bond are called P1′, P2′, P3′, etc. Usually, the RSL is composed of 6 to 12 amino acid residues.
  • Serine protease inhibitors can be selected from the group comprising the ⁇ -1antichymotrypsin (ACT), protein C inhibitor (PCI), ⁇ -1 antiproteinase (AAT), human ⁇ -1 antitrypsin-related protein precursor (ATR), ⁇ -2-plasmin inhibitor (AAP), human anti-thrombin-III precursor (ATIII), protease inhibitor 10 (PI10), human collagen-binding protein 2 precursor (CBP2), protease inhibitor 7 (PI7), protease inhibitor leuserpin 2 (HLS2), human plasma protease C1 inhibitor (C1 INH), monocyte/neutrophil elastase inhibitor (M/NEI), plasminogen activator inhibitor-3 (PAI3), protease inhibitor 4 (PI4), protease inhibitor 5 (PI5), protease inhibitor 12 (PI12), human plasminogen activator inhibitor-1 precursor endothelial (PAI-1), human plasminogen activator inhibitor-2 placen
  • ACT ⁇ -1antichy
  • the serine protease inhibitor of the invention may be a serine protease trypsin-like enzyme and preferably a Kallikrein inhibitor.
  • Kallikrein inhibitors of the invention are selected amongst hK2, hK3, hK4, hK5, hK6, hK7, hK8, hK9 hK10, hK11, hK12, hK13, hK14 or hK15 inhibitors.
  • kallikreins inhibitors are selected among hK2, hK5, hK7, and hK14 inhibitors.
  • the kallikrein inhibitor is an inhibitor directed against hK2, said inhibitor can be selected among those disclosed in International Patent Application PCT/IB2004/001040, which content is incorporated herein by reference in its entirety.
  • the kallikrein inhibitor of the invention may be selected from the group comprising MD820, MD62, MD61, MD67 and MDCI. Most preferably this inhibitor is MD67.
  • This application discloses a recombinant inhibitor protein of a protease comprising an inhibiting polypeptidic sequence and at least one polypeptidic sequence of a substrate-enzyme interaction site specific for a protease as well as a method for producing the recombinant inhibitor protein of a protease.
  • the recombinant Serine protease inhibitor is selected from the group comprising the SEQ ID No 2, 4, 6, 8, 10, 12 and 14 or a biologically active fragment thereof having a Serine protease inhibitor activity.
  • inhibitor proteins have been obtained by modifying the RSL of ⁇ 1-antichymotrypsin (rACT), which is known to inhibit a large panel of human enzymes such as chymotrypsin, mast cell chymase, cathepsin G, prostatic kallikreins hK2 and PSA (hK3), in order to change the specificity of this serpin.
  • rACT ⁇ 1-antichymotrypsin
  • Peptide sequences selected as substrates for the enzyme hK2 by phage display technology as explained in International Patent Application PCT/IB2004/001040, have been used to replace the scissile bond and neighbour amino acid residues of the RSL.
  • recombinant inhibitors were produced in bacteria and purified by affinity chromatography.
  • said kallikrein inhibitor is an inhibitor directed against hK14
  • said inhibitor can be selected among those disclosed in the International Patent Application PCT/IB2005/000504, which content is incorporated herein by reference in its entirety.
  • said recombinant inhibitor may be selected from the group comprising AAT G1 , AAT G1G , AAT C11 , AAT C11G , AAT E5 , AAT E8 , AAT F11 , AAT F3 , AAT G9 , ACT G1 , AcT G1G , ACT C11 , ACT C11G , ACT E5 , ACT E8 , ACT F11 , ACT F3 , ACT G9 , ACT G1V , ACT WT and ACT C11D .
  • said inhibitor protein of an hK14 protease is AAT G1 , AAT G1G , AAT C11 , AAT C11G , AAT E5 , AAT E8 , AAT F3 , AAT G9 , ACT G1G , ACT C11 , ACT C11G , ACT E5 , ACT E8 , AGT F11 , ACT F3 , ACT G9 , ACT G1V , or ACT C11D .
  • This application discloses a recombinant inhibitor protein of an hK14 protease having an inhibiting polypeptidic sequence and at least a polypeptidic sequence of a substrate-enzyme interaction site specific for said hK14 protease.
  • said recombinnat inhibitor protein of an hK14 protease has, under physiological conditions,
  • the inhibiting polypeptidic sequence of the protease inhibitor may also be selected from a cysteine protease since there are now a number of well-documented instances of inhibition of cysteine proteases by serpins (Gettins P. G. W., 2002 “Serpin structure, mechanism, and function” in Chem. Rev, 102, 4751-4803).
  • Examples include inhibition of cathepsins K, L and S by the serpin squamous cell carcinoma antigenl, inhibition of prohormone thiol proteinase by the ⁇ -1 antichymotrypsin, and inhibition of members of the caspase family, including caspase 1 (interleukine 1 ⁇ converting enzyme), caspase 3, and caspase 8 by the viral serpin crmA and caspases 1, 4 and 8 by the human serpin PI9.
  • caspase 1 interleukine 1 ⁇ converting enzyme
  • caspase 3 caspase 8 by the viral serpin crmA and caspases 1, 4 and 8 by the human serpin PI9.
  • the serine protease inhibitor is a recombinant inhibitor protein.
  • recombinant techniques are employed to prepare a Serine protease inhibitor, nucleic acid molecules or fragments thereof encoding the polypeptides are preferably used.
  • the present invention also relates to a purified and isolated DNA sequence encoding the Serine protease inhibitor as described above.
  • a purified and isolated DNA sequence refers to the state in which the nucleic acid molecule encoding the recombinnat inhibitor protein of a protease of the invention, or nucleic acid encoding such recombinnat inhibitor protein of a protease will be, in accordance with the present invention.
  • Nucleic acid will be free or substantially free of material with which it is naturally associated such as other polypeptides or nucleic acids with which it is found in its natural environment, or the environment in which it is prepared (e.g. cell culture) when such preparation is by recombinant DNA technology practised in vitro or in vivo.
  • DNA which can be used herein is any polydeoxynucleotide sequence, including, e.g. double-stranded DNA, single-stranded DNA, double-stranded DNA wherein one or both strands are composed of two or more fragments, double-stranded DNA wherein one or both strands have an uninterrupted phosphodiester backbone, DNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded DNA wherein the DNA strands are fully complementary, double-stranded DNA wherein the DNA strands are only partially complementary, circular DNA, covalently-closed DNA, linear DNA, covalently cross-linked DNA, cDNA, chemically-synthesized DNA, semi-synthetic DNA, biosynthetic DNA, naturally-isolated DNA, enzyme-digested DNA, sheared DNA, labeled DNA, such as radiolabeled DNA and fluorochrome-labeled DNA, DNA containing one or more non-naturally
  • DNA sequences that encode the Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity can be synthesized by standard chemical techniques, for example, the phosphotriester method or via automated synthesis methods and PCR methods.
  • the purified and isolated DNA sequence encoding the Serine protease inhibitor according to the invention may also be produced by enzymatic techniques.
  • restriction enzymes which cleave nucleic acid molecules at predefined recognition sequences can be used to isolate nucleic acid sequences from larger nucleic acid molecules containing the nucleic acid sequence, such as DNA (or RNA) that codes for the recombinnat inhibitor protein or for a fragment thereof.
  • RNA polyribonucleotide
  • RNA RNA
  • RNA polyribonucleotide
  • RNA including, e.g., single-stranded RNA, double-stranded RNA, double-stranded RNA wherein one or both strands are composed of two or more fragments, double-stranded RNA wherein one or both strands have an uninterrupted phosphodiester backbone, RNA containing one or more single-stranded portion(s) and one or more double-stranded portion(s), double-stranded RNA wherein the RNA strands are fully complementary, double-stranded RNA wherein the RNA strands are only partially complementary, covalently crosslinked RNA, enzyme-digested RNA, sheared RNA, mRNA, chemically-synthesized RNA, semi-synthetic RNA, biosynthetic RNA, naturally-isolated RNA, labeled RNA, such as radiolabeled RNA and fluorochrome
  • the purified and isolated DNA sequence encoding a Serine protease inhibitor is preferably selected from the group comprising SEQ ID No 1, SEQ ID No 3, SEQ ID No 5, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11, SEQ ID No 13, SEQ ID No 16 to SEQ ID No 37.
  • the present invention also includes variants of the aforementioned sequences, that is nucleotide sequences that vary from the reference sequence by conservative nucleotide substitutions, whereby one or more nucleotides are substituted by another with same characteristics.
  • Also encompassed in the present invention is the use of a purified and isolated DNA sequence encoding a Serine protease inhibitor in the preparation of a medicament for the treatment of a skin disease.
  • the Kallikrein inhibitors or the serine protease inhibitors of the invention comprise a detectable label or bind to a detectable label to form a detectable complex.
  • Detectable labels are detectable molecules or detection moiety for diagnostic purposes, such as enzymes or peptides having a particular binding property, e.g. streptavidin or horseradish peroxidase. Detection moiety further includes chemical moieties such as biotin which may be detected via binding to a specific cognate detectable moiety, e.g. labelled avidin.
  • detectable labels include fluorescent labels and labels used conventionally in the art for MRI-CT imagine.
  • fluorescent materials are known and can be utilized as labels. These include, for example, fluorescein, rhodamine, auramine, Texas Red, AMCA blue and Lucifer Yellow.
  • the Kallikrein inhibitors or the serine protease inhibitors of the invention may carry a radioactive label as the detection moiety, such as the isotopes 3H, 14C, 32P, 35S, 36Cl, 51Cr, 57Co, 58Co, 59Fe, 90Y, 121I, 124I, 125I, 131I, 111In, 211At, 198Au, 67Cu, 225Ac, 213bu, 99Tc and 186Re.
  • radioactive labels When radioactive labels are used, known currently available counting procedures may be utilized to identify and quantitate the specific binding members.
  • detection may be accomplished by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques known in the art.
  • the radioactive labels are useful in in vitro diagnostics techniques, ex vivo and in in vivo radioimaging techniques.
  • the radioactive labels are useful in radioimmuno-guided surgery techniques, wherein they can identify and indicate the presence and/or location of cancer cells, precancerous cells, tumor cells, and hyperproliferative cells, prior to, during or following surgery to remove such cells.
  • the labels of the present invention may be conjugated to an imaging agent rather than a radioisotope(s), including but not limited to a magnetic resonance image enhancing agent.
  • imaging agent rather than a radioisotope(s), including but not limited to a magnetic resonance image enhancing agent.
  • chelating groups include EDTA, porphyrins, polyamines crown ethers and polyoximes.
  • paramagnetic ions examples include gadolinium, iron, manganese, rhenium, europium, lanthanium, holmium and erbium.
  • the present invention is also directed to a pharmaceutical composition
  • a pharmaceutical composition comprising the serine protease inhibitor as described herein as an active agent, optionally in combination with one or more pharmaceutically acceptable carriers.
  • the composition as a pharmaceutical composition, according to the invention is to be administered to a patient in need of treatment via any suitable route, usually by injection into the bloodstream or CSF, or directly into the site of the disease, or close to this site.
  • the precise dose will depend upon a number of factors, including whether the composition is for diagnosis, prognosis, prophylaxis of or for treatment, the size and location of, for example, desquamation, the precise nature of the composition, and the nature of the detectable or functional label attached to the Kallikrein inhibitor or the serine protease inhibitor.
  • the present pharmaceutical composition comprises as an active substance a pharmaceutically effective amount of the composition as described, optionally in combination with pharmaceutically acceptable carriers, diluents and adjuvants.
  • a pharmaceutically effective amount refers to a chemical material or compound which, when administered to a human or animal organism induces a detectable pharmacological and/or physiologic effect.
  • the pharmaceutically effective amount of a dosage unit of the polypeptide usually is in the range of 0.001 ng to 100 ⁇ g per kg of body weight of the patient to be treated.
  • the pharmaceutical composition may contain one or more pharmaceutically acceptable carriers, diluents and adjuvants.
  • Acceptable carriers, diluents and adjuvants which facilitates processing of the active compounds into preparation which can be used pharmaceutically are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl orbenzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as
  • administration of the pharmaceutical composition may be systemic or topical.
  • administration of such a composition may be various parenteral routes such as subcutaneous, intravenous, intradermal, intramuscular, intraperitoneal, intranasal, transdermal, buccal routes or via an implanted device, and may also be delivered by peristaltic means.
  • the pharmaceutical composition may also be incorporated or impregnated into a bioabsorbable matrix, with the matrix being administered in the form of a suspension of matrix, a gel or a solid support.
  • the matrix may be comprised of a biopolymer such as Natrosol®.
  • Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semi permeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g. films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.
  • copolymers of L-glutamic acid and [gamma]ethyl-L-glutamate non-degradable ethylene-vinyl acetate
  • degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOTTM (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-( ⁇ )-3-hydroxybutyric acid.
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished for example by filtration through sterile filtration membranes.
  • the suitable dosage of the present composition will be dependent upon the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any and the nature of the effect desired.
  • the appropriate dosage form will depend on the disease, the inhibitor, and the mode of administration; possibilities include tablets, capsules, lozenges, dental pastes, suppositories, inhalants, solutions, ointments and parenteral depots.
  • amino acid modifications of the amino acids are also encompassed in the present invention, this may be useful for cross-linking the inhibitor to a water-insoluble matrix or the other macromolecular carriers, or to improve the solubility, adsorption, and permeability across the blood brain barrier. Such modifications are well known in the art and may alternatively eliminate or attenuate any possible undesirable side effect of the peptide and the like.
  • kits for the diagnosis, prognosis, prophylaxis or treatment of skin disease in a mammal comprising a recombinant serine protease, optionally with reagents and/or instructions for use.
  • kit of the present invention may further comprise a separate pharmaceutical dosage form comprising other pharmaceutical compisitions and combinations thereof.
  • the Kit comprises a container and a label or package insert on or associated with the container.
  • Suitable containers include, for example, bottles, vials, syringes, etc.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the container holds a composition which is effective for treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
  • the label or package insert indicates that the composition is used for treating the condition of choice, such as cancer.
  • the Kit may further comprise a second (or third) container comprising a pharmaceutically-acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
  • a pharmaceutically-acceptable buffer such as bacteriostatic water for injection (BWFI), phosphate-buffered saline, Ringer's solution and dextrose solution.
  • the present invention also discloses the use of the composition of the invention, as a pharmacological tool in the development and standardization of in vitro and in vivo test systems for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in mammals.
  • Also encompassed by the present invention is a detection assay for the diagnosis, prognosis, prophylaxis or treatment of skin diseases in a tissue sample comprising contacting the tissue sample with the composition of the invention, determining and measuring the amount of detected label and correlating this amount to the presence or absence of a disease in said tissue sample.
  • Yet another object of the present invention is to provide a method for killing a skin cell expressing kallikrein molecules, comprising contacting the cell with the composition of the invention so as to kill the cell, destroying or avoiding the survival of cells expressing kallikrein molecules.
  • Yet another object of the present invention is to provide a cosmetic composition
  • a cosmetic composition comprising a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity as described herein as well as the use of this composition for the improvement of an undesirable skin condition.
  • the Serine protease inhibitor is a recombinant inhibitor protein of the invention.
  • the Serine protease is selected from the group comprising kallikrein, plasmin, chymotrypsin (Chtr), urokinase (uPA), tryptase and neutrophile elastase (ENE) enzymes and/or a half thereof.
  • the kallikrein is selected from the group comprising hK2, hK5, hK7, and hK14 and/or a half thereof.
  • the invention also provides the use of a Serine protease inhibitor, or a biologically active fragment thereof having a Serine protease inhibitor activity, in the preparation of cosmetic composition for the improvement of an undesirable skin condition.
  • hK2 and hK3 were purified from human semen as previously described (Frenette G, Gervais Y, Tremblay R R, Dube J Y. 1998 “Contamination of purified prostate-specific antigen preparations by kallikrein hK2” J Urol 159, 1375-8), anti-hK2 and anti-PSA monoclonal antibodies were a gift from Professor R R Tremblay, Laval University, Canada.
  • Human chymotrypsin (Chtr), urokinase plasminogen activator (uPA), human kallikrein hK1, human plasma kallikrein (PK), human neutrophil elastase (HNE) and commercial ACT (human plasma ⁇ 1-antichymotrypsin) were purchased from Calbiochem.
  • Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC, Z-Gly-Gly-Arg-AMC, MeOSuc-Ala-Ala-Pro-Val-AMC were purchased from Calbiochem.
  • CFP-TFRSA-YFP fluorescent substrate was developed as previously described (Mahajan N P et al.
  • Substrate phage libraries were generated using a modified pH0508b phagemid (Lowman et al. 1991 “Selecting high-affinity binding proteins by monovalent phage display” Biochemistry 12, 10832-8).
  • the construction consists of a His 6 tag at either end of a Gly-Gly-Gly-Ser-repeat-rich region that precedes the carboxyl-terminal domain (codons 249-406) of the M13 gene III.
  • the random pentamers were generated by PCR extension of the template oligonucleotides with appropriate restriction sites positioned on both side of the degenerate codons: 5′TGAGCTAGTCTAGATAGGTGGCGGTNNSNNSNNSNNSNNSGGGTCGACGTCGGTCA TAGCAGTCGCTGCA-3′ (where N is any nucleotide and S is either G or C) using 5′ biotinylated primers corresponding to the flanking regions: 5′TGAGCTAGTCTAGATAGGTG-3′ (SEQ ID No 83) and 5′-TGCAGCGACTGCTATGA-3′ (SEQ ID No 84).
  • PCR templates are digested and purified as described previously (Smith G. P, Scott J. K. 1993 “Libraries of peptides and proteins displayed on filamentous phage” Methods Enzymol. 217, 228-57), inserted into XbaI/SalI digested pH0508b vector, and electroporated into XL1-Blue (F ⁇ ).
  • the extent of the library was estimated from the transformation efficiency determined by plating a small portion of the transformed cells onto Luria-Bertani plates containing ampicillin and tetracycline (100 and 15 ⁇ g ⁇ mL ⁇ 1 , respectively).
  • the rest of the transformed cells were used to prepare a phage library by incubating overnight by adding an M13K07 helper phage at a concentration giving a multiplicity of infection of 100 plaque forming units (p.f.u.) per mL. Phages were collected from the supernatant and purified by poly(ethylene glycol) precipitation. Of these, 200 clones were selected arbitrarily for sequencing to verify the randomization of the library.
  • This new pentapeptide library was subjected to eight rounds of screening with hK2.
  • One hundred microliters of Ni 2+ -nitrilotriacetic acid coupled to sepharose beads (Ni 2+ -nitrilotriacetic acid resin) was washed with 10 mL NaCl/P i containing 1 mg ⁇ mL ⁇ 1 BSA.
  • Phage particles (10 11 ) were added to the equilibrated Ni 2+ -nitrilotriacetic acid resin and allowed to bind with gentle agitation for 3 h at 4° C.
  • the resin was subsequently washed (NaCl/P i /BSA 1 mg ⁇ mL ⁇ 1 , 5 mM imidazole, 0.1% Tween 20) to remove unbound phages and then equilibrated in NaCl/Pi.
  • the substrate phage was exposed to 27 nM (final concentration) of hK2 for 45 min at 37° C. A control selection without protease was also performed.
  • the cleaved phages released into the supernatant were amplified using XL1-Blue Escherichia coli and then used for subsequent rounds of selection. After eight rounds of panning, about 15 individual clones were picked from the fifth, sixth and eighth round of selection and plasmid DNA were isolated and sequenced in the region encoding for the substrate.
  • rACT 8.20 (SEQ ID No 61) 5′-TACCGCGGTCAAAATCACC CTCCGTTCTCGAGCA GTGGAGACGCGT GA-3′; rACT 6.3 , ((SEQ ID No 62) 5′-TACCGCGGTCAAAATCACC AGGAGGTCTATCGAT GTGGAGACGCGTG A-3′; rACT 8.3 , (SEQ ID No 63) 5′-TACCGCGGTCAAAATC AGGGGGAGATCTGAG TTAGTGGAGACGCGTG A-3′; rACT 6.7 , ((SEQ ID No 64) 5′-TACCGCGGTCAAAATC AAGCTTAGAACAACA TTAGTGGAGACCGCTG A-3′; rACT 6.1 , (SEQ ID No 65) 5′-TACCGCGGTCAAAATC ATGACAAGATCTAAC TTAGTGGAGACGCGTG A-3′; rACT 5.18 , (SEQ ID No 86) 5′-TACCGCGGTCAAAAAA
  • PCR products were digested with Sac II and Mlu I restriction enzymes and then subcloned into digested rACT WT construct.
  • IPTG Isopropylthio- ⁇ -galactoside
  • the cells from 100 ml of culture were harvested by centrifugation, resuspended in cold PBS and then passed through a french press to recover the total soluble cytoplasmic proteins.
  • Cell debris were removed by centrifugation and Ni 2+ -nitilotriacetic affinity agarose beads were added to supernatant for 90 min at 4° C. to bind recombinant serpins.
  • the resin was subsequently washed with 50 mM Tris pH 8.0, 500 mM NaCl, 25 mM Imidazole and the bound proteins were eluted for 10 min with 50 mM Tris pH 8.0, 500 mM NaCl and 150 mM Imidazole.
  • rACT were dialysed against 50 mM Tris pH 8.0, 500 mM NaCl, 0.05% Triton X-100 for 16 h at 4° C.
  • the protein concentration was determined for each purification by Bradford assay and normalized by densitometry of Coomassie Blue-stained SDS-PAGE gels (Laemmli UK. 1970 “Cleavage of structural proteins during the assembly of the head of bacteriophage T4” Nature 227, 680-5).
  • SI stoichiometry of inhibition
  • reaction buffer 50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA
  • fluorescent substrates Z-Phe-Arg-AMC for hK1, hK2 and PK, Suc-Ala-Ala-Pro-Phe-AMC for Chtr, Z-Gly-Gly-Arg-AMC for uPA, MeOSuc-Ala-Ala-Pro-Val-AMC for HNE, and CFP-TFRSA-YFP for PSA.
  • Activity of enzyme in presence of inhibitors was compared to uninhibited reaction.
  • SI was determined by incubating different concentrations of recombinant serpins. Using linear regression analysis of fractional activity (velocity of inhibited enzyme reaction/velocity of uninhibited enzyme reaction) versus the molar ratio of the inhibitor to enzyme ([I o ]/[E o ]), the stoichiometry of inhibition, corresponding to the abscissa intercept, was obtained.
  • association rate constants for interactions of hK2, chymotrypsin, PK and HNE with different rACTs were determined under pseudo-first order conditions using the progress curve method (Morrison J F, Walsh C T. 1988 “The behavior and significance of slow-binding enzyme inhibitors” Adv. Enzymol. Relat. Areas Mol. Biol. 61, 201-301). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-800 nM) and an excess of substrate (10 ⁇ M). Each reaction was made in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) at 25° C.
  • reaction buffer 50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA
  • a k obs was calculated, for four different concentrations of inhibitors, by non linear regression of the data using equation 1.
  • equation 2 is used to correct the second order rate constant k′ by taking in account the substrate concentration [S] and the K m of the enzyme for its substrate, giving the k a .
  • the K m of hK2 for Z-FR-AMC, chymotrypsin for Suc-AAPF-AMC, PK for Z-FR-AMC and HNE for MeOSuc-AAPV-AMC were 67 ⁇ M, 145 ⁇ M, 170 ⁇ M and 130 ⁇ M respectively.
  • Kallikrein hK2 was incubated 3 hours at 37° C. with different recombinant ACTs at a [I] o :[E] o ratio of 100:1 in 50 mM Tris, 200 mM NaCl, 0.05% Triton X-100. Protein samples were heated at 95° C. for 5 min, separated by SDS-PAGE (12% acrylamid 19:1 T:C ratio) and then electroblotted onto Hybond-ECL (Amersham Pharmacia) nitrocellulose. The free-hK2 and hK2-ACT complexes were detected using a mouse anti-hK2 monoclonal antibody and an alkaline phosphatase-conjugated goat anti-mouse secondary antibody.
  • Wild type serpin ⁇ 1-antichymotrypsin was used to develop specific inhibitors of the kallikrein hK2.
  • Residues P3-P3′ located in RSL structure of rACT WT were replaced by substrate pentapeptides, previously selected by phage display technology as described above.
  • Six variants of rACT shown in table IV, have been designed and constructed. The scissile bond in substrate peptides was aligned according to Leu-358-Ser-359 into RSL of the serpin.
  • rACT WT and its variants were expressed in E. coli TG1 as fusion proteins containing an His tag in N-terminal position. Each of them was produced at low temperature allowing protein accumulation mainly in active soluble form. Purified under native conditions, the level of production varied between 1.0 to 2.5 mg/L. The purity of purified serpins, such as for example Variant 6.1 and wild type ACT, as estimated by SDS-PAGE analysis is more than 98%.
  • a panel of enzymes including human neutrophil elastase, chymotrypsin-like (Chtr, PSA or hK3) and trypsin-like (hK2, hK1, PK, uPA) proteinases have been screened to determine inhibitory specificity of rACT variants (Table IV).
  • hK2 Incubating with an excess of inhibitors ([I] o /[E] o of 100:1) for 30 minutes, hK2 is completely inhibited by rACT 6.2 , rACT 8.3 , rACT 6.7 and rACT 6.1 , whereas rACT 8.20 and rACT 5.18 inhibited 95% and 73% of enzyme activity, respectively. Under this condition, wild type rACT showed no inhibition activity toward hK2. Among these variants, two (rACT 8.3 and rACT 5.18 ) are specific to hK2, inhibiting no other tested enzyme. Two other variants, rACT 6.7 and rACT 6.2 , inhibited as well PK at 36% and 100% respectively.
  • variant rACT 8.20 inhibited the two chymotrypsin-like proteases Chtr and PSA but additionally also PK and HNE. None of the recombinant serpins showed inhibitory activity against the kallikrein hK1 and uPA.
  • Second order rate constants for serpin-proteinase reactions were measured under pseudo-first- or second order conditions as described in “Experimental Procedure”.
  • c Amino acid sequence of P3-P3′ residues in RSL (Reactive Serpin Loop) of recombinant ACT corresponding to selected substrate peptide by hK2 —, No detectable inhibitory activity.
  • Applicants have incubated hK2 (5 nM) with different concentrations (6.25-500 nM) of rACT 8.20 , rACT 6.2 , rACT 8.3 , rACT 6.7 , rACT 6.1 , rACT 5.18 , rACT WT , at 25° C. for 30 min in reaction buffer. Residual activities (velocity) for hK2, were assayed by adding the fluorescent substrate (10 ⁇ M) Z-FR-AMC. Fractional velocity corresponds to the ratio of the velocity of inhibited enzyme (v i ) to the velocity of the uninhibited control (v o ). The SI was determined using linear regression analysis to extrapolate the TIE ratio (i.e. the x intercept).
  • hK2 was incubated 3 h at 37° C. with rACT 8.20 , rACT 6.2 , rACT 8.3 , rACT 6.7 , rACT 6.1 , rACT 5.18 and wild type rACT, at a I:E ratio of 100:1.
  • Western Blot analysis of the reaction products of rACTs with hK2 (rACT 8.20 ), rACT 6.2 , rACT 8.3 , rACT 6.7 , rACT 6.1 , rACT 5.18 and wild type rACT, has been done under reducing conditions using a mouse anti-hK2 antibody to determine the fate of inhibitors after the interaction with the enzyme.
  • ACT 8.3 or ACT 6.7 were incubated with hK2 under kinetic conditions (30 min at 25° C.) at a I:E ratio of 10:1.
  • the complex formation was analysed by western blot under reducing conditions using a mouse monoclonal anti-his tag. All inhibitor proteins were either complexed with hK2 or present as uncleaved form, indicating that the possible substrate pathway for the serpin-enzyme interaction is marginal.
  • the rate of inhibitory reaction with variant ACTs was determined for each protease showing reactivity with these inhibitors.
  • interaction of hK2 and recombinant serpins was measured under pseudo-first order conditions using progress curve method.
  • hK2 (2 nM) and substrate Z-FR-AMC (10 ⁇ M) were added to varying amounts (20 n-800 nM) of inhibitors rACT 8.20 , rACT 5.18 and inhibitors rACT 6.2 , rACT 8.3 , rACT 6.7 , rACT 6.1 (data not shown).
  • Representative progress curves were subjected to non linear regression analysis using eq 1 and the rate (k obs ) was plotted against the serpin concentrations.
  • association constants were calculated using K m of the proteases for their corresponding substrates (table VI).
  • the ka value of wild type ACT with chymotrypsin was identical as to published data (Cooley et al. 2001 “The serpin MNEI inhibits elastase-like and chymotrypsin-like serine proteases through efficient reactions at two active sites” Biochemistry 40, 15762-70).
  • the recombinant rACT 6.7 showed a highest ka (8991 M ⁇ 1 s ⁇ 1 ) with hK2 whereas that obtained with PK was 45 fold inferior.
  • recombinant rACT 6.2 gave equivalent ka with hK2 and PK demonstrating a lack of discrimination between the two proteases.
  • ka values of hK2 specific recombinant inhibitors rACT 8.3 and rACT 5.18 were lower, 2439 and 595 M ⁇ 1 s ⁇ 1 respectively, whereas non specific ACT 8.20 exhibited a ka of 1779 M ⁇ 1 s ⁇ 1 , for hK2, superior compared to Chtr, PK and HNE.
  • One of the recombinant serpins, rACT 6.1 was reacting at higher velocity with PK than with hK2.
  • Residues P3-P3′ located in RSL structure of rACT WT were replaced by substrate pentapeptide coding for the RSL of Protein C Inhibitor (PCI) (Table VI) as described in example 1.
  • PCI Protein C Inhibitor
  • TG1 cells were transformed with the corresponding constructions followed by growth in appropriate culture media. Cells were then induced to an optimal density to express recombinant inhibitors for 16 h at 16° C.
  • Recombinant inhibitor ACT PCI was extracted from cytoplasm bacteria and separated by affinity chromatography using Ni-NTA column as described for the previous example.
  • MD61 and MD62 are inhibitors with very high affinity for hK2 inhibiting all hK2 protein in less than 3 minutes (under the same conditions) compared to wild type or commercial a 1-antichymotrypsin, which requires more than 12 hours of incubation to inhibit the same amount of hK2 (data not shown).
  • First-strand cDNA synthesis was performed by reverse transcriptase using the SuperscriptTM preamplification system (Gibco BRL, Gaithersburg, Md.) with 2 ⁇ g of total human cerebellum RNA (Clontech, Palo Alto, Calif.) as a template. The final reaction volume was 20 ⁇ L. To confirm the efficiency of RT-PCR, 1 ⁇ L of cDNA was subsequently amplified by PCR with primers specific for actin, a housekeeping gene (ActinS: 5′ ACAATGAGCTGCGTGTGGCT, ActinAS: 5′ TCTCCTTAATGTCACGCACGA).
  • AAK48524 was carried out in a 50 ⁇ L reaction mixture containing 1 ⁇ L of cerebellum cDNA as a template, 100 ng primers (FPL6: 5′ AGG ATG AGG AAT TCA TAA TTG GTG GCC AT (SEQ ID No 69) and RPL6: 5′ CCC ACC GTC TAG ACC ATC ATT TGT CCC GC (SEQ ID No 70)), 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl 2 , 200 ⁇ M deoxynucleoside triphosphates (dNTPs) and 0.75 ⁇ L (2.6 U) of Expand Long Template PCR polymerase mix (Roche Diagnostics, Mannheim, Germany), using an Eppendorf master cycler.
  • FPL6 5′ AGG ATG AGG AAT TCA TAA TTG GTG GCC AT (SEQ ID No 69) and RPL6: 5′ CCC ACC GTC TAG
  • PCR conditions were 94° C. for 2 min, followed by 94° C. for 10 s, 52° C. for 30 s, 68° C. for 1 min for 40 cycles, and a final extension at 68° C. for 7 min.
  • amplified KLK14 was visualized with ethidium bromide on 2% agarose gels, extracted, digested with EcoRI/XbaI and ligated into expression vector pPICZ ⁇ A of the EasyselectTM Pichia pastoris expression system (Invitrogen, Carlsbad, Calif.) at corresponding restriction enzyme sites using standard techniques (Sambrook et al., 1989).
  • the KLK14 sequence within the construct was confirmed with an automated DNA sequencer using vector-specific primers in both directions.
  • PmeI-linearized pPICZ ⁇ A-KLK14 as well as empty pPICZ ⁇ A (negative control), were transformed into chemically competent P. pastoris yeast strain X-33 after which they integrated into the yeast genome by homologous recombination.
  • Transformed X-33 cells were then plated on YPDS (1% yeast extract, 2% peptone, 2% dextrose, 1 M sorbitol, 2% agar) plates containing ZeocinTM, a selective reagent.
  • BMGY buffered minimal glycerol-complex
  • Recombinant hK14 was purified from yeast culture supernatant by cation exchange using a 5 mL HiTrapTM carboxymethyl (CM) Sepharose Fast Flow column on the AKTAFPLC chromatography system (Amersham Biosciences, Piscataway, N.J.). First, the supernatant was filtered with a 0.22 ⁇ m disposable filter and concentrated 50-fold by ultrafiltration with an AmiconTM YM10 membrane (Millipore Corporation, Bedford, Mass.).
  • CM carboxymethyl
  • AmiconTM YM10 membrane AmiconTM YM10 membrane
  • the filtered, concentrated supernatant was then introduced into the injector of the ⁇ KTAFPLC system and loaded onto the CM sepharose column, previously equilibrated with 5 mL of 10 mM MES buffer (pH 5.3) at a flow rate of 0.8 ml/min.
  • the column was washed with the aforementioned equilibration buffer and the adsorbed hK14 was eluted with a 150 mL continuous linear KCl gradient from 0 to 1 M in 10 mM MES (pH 5.3) at a flow rate of 3 ml/min. Elution fractions of 5 ml were collected and analyzed.
  • Fractions containing hK14 were pooled and further concentrated 10 times using Biomax-10 Ultrafree®-15 Centrifugal Filter Device (Millipore Corporation, Bedford, Mass.). The protein concentration of the purified hK14 was determined by the bicinchoninic acid method (Smith et al., 1985), which uses bovine serum albumin as calibrator (Pierce Chemical Co., Rockford, Ill.).
  • the purity of the recombinant 1114 protein was analyzed by SDS-PAGE (Laemmli, 1970) followed by Coomassie blue staining and/or Western blot analysis using a previously produced polyclonal rabbit antibody raised against hK14 (Borgono et al., 2003) and its identity was confirmed by tandem mass spectrometry, as described in detail for recombinant hK10 (Luo et al., 2001).
  • a monovalent type phagemid supplied by Dr Lowman was previously modified in order to generate a substrate phage library containing six His residues N terminal to the random pentapeptide fused to the g3p (Cloutier et al, 2002).
  • the six His residues allow the phage fixation to the Ni-NTA column.
  • This phage display substrate library was subjected to six rounds of screening with hK14. Briefly, substrate phages (10 11 ) were incubated with sixty microliters of Ni 2+ -nitrilotriacetic acid resin in PBS 1 ⁇ containing BSA at 1 mg/mL, washed four times (PBS 1 ⁇ , BSA 1 mg/mL, 5 mM imidazole, 0.1% Tween 20) to remove unbound phages and then exposed to 65 nM (final concentration) of hK14 for 45 minutes at 37° C. in 50 mM Tris, 100 mM NaCl, 0.05% Triton, pH 7.5. The released phages were subsequently amplified using XL1-Blue Escherichia coli and then used after purification for subsequent rounds of selection. 32 individual clones from the last round of selection were sequenced for determination of their corresponding amino acid sequences.
  • CFP-XXXXX-YFP-6 ⁇ His recombinant proteins were constructed with varying pentapeptides (in bold) between CFP and YFP proteins using synthetic genes possessing the appropriate restriction sites (BssHII; SalI).
  • the constructs contain the following amino acid sequences between CFP and YFP proteins: Gly-Ala-Leu-Gly-Gly-XXXXX-Gly-Ser-Thr.
  • TG1 cells were transformed with the corresponding constructs and purified by affinity chromatography using Ni 2+ -NTA agarose beads.
  • the purity and quantity of the purified CFP-YFP recombinant substrates were evaluated by SDS gel electrophoresis according to Laemmli followed by Coomassie Blue staining and Western blot analysis using a specific anti-His primary antibody (1/3000 dilution), a mouse anti-Fab secondary antibody (1/50000 dilution) and the ECL system (Amersham) for detection. All clones were sequenced prior to evaluation.
  • CFP-substrate-YFP proteins were tested towards different proteases and Kcat/Km values calculated as previously described (Felber et al., 2004). Briefly, fluorescence of CFP-X 5 -YFP proteins was measured in black 96-well plates using a microplate fluorescence reader (Bio-Tek Instruments, Inc.) with excitation at 440 nm ( ⁇ 15) and emissions at 485 nm ( ⁇ 10) and 528 nm ( ⁇ 10).
  • Each recombinant substrate at a concentration of 150 nM, was incubated with hK14, chymotrypsin, trypsin, PSA, hK2, plasma kallikrein or elastase at a final concentration of 8 nM, 0.1 nM, 0.3 nM, 2 ⁇ M, 10 nM, 10 nM and 0.5 nM respectively.
  • the reaction was performed for 60 min at 37° C. in reaction buffer (50 mM Tris pH 7.5, 100 mM NaCl, 0.05% Triton-X100).
  • the enzyme concentration for initial-rate determinations was chosen at a level intended to hydrolyze specifically the substrate linker and not a GGGGG substrate, which was used as negative control.
  • the cleavage products were separated by SDS-polyacrylamide gel electrophoresis, transferred to an Immobilon polyvinylidene difluoride membrane (Bio-Rad), and subjected to automated Edman degradation with an Applied Biosystems (model ABI493A) sequenator to determine the cleavage site.
  • the substrate phage library was panned against hK14 to select substrates cleaved by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, indicating the presence of a higher number of hK14-susceptible phages after each round of selection.
  • the amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing. The sequences corresponding to the substrate regions are listed in Table 1.
  • Applicants substrate system is based on the transfer of energy from CFP to YFP which are linked by the substrate. Cleavage of the linker by a protease separates the two fluorophores and results in a loss of the energy transfer.
  • hydrolysis of the substrate can be evaluated by the measurement of increasing fluorescence intensity of the donor at 485 nm, corresponding to the wavelength of CFP emission (Mitra et al., 1996; Felber et al., 2004).
  • Preferred substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold lower than for hK14. For example, NQRSS peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively and F3 peptide demonstrates high hK14 specificity and no cleavage with another kallikrein could be detected.
  • Fluorescent substrates Z-Phe-Arg-AMC, Suc-Ala-Ala-Pro-Phe-AMC, Z-Gly-Gly-Arg-AMC and MeOSuc-Ala-Ala-Pro-Val-AMC were purchased from Calbiochem, Boc-Val-Pro-Arg-AMC from Bachem, Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 from Neosystem. Oligonucleotide synthesis was carried out by Invitrogen and DNA sequencing by Synergene Biotech GmbH.
  • Human kallikrein 2, 5, 13 and 14 were produced in a yeast system (Yousef et al., 03c; Kapadia et al., 03; Borgono et al., 03).
  • Human kallikrein 6 was produced in a 293 human embryonic kidney cell system and human kallikrein 8 with a baculovirus vector and HighFive insect cells (Little et al., 97; Kishi et al., 03).
  • HK6 and hK8 were activated with Lys-C (Shimizu et al., 98).
  • Human AAT cDNA (Invitrogen, UK) was amplified by PCR using the oligonucleotides 5′-TATGGATCCGATGATCCCCAGGGAGA-3′ (SEQ ID No 71) and 5′-CGCGAAGCTTTTATTTTTGGGTGGGA-3′ (SEQ ID No 72).
  • the BamHI-HindIII fragment of the amplified AAT gene was cloned into the vector pQE9 (Qiagen, Germany) resulting in plasmid pAAT, which contains an open reading frame of the mature AAT with an N-terminal His 6 -tag.
  • Silent mutations producing KasI and Bsu36I restriction sites were introduced in pAAT 24 bp upstream and 11 bp downstream of the P1 codon of the RSL domain, respectively.
  • the restriction sites were created using the oligonucleotides 5′-ACTGAAGCTGCTGGCGCCGAGCTCTTAGAGGCCATA-3′ (SEQ ID No 73) for the KasI and 5′-GTCTATCCCCCCTGAGGTCAAGTTC-3′ (SEQ ID No 74) for the Bsu36I site following the QuikChange mutagenesis protocol supplied by Stratagene. Construction of the plasmid expressing wild-type ACT was described previously (Cloutier et al., 2004).
  • rAAT and rACT variants were produced by replacement of the RSL region with corresponding DNA fragments amplified from appropriate template oligonucleotides: rAAT E8 , 5′-CCATGTTTCTAGAGGCT CTGCAGCGTGCTATC CCGCCTGAGGTCAAGTT-3′ (SEQ ID No 75); rAAT G9 , 5′-CCATGTTTCTAGAG ACCGTTGACTACGCT ATCCCGCCTGAGGTCAAGTT-3′(SEQ ID No 76), rACT E8 , 5′-TACCGCGGTCAAAATC CTGCAGCGTGCTATC CTGGTGGAGACGCGTGA-3′ (SEQ ID No 77) and rACT G9 , 5′-TACCGCGGTCAAA ACCGTTGACTACGCT GCTCTGGTGGAGACGCGTGA-3′(SEQ ID No 78).
  • Templates were amplified using primers corresponding to their respective flanking regions, 5′-GCTGGCGCCATGTTTCTAGAG-3′ (SEQ ID No 79; AAT variants 1) and 5′-TTGTTGAACTTGACCTCAGG-3′(SEQ ID No 80; AAT variants 2) for AAT variants and 5′-GTACCGCGGTCAAA-3′(SEQ ID No 81; ACT variants 1) and 5′-TCACGCGTGTCCAC-3′(SEQ ID No 82; ACT variants 2) for ACT variants.
  • Recombinant serpins were produced in Escherichia coli strain TG1.
  • Isopropyl thio- ⁇ -D-galactoside (IPTG) was added to a final concentration of 0.5 mM for production of rACT proteins and 0.1 mM for rAAT proteins and recombinant serpins were expressed for 16 h at 18° C.
  • Cells were harvested by centrifugation and resuspended in 0.1 volume of cold PBS 2 ⁇ .
  • the resin was washed three times with 50 mM Tris, pH 7.5, 150 mM NaCl, 20 mM imidazole and bound proteins were eluted with 50 mM Tris, pH 7.5, 150 mM NaCl, 150 mM imidazole. Eluted proteins were dialyzed against 50 mM Tris, pH 7.5, 150 mM NaCl, 0.01% Triton X-100 for 16 h at 4° C. and protein purity was assessed by Coomassie Blue-stained SDS-PAGE. Protein concentrations were determined by the bicinchoninic acid method (Smith et al., 1985), using bovine serum albumin as standard (Pierce Chemical Co., Rockford, Ill.). AAT E8 , ACT E8 and AAT G9 , ACT G9 were titrated with trypsin and chymotrypsin, respectively.
  • SI values of rAAT, rACT, and their variants were determined with hK14 incubating the protease with varying concentrations of inhibitor. After an incubation of 4 hours at 37° C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by the addition of fluorescent substrate (Boc-Val-Pro-Arg-AMC). Fluorescence was measured with excitation at 340 nm ( ⁇ 15) and emission at 485 nm ( ⁇ 10) in black 96 well plates using a microplate fluorescence reader FL x 800 (Bio-Tek Instruments, Inc.).
  • the SI value corresponds to the abscissa intercept of the linear regression analysis of fractional velocity (velocity of inhibited enzyme reaction (vi)/velocity of uninhibited enzyme reaction (v 0 )) vs. the molar ratio of the inhibitor to enzyme ([I 0 ]/[E 0 ]).
  • association rate constants for interactions of hK14, with different inhibitors were determined under pseudo-first order conditions using the progress curve method (Morrison and Walsh, 1988). Under these conditions, a fixed amount of enzyme (2 nM) was mixed with different concentrations of inhibitor (0-80 nM) and an excess of substrate (20 ⁇ M). Reactions were performed in reaction buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA) at 37° C. for 45 min and the rate of product formation was measured using a FL x 800 fluorescence 96-well microplate reader (Biotek, USA).
  • Inhibition is considered to be irreversible over the course of reaction and the progression of enzyme activity is expressed as product formation (P), beginning at a rate (v z ) and is inhibited over time (t) at a first-order rate (k obs ), where the rate constant is only dependent on the inhibitor concentration.
  • a k obs was calculated for four different concentrations of inhibitor, by non linear regression of the data using equation 1.
  • the K m of hK14 for MeOSuc-VPR-AMC was 8 ⁇ M. However, it will be understood that, depending on the purity grade and specific activity of the hK14 protease, the K m may vary.
  • reaction buffer 50 mM Tris pH 7.5, 150 mM NaCl, 0.05% Triton X-100
  • hK14 corresponding to 0.5, 1 and 2 times the SI value.
  • Samples were heated at 90° C. for 10 minutes, resolved on a 10% SDS gel under reducing conditions and visualized by Coomassie Blue staining.
  • Residual activities were detected by the addition of fluorescent substrates (Z-Phe-Arg-AMC for trypsin and plasma kallikrein, Suc-Ala-Ala-Pro-Phe-AMC for chymotrypsin, Z-Gly-Gly-Arg-AMC for thrombin and MeOSuc-Ala-Ala-Pro-Val-AMC for human neutrophil elastase and Abz-Thr-Phe-Arg-Ser-Ala-Dap(Dnp)-NH2 for human kallikreins).
  • fluorescent substrates Z-Phe-Arg-AMC for trypsin and plasma kallikrein
  • Suc-Ala-Ala-Pro-Phe-AMC for chymotrypsin
  • Z-Gly-Gly-Arg-AMC for thrombin
  • MeOSuc-Ala-Ala-Pro-Val-AMC for human neutrophil elastase and Abz-Thr-Phe-Arg
  • HK14 (2 nM) was incubated with different amounts of inhibitors, corresponding to 0, 1 and 2 times the SI. After incubations for 4, 8 and 24 h at 37° C. in reaction buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.05% Triton X-100, 0.01% BSA), the residual activity was detected by addition of 20 ⁇ M of the fluorescent substrates Boc-Val-Pro-Arg-AMC. The slope (velocity) of each inhibitory reaction was divided by the slope of the corresponding reaction without inhibitor.
  • Applicants substituted five residues surrounding the scissile bond of rAATwt and rACTwt by two substrate pentapeptides, previously selected with hK14 using phage-display technology (Felber et al., 05).
  • Profiling of hK14 enzymatic activity demonstrated that hK14 has a dual trypsin and chymotrypsin-like activity.
  • Applicants therefore decided to develop inhibitors with two substrate peptides, E8 and G9, specific for trypsin and chymotrypsin-like activity, respectively.
  • the scissile bond of these substrates was aligned according to the P1-P′1 of the rAATwt and rACTwt.
  • the RSL regions of the serpin variants are shown in Table IX.
  • Substrate peptides selected by kallikrein hK14 using a phage-displayed random pentapeptide library (Felber et al., 2004). Plain type residues are common to wild type serpin, bold residues correspond to substrate peptides relocated in RSL of AAT and ACT variants.
  • the scissile bond cleaved by hK14 in substrate peptides is designated by ⁇ and putative cleavage sites in serpins are marked by asterisks between the P1-P1′ residues.
  • the recombinant serpins were produced as soluble, active form and were purified under native conditions from cytoplasmic proteins in a one-step procedure over a nickel affinity column. Analysis on SDS-PAGE under reducing conditions revealed a single band for each inhibitor, rAAT and rACT variants, migrating at apparent sizes of 45 to 50 kDa, corresponding with their molecular weight, except for the protein AAT E8 , which is migrating slightly faster (data not shown). All inhibitors were estimated to be more than 95% pure by densitometric analysis, with a range of production yield of 1 to 5 mg/L.
  • SI stoichiometry of inhibition
  • reaction with hK14 also produced a fraction of hydrolyzed inhibitor, with a molecular size consistent with the serpin being cleaved at or near the reactive site of the RSL.
  • the amount of this fraction was largely lowered when the SI value is close to 1 (AAT-G9, ACT-E8 and ACT-G9).
  • the only variant with a SI values>>1 rAAT E8 ) exhibited a substrate behavior with hK14, resulting mainly in accumulation of the cleaved form of the inhibitor rather than formation of the irreversible complex.
  • the presence of intact inhibitor was observed when the ratio [I] o /[E] o was above the SI with a weak band of complex.
  • Serpins modified with the chymotrypsin-like substrate, rAAT G9 and rACT G9 demonstrated only a moderate affinity for hK14, with association constants of respectively 217′000 and 74′000 M ⁇ 1 s ⁇ 1 while rACT E8 possessed association constants of 575′000 M ⁇ 1 s ⁇ 1 .
  • hK14 inhibitors investigated the reaction of purified variants with a broad panel of proteinases. First at all, proteinases with broad specificities were examined, including trypsin, chymotrypsin, plasma kallikrein, human neutrophil elastase and thrombin. Additionally, Applicants assessed the specificity of hK14 inhibitors towards enzymes belonging to the same protease family, i.e. hK2, hK3, hK5, hK6, hK8 and hK13 (Table XI).
  • Percentage inhibition conrresponding to 100 ⁇ [1 ⁇ (velocity in presence of inhibitor/velocity of uninhibited control)]. Reaction of 30 min. incubation with an excess of inhibitors ([I] o /[E] o of 50:1).
  • Human Kallikrein 14 was produced and purified as previously described.
  • the substrate phage library was panned against hK14 to select substrates hydrolyzed by its hydrolytic activity. Cleaved phages were amplified in E. coli TG1 cells and then subjected to five more rounds of enzyme digestion and screening. The amount of released phages increased with each round, thus verifying a higher number of hK14-susceptible phages after each round of selection.
  • the amino acid sequences of 32 phage peptides from the last round of selection were determined by sequencing and the obtained sequences corresponding to the substrate regions were listed in Table 8.
  • trypsin-like substrates are cleaved by trypsin with a variable efficacy which was not strictly in correlation with hK14 preferences.
  • the two pentapeptides VGSLR and RQTND were best substrates for hK14 but were not very efficiently cleaved by trypsin in comparison to other peptides like LSGGR peptide giving a Kcat/Km of almost 5′000′0000 M ⁇ 1 ⁇ s ⁇ 1 with trypsin.
  • peptides possessing a Gln in P2 position were best substrates as well as for hK14 than for trypsin. Only two hK14 substrates, RVTST and VVMKD, in exception to chymotrypsin-like substrates were not cleaved by trypsin.
  • Chymotrypsin-like substrates were cleaved by chymotrypsin more efficiently than with hK14 excepted TVDYA substrate which gave almost the same Kcat/Km with hK14, chymotrypsin and elastase.
  • This last enzyme also proteolyzed the two selected peptides YQSLN, which is also cleaved weakly by PSA, and TSYLN.
  • Selected substrates displayed a high selectivity for hK14 in comparison to other human kallikreins such as hK1, hK2, PSA and PK. Only hK2 proteolyzed most of the trypsin-like substrates with Kcat/Km values always at least 5 fold less than for hK14. For example, NQRSS peptide is 27 and 78 fold more selective for hK14 than for hK2 and PK, respectively.
  • hK14 has trypsin-rather than chymotrypsin-like cleavage specificity despite the selection of several aromatic residue-containing substrates.
  • the substrates with the highest Kcat/Km have an arginine in P1 position indicating a preference for this amino acid (Table XIV). Lysine, on the other hand, seems to be less suitable than tyrosine in P1 position. If the two amino acids were present in the same peptide, hK14 cleaved after the tyrosine residue.
  • hK14 one of the chymotrypsin-like substrates, TVDYA, gave a significantly higher kinetic value, 134,000 M ⁇ 1 ⁇ s ⁇ 1 , than all the lysine-P1 substrates, with Kcat/km values not higher than 34,000 M ⁇ 1 ⁇ s ⁇ 1 .
  • No selectivity of hK14 was observed for the P1′ position, where different types of amino acids such as small and uncharged, hydrophobic, positively charged or negatively charged residues have been recovered in the best substrates
  • Analysis of other surrounding positions demonstrated that hK14 can be accommodated by a large variety of amino acids. This observation does not mean that hK14 has a large spectrum of activities like trypsin or chymotrypsin but demonstrates an ability to cleave different sequences depending to the context.
  • hK14 The chymotrypsin-like activity of hK14, even if it is inferior to its trypsin-like activity, is interesting. To Applicants knowledge, except for the Phe-Phe link cleaved by hK1 in kallistatin and some derived peptides, this is the first human kallikrein described with a dual activity. The conformation of the specificity pocket in hK14 should therefore accommodate both aromatic and basic amino acid side chains at the substrate P1 position to explain the dual chymotrypsin and trypsin-like activity of hK14.
  • the serpin AATwt is a good inhibitor for hK14 with an association constant of 263 000M ⁇ 1 s ⁇ 1 .
  • All the AAT variants had a lower association constant than AATwt, but several of them still react at high velocity with hK14, as AAT G1 , AAT G9 , AAT E8 , AAT G1g and AAT C11 exhibiting a ka of 168 000, 217 000, 242 000, 257 000 and 63 000 M ⁇ 1 s ⁇ 1 respectively. Only two AT variants did not inhibit hK14.
  • a panel of enzymes including trypsin, human neutrophil elastase, chymotrypsin, plasma kallikrein (PK), urokinase (uPA), and thrombin were screened to determine inhibitory specificity of ACT and AAT variants with a SI for hK14 lower than 10 (Table XVIII).
  • PK plasma kallikrein
  • uPA urokinase
  • thrombin A panel of enzymes including trypsin, human neutrophil elastase, chymotrypsin, plasma kallikrein (PK), urokinase (uPA), and thrombin
  • ACT variants two (rACT C11 and rACT C11D ) show specificity to hK14, inhibiting no other tested enzymes apart from trypsin and chymotrypsin.
  • these new inhibitors clearly exhibited a higher specificity toward hK14 than AATwt.
  • AAT G9 demonstrated to be highly specific to hK14, showing no reactivity with any trypsin-like proteases.
  • hK14 inhibiting ACT variants were screened against a larger panel of tissue kallikreins related to hK14. Partial inhibition was observed against different subsets of tested kallikreins.
  • the molecule has been formulated at 2 mg/ml in natrosol 2% (w/v).
  • the formulation has been chosen following in vitro diffusion criteria retaining MDPK67b inhibition property over trypsin (surrogate in vitro substrate).
  • MDPK67b 2 mg/ml, prepared as a solution is formulated in 2% natrosol (w/v), PBS 1 ⁇ pH7.4 at 4° C. under slow agitation to prevent molecule shearing.
  • the preparation is carefully homogenized under stirring at 4° C. to ensure proper inhibitor repartition within the hydrogel.
  • Natrosol has to be added as a powder to MDPK67b solution to avoid clumps and to allow a homogenous formulation without shearing.
  • the solutions are autoclaved or filtered through a 0.22 u filter.
  • MDPK67b potential therapeutic effect has been assessed on a group of 12 transgenic KLK5 mice with different lesion grade severity, starting from a low severity grade (grade 1) to a more severe grade (grade 4) ( FIG. 30 ).
  • Group 1 has been treated once per day with 0.3 ml of vehicle, 2% natrosol and group 2 once per day with 0.3 ml of MDPK67b formulated at 2 mg/ml in 2% natrosol over 28 days. This time period corresponds to two epiderma renewals in the mouse model.
  • mice have been monitored for changes in lesion grade and lesion size phenotypes. Lesion size has been measured every 3 days and lesion grade was monitored daily
  • MDPK67b Lesion grade development was also positively affected by topical application of MDPK67b.
  • One MDPK67b treated test animal showed a complete reversion of the phenotype.
  • a partial reversion was seen on a second MDPK67b treated animal.
  • the protective effect seems larger in mice with low grade symptoms.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Organic Chemistry (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • Urology & Nephrology (AREA)
  • Analytical Chemistry (AREA)
  • Birds (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
US12/863,651 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases Abandoned US20110130338A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US12/863,651 US20110130338A1 (en) 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US2238608P 2008-01-21 2008-01-21
US657608P 2008-01-22 2008-01-22
PCT/IB2009/000089 WO2009093119A2 (en) 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases
US12/863,651 US20110130338A1 (en) 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2009/000089 A-371-Of-International WO2009093119A2 (en) 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/447,317 Continuation US20140341881A1 (en) 2008-01-21 2014-07-30 Use of serine protease inhibitors in the treatment of skin diseases

Publications (1)

Publication Number Publication Date
US20110130338A1 true US20110130338A1 (en) 2011-06-02

Family

ID=40901490

Family Applications (3)

Application Number Title Priority Date Filing Date
US12/863,651 Abandoned US20110130338A1 (en) 2008-01-21 2009-01-21 Use of serine protease inhibitors in the treatment of skin diseases
US14/447,317 Abandoned US20140341881A1 (en) 2008-01-21 2014-07-30 Use of serine protease inhibitors in the treatment of skin diseases
US16/217,957 Active US11793864B2 (en) 2008-01-21 2018-12-12 Use of serine protease inhibitors in the treatment of skin diseases

Family Applications After (2)

Application Number Title Priority Date Filing Date
US14/447,317 Abandoned US20140341881A1 (en) 2008-01-21 2014-07-30 Use of serine protease inhibitors in the treatment of skin diseases
US16/217,957 Active US11793864B2 (en) 2008-01-21 2018-12-12 Use of serine protease inhibitors in the treatment of skin diseases

Country Status (8)

Country Link
US (3) US20110130338A1 (ja)
EP (1) EP2244728B1 (ja)
JP (2) JP5615184B2 (ja)
CN (2) CN101977626A (ja)
AU (1) AU2009207394B2 (ja)
BR (1) BRPI0906167A2 (ja)
CA (1) CA2712512C (ja)
WO (1) WO2009093119A2 (ja)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10550154B2 (en) 2012-08-08 2020-02-04 Daiichi Sankyo Company, Limited Peptide library and use thereof

Families Citing this family (20)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5615184B2 (ja) * 2008-01-21 2014-10-29 ドゥルマディス エスアーＤｅｒｍａｄｉｓ Ｓａ 皮膚病の治療におけるセリンプロテアーゼ阻害剤の使用
CA2753282C (en) * 2009-03-10 2017-11-28 Med Discovery Sa Use of serine protease inhibitors in the treatment of neutropenia
KR101979464B1 (ko) 2011-12-09 2019-05-16 모멘티브 파포만스 마테리아루즈 쟈판 고도가이샤 실리콘 고무 발포체용 조성물, 실리콘 고무 발포체의 제조방법 및 실리콘 고무 발포체
US9815878B2 (en) 2012-09-19 2017-11-14 Mackay Memorial Hospital Use of PEDF-derived polypeptides for preventing and/or ameliorating skin aging
KR101437408B1 (ko) 2012-11-05 2014-09-05 동아대학교 산학협력단 플라스민 및 엘라스타아제 저해 활성을 갖는 산왕거미 유래의 쿠니츠 타입 세린 프로테아제 저해 단백질 및 이를 유효성분으로 포함하는 염증 억제 및 항섬유소용해용 조성물
CA2912528A1 (en) 2013-05-17 2014-11-20 Intelligrated Headquarters, Llc Robotic carton unloader
US10807805B2 (en) 2013-05-17 2020-10-20 Intelligrated Headquarters, Llc Robotic carton unloader
GB201322091D0 (en) * 2013-12-13 2014-01-29 Cambridge Entpr Ltd Modified serpins for the treatment of bleeding disorders
WO2015114144A1 (en) * 2014-02-03 2015-08-06 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of netherton syndrome
EP3536377A1 (en) * 2014-02-26 2019-09-11 Luma Therapeutics, Inc. Ultraviolet phototherapy apparatus
TW201619605A (zh) * 2014-10-24 2016-06-01 Shiseido Co Ltd 用以改善起因於角質層剝離之抑制或促進之肌膚狀態的美容方法及評價方法
MA40998A (fr) 2014-11-21 2017-09-26 Ophirex Inc Thérapies contre une envenimation, ainsi que compositions, systèmes et kits pharmaceutiques associés
US10597235B2 (en) 2016-10-20 2020-03-24 Intelligrated Headquarters, Llc Carton unloader tool for jam recovery
CN106478812B (zh) * 2016-10-21 2020-11-20 沈阳药科大学 丝氨酸蛋白酶抑制剂-3及其功能、制备方法和应用
MX2019012419A (es) * 2017-04-21 2019-12-05 Genentech Inc Uso de antagonistas de klk5 para el tratamiento de una enfermedad.
CA3067364A1 (en) * 2017-06-16 2018-12-20 Azitra Inc Compositions and methods for treatment of netherton syndrome with lekti expressing recombinant microbes
AU2019346549A1 (en) 2018-09-24 2021-04-15 Krystal Biotech, Inc. Compositions and methods for the treatment of netherton syndrome
EP4114414A4 (en) * 2020-03-06 2024-03-27 The Regents of The University of Michigan SERINE PROTEASE INHIBITORS FOR SUPPRESSING OR PREVENTING ANAPHYLACTIC REACTION
CN112315897A (zh) * 2020-11-04 2021-02-05 深圳前海鹰岗生物科技有限公司 一种抑制细胞炎症反应释放治疗痛风急性发作的聚合物微针及制备方法
WO2023141125A2 (en) * 2022-01-18 2023-07-27 The Regents Of The University Of California Method of inhibiting degrading protease activity in aging

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030054445A1 (en) * 2000-11-14 2003-03-20 Jian Chen Polynucleotide encoding a novel human serpin secreted from lymphoid cells, LSI-01
US20060269536A1 (en) * 2003-04-04 2006-11-30 David Deperthes Inhibitor proteins of a protease and use thereof

Family Cites Families (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5252725A (en) * 1989-06-23 1993-10-12 The Trustees Of The University Of Pennsylvania α-1-antichymotrypsin, analogues and methods of production
US5079336A (en) * 1989-06-23 1992-01-07 The Trustees Of The University Of Pennsylvania α-1-antichymotrypsin, analogues and methods of production
DE4214215A1 (de) * 1992-04-30 1993-11-04 Behringwerke Ag Verwendung von inhibitoren von plasminogenaktivatoren zur behandlung von entzuendungen
AUPP508798A0 (en) * 1998-08-05 1998-08-27 Biotech Australia Pty Limited Method of treating psoriasis
MXPA01013246A (es) * 1999-06-18 2003-08-20 Jon Bragi Bjarnason Proteinasas serina de pescado y su uso farmaceutico y cosmetico.
US7105172B1 (en) * 1999-11-18 2006-09-12 Bolla John D Treatment of rosacea
US20040097481A1 (en) * 2002-11-20 2004-05-20 Benjamin Levinson Water-soluble mesoporphyrin compounds and methods of preparation
ATE439853T1 (de) * 2002-11-20 2009-09-15 Arriva Prometic Inc Zusammensetzung zur behandlung von ichthyosis unter verwendung von antitrypsin
WO2005117955A1 (en) * 2004-05-19 2005-12-15 Arriva Pharmaceuticals, Inc. Treatment of atopic dermatitis with unglycosylated alpha one-antitrypsin
EP1666075A1 (en) * 2004-10-04 2006-06-07 Switch Biotech Aktiengesellschaft Wound dressing compositions, especially for delivery of protease inhibitors
WO2006090282A2 (en) * 2005-02-28 2006-08-31 Universite De Lausanne Recombinant inhibitor proteins of an hk14 protease and use thereof
GB0525999D0 (en) * 2005-12-21 2006-02-01 Ares Trading Sa Novel members of the kazal family of serine protease inhibitors
AR067336A1 (es) * 2007-06-28 2009-10-07 Novartis Ag Moduladores de calicreina 7
US8415305B2 (en) * 2007-08-17 2013-04-09 Novartis Ag Use of cyclic depsipeptides to inhibit kallikrein 7
JP5615184B2 (ja) * 2008-01-21 2014-10-29 ドゥルマディス エスアーＤｅｒｍａｄｉｓ Ｓａ 皮膚病の治療におけるセリンプロテアーゼ阻害剤の使用

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030054445A1 (en) * 2000-11-14 2003-03-20 Jian Chen Polynucleotide encoding a novel human serpin secreted from lymphoid cells, LSI-01
US20060269536A1 (en) * 2003-04-04 2006-11-30 David Deperthes Inhibitor proteins of a protease and use thereof

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
Berendsen, A Glimpae of the Holy Grail?, Science, 1998, 282, pages 642-643. *
Bradley et al., Limits of Cooperativity in a Structurally Modular Protein: Response of the Notch Ankyrin Domain to Analogous Alanine Substitutions in Each Repeat, J. Mol. BIoL (2002) 324, 373-386. *
Ngo et al, Computational Complexity, Protein Structure Protection, and the Levinthal Paradox, 1994, pages 491-494. *
Rudinger, Peptide Hormones, JA Parsons, Ed., 1976, pages 1-7. *
SIGMA, 2004, pages 1-2. *
Voet et al, Biochemistry, John Wiley & Sons Inc., 1995, pages 235-241. *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10550154B2 (en) 2012-08-08 2020-02-04 Daiichi Sankyo Company, Limited Peptide library and use thereof
US11319345B2 (en) 2012-08-08 2022-05-03 Daiichi Sankyo Company, Limited Peptide library and use thereof

Also Published As

Publication number Publication date
CA2712512C (en) 2018-08-28
AU2009207394A1 (en) 2009-07-30
JP5615184B2 (ja) 2014-10-29
JP5891266B2 (ja) 2016-03-22
EP2244728B1 (en) 2016-08-31
US20190183989A1 (en) 2019-06-20
BRPI0906167A2 (pt) 2018-05-22
JP2014240389A (ja) 2014-12-25
US20140341881A1 (en) 2014-11-20
JP2011511766A (ja) 2011-04-14
US11793864B2 (en) 2023-10-24
CA2712512A1 (en) 2009-07-30
AU2009207394B2 (en) 2015-01-22
CN110522905A (zh) 2019-12-03
CN101977626A (zh) 2011-02-16
EP2244728A2 (en) 2010-11-03
WO2009093119A3 (en) 2009-11-26
WO2009093119A2 (en) 2009-07-30

Similar Documents

Publication Publication Date Title
US11793864B2 (en) Use of serine protease inhibitors in the treatment of skin diseases
Stefansson et al. Activation of proteinase-activated receptor-2 by human kallikrein-related peptidases
Stassens et al. Anticoagulant repertoire of the hookworm Ancylostoma caninum.
KR100818010B1 (ko) 루핀의 펩티드 추출물 및 이를 함유하는 약학 조성물,화장 조성물 또는 영양 조성물
Ohnishi et al. Effects of urinary trypsin inhibitor on pancreatic enzymes and experimental acute pancreatitis
CA2243633C (fr) Polypeptide isole de l'epiderme et son utilisation
EP2821414A1 (en) Kappa casein fragments inhibiting gingipains
KR101956579B1 (ko) 상아질 지각과민증 완화를 위한 치약 조성물
JP4585342B2 (ja) 不全角化を抑制する物質のスクリーニング方法、同方法によりスクリーニングされた物質及び不全角化を抑制する方法
Into et al. Arginine-specific gingipains from Porphyromonas gingivalis deprive protective functions of secretory leucocyte protease inhibitor in periodontal tissue
AU3238700A (en) Compositions and methods for prevention of photoaging
TW201309334A (zh) 角質層剝離促進劑
JP2015504417A (ja) ジンジパイン阻害プロペプチド
Schmid et al. Protease-antiprotease interactions and the rationale for therapeutic protease inhibitors
Shinguh et al. Biochemical and pharmacological characterization of FK706, a novel elastase inhibitor
WO2019131406A1 (ja) トロンビンの抑制作用を指標とした皮膚状態改善剤のスクリーニング方法、及びトロンビン作用阻害剤を含む皮膚状態改善剤
US20040127421A1 (en) Method to increase fibronectin
JPH09304379A (ja) ファクターｖ（ｌｅｉｄｅｎ）キャリアのための血栓症の予防
CN114828871A (zh) 谷胱甘肽混合组合物
WO2021225469A1 (ru) Биологически активный комплекс, зубная паста и ополаскиватель на его основе
WO2018195637A1 (pt) Cistatina recombinante da cana-de-açúcar para redução do desgaste dentário erosivo e proteção contra cárie dentária
Diamandis et al. Induction of Complement C3a Receptor

Legal Events

Date Code Title Description
AS Assignment

Owner name: DERMADIS SA, FRANCE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEPERTHES, DAVID;KUNDIG, CHRISTOPH;HOVNANIAN, ALAIN;AND OTHERS;SIGNING DATES FROM 20101210 TO 20101217;REEL/FRAME:025618/0551

Owner name: INSTITUT NATIONAL DE LA SANTE ET DE LA RECHERCHE M

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:DEPERTHES, DAVID;KUNDIG, CHRISTOPH;HOVNANIAN, ALAIN;AND OTHERS;SIGNING DATES FROM 20101210 TO 20101217;REEL/FRAME:025618/0551

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION