US20090099043A1 - Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions - Google Patents

Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions Download PDF

Info

Publication number
US20090099043A1
US20090099043A1 US12/313,554 US31355408A US2009099043A1 US 20090099043 A1 US20090099043 A1 US 20090099043A1 US 31355408 A US31355408 A US 31355408A US 2009099043 A1 US2009099043 A1 US 2009099043A1
Authority
US
United States
Prior art keywords
dna
loop
ina
sequence
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US12/313,554
Other languages
English (en)
Inventor
York Yuan Yuan Zhu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Publication of US20090099043A1 publication Critical patent/US20090099043A1/en
Priority to US14/791,157 priority Critical patent/US9944928B2/en
Assigned to ZHU, YORK YUAN YUAN reassignment ZHU, YORK YUAN YUAN ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: BIOMICS BIOTECHNOLOGIES CO., LTD.
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B50/00—Methods of creating libraries, e.g. combinatorial synthesis
    • C40B50/06—Biochemical methods, e.g. using enzymes or whole viable microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/30—Production chemically synthesised
    • C12N2330/31—Libraries, arrays

Definitions

  • the present invention relates to methods and compositions for constructing a pool of interfering nucleic acids (iNA) from a sample and the selected polynucleotide pools produced thereby, more particularly for preparing an iNA polynucleotide pool using type III restriction/modification enzymes and the corresponding linkers.
  • iNA interfering nucleic acids
  • RNA interference is a well-established experimental technology for silencing gene expression both in cultured eukaryotic cells and living organisms. RNAi also be used as gene therapy for treating viral infections, cancer, vascular diseases and other diseases in which the down-regulation of a polypeptide would ameliorate the disease.
  • RNAi induces the sequence-specific degradation of a single mRNA species by short interfering RNA (siRNA, a double-stranded small interference RNA), which is believed to be processed through the highly conserved Dicer family of RNase III enzymes in vivo.
  • the process includes: 1) the delivery of homologous double-stranded RNAs (dsRNAs) to the cytoplasm of a cell. 2) dsRNA cleavage by the RNase III-like enzyme, Dicer, to 21 ⁇ 23 bp siRNAs. 3) siRNA incorporation into a protein complex, the RNA-induced silence complex (RISC).
  • RISC RNA-induced silence complex
  • siRNA is also an interfering nucleic acid (iNA) as some of these interfering nucleic acids may contain a deoxyribonucleic acid placed in the iNA to inhibit RNA nucleases.
  • the siRNA molecule of interest can be synthesized in vitro by chemical and enzymatic (for example by using the enzyme Dicer) methods. They can also be synthesized in vivo.
  • a synthetic oligonucleotide is cloned into siRNA expression vectors with a RNA polymerase III promoter (including U6, human H1, and tRNA promoters), or a polymerase II promoter with a minimal poly(A) signal sequence, siRNA can be transcribed in vivo.
  • a single promoter is used to express a short hairpin (shRNA) sequence, although two tandem polymerase III promoters have also been used to transcribe the sense and antisense siRNA sequences.
  • PCR-derived siRNA expression cassettes based on the single-promoter system is an alternative format for suppressing transfected gene activity.
  • siRNA-mediated gene silencing efficiency is affected by many parameters. An important limiting fact is that only about 25% of selected target siRNA sequences are functional due to some factors, such as secondary structures, non-gene-specific reactions and other unknown factors. Thus several synthetic siRNAs need to be generated and tested for every target gene. Thus, it is very expensive and time consuming to identify a suitable iNA construct. Another difficulty is the fact that an iNA sequence may have enough complementarity to the sequence of a second, unintended RNA. This is called the so-called off-target effect. Furthermore, to find the best siRNA binding sites (RNAi drug targets) is very challenging. To resolve the off-target phenomenon, extensive studies have been done on selecting specific target sequences for siRNA.
  • siRNA library constructed from cDNA or DNA offers a better alternative way to search for sequences that have the best potential silencing effect.
  • siRNA library can be a useful research tool in functional genomics, and useful for screening RNAi therapeutic targets in a high-throughput manner.
  • siRNA library approaches such as whole genomic or gene-specific or domain-specific siRNA libraries
  • MmeI-a type II restriction enzyme by which a maximum 20 nucleotides can be generated.
  • a siRNA having a maximum length of 20 bp cannot completely mimic the cleavage product, having a length of 21-23 bp produced by an RNase III-like enzyme-Dicer. This can result in the best siRNA target sites being underrepresented.
  • the double-stranded (ds) cDNA is randomly cleaved into small fragments by DNase I (some use restriction enzymes for fragmentation but the representation is an issue) and subsequently ligated to an artificial loop-anchor which contains a MmeI-type II restriction site, then digested by the MmeI restriction enzyme to cut 18-20 nucleotides away from the recognized site.
  • the ds-cDNA is then converted into a 20-nt palindromic structure with a loop (shRNA) and finally cloned into an siRNA expression vector with an RNA polymerase III promoter.
  • An shRNA library cannot be generated by PCR due to a palindromic structure. The complicated steps together with heavy cDNA loss in multiple process steps make this approach difficult and impossible to be developed into a high-throughput tool for functional genomics and for siRNA therapeutic target screening.
  • a palindromic structure is unstable during cloning in E. coli . This can lead to reduction in library complexity and potential loss of the best therapeutic target sites.
  • An iNA having a maximum of 20 bp cannot completely mimic the cleavage products having 21 to 23 bp produced by an RNase III enzyme like Dicer.
  • dsRNAs corresponding to the cDNA of interest are prepared by T7 RNA polymerase mediated transcription from DNA templates flanked by a T7 RNA promoter and subsequent annealing.
  • the dsRNAs are then digested with cloned human Dicer in vitro, yielding 21 ⁇ 23 bp siRNAs.
  • a modified bacterial RNase III can be used to replace Dicer, but the generated siRNA is 20 ⁇ 25 bp. Cleavage products are denatured, purified by PAGE and dephosphorylated.
  • RNA adapters are attached subsequently to the 3′- and 5′-ends of the cleavage products by T4 RNA ligase. RNAs are subsequently converted into dsDNA by RT-PCR using primers complementary to the adapters. After digestion with appropriate restriction enzymes, the 21 ⁇ 23 bp siRNAs corresponding to the cDNA fragments are ligated into an siRNA expression vector having the dual RNA polymerase III promoters, U6 and H1. For a description of the U6 and H1 promoters see US patent application publication no. 20050064489. Taking advantage of PCR, this approach can tolerate the a heavy loss of starting material due to multiple process steps and still generate enough molecules for cloning.
  • RNA fragmentation with Dicer a distinct random pools of iNAs having 21 ⁇ 23 bp in length can be generated.
  • the cDNA-RNA-cDNA conversion process steps are obviously a complex, and even more complicated than shRNA library construction described above.
  • RNA degradation during multiple process steps e.g., T7 DNA polymerase-mediated DNA to RNA transcription, Dicer digestion, RNA PAGE purification, dephosphate and anchor ligation as well as RT-PCR
  • T7 DNA polymerase-mediated DNA to RNA transcription, Dicer digestion, RNA PAGE purification, dephosphate and anchor ligation as well as RT-PCR is unavoidable, which may result in the loss of some of the best siRNA target sites.
  • siRNA library construction is based on DNase I digestion.
  • dscDNA is partially digested with DNase I, followed by PAGE gel purification isolating DNA fragments that are 20-30 bp in lengths. These fragments are either directly blunt-end cloned into siRNA expression vector or attached to a PCR anchor by ligation, followed by PCR amplification and subsequently cloning into siRNA expression vector. It sounds much simpler and straightforward. However, cutting a nucleic acid fragment that is 20 ⁇ 30 bp length from a PAGE gel is very challenging.
  • Contamination with smaller nucleic acid fragments that have a length of less than 16 bp and with larger nucleic acid fragments having a length greater than 30 bp cannot be avoided.
  • the iNAs that are too short having a length of less than 16 bp results in iNAs that do not efficiently downregulate the target RNA.
  • An iNA that has a length that is greater than 30 bp cannot be transfected into mammalian cells because their introduction into the mammalian cells activates an interferon and protein kinase R (PKR) pathways in the cells, resulting in nonspecific gene silencing and apoptosis.
  • PLR protein kinase R
  • Such an siRNA library may contain a high frequency of undesirable (“junk”) clones which may not only drastically impair the overall efficiency of the approach, but also seriously compromise the integrity of the data that are generated. Thus, this approach is not ideal for screening for the best siRNA sequence site for functional genomics and RNAi therapeutics.
  • An ideal iNA library especially a gene-specific library, should contain every site represented by multiple overlapping sequences, and individual sequences should have the widely accepted rational length of 19-23 bp, and should easily and simply be amplified by PCR to meet a high-throughput library construction format, accelerating the screenings for the best siRNA sequence site for functional genomics and RNAi therapeutics.
  • a method for to produce a library or pool iNA constructs having a length of 19-23 bps which can be produced in a high-throughput manner, which covers the target sequence of an RNA.
  • An object of the present invention is to provide a type III restriction/modification enzyme mediated PCR high-throughput method for preparing an iNA pool from a DNA sample (cDNA or genomic DNA and so on) for RNAi therapeutic targets screening.
  • the resulting siRNA polynucleotide pool has iNAs constructing ranging in length from 16 to 27 bp, more preferably, from 21 ⁇ 23 bp.
  • the pool of iNA constructs completely mimics the length of siRNA naturally generated by Dicer enzyme in living cells.
  • the type III restriction enzyme-EcoP15I can cleave maximal nucleic acid fragment having a length of 25-27 bp of DNA outside of their recognition site.
  • cleavage product having 25-27 bp is the ideal length for an iNA of 19-23 bp which is a widely accepted rational length of an siRNA;
  • b. two inversely oriented recognition sites of type III restriction/modification enzymes is required for effective cleavage (using EcoP15I as an example):
  • Loop-1 linkers an artificial oligonucleotide shaped in a loop after self-annealing containing the recognition sites of a type III restriction/modification enzyme and a type II restriction enzyme.
  • the general structure formula of Loop-1 linker(s) is:
  • SEQ ID NO: 5 there can be 0 to 20 nucleotides between the ‘C’ and the first ‘T’ at the 5′ end at the 3′ end there can be an additional nucleotides ranging from 0 to 20 after the 3′ N;
  • SEQ ID NO: 6 there can be 0 to 20 nucleotides between the ‘G’ and the first ‘T’ at the 3′ end, and 0 to 20 nucleotides after the A at the 5′ end;
  • N is any nucleotide bases preferably G, C, T, or A;
  • Type IIase type III restriction/modification enzyme; Type IIase: type II restriction enzyme.
  • Another object of the present invention is to provide another artificial oligonucleotide shaped in a loop after self-annealing (Loop-2 linker) containing a type II restriction enzyme recognition sequences.
  • Loop-2 linker The general structure formula of Loop-2 linker is:
  • 5′CTTTTN Type IIase site-PCR anchor-loop having 0-20 nucleotides between ‘C’ and first ‘T’ and 0-20 nucleotides after the 5′ ‘T’
  • 3′ GAAAAN Type IIase site-PCR anchor-loop having 0-20 nucleotides between ‘G’ and the first ‘A’ and 0-20 nucleotides after the final 3′ ‘A’.
  • N is a nucleotide base preferably G, C, T, or A; and Type IIase is a type II restriction enzyme.
  • Another object of the present invention is to provide a protocol for a PCR based high-throughput method for preparing an siRNA polynucleotide pool from a DNA sample, comprised of:
  • RNA polynucleotide pool distributed from 19 to 23 bp in length by adjusting the adjacent number of poly (A/T) sequences in the Loop-1 linker(s);
  • Loop-2 linker ligation e.g., Fok1
  • a type II restriction site e.g., Fok1 is included in the Loop-2;
  • a type II restriction enzyme e.g., FokI in both loops
  • digestion to generate over polyA (A 4 ) sticky ends (cohesive ends) at both 5′ ends;
  • FIG. 1 A Schematic Diagram of Technical Flow-Chart and the Structure of Loop-1 Linker(s) (using EcoP15I as an example):
  • FIG. 2 Schematic Diagram of an siRNA Expression Vector (pU6H1-GFP) Map and MCS Sequences Before and After Cloning.
  • interfering nucleic acid refers to a nucleic acid duplexes having a sense and antisense strand, which when entered into a RISC complex induces enzymatic degradation of mRNA.
  • each strand contains predominantly RNA nucleotides but the strands can contain RNA analogs, RNA and RNA analogs, RNA and DNA, RNA analogs and DNA, or one strand that is completely DNA and one strand that is RNA as long as the iNA construct induces enzymatic degradation of a homologous mRNA.
  • short interfering nucleic acid refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression or viral replication, for example by mediating RNA interference “RNAi” or gene silencing in a sequence-specific manner; see for example Zamore et al., 2000, Cell, 101, 25-33; Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., International PCT Publication No.
  • the iNA can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the iNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 15 to about 30, e.g., about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs; the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof (e.g., about 15 to about 25 or more nucleotides of the iNA molecule are complementary to the target nucle
  • the iNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the iNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the iNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the iNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active iNA molecule capable of mediating RNAi.
  • the iNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such iNA molecule does not require the presence within the iNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5′-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568), or 5′,3′-diphosphate.
  • a terminal phosphate group such as a 5′-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568), or 5′,3′-diphosphat
  • the iNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic interactions, and/or stacking interactions.
  • the iNA molecules of the invention comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the iNA molecule of the invention interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • iNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules of the invention lack 2′-hydroxy (2′-OH) containing nucleotides.
  • Applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2′-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group).
  • iNA molecules that do not require the presence of ribonucleotides within the iNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups.
  • iNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • modified short interfering nucleic acid molecules of the invention can also be referred to as short interfering modified oligonucleotides “siMON.”
  • iNA short interfering modified oligonucleotides
  • shRNA short hairpin RNA
  • short interfering oligonucleotide short interfering nucleic acid
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post-transcriptional gene silencing, translational inhibition, or epigenetics.
  • iNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level.
  • epigenetic regulation of gene expression by iNA molecules of the invention can result from iNA mediated modification of chromatin structure or methylation pattern to alter gene expression (see, for example, Verdel et al., 2004, Science, 303, 672-676; Pal-Bhadra et al., 2004, Science, 303, 669-672; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
  • iNA duplex is a generic term used throughout the specification to include interfering nucleic acids (iNAs), hairpin iNAs which can be cleaved in vivo to form iNAs.
  • the iNA duplexes herein also include expression vectors (also referred to as iNA expression vectors) capable of giving rise to transcripts that form iNA duplexes or hairpin iNAs in cells, and/or transcripts, which can produce iNAs in vivo.
  • the iNA include single strands that form a duplex by a hairpin-loop or double strands of iNA.
  • the iNA is a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence in a target ribonucleic acid molecule for down regulating expression, or a portion thereof.
  • the sense strand or antisense strand have one or more nicks or nucleotide.
  • the terminal structure of iNA may be either blunt or cohesive (overhanging) as long as the iNA can silence the target mRNA.
  • the cohesive (overhanging) end structure is not limited only to the 3′ overhang, as the 5′overhanging structure may be included as long as it is capable of inducing the RNAi effect.
  • the number of overhanging nucleotides is not limited to the reported 2 or 3, but can be any number as long as the overhang is capable of inducing the RNAi effect.
  • the overhang may be 1 to 8, or 2 to 4 nucleotides.
  • the length of the iNA duplex is determined by counting the number of nucleotides in the duplex starting at the first base-pair at the 5′ end of the sense strand and ending at the last base-pair at the 3′ end of the sense strand.
  • miRNAs are single-stranded RNA molecules of about 21-23 nucleotides in length, which regulate gene expression. miRNAs are encoded by genes that are transcribed from DNA but not translated into protein (non-coding RNA); instead they are processed from primary transcripts known as pri-miRNA to short stem-loop structures called pre-miRNA and finally to functional miRNA. Mature miRNA molecules are partially complementary to one or more messenger RNA (mRNA) molecules, and their main function is to downregulate gene expression.
  • mRNA messenger RNA
  • Modified nucleotides in an iNA molecule can be in the antisense strand, the sense strand, or both.
  • modified nucleotides can have a Northern conformation (e.g., Northern pseudorotation cycle, see, for example, Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984).
  • nucleotides having a Northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2′-O, 4′-C-methylene-(D-ribofuranosyl) nucleotides), 2′-methoxyethoxy (MOE) nucleotides, 2′-methyl-thio-ethyl, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy-2′-chloro nucleotides, 2′-azido nucleotides, and 2′-O-methyl nucleotides.
  • LNA locked nucleic acid
  • MOE 2′-methoxyethoxy
  • Chemically modified nucleotides can be resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • a conjugate molecule attached to a chemically-modified iNA molecule is a polyethylene glycol, human serum albumin, or a ligand for a cellular receptor that can mediate cellular uptake.
  • Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified iNA molecules are described in Vargeese, et al., U.S. Patent Publication No. 20030130186 and U.S. Patent Publication No. 20040110296, which are each hereby incorporated by reference in their entirety.
  • oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-O-allyl, 2′-H, nucleotide base modifications.
  • nuclease resistant groups for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-O-allyl, 2′-H, nucleotide base modifications.
  • the iNA duplexes may contain modified iNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
  • oligonucleotide backbone modifications see Hunziker and Leumann, Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 1995, pp.
  • Examples of chemical modifications that can be made in an iNA include phosphorothioate internucleotide linkages, 2′-deoxyribonucleotides, 2′-O-methyl ribonucleotides, 2′-deoxy-2′-fluoro ribonucleotides, “universal base” nucleotides, “acyclic” nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation.
  • the antisense region of a iNA molecule can include a phosphorothioate internucleotide linkage at the 3′-end of said antisense region.
  • the antisense region can comprise about one to about five phosphorothioate internucleotide linkages at the 5′-end of said antisense region.
  • the 3′-terminal nucleotide overhangs of a iNA molecule can include ribonucleotides or deoxyribonucleotides that are chemically-modified at a nucleic acid sugar, base, or backbone.
  • the 3′-terminal nucleotide overhangs can include one or more universal base ribonucleotides.
  • the 3′-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
  • a chemically-modified iNA can have 1, 2, 3, 4, 5, 6, 7, 8, or more phosphorothioate internucleotide linkages in one strand, or can have 1 to 8 or more phosphorothioate internucleotide linkages in each strand.
  • the phosphorothioate internucleotide linkages can be present in one or both oligonucleotide strands of the iNA duplex, for example in the sense strand, the antisense strand, or both strands.
  • a iNA molecule includes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more purine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or in both strands.
  • the iNA molecules which can be chemically-modified, can be synthesized by: (a) synthesis of two complementary strands of the iNA molecule; and (b) annealing the two complementary strands together under conditions suitable to obtain a double-stranded iNA molecule.
  • synthesis of the complementary portions of the iNA molecule is by solid phase oligonucleotide synthesis, or by solid phase tandem oligonucleotide synthesis.
  • nucleotide refers to a heterocyclic nitrogenous base in N-glycosidic linkage with a phosphorylated sugar. Nucleotides are recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1′ position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group.
  • the nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see for example, Usman and McSwiggen, supra; Eckstein et al., International PCT Publication No. WO 92/07065; Usman et al., International PCT Publication No. WO 93/15187; Uhlman & Peyman, supra all are hereby incorporated by reference herein).
  • modified nucleic acid bases known in the art as summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183.
  • nucleic acids include, for example, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
  • modified bases in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1′ position or their equivalents; such bases can be used at any position, for example, within the catalytic core of an enzymatic nucleic acid molecule and/or in the substrate-binding regions of the nucleic acid molecule.
  • Nucleotides are organic compounds comprised of three joined structures: a nitrogenous base, a sugar, and a phosphate group. The most common nucleotides can be divided into two groups (purines and pyrimidines) based on the structure of the nitrogenous base.
  • the joined sugar is either ribose or deoxyribose.
  • a nucleotide is composed of a ring of nitrogen, carbon and oxygen atoms, a five-carbon sugar (together referred to as a nucleoside) and one phosphate group.
  • the name of the nucleotide is determined by its base.
  • an adenine (A) nucleotide has an adenine base
  • a guanine (G) nucleotide has a guanine base
  • a thymine (T) nucleotide has a thymine base
  • a uracil (U) nucleotide has a uracil base
  • a cytosine (C) nucleotide has a cytosine base.
  • a strand of DNA contains nucleotides and a DNA molecule is made up of 2 polynucleotide chains arranged on the double helix (the backbone). These nucleotides are composed of three parts: a phosphate, a sugar (deoxyribose), and a type of compound base. The deoxyribose and phosphate form the backbone of nucleic acid (the side of the ladder) while the base connect the two polynucleotide chains (like the rungs of the ladder). There are four main types of bases, adenine, guanine, thymine and cytosine but they are just referred to by the first letter in their name, A, G, T and C respectively.
  • RNA Ribonucleic acid
  • RNA is a nucleic acid that is comprised of a long chain of nucleotide units. Each nucleotide consists of a nitrogenous base, a ribose sugar, and a phosphate.
  • RNA is very similar to DNA, but differs in a few important structural details: in the cell, RNA is usually single-stranded, while DNA is usually double-stranded; RNA nucleotides contain ribose while DNA contains dexoyribose (a type of ribose that lacks one oxygen atom); and RNA has the base uracil rather than thymine that is present in DNA.
  • RNA is transcribed from DNA by enzymes called RNA polymerases and is generally further processed by other enzymes.
  • Oligonucleotides are synthesized using protocols known in the art, for example as described in Caruthers, et al, Methods in Enzymology 211:3-19, 1992; Thompson, et al., International PCT Publication No. WO 99/54459; Wincott, et al., Nucleic Acids Res. 23:2677-2684, 1995; Wincott, et al., Methods Mol. Bio. 74:59, 1997; Brennan, et al., Biotechnol Bioeng. 61:33-45, 1998; and Brennan, U.S. Pat.
  • RNA including certain iNA molecules of the invention
  • the double-stranded structure may be formed by self-complementary iNA strand such as occurs for a hairpin RNA or by annealing of two distinct complementary iNA strands.
  • “Overlapping” refers to when two iNA fragments have sequences which overlap by a plurality of nucleotides on one strand, for example, where the plurality of nucleotides (nt) numbers as few as 2-5 nucleotides or by 5-10 nucleotides or more.
  • One or more iNAs refers to iNAs that differ from each other on the basis of primary sequence.
  • target site or “target sequence” or “targeted sequence” is meant a sequence within a target nucleic acid (e.g., RNA) that is “targeted” for cleavage mediated by an iNA duplex which contains sequences within its antisense region that are complementary to the target sequence.
  • a target nucleic acid e.g., RNA
  • a hybrid iNA molecule is an iNA that is a double-stranded nucleic acid.
  • a hybrid iNA is comprised of an RNA strand and a DNA strand.
  • the RNA strand is the antisense strand as that is the strand that binds to the target mRNA.
  • the hybrid iNA created by the hybridization of the DNA and RNA strands have a hybridized complementary portion and preferably at least one 3′overhanging end.
  • To “modulate gene expression” as used herein is to up-regulate or down-regulate expression of a target gene, which can include upregulation or down-regulation of mRNA levels present in a cell, or of mRNA translation, or of synthesis of protein or protein subunits, encoded by the target gene.
  • inhibitor means that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or level or activity of one or more proteins or protein subunits encoded by a target gene, is reduced below that observed in the absence of the nucleic acid molecules (e.g., iNA) of the invention.
  • nucleic acid molecules e.g., iNA
  • Gene silencing refers to partial or complete inhibition of gene expression in a cell and may also be referred to as “gene knockdown.” The extent of gene silencing may be determined by methods known in the art, some of which are summarized in International Publication No. WO 99/32619.
  • restriction enzyme is an enzyme that cuts double-stranded DNA at specific recognition nucleotide sequences known as restriction sites. Such enzymes, found in bacteria and archaea, are thought to have evolved to provide a defense mechanism against invading viruses. To cut the DNA, a restriction enzyme makes two incisions, once through each sugar-phosphate backbone (i.e. each strand) of the DNA double helix. Restriction endonucleases are categorized into three general groups (Types I, II and III) based on their composition and enzyme cofactor requirements, the nature of their target sequence, and the position of their DNA cleavage site relative to the target sequence.
  • complementarity refers to the ability of a nucleic acid to form hydrogen bond(s) with another RNA sequence by either traditional Watson-Crick or other non-traditional types.
  • the binding free energy for a nucleic acid molecule with its target or complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNA interference, enzymatic nucleic acid cleavage, antisense or triple helix inhibition. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol. LII pp.
  • a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule which can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • RNA is meant a molecule comprising at least one ribonucleotide residue.
  • ribonucleotide is meant a nucleotide with a hydroxyl group at the 2′ position of a ⁇ -D-ribo-furanose moiety.
  • the terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • ribonucleotide or “2′-OH” is meant a nucleotide with a hydroxyl group at the 2′ position of a ⁇ -D-ribo-furanose moiety.
  • DNA ligation involves creating a phosphodiester bond between the 3′ hydroxyl of one nucleotide and the 5′ phosphate of another.
  • the enzyme used to ligate DNA fragments is T4 DNA ligase, which originates from the T4 bacteriophage. This enzyme will ligate DNA fragments having overhanging, cohesive ends that are annealed together, as in the EcoRI example below—this is equivalent to repairing “nicks” in duplex DNA. T4 DNA ligase will also ligate fragments with blunt ends, although higher concentrations of the enzyme are usually recommended for this purpose.
  • a restriction digest is a procedure used in molecular biology to prepare DNA for analysis or other processing. It is also known as DNA fragmentation. It uses a number of restriction enzymes to selectively cleave strands of DNA into shorter fragments, or to isolate short fragments of interest. The resulting digested DNA is very often selectively amplified using PCR, making it more suitable for analytical techniques such as agarose gel electrophoresis, and chromatography. It is used in genetic fingerprinting, and RFLP analysis.
  • a given restriction enzyme cuts DNA segments within a specific nucleotide sequence. These recognition sequences are typically four, six, eight, ten, or twelve nucleotides long. Because there are only so many ways to arrange the four nucleotides which compose DNA (Adenine, Thymine, Guanine and Cytosine) into a four- to twelve-nucleotide sequence, recognition sequences tend to occur by chance in any long sequence. Restriction enzymes specific to hundreds of distinct sequences have been identified and synthesized for sale to laboratories, and as a result, several potential “restriction sites” appear in almost any gene or locus of interest on any chromosome.
  • plasmids include an (often entirely synthetic) polylinder (also called “multiple cloning site”) that contains dozens of restriction enzyme recognition sequences within a very short segment of DNA. This allows the insertion of almost any specific fragment of DNA into plasmid vectors, which can be efficiently “cloned” by insertion into replicating bacterial cells.
  • DNA can then be analysed using gel electrophoresis.
  • gel electrophoresis a sample of DNA is first “loaded” onto a slab of agarose gel (literally pipetted into small wells at one end of the slab). The gel is then subjected to an electric field, which draws the negatively charged DNA across it. The molecules travel at different rates (and therefore stop at different distances) depending on their net charge (more highly charged particles travel further), and size (smaller particles travel further). Since none of the four nucleotide bases carry any charge, net charge becomes insignificant and size is the main factor affecting rate of diffusion through the gel. Net charge in DNA is produced by the sugar-phosphate backbone.
  • PCR Polymerase chain reaction
  • PCR is very versatile. Many types of samples can be analyzed for nucleic acids. Most PCR uses DNA as a target, rather than RNA, because of the stability of the DNA molecule and the ease with which DNA can be isolated. Almost all PCR applications employ a heat-stable DNA polymerase, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus . This DNA polymerase enzymatically assembles a new DNA strand from DNA building blocks, the nucleotides, by using single-stranded DNA as a template and DNA oligonucleotides (also called DNA primers), which are required for initiation of DNA synthesis. The vast majority of PCR methods use thermal cycling, i.e., alternately heating and cooling the PCR sample to a defined series of temperature steps.
  • PCR DNA double helix
  • DNA melting DNA double helix
  • DNA polymerase DNA polymerase
  • the selectivity of PCR results from the use of primers that are complementary to the DNA region targeted for amplification under specific thermal cycling conditions.
  • PCR is used to amplify specific regions of a DNA strand (the DNA target). This can be a single gene, a part of a gene, or a non-coding sequence.
  • Most PCR methods typically amplify DNA fragments of up to 10 kilo base pairs (kb), although some techniques allow for amplification of fragments up to 40 kb in size.
  • a basic PCR set up requires several components and reagents. These components include:
  • PCR is commonly carried out in a reaction volume of 10-200 ⁇ L in small reaction tubes (0.2-0.5 mL volumes) in a thermal cycler.
  • the thermal cycler heats and cools the reaction tubes to achieve the temperatures required at each step of the reaction (see below).
  • Many modern thermal cyclers make use of the Peletier effect which permits both heating and cooling of the block holding the PCR tubes simply by reversing the electric current.
  • Thin-walled reaction tubes permit favorable thermal conductivity to allow for rapid thermal equilibration.
  • Most thermal cyclers have heated lids to prevent condensation at the top of the reaction tube. Older thermocyclers lacking a heated lid require a layer of oil on top of the reaction mixture or a ball of wax inside the tube.
  • the PCR usually consists of a series of 20 to 40 repeated temperature changes called cycles; each cycle typically consists of 2-3 discrete temperature steps. Most commonly PCR is carried out with cycles that have three temperature steps.
  • the cycling is often preceded by a single temperature step (called hold) at a high temperature (>90° C.), and followed by one hold at the end for final product extension or brief storage.
  • the temperatures used and the length of time they are applied in each cycle depend on a variety of parameters. These include the enzyme used for DNA synthesis, the concentration of divalent ions and dNTPs in the reaction, and the melting temperature (Tm) of the primers.
  • Initialization step This step consists of heating the reaction to a temperature of 94-96° C. (or 98° C. if extremely thermostable polymerases are used), which is held for 1-9 minutes. It is only required for DNA polymerases that require heat activation by hot-start PCR.
  • Denaturation step This step is the first regular cycling event and consists of heating the reaction to 94-98° C. for 20-30 seconds. It causes melting of DNA template and primers by disrupting the hydrogen bonds between complementary bases of the DNA strands, yielding single strands of DNA.
  • Annealing step The reaction temperature is lowered to 50-65° C. for 20-40 seconds allowing annealing of the primers to the single-stranded DNA template. Typically the annealing temperature is about 3-5 degrees Celsius below the Tm of the primers used. Stable DNA-DNA hydrogen bonds are only formed when the primer sequence very closely matches the template sequence. The polymerase binds to the primer-template hybrid and begins DNA synthesis.
  • Extension/elongation step The temperature at this step depends on the DNA polymerase used; Taq polymerase has its optimum activity temperature at 75-80° C., and commonly a temperature of 72° C. is used with this enzyme.
  • the DNA polymerase synthesizes a new DNA strand complementary to the DNA template strand by adding dNTPs that are complementary to the template in 5′ to 3′ direction, condensing the 5′-phosphate group of the dNTPs with the 3′-hydroxyl group at the end of the nascent (extending) DNA strand.
  • the extension time depends both on the DNA polymerase used and on the length of the DNA fragment to be amplified.
  • the DNA polymerase will polymerize a thousand bases per minute. Under optimum conditions, i.e., if there are no limitations due to limiting substrates or reagents, at each extension step, the amount of DNA target is doubled, leading to exponential (geometric) amplification of the specific DNA fragment.
  • This single step is occasionally performed at a temperature of 70-74° C. for 5-15 minutes after the last PCR cycle to ensure that any remaining single-stranded DNA is fully extended.
  • agarose gel electrophoresis is employed for size separation of the PCR products.
  • the size(s) of PCR products is determined by comparison with a DNA ladder (a molecular weight marker), which contains DNA fragments of known size, run on the gel alongside the PCR products. See Joseph Sambrook and David W. Russel (2001). Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press. Chapter 8: In vitro Amplification of DNA by the Polymerase Chain Reaction
  • Type I restriction enzymes were the first to be identified and are characteristic of two different strains (K-12 and B) of E. coli . These enzymes cut at a site that differs, and is some distance (at least 1000 bp) away, from their recognition site.
  • the recognition site is asymmetrical and is composed of two portions—one containing 3-4 nucleotides, and another containing 4-5 nucleotides—separated by a spacer of about 6-8 nucleotides.
  • type II restriction enzymes differ from type I restriction enzymes in several ways. They are composed of only one subunit, their recognition sites are usually undivided and palindromic and 4-8 nucleotides in length, they recognize and cleave DNA at the same site, and require only Mg 2+ as a cofactor. There are subcategories based on deviations from typical characteristics of type II enzymes. These subgroups are defined using a letter suffix.
  • Type IIB restriction enzymes are multimers containing more than one subunit. They cleave DNA on both sides of their recognition to cut out the recognition site. They require both AdoMet and Mg 2+ cofactors.
  • Type IIE restriction endonucleases e.g. NaeI
  • type IIF restriction endonucleases e.g. NgoMIV
  • Type IIG restriction endonucleases (Eco57I) do have a single subunit, like classical Type II restriction enzymes, but require the cofactor AdoMet to be active.
  • Type IIM restriction endonucleases such as DpnI, are able to recognize and cut methylated DNA.
  • Type IIS restriction endonucleases (e.g. FokI) cleave DNA at a defined distance from their non-palindromic asymmetric recognition sites.
  • Type IIT restriction enzymes e.g., Bpu10I and BslI are composed of two different subunits. Some recognize palindromic sequences while others have asymmetric recognition sites.
  • Type III restriction enzymes e.g. EcoP15 and EcoP151
  • EcoP15 and EcoP151 recognize two separate non-palindromic sequences that are inversely oriented. They cut DNA about 20-30 base pairs after the recognition site. These enzymes contain more than one subunit and require AdoMet and ATP cofactors for their roles in DNA methylation and restriction, respectively.
  • “Recognition site” Restriction enzymes recognize a specific sequence of nucleotides and produce a double-stranded cut in the DNA. While recognition sequences vary widely, with lengths between 4 and 8 nucleotides, many of them are palindromic; that is, the sequence on one strand reads the same in the reverse direction on the complementary strand. The meaning of “palindromic” in this context is different from what one might expect from its linguistic usage: GTAATG (SEQ ID NO:68) is not a palindromic DNA sequence, but GTATAC (SEQ ID NO:69) is [GTATAC (SEQ ID NO:69 is complementary to CATATG (SEQ ID NO:70)].
  • Recognition sequences in DNA differ for each restriction enzyme, producing differences in the length, sequence and strand orientation (5′ end or the 3′ end) of a sticky-end “overhang” of an enzyme restriction.
  • a vector is any vehicle used to transfer foreign genetic material into another cell.
  • the vector itself is generally a DNA sequence that consists of an insert (transgene) and a larger sequence that serves as the “backbone” of the vector.
  • the purpose of a vector to transfer genetic information to another cell is typically to isolate, multiply, or express the insert in the target cell.
  • Vectors called expression vectors (expression constructs) specifically are for the expression of the transgene in the target cell, and generally have a promotersequence that drives expression of the transgene.
  • the expression may be of a polypeptide, protein or RNA.
  • An iNA expression vector is a vector that expresses an iNA.
  • a DNA construct is a DNA that is to be expressed when inserted into a vector and transfected into a cell.
  • Insertion of a vector into the target cell is generally called transfection, although insertion of a viral vector is often called transduction.
  • loop-1 linker(s) of present invention as described in FIG. 1 and “The general structure formula” described above, the poly(T/A) sequences between EcoP15I and DNA inserts play three key roles:
  • the resulting DNA insert length after EcoP15I cleavage can be modified to have a length of from 19-23 bp by the addition or deletion of poly(T/A) sequences between EcoP15I in Loop-1 and DNA substrates. If one uses a Loop-1 linker only with a distinct poly(T/A) number, the length of DNA insert can also be fixed at a certain length to construct an siRNA polynucleotide pool at a distinct length, or mix all Loop-1 linkers together to generate an siRNA polynucleotide pool having a 19-23 bp size distribution, according to the needs.
  • siRNA polynucleotide pool can be produced in which the lengths of the iNA constructs can be varied by the addition or deletion of the A/T sequences in Loop-1 linker(s) resulting in iNA pools being constructed in which the lengths of the constructs are 16-18 bp or 24-27 bp;
  • RNA polymerase III promoters Generating the initiation and termination signals of RNA polymerase III promoters. After the iNA polynucleotide inserts are cloned into a siRNA expression vector, the “AAAAA” (SEQ ID NO: 7) (an initiation signal) and “TTTTT” (SEQ ID NO: 8)(a termination signal) of the promoters are generated. There are no additional cloning sequences between RNA polymerase III (U6 and H1) promoters and DNA inserts, which can increase specificity of RNAi therapeutic targets screening.
  • the number of “N” between EcoP15I and FokI maintains the A 4 adhesive ends (over A 4 hanging ends at both 5′ ends).
  • the length of initiation signal [AAAAA (SEQ ID NO:7)] and termination signal [TTTTT (SEQ ID NO: 8)] for RNA polymerase III promoters are created.
  • Loop-1 linkers contain a “G” before Poly(A), except for construction of 23 bp siRNA polynucleotide pool. It is widely accepted that placing “G” before the initial signal “AAAAA” (SEQ ID NO: 7) enhances RNA polymerase III promoter activity, especially for the U6 promoter. However, the “G” needs to be omitted to maintain siRNA polynucleotide 23 bp in length by Loop-1 linker and can be added to an siRNA expression vector.
  • siRNA polynucleotide pool construction If needed, for 24-27 bp siRNA polynucleotide pool construction, one should place the initiation/termination signals together with its enhancing base “G” into an siRNA expression vector. In this case an appropriate cloning site has to be selected in both Loop-1 linker(s) and vector to conduct an efficient cloning.
  • the present invention provides unlimited formats, especially with the future appearance of other type III restriction enzymes that have longer cleavage outside of their recognition sequences than EcoP15I or EcoP15.
  • the PCR anchor and the loop structure designed in Loop-1 linker(s) are used to select a correct orientation for type III restriction/modification enzyme cleavage.
  • the type III restriction/modification enzymes require two 5′ sequences in inversed orientations within the same DNA molecule to accomplish cleavage.
  • Single primer PCR enables to select such molecules.
  • a loop shaped structure is helpful.
  • a looped linker has no primer activity, thus ensures the single primer PCR successful.
  • DNA is randomly and partially digested producing blunt-ended fragments by DNase I in the presence of Mn 2+ .
  • DNase I (RNase-free) is an endonuclease that nonspecifically cleaves DNA to produce products having 5′-phosphorylated and 3′-hydroxylated end.
  • concentration of DNase I for the partial digestion is 0.01 ⁇ 0.3 U of DNaseI per 1 g DNA depending on the length and purity of DNA as well as the source of the enzyme. Due to a nonspecific fragmentation, the resulting products are random fragments that can be a representative distribution of the siRNA polynucleotide pool generated.
  • the partially digested DNA are blunt-ended.
  • the preferable length for downstream Loop-1 linker(s) ligation and siRNA polynucleotide pool construction is 100-300 bp.
  • FIG. 1 shows the general structure of a DNA construct of a Loop-1 linker having a EcoP151/Fok1 restriction sites. Examples of such Loop-1 constructs include:
  • a blunt-end ligation with the partially digested DNA can be performed by any DNA ligases, more preferably, a T4 DNA ligase in the presence of ATP.
  • the molar ratio of Loop-1 linker(s) and DNA is 10:1.
  • poly(A) sequence after the final N at the 3′ end of SEQ ID NO:1 a poly(T) sequence for the first nucleotide at the 5′ end of SEQ ID NO:2, a poly(T) sequence after the last nucleotide at the 5′ end of SEQ ID NO:3, a poly(A) sequence before the first nucleotide at the 3′ end of SEQ ID NO:4, N at the 3′ end of SEQ ID NO:1 represents 25 nucleotides before the poly(A) sequence, N at the 5′ end of SEQ ID NO:2 represents 27 nucleotides before the poly(T) sequence, there is a poly(T) sequence at the 5′ end of SEQ ID NO:3 after the final ‘N’ where ‘N’ represents 27 nucleotides, there is a poly(A) sequence before the first ‘N’ at the 3′ end of SEQ ID NO: 4 where ‘N’ represents 25 nucleotides.
  • Loop-1 linker(s) and DNA not only can generate the cleavable molecules (A), also generate other uncleavable molecules (B and C) as well:
  • the present invention provides a single primer PCR amplification for selection of molecule (A) that can be cleaved.
  • This single primer is a portion of sequences homolog to the strand with poly(A) stretch in the Loop-1 linker(s).
  • the single primer PCR amplification completes a selection for molecule (A) that has two inversely orientated 5′-ends.
  • the resulting PCR products are EcoP15I cleavable.
  • the unclevable molecules (B) and (C) are removed during the PCR process:
  • the type III restriction-modification enzyme-EcoP15I consisting of two modification (Mod) subunits and two restriction (Res) subunits, requires the interaction of two unmethylated, inversely oriented recognition sites 5′-CAGCAG (SEQ ID NO:17) in head to head configuration to allow an efficient DNA cleavage. ATP is required for the cleavage. Cleavage efficiency is also affected by the distance between the two sites. EcoP15I can efficiently recognize the sites in distance up to 1.7 kb.
  • the Loop-1 linkers contain a type III restriction/modification enzyme site-EcoP15I and a type II restriction site-Fok1 adjacent to a PCR anchor.
  • EcoP15I cleaves 25-27 bp outside of their recognition sequences, thus adjusting the number of the poly A/T sequences between EcoP151 recognition site in Loop-1 linker(s) and DNA inserts, the resulting siRNA polynucleotide pool has a distinct siRNA distribution in functional length (e.g., 19-23 bp).
  • Blunt-ending and Loop-2 linker ligation The DNA is cohesive-ended after EcoP15I cleavage (sense strand 25 bp and antisense strand 27 bp), forming an over 5′ two bases hand and can be filled-in using a DNA polymerase in the presence of dNTPs at a final concentration is 0.02 mM. After a gel purification, the ligation of blunt-ended DNA and a Loop-2 linker is catalyzed by T4 DNA ligase in the presence of ATP. The ligation products are template for the second PCR amplification.
  • Second PCR amplification The blunt-end ligation of EcoP15I digested siRNAs and Loop-2 linker generates the following two molecules due to different orientations:
  • the second PCR amplification selects molecule (B) by 5′ Loop-1 and 3′ Loop-2 primers:
  • Loop-2 linker plays a role in creating a PCR anchor and a cloning site.
  • a type II restriction enzyme-FokI can cleave any neighboring 9-13 bp sequences, after digestion, the DNA inserts generate over A 4 hands at both 5′ ends as described in (5.).
  • the FokI digested products can be cloned into a pre-prepared siRNA expression vector with over T 4 hands at both 3′ ends (dephosphorylated), flanked by two tandem RNA polymerase III promoters such as U6 and H1 ( FIG. 2 ).
  • Poly(A/T) 5 act as the initial and termination signals for RNA polymerase III promoters as described previously.
  • the resulting siRNA polynucleotide pool has a size distribution same as that the Loop-1 linkers restricted (e.g., 19-23 bp).
  • each (100 mM) phosphate linker listed above was denatured at 95° C. in a PCR thermocycler for 1 minute (min) and then self annealed to a loop by cooling down to room temperature. After gel purification, each looped linker was diluted with 1 ⁇ TE buffer to 50 mM and stored at ⁇ 70° C. until use.
  • PCR-1 primer BH1: 5′ ACACATCCA ACGGATCCCAGTTCAG 3′ (SEQ ID NO:37)
  • PCR-2 primers BH1: 5′ ACACATCCA ACGGATCCCAGTTCAG 3′ (SEQ ID NO:38) LG: 5′ GACTCTGATGGATCGTCTGCAGAG 3′ (SEQ ID NO:39)
  • Each one was diluted with 1 ⁇ TE buffer to 10 mM and stored at ⁇ 70° until use.
  • the partially digested products were ligated to Loop-1 phosphate linker(s) (19-; 20-; 21-; 22- and 23-bp Loop-1 linker) respectively.
  • 5 L of ligation reaction mix contained: 2.5 ⁇ L partially digested DNA; 0.5 ⁇ L 10 ⁇ ligation reaction buffer (500 mM Tris-HCl (pH 7.5, 25° C.), 100 mM MgCl 2 , 100 mM dithiothreitol (DTT), 25 ⁇ g/ ⁇ L bovine serum albumin (BSA); 1 ⁇ l (10 mM) Loop-1 linker; 0.5 ⁇ L 10 mM ATP, 0.5 ⁇ l T4 DNA Ligase (NEB). The reaction was performed at 16° C. overnight.
  • the reaction mixture (50 ⁇ l) contained: 0.5 ⁇ l each Loop-1 ligated product; 2 ⁇ L single primer BH1 (20 ⁇ M), 1 ⁇ l dNTP (10 mM), 5 ⁇ l 10 ⁇ PCR buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl, 15 mM MgCl 2 ), 0.5 ⁇ l Taq DNA polymerase and 41 ⁇ L PCR H 2 O.
  • the thermal cycling was as follows: preheating at 95° C. for 1 min; 28 cycles of 95° C. for 15 s; 68° C. for 1 min. Three ⁇ L of each PCR products were analyzed on a 1% Agarose gel.
  • the pellet was dissolved with 11 ⁇ L D-H 2 O, add 1.5 ⁇ L (4.5 U) T4 DNA polymerase (NEB), 1.5 ⁇ L NEB Buffer-2 and 2 ⁇ L dNTP (1 mM) to a total 15 ⁇ L reaction volume and incubated at 37° C. for 15 min in a PCR thermal cycler. The reaction was inactivated by heating at 68° C. for 20 min.
  • NEB T4 DNA polymerase
  • the gel was cut into pieces containing 66 bp fragments, and put together in a fresh tube containing 150 ⁇ L gel diffusion buffer (0.5M NH 4 AC, 10 mM Mg(Ac) 2 , 1 mM EDTA; pH 8.0). The tube was incubated at 55° C. overnight. DNA was extracted with QIAEX II Gel Extraction Kit and elute DNA with D-H 2 O.
  • gel diffusion buffer 0.5M NH 4 AC, 10 mM Mg(Ac) 2 , 1 mM EDTA; pH 8.0.
  • ligation reaction contained: 2.5 ⁇ L DNA isolated by PAGE, 0.5 ⁇ L 10 ⁇ ligation reaction buffer (500 mM Tris-HCl (pH 7.5, 25° C.), 100 mM MgCl 2 , 100 mM DTT, 25 ⁇ g/mL BSA), 1 ⁇ L (20 mM) Loop-2 linker, 0.5 ⁇ L ATP (10 mM), 0.5 ⁇ L T4 DNA Ligase (NEB) and 0.5 ⁇ L D-H 2 O. The ligation reaction was incubated the reaction at 16° C. overnight in a PCR thermal cycler.
  • the 5 ⁇ L ligation-2 product was diluted with 45 ⁇ L D-H 2 O and take out 0.5 ⁇ l as a template for PCR-2 amplification.
  • a 50 ⁇ L reaction contained: 0.5 ⁇ L diluted ligation-2 template, 5 ⁇ L 10 ⁇ PCR buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl, 15 mM MgCl 2 ), 1 ⁇ L LG primer (10 ⁇ M), 1 ⁇ L BH1(10 ⁇ M), 1 ⁇ L dNTP (10 mM), 0.5 ⁇ L Taq DNA polymerase, 41 ⁇ L PCR H 2 O.
  • the thermal cycling was as follows: preheating at 95° C. for 1 min; 28 cycles of 95° C.
  • a 100 ⁇ L reaction contained: 20 ⁇ L above PCR-2 product, 2 ⁇ L FokI (8 U; NEB), 10 ⁇ L NEBuffer-3 and 72 ⁇ L D-H 2 O, which was incubated at 37° C. for 2 hrs. After the digestion reaction 10 ⁇ L of the Fok1 digested DNA was analyzed on a 20% TBE polyacrylamide gel. The target bands were distributed from 29 to 33 bp in length, which corresponds to siRNA having 19-23 bp having 10 bp cloning sites (“AAAAG” (SEQ ID NO:41) at both 5′ ends).
  • Three other 3 bands from top to bottom were: an undigested 109 bp band, a partial digested band (siRNA with a loop at one side), a Loop-1 and Loop-2 overlapping band (owing to Loop-1 and Loop-2 overlap each other, the signal is strong).
  • DNA fragments after FokI digestion were ligated into an siRNA expression vector: pU6H1-GFP(NT Omics, USA) with double promoters of U6 and H1 ( FIG. 2 ).
  • a 15 ⁇ L ligation mixture contained: 1 ⁇ L (100 ng) pU6H1-GFP, 2 ⁇ L FokI digested DNA, 10 ⁇ L 1.5 ⁇ Plasmid Ligation Buffer (90 mM Tris (PH8.5-9.0); 12 mM DTT; 60 mM MgCl 2 ; 40% PEG8000), 0.5 ⁇ L ATP (10 mM), 0.25 ⁇ L T4 DNA Ligase (NEB), 2.25 ⁇ l D-H 2 O.
  • the reaction was incubated at 16° C. for 30 min. 85 ⁇ L D-H 2 O was added to the ligation mixture and ethanol-precipitated an ethanol precipitated at ⁇ 70° C. for 30 minutes. The precipitated DNA was centrifuged forming a DNA pellet and the pellet was dissolved in 5 ⁇ L D-H 2 O.
  • the reaction mixture (30 HL) contained: 2 ⁇ L above bacteria culture, 0.5 ⁇ L 5′ U6 primer (10 ⁇ M), 0.5 ⁇ L 5′ H1 primer (10 ⁇ M), 0.5 ⁇ l dNTP (10 mM), 3 L 10 ⁇ PCR buffer (200 mM Tris-HCl (pH 8.4), 500 mM KCl, 15 mM MgCl 2 ), 0.3 ⁇ L Taq DNA polymerase and 23.2 ⁇ L PCR H 2 O.
  • the thermal cycling was as follows: preheating at 95° C. for 5 min; 25 cycles of 95° C. for 15 s; 62° C. for 30 s; 72° C. for 40 s; holding at 72° C. for 7 min for last extension.
  • Five ⁇ L of each PCR products were analyzed on 1% Agarose gel. The positive bands of PCR products were ⁇ 400 bp in length. The positive rate for sampling was 91.6% (44/48).
  • the size of the siRNAs ranged from 19-23 bp in length.
  • SfiI restriction enzyme was added to PCR products.
  • the SfiI restriction site was originally in the MCS (multiple cloning sites) region of pU6/H1-GFP vector used.
  • a positive digestion indicates siRNA insert negative ((just a vacant vector).
  • the SfiI digestion mixture contained: 4 ⁇ L above PCR products, 0.25 ⁇ L (5 U) SfiI (NEB), 0.75 ⁇ L NEBuffer-2. Digestion was incubated at 50° C. for 1.5 hr in a PCR thermal cycler. Five ⁇ L SfiI digestion mixture was analyzed on 1% Agarose gel. Out of the 43 testing samples, only 1 could be digested by SfiI, indicating that the recombination rate of the experimental SARS siRNA library was 97.6% (43/44).
  • siRNA sequences (bp) (nt) 1 S061218-1 TACAATTTGCCTATTCTAATC 21 101 ⁇ 121 (SEQ ID NO:43) 2 S061218-11 GGCTCTTGTGGCCAGTAACA 20 161 ⁇ 181 (SEQ ID NO:44) 3 S061220-10 GGAAAACAAGCTTTATTATG 20 529 ⁇ 510 (SEQ ID NO:45) 4 S061220-19 TACGGTAGCGGTTGTATGC 19 87 ⁇ 69 (SEQ ID NO:46) 5 S070115-21 TATTCTAATCGGAACAGGTT 20 112 ⁇ 131 (SEQ ID NO:47) 6 S070115-26 GAGCAAACAGCCTGAAGGAAGC 22 378 ⁇ 357 (SEQ ID NO:48) 7 S070115-46 GTACCCGCTCAATGTGGTCA 20 311 ⁇ 330 (SEQ ID NO:49) 8 S070119-27 GTACATAATAAAGCTTGTTTTCC 23 135 ⁇ 157 (SEQ ID NO:50) 9 S070

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
US12/313,554 2007-07-23 2008-11-21 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions Abandoned US20090099043A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/791,157 US9944928B2 (en) 2007-07-23 2015-07-02 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
CN200710024217.6 2007-07-23
CNB2007100242176A CN100570022C (zh) 2007-07-23 2007-07-23 PCR高通量构建siRNA全位点分子库制备方法
CNPCT/CN2008/001283 2008-07-07
PCT/CN2008/001283 WO2009012644A1 (fr) 2007-07-23 2008-07-07 Procédé à haut rendement utilisant la pcr pour construire des polynucléotides de petits arn interférents (sirna) à sites entiers et compositions associées

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2008/001283 Continuation WO2009012644A1 (fr) 2007-07-23 2008-07-07 Procédé à haut rendement utilisant la pcr pour construire des polynucléotides de petits arn interférents (sirna) à sites entiers et compositions associées

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/791,157 Continuation US9944928B2 (en) 2007-07-23 2015-07-02 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Publications (1)

Publication Number Publication Date
US20090099043A1 true US20090099043A1 (en) 2009-04-16

Family

ID=39094304

Family Applications (2)

Application Number Title Priority Date Filing Date
US12/313,554 Abandoned US20090099043A1 (en) 2007-07-23 2008-11-21 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions
US14/791,157 Expired - Fee Related US9944928B2 (en) 2007-07-23 2015-07-02 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Family Applications After (1)

Application Number Title Priority Date Filing Date
US14/791,157 Expired - Fee Related US9944928B2 (en) 2007-07-23 2015-07-02 Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Country Status (3)

Country Link
US (2) US20090099043A1 (fr)
CN (1) CN100570022C (fr)
WO (1) WO2009012644A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9944928B2 (en) 2007-07-23 2018-04-17 York Yuan Yuan Zhu Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Families Citing this family (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101633930B (zh) * 2009-06-11 2012-11-07 陕西师范大学 小干扰rna快速筛选的载体及其构建方法和应用
CN101935649B (zh) * 2009-07-03 2012-08-08 百奥迈科生物技术有限公司 一种抑制Survivin表达的siRNA分子及其应用
CN101935651B (zh) * 2009-07-03 2012-08-08 百奥迈科生物技术有限公司 一种靶向Survivin基因的siRNA分子及其应用
CN101831427B (zh) * 2010-04-01 2012-07-18 清华大学深圳研究生院 一种预防肿瘤复发和抑制肿瘤生长的寡聚核酸及其应用
CN103088020B (zh) * 2011-10-27 2016-01-20 江苏吉康生物技术有限公司 抑制黑色素生成的siRNA分子及其应用
US9635246B2 (en) 2013-06-21 2017-04-25 Qualcomm Incorporated Systems and methods to super resolve a user-selected region of interest
US10781481B2 (en) 2016-04-27 2020-09-22 Bio-Rad Laboratories, Inc. miRNA transcriptome methods and compositions
KR101803472B1 (ko) * 2016-08-11 2017-12-28 한국과학기술원 유전체 유래 인공 ncRNA 발현 라이브러리 및 이의 제조방법
CN108929870B (zh) * 2017-05-19 2020-01-24 百奥迈科生物技术有限公司 抑制HBV的siRNA分子及其应用

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050233994A1 (en) * 2004-04-16 2005-10-20 Ajamete Kaykas Methods and vectors for expressing siRNA
US20060024681A1 (en) * 2003-10-31 2006-02-02 Agencourt Bioscience Corporation Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof
US20080008993A1 (en) * 2003-05-09 2008-01-10 Iwate Prefectural Government Use Of A Type III Restriction Enzyme To Isolate Identification Tags Comprising More Than 25 Nucleotides
US20080021205A1 (en) * 2003-12-11 2008-01-24 Helen Blau Methods and Compositions for Use in Preparing Hairpin Rnas
US20090111705A1 (en) * 2006-11-09 2009-04-30 Complete Genomics, Inc. Selection of dna adaptor orientation by hybrid capture

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040191873A1 (en) * 2003-03-27 2004-09-30 Won-Bin Young Method for high throughput elucidation of transcriptional profiles and genome annotation
WO2004092383A2 (fr) * 2003-04-15 2004-10-28 Sirna Therapeutics, Inc. Inhibition par interference d'arn de l'expression genetique virale du syndrome respiratoire aigu severe au moyen d'acide nucleique d'interference court
CN100560725C (zh) * 2007-07-05 2009-11-18 山东大学 一种利用pSilencer质粒快速构建siRNA载体的方法
CN100570022C (zh) * 2007-07-23 2009-12-16 百奥迈科生物技术有限公司 PCR高通量构建siRNA全位点分子库制备方法

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080008993A1 (en) * 2003-05-09 2008-01-10 Iwate Prefectural Government Use Of A Type III Restriction Enzyme To Isolate Identification Tags Comprising More Than 25 Nucleotides
US20060024681A1 (en) * 2003-10-31 2006-02-02 Agencourt Bioscience Corporation Methods for producing a paired tag from a nucleic acid sequence and methods of use thereof
US20080021205A1 (en) * 2003-12-11 2008-01-24 Helen Blau Methods and Compositions for Use in Preparing Hairpin Rnas
US20050233994A1 (en) * 2004-04-16 2005-10-20 Ajamete Kaykas Methods and vectors for expressing siRNA
US20090111705A1 (en) * 2006-11-09 2009-04-30 Complete Genomics, Inc. Selection of dna adaptor orientation by hybrid capture

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Dinh et al., Alternative approach to generate shRNA from cDNA, 2005, BioTechniques, volume 38, pages 629-632. *
Kaykas et al., A plasmid-based system for expressing small interfering RNA libraries in mammalian cells, 2004, BMC Cell Biology, volume 5:16, pages 1-11. *
Mücke et al. DNA cleavage by type III restriction-modification enzyme EcoP15I is independent of spacer distance between two head to head oriented recognition sites, 2001, JMB, volume 312, pages 687-698. *
Restriction enzyme MmeI, New England Biolabs product instruction, accessed and retrieved from www.neb.com on February 6, 2014. *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9944928B2 (en) 2007-07-23 2018-04-17 York Yuan Yuan Zhu Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions

Also Published As

Publication number Publication date
CN101126176A (zh) 2008-02-20
CN100570022C (zh) 2009-12-16
WO2009012644A1 (fr) 2009-01-29
US9944928B2 (en) 2018-04-17
US20150299707A1 (en) 2015-10-22

Similar Documents

Publication Publication Date Title
US9944928B2 (en) Construction of pool of interfering nucleic acids covering entire RNA target sequence and related compositions
Lehmann et al. The importance of internal loops within RNA substrates of ADAR1
US20090004739A1 (en) Efficient Method of Preparing Dna Inverted Repeat
AU779060B2 (en) cDNA synthesis improvements
US20160024494A1 (en) Compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis
EP2235179A2 (fr) Procédés pour créer et identifier des éléments d'interférence avec des arn fonctionnels
JP2005517450A (ja) 短干渉核酸（ｓｉＮＡ）を用いるＲＮＡ干渉媒介性標的発見および標的評価
US5681726A (en) Method of double stranded DNA synthesis
CN111094574A (zh) 使用包括硫代磷酸酯化的核苷酸的双链多联体dna的体内rna或蛋白质表达
EP4227412A1 (fr) Arn guide modifié pour augmenter l'efficacité du système crispr/cas12f1 (cas14a1), et utilisation associée
AU782555B2 (en) Compositions and methods for enhanced sensitivity and specificity of nucleic acid synthesis
AU2004264481B2 (en) Improved siRNA molecule and method of inhibiting gene expression with the use of the same
US7863222B2 (en) shRNA library
JP2005245297A (ja) ゲノムライブラリー作製方法、および同方法により作製されたゲノムライブラリー
US20050089902A1 (en) Methods and compositions for siRNA expression
WO2006130976A1 (fr) Arn interferents, procedes d'elaboration et utilisation
US6150111A (en) Methods and kits for recombining nucleic acids
CN116981773A (zh) 用于编辑靶标rna的多聚腺苷酸化信号序列的指导rna
EP2841577B1 (fr) Groupes d'arnsi de haute complexité
Karkare et al. RNA interference silencing the transcriptional message: aspects and applications
CN115397982A (zh) 核酸组合物
US20050079614A1 (en) RNAs able to modulate chromatin silencing
JP2008507277A (ja) 修飾核酸分子の配列決定
WO2023085232A1 (fr) Procédé amélioré de préparation de banque
CN116897047A (zh) 一种有效沉默细胞中的基因表达的生物稳定的XNAzyme

Legal Events

Date Code Title Description
STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: ZHU, YORK YUAN YUAN, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:BIOMICS BIOTECHNOLOGIES CO., LTD.;REEL/FRAME:037111/0281

Effective date: 20151105