Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
  • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
  • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

• the invention is in the field of plant molecular biology and relates to transgenic plants having novel phenotypes, methods of producing such plants and polynucleotides and polypeptides useful in such methods. More specifically, the invention relates to the use of MYB polynucleotides and transgenic plants expressing these polynucleotides and polypeptides.
• Transcription factors are DNA binding proteins that interact with specific promoter or enhancer sequences and alter the gene expression of the associated gene. Where the specific sequence that binds the transcription factor is associated with a suite of genes whole pathways can be coordinately regulated with various component genes being simultaneously up-regulated or down-regulated. A transcription factors may coordinately alter a suite of genes in response to a stimulus such as an environmental stress, nutritional status or pathogen attack, for example, or can be a component of a signaling pathway, such as a hormone signaling pathway for example. Transcription factors posses a modular structure and are classified primarily on the basis of the DNA binding domain.
• the MYB family of transcription factors is composed of at least 198 genes (Yanhui et al. 2006) and has been proposed to have regulatory functions in a wide array of processes ranging from growth and development to defense responses.
• Plant MYB proteins are classified based on the presence and number of imperfect MYB repeats each composed of about 52 amino acids.
• the MYB domain forms a helix-turn-helix conformation and represents the DNA binding domain.
• Three major groups of MYB proteins have been classified as R1R2R3-MYB, R2R3-MYB and MYB-related proteins.
• the R2R3-MYB family of proteins in Arabidopsis consists of 125 proteins and is characterized by having a R2R3DNA binding domain at their N-terminus (Kranz et al., 1998, and Stracke et al., 2001). These genes are involved in a number of biological processes including mediating hormone actions, secondary metabolism (Paz-Ares et al., 1987), control of cell morphogenesis (Oppenheimer et al., 1991), meristem, floral and seed development (Kirik et al., 1998, Schmitz et al., 2002) and response to various environmental factors (Kranz et al., 1998; Jin and Martin, 1999; Meissner et al, 1999).
• MYB sequences have been further classified into a number of subgroups based on sequence (Krantz et al. 1998, Stracke et al 2001).
• MYB68 falls within subgroup14 as does MYB36 and MYB84 as identified by Krantz et al 1998.
• Stracke et al 2001 have additionally include the MYB37, MYB38 and MYB87 in subgroup14. Stracke further notes that there are several cases of functional conservation of genes that cluster together in the dendrogram.
• R2R3-MYB Classification of the R2R3-MYB family has identified 125 MYB proteins in Arabidopsis thaliana (At).
• a R2R3 MYB gene is characterized by a MYB domain containing two imperfect repeats of 53 aa (R2, and R3). Each repeat contains three helix-turn-helix structures. The R2 and R3 domains are located near the N-terminus of the proteins. The last two helices on each repeat with a loop between them form a DNA-binding motif structure similar to HLH proteins.
• the third helix directly binds to DNA, and the first and second helices contribute to the conformation of the HLH motif that appears to be important in recognition of a specific gene target (Ogata et al., 1994; William and Grotewold, 1997; Jia et al., 2004).
• the R2R3-MYB proteins were further characterized into 22 subgroups according to their phylogenetic relationship based on at least one of the shared amino acid motifs in addition to the MYB domain (Kranz et al., 1998).
• AtMYB68, AtMYB84, and AtMYB36 were categorized as subgroup14 based on two shared motifs: S1: SFSQLLLDPN SEQ ID NO:266 and S2: TSTSADQSTISWEDI SEQ ID NO:267, at the C-terminus of the proteins.
• S1 SFSQLLLDPN SEQ ID NO:266
• S2 TSTSADQSTISWEDI SEQ ID NO:267
• Arabidopsis MYB36 has only 20% identity.
• AtMYB87, AtMYB37 and AtMYB38 were also included in subgroup14, on the basis of sequence conservation in the MYB DNA domain: R2 and R3 helix-turn-helix repeats (Stracke et al., 2001).
• the R2R3 domains may be indicative of specific DNA binding through the unique amino acid sequence of the third helix of the R3 domain and minor conformational changes associated with the structural interaction between the first two helices. It suggests that subgroup14 members may be functionally redundant orthologous. For example, lateral meristem initiation in Arabidopsis was studied with respect to MYB-subgroup14 (Muller et al., 2006). All members of MYB-subgroup14 showed high similarity to the tomato Blind (Bl) gene, a regulator of axillary meristems.
• Bl tomato Blind
• AtMYB37, AtMYB38, AtMYB84 and AtMYB87 were detected by RT-PCR in tissues including shoot tip, internode, leaf, flower bud, open flower, and root, whereas AtMYB36 and AtMYB68 expression was expressed in root tissue.
• MYB68 is a R2R3 type MYB gene, and a member of MYB-subgroup14, that has been identified in a transposon gene trapping study (Feng et al., 2004). Expression of this gene has been demonstrated to be specific to root pericycle cells. In the null mutant, no MYB68 mRNA was detectable; however, no mutant phenotype was exhibited when plants were grown under standard conditions. In the evaluation of MYB68 under a variety of growth conditions the only phenotype discerned was reduced plant leaf area when plants were grown under hot greenhouse conditions (30-40° C.). This phenotype was rescued by transformation of the myb68 mutant background with a wild-type MYB68 gene. Examination root tissue of the myb68 mutant grown in root cultures indicated increased biomass and lignin levels. The authors conclude that MYB68 is involved in root development (Feng et al., 2004).
• Transcriptional activation is primarily mediated through transcription factors that interact with enhancer and promoter elements. Binding of transcription factors to such DNA elements constitutes a crucial step in transcriptional initiation. Each transcription factor binds to its specific binding sequence in a promoter and activates expression of the linked coding region through interactions with coactivators and/or proteins that are a part of the transcription complex.
• This invention relates to a method for enhancing the heat stress tolerance of plants by means of increasing the expression of a MYB subgroup-14 polypeptide.
• Enhanced heat stress tolerance includes improved seed set during and following conditions of heat stress. Improved seed set results in increased yield.
• a MYB-subgroup-14 polypeptide includes for example a MYB68, a MYB36, a MYB84, a MYB37, aMYB38 or a MYB87 polypeptide.
• the MYB-subgroup-14 polypeptide is a MYB68, a MYB36 or a MYB84 polypeptide.
• the MYB subgroup-14 polypeptide expression is ectopic, or constitutive. Alternatively, expression of the MYB subgroup-14 polypeptide in its typical place of expression, e.g. root tissue.
• a heat stress heat stress tolerant plant is produced by providing a nucleic acid construct that increases the expression of a Myb subgroup-14 polypeptide, inserting the nucleic construct into a vector, transforming a plant, tissue culture, or a plant cell with the vector to obtain a plant, tissue culture or a plant cell with increased expression of the Myb subgroup-14 polypeptide and growing said plant or regenerating a plant from the tissue culture or plant cell.
• a nucleic acid construct that increases the expression of a Myb subgroup-14 polypeptide includes for example an enhancer element.
• An enhancer is a sequence found in eukaryotes and certain eukaryotic viruses which can increase transcription of a gene when located, in either orientation, up to several kilobases from the gene concerned.
• Enhancer elements can activate transcription of a gene and alter the normal expression pattern of the endogenous gene. Enhancer elements are known to those skilled in the art. For example the enhancer element is a 35S enhancer element.
• a nucleic acid construct that increases the expression of a Myb subgroup-14 polypeptide includes for example a nucleic acid encoding a Myb subgroup-14 polypeptide.
• MYB polypeptides and nucleic acids include those of SEQ ID NO: 1-265.
• the nucleic acid encoding a Myb subgroup-14 polypeptide is operably linked to a promoter.
• the promoter is a heterologous promoter or a homologous promoter. Additionally, the promoter is a constitutive or an inducible promoter.
• a control cell includes for example a cell that endogenously expresses a MYB subgroup-14 polypeptide such a plant root cell, alternatively a control cell is a non transformed cell of the same cell-type as the transformed cell, be it a leaf cell a meristem cell or a flower or seed cell.
• An increase is a 1-fold, 2-fold, 3 fold or greater increase.
• An increase of expression is also meant to include expression of a MYB subgroup-14 polypeptide in a cell that does not typically produced by a cell.
• Heat stress tolerant plants are identified by exposing a population of flowering plants to a heat stress treatment and selecting a plant from the population of plants that has reduced flower abortion.
• Heat stress treatment includes for example exposing the plant to a temperature that is hot enough for a sufficient amount of time such that damage to plant functions or development results.
• reduced flower abortion is meant that a plant does not loss as many flowers, due to flower abortion, or has a greater seed yield compared to another plant that is exposed to a similar level of heat stress. Plants with a reduced flower abortion have a 5, 10, 20, 25, 30% or more increase in seed yield as compared to a control plant.
• the invention further includes the plants produced by the methods of the invention and the seed produced by the plants which produce a plant that has an increase tolerance to heat stress.
• the invention is based upon the surprising discovery of plants that have an increased tolerance to heat stress which results in an increased yield relative to a wild-type control. More specifically, the invention is based upon the discovery that increasing the expression of a MYB-subgroup14 polypeptide (e.g., MYB68) results in a plant having an increased resistance to heat stress.
• MYB-subgroup14 polypeptide e.g., MYB68
• MYB-subgroup 14 polypeptide can be accomplished for example by increasing the expression of an endogenous MYB-subgroup 14 polypeptide (e.g., activation tag insertion) or by expression of an exogenous gene construct encoding for a MYB-subgroup 14 polypeptide.
• the gene encoding for the MYB-subgroup 14 polypeptide may be endogenous or exogenous to the transformed species.
• plants having an increases resistance to heat stress were produced not only transforming a plant with its native MYB-subgroup 14 polypeptide but also with a MYB-subgroup 14 polypeptide from another plant species.
• the invention provides methods of enhancing (e.g., increasing) the heat stress tolerance of plants by increasing the expression of a MYB subgroup-14 polypeptide. Also included in the invention is a method of identifying a heat stress tolerant plant. The plants identified by these methods have reduced flower abortion and increased yield as compared to a control plant. Heat stress tolerant plants are identified by exposing the population of flowering plants to a heat stress treatment and selecting a plant from the population of plants that has reduced flower abortion. The invention also includes the transgenic plants produced by the methods of the invention and the seeds produced by the transgenic plants that produce a heat stress tolerant plant.
• constitutive expression means expression of a gene in any cell at constant levels in a non-regulated manner.
• cMYB and “MYB” refer to a cDNA clone of MYB and are used interchangeably. Where a genomic sequence has been used or referred to, it is identified and differentiated by the term “gMYB” or “genomic MYB” thereby referring to a genomic MYB sequence.
• Ectopic expression means expression of a gene in an abnormal place in an organism relative to the endogenous gene expression. Ectopic expression may include constitutively expressed genes depending on the native expression patterns of a given gene.
• expression cassette means a vector construct wherein a gene is transcribed. Additionally, the expressed mRNA may be translated into a polypeptide.
• expression or “over-expression” are used interchangeably and means the expression of a gene such that the transgene is expressed.
• the total level of expression in a cell may be elevated relative to a wild-type cell.
• Flower abortion means a flower that fails to develop and produce a fruit or seed. In addition to premature senescence of a flower, flower abortion may refer to loss of pollen production, altered pollination or fertilization and subsequent seed development. Altered growth and development of meristem tissue, a flower meristem in particular, is further included within the meaning of flower abortion.
• heat tolerance is defined as a phenotype where a first plant, or plant line, has increased capacity to withstand elevated temperature and produce a yield that is in excess of a second plant or plant line, the second plant line being a control plant such as a wild-type control plant line.
• a “promoter sequence”, or “promoter”, means a nucleic acid sequence capable of inducing transcription of an operably linked gene sequence in a plant cell.
• seed set is seed formation as a result of flower pollination followed by egg cell fertilization and zygote development. Reductions in seed set which can occur due to interruption in any of the above processes will produce a net reduction in seed number produced.
• substantially similar refers to nucleic acids where a change in one or more nucleotides does not alter the functional properties of the nucleic acid or the encoded polypeptide. Due to the degeneracy of the genetic code, a base pair change can result in no change in the encoded amino acid sequence. For example, the codons ACT, ACC, ACA and ACG all encode a threonine amino acid. Alternatively one or more base pair changes may alter the encoded amino acid however if the substituted amino acid has similar chemical properties functionality of the encoded protein is likely to be unaffected. For example, threonine codons ACT and ACC when changed to AGT or AGC respectively encode for serine, a chemically and biologically similar amino acid.
• polypeptides are non essential and alterations may be made in these locations without an effect on the functionality of the polypeptide.
• Substantially similar also refers to sequences having changes at one or more nucleotide bases wherein the changes do not affect the ability of the sequence to alter gene expression by various gene silencing methodologies such as antisense, RNAi or co-suppression.
• the term “substantially similar” refers to polypeptides wherein a change in one or more amino acids does not alter the functional properties of the polypeptide as discussed above.
• yield refers to seed number, seed weight, seed size, total plant biomass, increased biomass of a plant organ, such as stems or leaves or roots, fruit production, and flower production,
• yield protection is defined as the positive difference, expressed as a % value, between the yield of the transgenic or mutant and the control, where the yield is expressed as a % of optimal, following an imposed stress. The calculation is done by comparing the optimal yield with that after the stress treatment (stress yield/optimal yield ⁇ 100).
• the MYB gene family is classified based on sequence homology and the presence of defined domains and motifs such as an R2R3 domain. The classification in all cases is not absolute and varies depending on the criteria selected for the analysis (Krantz et al 1998, Stracke et al 2001).
• MYB-subgroup14 to include at least the following members, MYB68, MYB36, MYB84, MYB37, MYB38 and MYB87.
• the Arabidopsis MYB68, MYB36, MYB84, MYB37, MYB38 and MYB87 sequences are used to identify homologues from other species according to the methods herein, examples of which are included in Table 1
• MYB sequence refers to a polynucleotide sequence or a polypeptide sequence as contextually appropriate.
• the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in either of the sequences being compared for optimal alignment between the sequences).
• the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
• a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid “homology” is equivalent to amino acid or nucleic acid “identity”).
• the nucleic acid sequence homology may be determined as the degree of identity between two sequences.
• the homology may be determined using computer programs known in the art, such as GAP software provided in the GCG program package. See, Needleman and Wunsch 1970 J Mol Biol 48: 443-453.
• GAP software with the following settings for nucleic acid sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3
• the coding region of the analogous nucleic acid sequences referred to above exhibits a degree of identity preferably of at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99%, with the coding sequence (encoding) part of the DNA sequence shown in Table 1.
• sequence identity refers to the degree to which two polynucleotide or polypeptide sequences are identical on a residue-by-residue basis over a particular region of comparison.
• percentage of sequence identity is calculated by comparing two optimally aligned sequences over that region of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I, in the case of nucleic acids) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the region of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
• substantially identical denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence that has at least 80 percent sequence identity, preferably at least 85 percent identity and often 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison region.
• percentage of positive residues is calculated by comparing two optimally aligned sequences over that region of comparison, determining the number of positions at which the identical and conservative amino acid substitutions, as defined above, occur in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the region of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of positive residues.
• vectors preferably expression vectors, containing a nucleic acid encoding a MYB-subgroup14 protein, gene, analogs or homologs thereof.
• the sequence encoding a MYB-subgroup14 polypeptide may be a genomic sequence or a cDNA sequence.
• expression vector includes vectors which are designed to provide transcription of the nucleic acid sequence. The transcribed nucleic acid may be translated into a polypeptide or protein product.
• vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
• vector refers to a circular double stranded DNA loop into which additional DNA segments can be ligated.
• viral vector Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome.
• Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication). Other vectors are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
• certain vectors are capable of directing the expression of genes to which they are operatively-linked. Such vectors are referred to herein as “expression vectors”.
• expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
• plasmid and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector.
• the invention is intended to include such other forms of expression vectors, such as viral vectors or plant transformation vectors, binary or otherwise, which serve equivalent functions.
• the recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, that is operatively-linked to the nucleic acid sequence to be expressed.
• “operably-linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).
• regulatory sequence is intended to include promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
• Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences) or inducible promoters (e.g., induced in response to abiotic factors such as environmental conditions, heat, drought, nutrient status or physiological status of the cell or biotic such as pathogen responsive).
• tissue-specific regulatory sequences e.g., tissue-specific regulatory sequences
• inducible promoters e.g., induced in response to abiotic factors such as environmental conditions, heat, drought, nutrient status or physiological status of the cell or biotic such as pathogen responsive.
• suitable promoters include for example constitutive promoters, ABA inducible promoters, tissue specific promoters and abiotic or biotic inducible promoters.
• the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired as well as timing and location of expression, etc.
• the expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., MYB-subgroup14 proteins such as MYB68 proteins, mutant forms of MYB68 proteins, fusion proteins, etc.).
• the recombinant expression vectors of the invention can be designed for expression of a MYB-subgroup14 gene or a MYB-subgroup14 protein in prokaryotic or eukaryotic cells.
• a MYB-subgroup14 gene or a MYB-subgroup14 protein can be expressed in bacterial cells such as Escherichia coli , insect cells (using baculovirus expression vectors) yeast cells, plant cells or mammalian cells. Suitable host cells are discussed further in Goeddel, G ENE E XPRESSION T ECHNOLOGY : M ETHODS IN E NZYMOLOGY 185, Academic Press, San Diego, Calif. (1990).
• the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.
• a nucleic acid of the invention is expressed in plants cells using a plant expression vector.
• plant expression vectors systems include tumor inducing (Ti) plasmid or portion thereof found in Agrobacterium , cauliflower mosaic virus (CAMV) DNA and vectors such as pBI121, a pCAMBA series vector or one of preferred choice to a person skilled in the art.
• the recombinant expression cassette will contain in addition to a MYB-subgroup14 polynucleotide, a promoter region functional in a plant cell, a transcription initiation site (if the coding sequence to transcribed lacks one), and a transcription termination/polyadenylation sequence.
• the termination/polyadenylation region may be obtained from the same gene as the promoter sequence or may be obtained from different genes.
• Unique restriction enzyme sites at the 5′ and 3′ ends of the cassette are typically included to allow for easy insertion into a pre-existing vector.
• suitable plant expressible promoters include promoters from plant viruses such as the 35S promoter from cauliflower mosaic virus (CaMV) (Odell, et al., Nature, 313: 810-812 (1985)), promoters from genes such as rice actin (McElroy, et al., Plant Cell, 163-171 (1990)), ubiquitin (Christensen, et al., Plant Mol. Biol., 12: 619-632 (1992); and Christensen, et al., Plant Mol. Biol., 18: 675-689 (1992)), pEMU (Last, et al., Theor. Appl.
• CaMV cauliflower mosaic virus
• the Nos promoter the rubisco promoter, the GRP1-8 promoter, ALS promoter, (WO 96/30530), a synthetic promoter, such as Rsyn7, SCP and UCP promoters, ribulose-1,3-diphosphate carboxylase, fruit-specific promoters, heat shock promoters, seed-specific promoters and other transcription initiation regions from various plant genes, for example, including the various opine initiation regions, such as for example, octopine, mannopine, and nopaline.
• Useful promoters also include heat inducible promoters such as the HSP18.2 or HSP81.1 promoters (Takahashi et al. 1992, Plant J.
• Cryptic promoters are also useful for chimeric constructs useful in the invention.
• Cryptic gene regulatory elements are inactive at their native locations in the genome but are fully functional when positioned adjacent to genes in transgenic plants.
• a native MYB-subgroup14 promoter In addition to chimeric promoter-gene constructs the use of a native MYB-subgroup14 promoter is contemplated. Expression characteristics of a native promoter may be modified by inclusion of regulatory elements such that expression levels are elevated and or expressed ectopically and or constitutively. For example, a 4 ⁇ 35S enhancer sequence (Wiegel et al., 2000) may be included in a construct to enhance expression. Alternatively a population of plants may be produced by transformation with a construct having a 4 ⁇ 35S enhancer sequence, such as, a pSKI15 vector as per Wiegel et al., 2000. The transformed population can be screened for plants having increased expression of a MYB-subgroup14 sequence, or screened for plants having increased heat tolerance and reduced flower abortion, or a combination of such screens to identify a plant of interest.
• a 4 ⁇ 35S enhancer sequence such as, a pSKI15 vector as per Wiegel et al., 2000.
• Additional regulatory elements that may be connected to a MYB-subgroup14 encoding nucleic acid sequence for expression in plant cells include terminators, polyadenylation sequences, and nucleic acid sequences encoding signal peptides that permit localization within a plant cell or secretion of the protein from the cell.
• Such regulatory elements and methods for adding or exchanging these elements with the regulatory elements of a MYB-subgroup14 gene are known, and include, but are not limited to, 3′ termination and/or polyadenylation regions such as those of the Agrobacterium tumefaciens nopaline synthase (nos) gene (Bevan, et al., Nucl.
• Plant signal sequences including, but not limited to, signal-peptide encoding DNA/RNA sequences which target proteins to the extracellular matrix of the plant cell (Dratewka-Kos, et al., J. Biol. Chem., 264: 4896-4900 (1989)) and the Nicotiana plumbaginifolia extension gene (DeLoose, et al., Gene, 99: 95-100 (1991)), or signal peptides which target proteins to the vacuole like the sweet potato sporamin gene (Matsuka, et al., Proc. Nat'l Acad. Sci.
• the recombinant expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid).
• tissue-specific regulatory elements are known in the art.
• expression systems which are operable in plants include systems which are under control of a tissue-specific promoter, as well as those which involve promoters that are operable in all plant tissues.
• Organ-specific promoters are also well known.
• the chalcone synthase-A gene van der Meer et al., 1990 , Plant Molecular Biology 15(1):95-109
• the dihydroflavonol-4-reductase (dfr) promoter Elomaa et al., The Plant Journal, 16(1) 93-99
• the patatin class I promoter is transcriptionally activated only in the potato tuber and can be used to target gene expression in the tuber (Bevan, M., 1986 , Nucleic Acids Research 14:4625-4636).
• Another potato-specific promoter is the granule-bound starch synthase (GBSS) promoter (Visser, R. G. R, et al., 1991 , Plant Molecular Biology 17:691-699).
• organ-specific promoters appropriate for a desired target organ can be isolated using known procedures. These control sequences are generally associated with genes uniquely expressed in the desired organ. In a typical higher plant, each organ has thousands of mRNAs that are absent from other organ systems (reviewed in Goldberg, P., 1986 , Trans. R. Soc. London B314:343).
• the resulting expression system or cassette is ligated into or otherwise constructed to be included in a recombinant vector which is appropriate for plant transformation.
• the vector may also contain a selectable marker gene by which transformed plant cells can be identified in culture.
• the marker gene may encode antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamicin.
• the marker gene may encode a herbicide tolerance gene that provides tolerance to glufosinate or glyphosate type herbicides. After transforming the plant cells, those cells having the vector will be identified by their ability to grow on a medium containing the particular antibiotic or herbicide.
• Replication sequences of bacterial or viral origin, are generally also included to allow the vector to be cloned in a bacterial or phage host, preferably a broad host range prokaryotic origin of replication is included:
• a selectable marker for bacteria should also be included to allow selection of bacterial cells bearing the desired construct.
• Suitable prokaryotic selectable markers also include resistance to antibiotics such as kanamycin or tetracycline.
• DNA sequences encoding additional functions may also be present in the vector, as is known in the art. For instance, in the case of Agrobacterium transformations, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.
• host cell and “recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.
• Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques.
• transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell.
• a host cell of the invention such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) a polypeptide of the invention encoded in an open reading frame of a polynucleotide of the invention. Accordingly, the invention further provides methods for producing a polypeptide using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding a polypeptide of the invention has been introduced) in a suitable medium such that the polypeptide is produced. In another embodiment, the method further comprises isolating the polypeptide from the medium or the host cell.
• Plant host cells include, for example, plant cells that could function as suitable hosts for the expression of a polynucleotide of the invention include epidermal cells, mesophyll and other ground tissues, and vascular tissues in leaves, stems, floral organs, and roots from a variety of plant species, for example Arabidopsis, Brassica, Oryza, Zea, Sorghum, Gossypium, Triticum, Glycine, Pisum, Phaseolus, Lycopersicon, Trifolium, Cannabis, Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus,
• allelic variants of a MYB-subgroup14 or a MYB68 sequence that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequence of SEQ ID NO:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 88, 90, 91, 92, 94, 96, 98, 100, 102, 104, 106, 108, 109, 110, 112, 114, 116, 118, 120, 122, 124, 125, 127, 129, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153
• nucleotide substitutions leading to amino acid substitutions at “non-essential” amino acid residues can be made in the sequence of SEQ ID NO:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 89, 93, 95, 97, 99, 101, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 126, 128, 131, 133, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195,
• non-essential amino acid residue is a residue that can be altered from the wild-type sequence of a MYB-subgroup14 or a MYB68 without altering the biological activity, whereas an “essential” amino acid residue is required for biological activity.
• amino acid residues that are conserved among MYB-subgroup14 or MYB68 proteins of the present invention are predicted to be poor candidates for alteration. Alignments and identification of conserved regions are described herein and provide further guidance as to identification of essential amino acids and conserved amino acids.
• MYB-subgroup14 or MYB68 proteins differ in amino acid sequence from SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 89, 93, 95, 97, 99, 101, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 126, 128, 131, 133, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 157, 159, 161, 163, 165, 167, 169, 171,
• the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 75% homologous to the amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 89, 93, 95, 97, 99, 101, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 126, 128, 131, 133, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183,
• the protein encoded by the nucleic acid is at least about 80% homologous to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 89, 93, 95, 97, 99, 101, 103, 105, 107, 111, 113, 115, 117, 119, 121, 123, 126, 128, 131, 133, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203
• Mutations can be introduced into the nucleotide sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 88, 90, 91, 92, 94, 96, 98, 100, 102, 104, 106, 108, 109, 110, 112, 114, 116, 118, 120, 122, 124, 125, 127, 129, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184,
• conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.
• a “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art.
• amino acids with basic side chains e.g., lysine, arginine, histidine
• acidic side chains e.g., aspartic acid, glutamic acid
• uncharged polar side chains e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine
• nonpolar side chains e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan
• beta-branched side chains e.g., threonine, valine, isoleucine
• aromatic side chains e.g., tyrosine, phenylalanine, tryptophan, histidine
• a predicted nonessential amino acid residue in MYB68 is replaced with another amino acid residue from the same side chain family.
• mutations can be introduced randomly along all or part of a MYB-subgroup14 or a MYB68 coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity and the desired phenotypes.
• the invention includes a protoplast, plants cell, plant tissue and plant (e.g., monocot or dicot) transformed with a MYB-subgroup14 nucleic acid, a vector containing a MYB-subgroup14 nucleic acid or an expression vector containing a MYB-subgroup14 nucleic acid.
• plant is meant to include not only a whole plant but also a portion thereof (i.e., cells, and tissues, including for example, leaves, stems, shoots, roots, flowers, fruits and seeds).
• the plant can be any plant type including, for example, species from the genera Arabidopsis, Brassica, Oryza, Zea, Sorghum, Gossypium, Triticum, Glycine, Pisum, Phaseolus, Lycopersicon, Trifolium, Cannabis, Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browa
• the invention also includes cells, tissues, including for example, leaves, stems, shoots, roots, flowers, fruits and seeds and the progeny derived from the transformed plant.
• Numerous methods for introducing foreign genes into plants are known and can be used to insert a gene into a plant host, including biological and physical plant transformation protocols (See, for example, Miki et al., (1993) “Procedure for Introducing Foreign DNA into Plants”, In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson, eds., CRC Press, Inc., Boca Raton, pages 67-88; and Andrew Bent in, Clough S J and Bent A F, (1998) “Floral dipping: a simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana ”).
• the methods chosen vary with the host plant, and include chemical transfection methods such as calcium phosphate, polyethylene glycol (PEG) transformation, microorganism-mediated gene transfer such as Agrobacterium (Horsch, et al., Science, 227: 1229-31 (1985)), electroporation, protoplast transformation, micro-injection, flower dipping and biolistic bombardment.
• chemical transfection methods such as calcium phosphate, polyethylene glycol (PEG) transformation, microorganism-mediated gene transfer such as Agrobacterium (Horsch, et al., Science, 227: 1229-31 (1985)
• electroporation protoplast transformation
• micro-injection flower dipping and biolistic bombardment.
• Agrobacterium tumefaciens and A. rhizogenes which are plant pathogenic bacteria which genetically transform plant cells.
• the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes respectfully, carry genes responsible for genetic transformation of plants (See, for example, Kado, Crit. Rev. Plant Sci., 10:1-32 (1991)).
• Descriptions of the Agrobacterium vector systems and methods for Agrobacterium -mediated gene transfer are provided in Gruber et al., supra; and Moloney, et al, Plant Cell Reports, 8: 238-242 (1989).
• Transgenic Arabidopsis plants can be produced easily by the method of dipping flowering plants into an Agrobacterium culture, based on the method of Andrew Bent in, Clough S J and Bent A F, 1998.
• Floral dipping a simplified method for Agrobacterium -mediated transformation of Arabidopsis thaliana . Wild type plants are grown until the plant has both developing flowers and open flowers. The plants are inverted for 1 minute into a solution of Agrobacterium culture carrying the appropriate gene construct. Plants are then left horizontal in a tray and kept covered for two days to maintain humidity and then righted and bagged to continue growth and seed development. Mature seed is bulk harvested.
• a generally applicable method of plant transformation is microprojectile-mediated transformation, where DNA is carried on the surface of microprojectiles measuring about 1 to 4 ⁇ m.
• the expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate the plant cell walls and membranes.
• Aerosol Beam Injector (ABI) method described in U.S. Pat. No. 5,240,842, U.S. Pat. No. 6,809,232.
• Aerosol beam technology is used to accelerate wet or dry particles to speeds enabling the particles to penetrate living cells
• Aerosol beam technology employs the jet expansion of an inert gas as it passes from a region of higher gas pressure to a region of lower gas pressure through a small orifice.
• the expanding gas accelerates aerosol droplets, containing nucleic acid molecules to be introduced into a cell or tissue.
• the accelerated particles are positioned to impact a preferred target, for example a plant cell.
• the particles are constructed as droplets of a sufficiently small size so that the cell survives the penetration.
• the transformed cell or tissue is grown to produce a plant by standard techniques known to those in the applicable art.
• This procedure typically produces shoots within two to four months and those shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Shoots that rooted in the presence of the selective agent to form plantlets are then transplanted to soil or other media to allow the production of roots.
• the regenerated plants are self-pollinated to provide homozygous transgenic plants, or pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important, preferably inbred lines. Conversely, pollen from plants of those important lines is used to pollinate regenerated plants.
• a transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.
• a preferred transgenic plant is an independent segregant and can transmit the MYB68 gene and its activity to its progeny.
• a more preferred transgenic plant is homozygous for the gene, and transmits that gene to all offspring on sexual mating. Seed from a transgenic plant may be grown in the field or greenhouse, and resulting sexually mature transgenic plants are self-pollinated to generate true breeding plants. The progeny from these plants become true breeding lines that are evaluated for increased expression of the MYB68 transgene.
• the method includes introducing into one or more plant cells a compound that alters expression or activity of a MYB-subgroup14 in the plant to generate a transgenic plant cell and regenerating a transgenic plant from the transgenic cell.
• the compound increases MYB-subgroup14 expression or activity.
• the increased expression and or activity can additionally be directed to occur ectopically or constitutively or in a tissue specific manner.
• the compound can be, e.g., (i) a MYB-subgroup14 polypeptide; (ii) a MYB-subgroup14 nucleic acid and analogs and homologs thereof; (iii) a nucleic acid that increases expression of a MYB-subgroup14 nucleic acid.
• a nucleic acid that increases expression of a MYB-subgroup14 nucleic acid may include promoters or enhancer elements.
• the promoter is a heterologous promoter or a homologous promoter. Additionally, the promoter is a constitutive or an inducible promoter. Promoters include for example, organ specif promoter or tissue specific promoter. Promoter suitable for directing gene expression are know in the art and are described herein. Enhancer elements are known to those skilled in the art. For example the enhancer element is a 35S enhancer element.
• a control cell includes for example a cell that endogenously expresses a MYB subgroup-14 polypeptide such as a plant root cell, alternatively a control cell is a non transformed cell of the same cell-type as the transformed cell, be it a leaf cell a meristem cell or a flower or seed cell.
• An increase is a 1-fold, 2-fold, 3 fold or greater increase.
• An increase of expression is also meant to include expression of a MYB subgroup-14 polypeptide in a cell that does not typically express a MYB subgroup-14 polypeptide.
• the nucleic acid can be either endogenous or exogenous.
• the compound is a MYB-subgroup14 polypeptide or a MYB-subgroup14 nucleic acid encoding a MYB-subgroup14 polypeptide.
• the compound comprises the nucleic acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 88, 90, 91, 92, 94, 96, 98, 100, 102, 104, 106, 108, 109, 110, 112, 114, 116, 118, 120, 122, 124, 125, 127, 129, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186,
• the compound is a MYB-subgroup14 nucleic acid sequence from an endogenous source to the species being transformed.
• the compound is a MYB-subgroup14 nucleic acid sequence from an exogenous source to the species being transformed.
• the method includes introducing into one or more plant cells a compound that alters a MYB-subgroup 14 nucleic acid expression or activity in the plant to generate a transgenic plant cell and regenerating a transgenic plant from the transgenic cell.
• the compound increases a MYB-subgroup14 sequence expression or activity.
• the compound can be, e.g., (i) a MYB-subgroup14 polypeptide; (ii) a MYB-subgroup14 nucleic acid and analogs and homologs thereof; (iii) a nucleic acid that increases expression of a MYB-subgroup14 nucleic acid.
• a nucleic acid that increases expression of a MYB-subgroup14 nucleic acid may include promoters or enhancer elements.
• the nucleic acid can be either endogenous or exogenous.
• the compound is a MYB-subgroup14 polypeptide or a MYB-subgroup14 nucleic acid.
• the compound comprises the nucleic acid sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 88, 90, 91, 92, 94, 96, 98, 100, 102, 104, 106, 108, 109, 110, 112, 114, 116, 118, 120, 122, 124, 125, 127, 129, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186,
• An exogenous MYB-subgroup14 sequence expressed in a host species need not be identical to the endogenous MYB-subgroup14 sequence.
• sequences of three Arabidopsis GAMYB-like genes were obtained on the basis of sequence similarity to GAMYB genes from barley, rice, and L. temulentum . These three Arabidopsis genes were determined to encode transcription factors (AtMYB33, AtMYB65, and AtMYB101) and could substitute for a barley GAMYB and control alpha-amylase expression (Gocal et al. (2001) Plant Physiol. 127: 1682 1693).
• Maize, petunia and Arabidopsis MYB transcription factors that regulate flavonoid biosynthesis are very genetically similar and affect the same trait in their native species, therefore sequence and function of these MYB transcription factors correlate with each other in these diverse species (Borevitz et al. (2000) Plant Cell 12: 2383-2394).
• MYB-subgroup14 need only be functionally recognized in the host cell.
• Expression of MYB-subgroup14 encoding nucleic acids in Arabidopsis provides the basis of a functionally equivalent assay.
• expression of a MYB-subgroup14 from a Brassica , soybean, cotton or corn source in Arabidopsis and assessment of the heat tolerance demonstrates functional equivalence and provides a sound basis for prediction that the exogenous sequence is a MYB-subgroup14 gene and functions accordingly.
• MYB-subgroup14 sequences from Arabidopsis, Brassica and soybean that have been demonstrated to be functional in Arabidopsis in that the resulting plants have increased heat tolerance as indicated by reduced flower abortion and increased seed set under heat stress conditions during flowering.
• the transgenic plant has an altered phenotype as compared to a wild type plant (i.e., untransformed).
• altered phenotype is meant that the plant has a one or more characteristic that is different from the wild type plant.
• the transgenic plant has been contacted with a compound that increases the expression or activity of a MYB-subgroup14 nucleic acid
• the plant has a phenotype such as increased heat tolerance as compared to a wild type plant and manifests this trait in phenotypes such as decreased flower abortion, increased seed set and development, increased yield protection and protection of pollen development and protection of meristems, particularly flower meristems, from heat damage, drought tolerance and salt tolerance for example.
• Plants with a reduced flower abortion have a 5, 10, 20, 25, 30% or more increase in seed yield as compared to a control plant.
• the plant can be any plant type including, for example, species from the genera Arabidopsis, Brassica, Oryza, Zea, Sorghum, Gossypium, Triticum, Glycine, Pisum, Phaseolus, Lycopersicon, Trifolium, Cannabis, Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browa
• Heat stress tolerant plants are identified by exposing a population of flowering plants to a heat stress treatment and selecting a plant from the population of plants that has reduced flower abortion.
• Heat stress treatment includes for example exposing the plant to a temperature that is hot enough for a sufficient amount of time such that damage to plant functions or development results.
• reduced flower abortion is meant that a plant does not loss as many flowers, due to flower abortion, or has a greater seed yield compared to another plant that is exposed to a similar level of heat stress. Plants with a reduced flower abortion have a 5, 10, 20, 25, 30% or more increase in seed yield as compared to a control plant.
• Arabidopsis thaliana var. Columbia was transformed with pSKI15 vector containing a 4 ⁇ 35S enhancer sequence (Wiegel et al., 2000).
• a T3 population of Arabidopsis seed was obtained from ABRC and used to produce a T4-generation that was used in genetic screen experiments.
• the Arabidopsis h138 mutant was identified as having reduced or no flower abortion, relative to a wild type control, when exposed to a heat stress during flowering of about 45° C. for about 30 to 60 minutes.
• Initial isolates were retested by having flowering plants subjected to a 1 hour temperature ramp-up from 22° C. to 45° C. followed by a 2 hour heat stress of 45° C., flower production, seed set and seed development was monitored and heat tolerant lines selected.
• Genome walking to localize the T-DNA activation tag insertion was performed as follows. Genomic DNA was purified by phenol:chloroform extraction using 10-day-old seedlings of mutant h138. The isolated DNA was subsequently digested by the restriction enzymes such as EcoRV, PvuII, NruI, or Stul to generate DNA fragments with blunt ends. The resulting fragments from each digestion were ligated to an adaptor that was formed by the annealing of two oligos: Adaptor 1 and Adaptor 2. The addition of the adaptor to the DNA fragments enables PCR amplification using primers specific to the adaptor and a T-DNA insertion site.
• PCR programs TOUCH1 (6 cycles of 94° C., 25 sec; 72° C., 7 min; 32 cycles of 94° C., 25 sec; 67° C., 7 min and 1 cycle of 67° C., 10 min) and TOUCH2 (4 cycles of 94° C., 25 sec; 72° C., 7 min; 20 cycles of 94° C., 25 sec; 67° C., 7 min and 1 cycle of 67° C., 10 min) were used for the two rounds of PCR. All PCR was carried out using Ex-Taq as DNA polymerase and a Biometra® thermocycler. The PCR products were sequenced, and the flanking genomic sequences identified.
• the 4 ⁇ 35S enhancers were inserted into an intergenic region that is 5 kb down stream of 3′ end of genomic AtMYB68 (AT5G65790) on chromosome 5.
• Northern analysis and real-time PCR showed that the expression of MYB68 in h138 was induced to more than 2 fold relative to wild type.
• Plants were assessed for heat tolerance during flowering and scored based on the number of aborted flowers or pods and final seed yield. Plants were grown in controlled environment chambers where optimal growth conditions were 16 hr light 200 uE and 8 hr dark, 22° C. and 70% relative humidity. Three groups of plants were used in the experimental design; 1) A control group grown under optimal conditions; 2) a 3-hour heat treatment group and; 4) a 4-hour heat treatment group. Heat treatment was performed 6 days after first open flower and the temperature was ramped from 22° C. to 44° C. over a 1-hour period. Each group of plants contained the myb68 mutant and its wild type control (myb68-null) with 10 replicate pots per entry per treatment with each pot containing 5 plants. Plants were assessed for flower abortion a week following the heat stress treatments then left to grow under optimal conditions until maturity. Final seed yield per pot was determined for all 3 groups of plants.
• the seed yield of myb68 was lower than that of the myb68-null control in both the 3-hour (25%) and 4-hour (17%) stress treatments however the difference was only statistically significant for the 3-hour treatment.
• the 3-hour treatment resulted in 32% fewer aborted pods relative to myb68-null and the final seed yield was increased by 16% relative to myb68 plants grown in optimal conditions.
• the 4-hour treatment also resulted in a 16% increase in seed yield relative to optimally grown myb68 plants.
• the myb68-null showed 15% and 23% reductions in seed yield relative to optimally grown plants.
• the overall yield protection provided by the myb68 mutation was 31% and 39%, relative to the wild-type. Additional experiments have shown results of yield protection ranging from 5% to 44% depending on the experimental conditions.
• expression vector constructs can be produced using appropriate promoters and a MYB gene of the invention.
• Vectors to over-express MYB68 under regulatory control of either constitutive or conditional promoters may be constructed, as described below.
• the sequence encoding a MYB68 open reading frame has been operably linked to the promoter sequences of the 35S CaMV constitutive promoter, the P18.2 or P81.1 heat inducible promoters and its endogenous PMYB68 promoter. Additionally the genomic sequence of MYB68 has been cloned behind the 35S CaMV constitutive promoter in a pEGAD vector backbone.
• a 1.4 kb of MYB68 genomic DNA including 83 bps of 3′ UTR was amplified by PCR using primers: MYB68FW-BamH3 (5′-AAAGGATCCATGGGAAGAGCACCGTGTTG-3′) (SEQ ID NO:300) and MYB68RV-BamH4 (5′-AAAGGATCCCCACTCCCTAAAGACACAGATTT-3′) (SEQ ID NO:301), and subsequently digested with BamHI.
• the resulting DNA fragment was ligated into pBluescript II SK (+/ ⁇ ), and then subcloned into pEGAD at the same site to obtain 35S-gemonicAtMYB68 (35S-gAtMYB68) in pEGAD.
• AtMYB84 (At3g49690), AtMYB36 (At5g57620), AtMYB37 (At5g23000), AtMYB38 (At2g36890) and AtMYB87 (At4g37780) are classified as members of the MYB-subgroup14 family along with AtMYB68 (Stracke et al., 2001), therefore it is possible that their functions are redundant.
• These MYB genes are over-expressed in Arabidopsis to test their functionality as an AtMYB68 orthologue with respect to heat tolerance.
• the cDNA sequences are amplified by RT-PCR, and cloned into pBI121 without GUS to generate constructs of 35S-AtMYB84, 35S-AtMYB36, 35S-AtMYB37, 35S-AtMYB38 and 35S-AtMYB87.
• AtMYB68 cDNA was produced by RT-PCR using primers HG2F (5′-AAATCTAGAATGGGAAGAGCACCGTGTT-3′) (SEQ ID NO:302) and HG2R (5′-AAAGGATCCTTACACATGATTTGGCGCAT-3′) (SEQ ID NO:303), and digested with XbaI and BamHI.
• the resulting DNA fragment was cloned into pBluescript II SK (+/ ⁇ ), and then into pBI121 without GUS to generate 35S-MYB68.
• pBI121 without GUS was obtained by SmaI and EcolcR1 double digestion and followed by self-ligation of the remaining vector.
• AtMYB84 The coding sequence of AtMYB84 (933 bp, AtMYB84, At3g49690) was amplified by RT-PCR using forward primer 690M84-Xba-FW containing an XbaI site (5′-acgt TCTAGA ATG GGA AGA GCA CCG TGT TG-3′) (SEQ ID NO:273) and reverse primer 690M84-Bam-Re containing a BamHI site (5′-atcg GGATCC TTA AAA AAA TTG CTT TGA ATC AGA ATA-3′) (SEQ ID NO:274).
• the PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct of 35S-AtMYB84.
• AtMYB36 (1002 bp, AtMYB36, At5g57620) was amplified by RT-PCR using forward primer M36-Xb-FW containing an XbaI site (5′-actg TCTAGA ATG GGA AGA GCT CCA TGC TG-3′) (SEQ ID NO:304) and reverse primer M36-Bm-Re containing a BamHI site (5′-cagt GGATCC TTA AAC ACT GTG GTA GCT CAT C-3′) (SEQ ID NO:305).
• the PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct of 35S-AtMYB36.
• AtMYB37 (990 bp, AtMYB37, At5g23000) was amplified by RT-PCR using forward primer AM37-Xb-FW containing an XbaI site (5′-actg TCTAGA ATG GGA AGA GCT CCG TGT TG-3′) (SEQ ID NO:306) and reverse primer AM37-Bm-Re containing a BamH I site (5′-acgt GGATC CTA GGA GTA GAA ATA GGG CAA G-3′) (SEQ ID NO:307).
• the PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct of 35S-AtMYB37.
• AtMYB38 The coding sequence of AtMYB38 (897 bp, AtMYB38, At2g36890) was amplified by RT-PCR using forward primer AM38-Xb-FW containing an XbaI site (5′-actg TCTAGA ATG GOT AGG GCT CCA TGT TGT-3′) (SEQ ID NO:308) and reverse primer AM38-Bm-Re containing a BamH I site (5′-acgt GGATCC TCA GTA GTA CAA CAT GAA CTT ATC-3′) (SEQ ID NO:309).
• the PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct of 35 S-AtMYB38.
• AtMYB87 (918 bp, AtMYB87, At4g37780) will be amplified by RT-PCR using forward primer M87-Xb-FW containing an XbaI site (5′-aaaa TCTAGA ATG GGA AGA GCA CCG TGC-5′) (SEQ ID NO:310) and reverse primer M87-Bg-Re containing a Bg12 site (5′-aaaa AGATCT CTA CTC ATT ATC GTA TAG AGG-3′) (SEQ ID NO:311).
• the PCR product will be cloned at the XbaI-BamHI sites in pBI121, generating construct of 35S-AtMYB87.
• the construction involved 4-steps; 1) a 869 bp of Hsp18.2 promoter, and a 406 bp of Hsp81.1 promoter were amplified by PCR using primer sets: HP1F (SEQ ID NO: 277) and HP1R (SEQ ID NO:278), and HP2F (SEQ ID NO:279) and HP2R (SEQ ID NO:280), respectively, and digested with SalI and XbaI.
• the resulting DNA fragments were cloned into pBI101 at the same sites to generate the new vectors: P18.2pBI101 and P81.1pBI101; 2) a MCS2-oligo (including restriction sites of XbaI, HpaI, Agel, KpnI, XhoI, ScaI, SpeI, SalI, BamHI and SmaI) was cloned into the new vectors at XbaI and SmaI sites.
• a MCS2-oligo including restriction sites of XbaI, HpaI, Agel, KpnI, XhoI, ScaI, SpeI, SalI, BamHI and SmaI
• the resulting vectors were named P18.2pBI101MCS and P81.1pBI101MCS; 3) the GUS gene was removed by SmaI and EcolcR1 double digestion and followed by self-ligation of the remaining vector to give vectors P18.2pBI101MCS without GUS and P81.1pBI101MCS without GUS; 4) the 1.1 kb of MYB68 cDNA fragment was ligated into the two newer vectors at XbaI and BamHI sites to complete the construction of P18.2pBI101 MCS without GUS for P18.2-MYB68, and P81.1 MCSpBI121 without GUS for P81.1-MYB68.
• AtMYB68 The coding sequence of AtMYB68 was isolated by restriction digestion with XbaI and BamHI from plasmid pHSP18.2-AtMYB68, and cloned at the XbaI-BamHI sites in pHSP81.1.
• the promoter sequence ( ⁇ 1 to ⁇ 506 bp, relative to ATG start codon) of the Arabidopsis hydroxy pyruvate reductase gene was amplified by PCR from Arabidopsis genomic DNA using a forward primer containing a Sal I site (HPR-Sal-FW, acgt gtcgac GAAGCAGCAGAAGCCTTGAT) (SEQ ID NO:312) and a reverse primer containing an Xba I site (HPR-Xb-R2, acgt tctaga GGT AGA GAA AAG AGA aag cct c) (SEQ ID NO:313).
• the digested fragment was cloned into the vector pHSP81.1-AtMYB68 that was pre-digested with SalI and XbaI to remove the HSP81.1 promoter. This generates a recombinant plasmid with the HPR promoter placed in front of AtMYB68.
• the AtMYB68 promoter ( ⁇ 1 through ⁇ 1034 with respect to the MYB68 ATG start codon) was amplified by PCR using primers: Pm68-H3-FW (SEQ ID NO:275) and Pm68-Av-Xh-Re (SEQ ID NO:276), and digested by restriction enzymes: HindIII and XhoI.
• the resulting promoter fragment was cloned into P81.1MCSpBI121 without GUS at the same sites, replacing the Hsp81.1 promoter.
• This vector is then named PMYB68pBI121, and used for further cloning of AtMYB68 cDNA (1.1 kb) at Avr II and BamHI sites to obtain PMYB68-AtMYB68.
• the AvrII-BamHI fragment of MYB cDNA was recovered from the plasmid 18.2-MYB68.
• AtMYB84 The coding sequence of AtMYB84 (933 bp, AtMYB84, At3g49690) was amplified by RT-PCR using forward primer 690M84-Xba-FW containing an XbaI site (5′-acgt TCTAGA ATG GGA AGA GCA CCG TGT TG-3′) (SEQ ID NO:273) and reverse primer 690M84-Bam-Re containing a BamHI site (5′-atcg GGATCC TTA AAA AAA TTG CTT TGA ATC AGA ATA-3′) (SEQ ID NO:274).
• the PCR product was cloned at the AvRII-BamHI sites in pB-Pm68, generating construct of AtMYB84 under control of the AtMYB68 promoter.
• AtMYB36 (1002 bp, At5g57620) was amplified from RNA isolated from young Arabidopsis seedlings (leaves and roots) by RT-PCR using forward primer M36-Xb-FW containing an XbaI site (5′-actg TCTAGA ATG GGA AGA GCT CCA TGC TG-3′) (SEQ ID NO:305) and reverse primer M36-Bm-Re containing a BamHI site (5′-cagt GGATCC TTA AAC ACT GTG GTA GCT CAT C-3′) (SEQ ID NO:306).
• the PCR product was cloned at the Avr II and BamHI sites in pBI-Pm68 described above. This generated a construct of AtMYB36 under control of the AtMYB68 promoter.
• Rice MYB36 cDNA homolog The coding sequence (966 bp) of a rice MYB36 gene (SEQ ID NO:9), encoding a protein identified as SEQ ID NO:10 was amplified by RT-PCR from rice root RNA using forward primer rM-Xb-FW2 containing an XbaI site (5′-acgt TCTAGA ATG GGG AGA GCG CCG TGC TG-3′) (SEQ ID NO:314) and reverse primer rM-Bm-Re2 containing a BamH I site (5′-tgca GGATCC CTA CTG CAT CCC GAG GTC AG CT-3′) (SEQ ID NO:315). The PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct 35S-Os MYB36.
• Rice MYB genomic homolog clone Using the same primers described above forward primer rM-Xb-FW2 (SEQ ID NO:314) and reverse primer rM-Bm-Re2 (SEQ ID NO:315), the genomic sequence of the rice MYB36 gene (SEQ ID NO:265) was amplified (1259 bp). The PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct 35S-gOsMYB36.
• the soybean MYB161 is a homolog of Arabidopsis MYB84.
• the term ‘soybean MYB84’ is used interchangeably with Soybean MYB161.
• the 1068 bp coding sequence of a soybean MYB161 was cloned by RT-PCR from soybean root RNA using forward primer soybM-Xba-FW2 containing an XbaI site (5′-acgt TCTAGA ATG GGG AGG GCA CCT TGC T-3′) (SEQ ID NO:316) and reverse primer soybM-Bm-Re containing a BamHI site (5′-acgt GGATC CTA TTG CGC CCC CGG GTA G-3′) (SEQ ID NO:317).
• the PCR product was cloned at the XbaI-BamHI sites in pBI121, generating construct 35S-GmMYB84.
• the corn MYB36 cDNA (SEQ ID NO:261) was amplified by PCR using primers: ZmYYBFW-XbaI (5′-aaatctagaATGGGGAGAGCTCCGTGCTGCGACA-3′) (SEQ ID NO:318) and ZmMYBRV-BamHI2 (5′-aaaggatccCTACTTCATCCCAAGGTTTCCTGGC-3′) (SEQ ID NO:319).
• the DNA fragment was digested by XbaI and BamHI and subsequently ligated to the same sites at pBluescript II SK (+), and then subcloned into the same sites of pBI121 replacing GUS.
• the cotton MYB68 cDNA was amplified by PCR using primers: CotM-Xb-Fw (5′-acgt TCTAGA ATG GGG AGA GCT CCT TGT TG-3′) (SEQ ID NO:320) and CotM-Bm-Re (5′-acgt GGATCC CTA TTG CGC TCC TCC TGG G-3′) (SEQ ID NO:321).
• the DNA fragment was digested by XbaI and BamHI. It was ligated to the same sites at pBluescript II SK (+), and then subloned into the same sites in pBI121 replacing GUS.
• the canola root MYB cDNA was amplified by PCR using primers: Bn68root-FW-XbaI (5′-aaatctagaATGGGAAGAGCACCGTGTTGTGATAAGGCC-3′) (SEQ ID NO:322) and Bn68root-RV-BamHI (5′-aaaggatccTTACACATTATTTGGCCCATTGAAGTATCTTGC-3′) (SEQ ID NO:323).
• the DNA fragment was digested by XbaI and BamHI. It was ligated to the same sites at pBluescript II SK (+). The same fragment was then subcloned to the same sites in pBI121 replacing GUS.
• the canola bud MYB cDNA was amplified by PCR using primers: Bn68Bud-FW-XbaI (5′-aaatctagaATGGGAAGAGCACCGTGTTGTGACAAGGCT-3′) (SEQ ID NO:324) and Bn68Bud-RV-BamHI (5′-aaaggatccTTACAAATGATTTGCCCCATTGAAGTAACTTGC-3′) (SEQ ID NO:325).
• the DNA fragment was digested by XbaI and BamHI. It was ligated to the same sites at pBluescript II SK (+). The same fragment was then subcloned to the same sites in pBI121 replacing GUS.
• Table 2 describes oligonucleotide primers used to make the vector constructs described above, and additional primers useful for cloning AtMYB homologues.
• the expression vector constructs of the invention can be introduced into Arabidopsis , the plant of origin or any species of choice.
• an Arabidopsis MYB gene may be over expressed in a Brassica species or alternatively a soybean, maize, rice or cotton species.
• gradation of expression levels and physiological response will exist.
• the gradation of variation is a result of the site of integration of the gene construct and the local environment for gene expression at that locus. Therefore, lines must be screened and evaluated in order to select the best performing lines. This process is one of routine to one skilled in the art.
• Homozygous lines expressing a 35S-MYB68 expression construct have been evaluated in a heat and flower abortion experiment.
• the experimental set up included 8 replicate plants per line with 1 plant per 3′′ pot and grown under optimal conditions in a controlled environment chamber (18 hr light at 200 uE, 6 hr dark, 22° C., 70% relative humidity). Three days after the appearance of the first flower, plants were exposed to a heat shock of 1 hour at 42° C. and returned to optimal conditions for a further 7 days. Plants were assessed for flower abortion on the main stem. Lines were identified that demonstrated reduced flower abortion rates from 34% to 60% relative to wild type controls.
• Seed yields and yield protection expressed as a percent relative to wild type, was determined for nine independent 35S-MYB68 transgenic lines.
• the experimental set up included 3 plants per 3′′ pot which were grown as above with 22 replicates per line. Three days after the appearance of the first flower, 12 replicates per line were exposed to a 3-hour heat stress at 45° C. with a 1 hour ramp up from 22° C. Three days later the heat stress was applied again. The remaining 10 replicates the plants per line were maintained under optimal conditions throughout their life cycle. The final seed yield was determined for all the plants. Wild type plants showed a 40% reduction in yield due to the applied heat stress whereas transgenic lines, while still having a reduced yield due to heat stress the reduction was less severe resulting in a 10% to 12% yield protection.
• the best line showed only 70% of the heat damage as the control.
• Two of the transgenic lines examined here also showed reduced flower abortion at the T2 stage of screening.
• the myb68 mutant, included as a positive control also showed a reduction in the total number of damaged pods as compared to its segregating null control (myb68-null).
• Seeds were sterilized and placed on agar plates with 1 ⁇ 2 MS growth media containing salt (200 mM NaCl) or no salt (optimal plates) with 6 plates per entry and 30 seeds per plate. After 3 days at 4 C plates were placed in the growth room at 22 C, and 18 hr lights (100 uE) for 16 days. After 7 days plates were scored for germination and after additional 9 days seedlings were scored for bleaching (% white seedling indicative of stress). No differences were found between controls and transgenic lines or the mutant in germination on optimal plates and on salt plates. But after 16 days of salt exposure seedlings showed signs of stress by becoming bleached. Results indicated that the myb68 mutant and the transgenic 35S-Myb68 expressing lines had fewer bleached seedlings which are indicative of lower sensitivity to salt stress.
• the 35S-Myb68 Arabidopsis plants were grown in 3′′ pots with 3 plants per pot and 10 replicates per optimal treatment and 12 replicates per heat treatment. All plants were grown under optimal conditions until 2 days into flowering. At that point optimal plants remained in optimal conditions (22 C, 18 hr light of 200 uE, 70% RH) and the test group had a daily heat treatment applied by increasing temperature from 22° C. to 45° C. over a 1 hr ramp period and maintaining that temperature for 1.5 to 2.5 hr for five consecutive days. Plants recovered for a two day period without applied stress after which stress was applied again for an additional three days (total of eight days of heat treatment). Following the heat treatments plants were maintained in optimal conditions till maturity together with the optimal group and final seed yield of both groups was determined. The results indicate that four 35S-Myb68 transgenic lines (22-7, 20-11, 35-1 and 8-6) showed yield protection following the heat stress treatments that ranged from 8 to 21% relative to controls.
• Two closely related Myb68 sequences were identified from Brassica . Their expression patterns differ in that one is expressed predominately in the roots (SEQ ID NO:54), the other in flower buds (SEQ ID NO:56). Plants having constructs expressing either of the BnMyb68 were produced and evaluated. Plants were grown in 2.25′′ pots (1/pot) under optimal conditions (22 C, 50% RH, 17 hr light of 200 uE) until 3 days from first open flower. Plants were transferred from 22 C to 43 C for 2-2.5 hr (see tables below). Following this heat stress plants were returned to optimal conditions at 22 C for a week. One week following the heat stress number of aborted flowers was counted.
• Transgenic lines of 35S-BnMyb68(root) construct showed fewer aborted pods than its control (null).
• Two transgenic lines of 35S-BnMyb68(bud) construct showed reduced flower abortion following heat stress than their control (null line).
• the T2 seeds were plated on 0.5 ⁇ MS agar plates with vitamins (1 plate/flat). Each test group included a positive control, the original heat tolerant mutant myb68, and a corresponding wild type. Seedlings were transplanted to soil on day ten post germination. At the early flowering stage, plants were placed into a heating chamber at 45° C., 65% humidity) for 24-30 minutes. The plants were then placed back into the growing chamber under normal growth conditions (17 h light/7 h dark, 200 ⁇ E, 22° C., 70% humidity). Plants were examined on day thirty-two and scored for aborted siliques, partially aborted siliques, dead meristems or normal siliques. A heat stress was deemed effective if a majority of wild type plants had significant flower abortion Transgenic lines were assessed for gene expression by RT-PCR and demonstrated to have elevated expression levels.
• Constructs and transgenic plants are produced using homologous of Myb-subgroup14 sequences from desired crop species, for example, rice, corn, wheat, soybean and cotton and evaluated for heat tolerance.
• myb68-null Three of the lines examined here also showed reduced flower abortion at the T2 stage of screening.
• transgenic lines having an Arabidopsis Myb68 gene sequence under the control of a constitutive promoter or a heat inducible promoter were evaluated for heat stress tolerance under growth chamber conditions. These lines were at the T2 stage and were heterozygous, with the exception of the 01-105G-1-E line. Analysis of heterozygous lines typically produces greater variation than the same analysis performed on homozygous lines. However, early analysis allows for screening and subsequent analysis of the derived homozygous lines. Segregating nulls and the parent DH12075 were included as controls. The experiment was arranged in a split-plot design with temperature as main factor and transgenic line as subfactor.
• the plants were grown in 15 cm plastic pots filled with “Sunshine Mix #3” under approximately 500 ⁇ mol m ⁇ 2 s ⁇ 1 photosynthetically active radiation at the top of the crop canopy. Molecular analysis was performed to confirm transgene presence. Two groups of plants were included in the test; one group was grown under optimum conditions (22/18° C. day/night temperature, 16-h photoperiod) throughout the growing period, while the second group was subjected to heat stress at 31° C. for 5 hr. per day (ramped-up from 18 to 31° C., then back down to 18° C.). Heat stress conditions were initiated on the third day following the first flower opening and for seven days thereafter. The heat-stressed plants were then returned to optimum conditions until maturity.
• the gradation of variation is a result of the site of integration of the gene construct and the local environment for gene expression at that locus. This gradation is expected and therefore, lines must be screened and evaluated in order to select the best performing lines. This process is one of routine to one skilled in the art.
• Seed yield differed among the tested lines.
• Lines 02-104G-3-K, 02-104G-4-A and 01-105G-1-E had a slightly higher seed number per raceme but the other transgenic lines (02-33H-1-V and 01-105G-3-G) had significantly lower seed number per raceme compared the parent line. There were no significant differences in 100 seed weight among the tested lines.
• transgenic lines expressing the Arabidopsis Myb68 gene demonstrated significant protection against flower abortion during heat stress imposed at flowering. Additionally, three transgenic lines indicated a trend of increased seed yield.
• MYB-subgroup14 sequences have been is defined as a nucleotide or protein sequence comprising an Arabidopsis the characteristics described herein.
• the MYB-subgroup14 is a R2R3 MYB sequence that additionally comprises a conserved motif or motifs as described by the following patterns.
• the general pattern provides a sequence that can be used to identify a candidate MYB-subgroup14 sequence. At some positions multiple amino acid residues are permitted at a given location. Where multiple amino acids are permitted, the optional residues are indicated within square brackets. Where a R2R3MYB protein sequence fits the general pattern it is likely to be a MYB-subgroup14 sequence. A MYB-subgroup14 sequence may be less than identical to the general pattern, for example it may be 90%, 95% or 99% identical.
• a candidate MYB-subgroup14 sequence, matching the general pattern further includes a match to the exclusive pattern (SEQ ID NO:267) then the sequence is a strong candidate for inclusion as a MYB-subgroup14 sequence.
• the exclusive sequence defines the pattern of amino acids that are present in MYB-subgroup14 sequences but may differ in other R2R3 MYB proteins. Presence of the exclusive pattern within a MYB protein is a strong indicator that the MYB is a member of the MYB-subgroup14 family.
• a candidate MYB-subgroup14 sequence, matching the general pattern further includes a match to the absolute pattern (SEQ ID NO:268) then the sequence is a strong candidate for inclusion as a MYB-subgroup14 sequence.
• the Absolute pattern represents sequence residues present in all MYB-subgroup14 sequences analyzed to date.
• MYB-subgroup14 sequences can be defined by the consensus sequence of SEQ ID NO:266. Positions have been identified in which the amino acid residues are found exclusively or predominately in the MYB-subgroup14 sequences. In the following description all position numbers are in reference to Arabidopsis MYB68 protein (SEQ ID NO:2) which correlates to the general consensus sequence above, SEQ ID NO:266.
• a positively charged (K or R) residue is conserved in MYB-subgroup14. Although this amino acid is not exclusive to this subgroup at this position, the tendency for the rest of the Arabidopsis MYB proteins is for a hydrophobic residue, with over 50% of all MYB proteins having a hydrophobic isoleucine or valine residue (Stracke et al., 2001).
• members of the MYB-subgroup14 predominantly contain a hydrophobic isoleucine residue.
• a rice homologue identified as SEQ ID NO:191, which possesses a glutamine at this position.
• SEQ ID NO:191 a rice homologue identified as SEQ ID NO:191
• isoleucine appears to be exclusive to MYB-subgroup14.
• positively charged residues (39% R), and polar residues (23% N) are most prevalent at this position.
• all MYB-subgroup14 members contain the positively charged histadine residue.
• a positively charged residue appears at this position in all MYB proteins; however in contrast to the MYB-subgroup14, in other MYB proteins 73% contain an arginine (R) and 17% contain a lysine residue.
• members of MYB-subgroup14 contain the polar serine residue, while almost all other MYB proteins (91%) contain the polar asparagine residue.
• a serine residue appears to be exclusive to this subgroup.
• the absence of a serine at position 88 does not necessarily exclude it as a member of MYB-subgroup14 as at least one MYB-subgroup14 member has been identified that possesses a phenylalanine residue in position 88, for example SEQ ID NO:256.
• members of MYB-subgroup14 contain a positively charged arginine or lysine residue.
• the majority of MYB proteins also contain positively charged residues at this position, however, histadine (48%) is the most prevalent residue found.
• the absence of a arginine at position 112 does not necessarily exclude it as a member of MYB-subgroup14 as at least one MYB-subgroup14 member has been identified that possesses a glutamic acid residue in position 112, for example SEQ ID NO:68 contains a glutamic acid residue and SEQ ID NO:191 contains a threonine.
• a R2R3 domain of a MYB-subgroup14 sequence may be 90% homologous, preferably 95% homologous or more preferably 99% homologous to the consensus sequence presented.
• MYB68 and MYB84 sequences contain two further conserved motifs identified as S1 (SFSQLLLDPN) (SEQ ID NO:269) and S2 (TSTSADQSTISWEDI) (SEQ ID NO:270). These motifs are found in both Arabidopsis and Brassica MYB68, MYB36 and MYB84 sequences and show at least 70% homology within the amino acid sequence.
• homology to the S1 or S2 motifs was found to exist in orthologs in Brassica napus (Canola), Brassica rapa (Cabbage), Brassica oleracea, Raphanus raphanistrum (Radish), and homology to the S2 region in Poncirus trifoliate (Orange), and weak homology in a Medicago trunculata homologue and Vitis Vinifera (Grape) homologue within the S2 region.
• S1 or S2 motif target sequences show homology of at least 70%, more preferably 80% and most preferably 95%.
• the MYB68 and MYB84 sequences from species other than Arabidopsis and Brassica may not contain a S1 and S2 motif but may still be classified as a MYB subgroup-14 sequence based on sequence analysis and inclusion of other criteria.
• the top homologues are determined using programs such as tblastn, tblastp, searches against available databases in NCBI, such as the EST, GSS, HTG and chromosomal databases, as well as other genomic databases, such as the TIGR unigene database, Cucurbit genomics database (http://www.icugi.org/), Sunflower and Lettuce (http://compgenomics.ucdavis.edu/compositae_index.php), Medicago truncatula (International Medicago Genome Annotation Group), SGN (http://www.sgn.cornell.edu/), and Orange (http://harvest.ucr.edu/).
• the alignment parameters such as Gap costs, matrix values can be appropriately changed.
• AtMYB68 in each species is in fact a MYB68 homologue
• a reciprocal blast can be performed, in which the homologue is blasted against all Arabidopsis proteins.
• the homologue's closest Arabidopsis hit is to one of MYB68's gene family members (a MYB subgroup-14), instead of MYB68 itself.
• the homologue is assessed not to be a MYB-subgroup14 member.
• Open reading frames may be determined using programs such as “getorf” from the EMBOSS program, or ESTScan.
• PRATT is a tool provided by the PROSITE database. It generates conserved patterns from a group of conserved proteins http://www.expasy.ch/prosite/. PRATT was used to determine a conserved pattern between MYB68 and its closest homologues. ScanProsite and PHI-BLAST was then used to look for the conserved pattern in the Swiss-Prot and NCBI protein databases respectively. The search results are limited to alignments that also contain the pattern.
• HMMBuild was used to build a hidden markov model using the MYB68 and its homologues.
• HMMSearch was used to scan NCBI's protein database using the hidden markov model. Similar proteins to the basic blastp search were found.
• MYB68 homologues were found in over 50 different plant species. Homology was restricted in most cases to the N-terminal MYB DNA binding domain. Homology in the less conserved C-terminal region existed in genes found in Brassica napus (Canola), Brassica rapa (Cabbage), Brassica oleracea, Raphanus raphanistrum (Radish), Poncirus trifoliate (Orange), and weak homology in genes found in Medicago trunculata homologue and Vitis Vinifera (Grape) within the S2 region.
• the Poncirus trifoliate and Brassica rapa genes were identified by downloading strong EST hits, and assembling them using CAP3. The resulting contigs did not code for a complete protein.
• InterProScan is particularly useful as it provides an interface to query 13 programs simultaneously.
• the databases incorporated in InterPro include
• Propom a database of protein domain families. Built by clustering homologous segments from Swiss-Prot/Trembl database, followed by recursive PSI-BLAST searches.
• HMMTIGR Protein families represented by Hidden Markov Models.
• TMHMM Prediction of transmembrane helices in proteins.
• FPrintScan Searches the PRINTS database of fingerprints. Fingerprints are protein families represented by multiple motifs.
• ProfileScan Profiles from family related sequences.
• HMMPanther A database of hidden markov models
• HMMPIR Hidden markov models based on evolutionary relationship of whole proteins.
• ScanRegExp Scans the prosite database of patterns and profiles
• Gene3D a database of proteins containing functional information
• HMMPfam Protein domain families represented by hidden markov models.
• k) Superfamily a database of structural and functional protein annotations for all completely sequenced organisms.
• HMMSmart Allows the identification of mobile domains based on hidden markov models.
• SignalIP predicts the presence and location of signal peptide cleavage sites in amino acid sequences.
• Blocks are multiply aligned ungapped segments corresponding to the most highly conserved regions of proteins.
• the MYB domain is represented by three blocks.
• AtMYB68 contained each of these three blocks, as well as 1 of the 5 Wos2 blocks.
• the invention is based in part on the discovery of plants that are heat stress tolerant.
• the gene responsible for the heat tolerant phenotype has been determined and shown to be a MYB68 gene.
• Methods of producing a heat tolerant transgenic plant are disclosed herein.
• the invention identifies a transcription factor gene family, specifically the MYB gene family, and in particular a MYB-subgroup14 that when expressed in plants results in plants that are heat stress tolerant and have an increased yield following a heat stress or display tolerance to drought stress or salt stress.
• BLAST Basic Local Alignment Search Tool
• the tblastn or blastn sequence analysis programs were employed using the BLOSUM-62 scoring matrix (Henikoff, S, and Henikoff, J. G. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919).
• the output of a BLAST report provides a score that takes into account the alignment of similar or identical residues and any gaps needed in order to align the sequences.
• the scoring matrix assigns a score for aligning any possible pair of sequences.
• the P values reflect how many times one expects to see a score occur by chance. Higher scores are preferred and a low threshold P value threshold is preferred. These are the sequence identity criteria.
• the tblastn sequence analysis program was used to query a polypeptide sequence against six-way translations of sequences in a nucleotide database. Hits with a P value less than ⁇ 25, preferably less than ⁇ 70, and more preferably less than ⁇ 100, were identified as homologous sequences (exemplary selected sequence criteria).
• the blastn sequence analysis program was used to query a nucleotide sequence against a nucleotide sequence database. In this case too, higher scores were preferred and a preferred threshold P value was less than ⁇ 13, preferably less than ⁇ 50, and more preferably less than ⁇ 100.
• total plant DNA from Arabidopsis thaliana, Nicotiana tabacum, Lycopersicon pimpinellifolium, Prunus avium, Prunus cerasus, Cucumis sativus , or Oryza sativa are isolated according to Stockinger al (Stockinger, E. J., et al., (1996), J. Heredity, 87:214-218). Approximately 2 to 10 ⁇ g of each DNA sample are restriction digested, transferred to nylon membrane (Micron Separations, Westboro, Mass.) and hybridized.
• Hybridization conditions are: 42.degree. C. in 50% formamide, 5 ⁇ SSC, 20 mM phosphate buffer 1 ⁇ Denhardt's, 10% dextran sulfate, and 100 ⁇ g/ml herring sperm DNA.
• Four low stringency washes at RT in 2 ⁇ SSC, 0.05% sodium sarcosyl and 0.02% sodium pyrophosphate are performed prior to high stringency washes at 55° C. in 0.2.times.SSC, 0.05% sodium sarcosyl and 0.01% sodium pyrophosphate.
• High stringency washes are performed until no counts are detected in the washout according to Walling et al. (Walling, L. L., et al., (1988) Nucl. Acids Res. 16:10477-10492).
• a MYB68 gene can be identified by identifying genes that have high homology to an Arabidopsis MYB68 (SEQ ID NO:1). In addition to having homology of the nucleotide or amino acid sequence, one may identify candidate genes that share conformational protein structure. Such structural motifs may assist in identification of related proteins and their structure and function relationships.
• Candidate homologues are introduced into Arabidopsis and assessed for heat tolerance. Genes disclosed as SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 88, 90, 91, 92, 94, 96, 98, 100, 102, 104, 106, 108, 109, 110, 112, 114, 116, 118, 120, 122, 124, 125, 127, 129, 130, 132, 134, 135, 137, 139, 141, 143, 145, 147, 149, 151, 153, 155, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176,
• the expression of If a candidate MYB-subgroup14 sequence, matching the general pattern further includes a match to the exclusive pattern then the sequence is a strong candidate for inclusion as a MYB-subgroup14 genes or MYB68 genes can be evaluated in any transformable species, for example, Brassica , maize, cotton, soybean or rice. Examples of such functional testing have been provided in this disclosure.

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Organic Chemistry (AREA)
• Molecular Biology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Wood Science & Technology (AREA)
• Zoology (AREA)
• Biophysics (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Cell Biology (AREA)
• Botany (AREA)
• Gastroenterology & Hepatology (AREA)
• Medicinal Chemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Priority Applications (3)

Applications Claiming Priority (3)

Related Child Applications (1)

Publications (1)

Family

ID=40387938

Family Applications (3)

Family Applications After (2)

Country Status (10)

Cited By (3)

Families Citing this family (16)

Citations (4)

Family Cites Families (8)

• 2008
  • 2008-04-18 WO PCT/IB2008/002381 patent/WO2009027824A2/en active Application Filing
  • 2008-04-18 CN CN201610554875.5A patent/CN106119279B/zh active Active
  • 2008-04-18 CN CN200880020353.0A patent/CN101981192B/zh active Active
  • 2008-04-18 BR BRPI0810248-1A2A patent/BRPI0810248A2/pt not_active Application Discontinuation
  • 2008-04-18 AR ARP080101634A patent/AR067433A1/es active IP Right Grant
  • 2008-04-18 CA CA2684417A patent/CA2684417C/en active Active
  • 2008-04-18 AU AU2008291827A patent/AU2008291827B2/en active Active
  • 2008-04-18 US US12/148,548 patent/US20090158466A1/en not_active Abandoned
  • 2008-04-18 ES ES08828226.4T patent/ES2550364T3/es active Active
  • 2008-04-18 EP EP08828226.4A patent/EP2140012B1/en active Active
• 2009
  • 2009-10-16 ZA ZA2009/07261A patent/ZA200907261B/en unknown
• 2017
  • 2017-01-27 US US15/418,412 patent/US11130958B2/en active Active
• 2021
  • 2021-08-25 US US17/411,250 patent/US20220213498A1/en active Pending

Patent Citations (4)

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events