US20070259785A1 - SELECTING AND STABILIZING dsRNA CONSTRUCTS - Google Patents

SELECTING AND STABILIZING dsRNA CONSTRUCTS Download PDF

Info

Publication number
US20070259785A1
US20070259785A1 US11/674,005 US67400507A US2007259785A1 US 20070259785 A1 US20070259785 A1 US 20070259785A1 US 67400507 A US67400507 A US 67400507A US 2007259785 A1 US2007259785 A1 US 2007259785A1
Authority
US
United States
Prior art keywords
nucleic acid
dsrna
pathogen
target
pest
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/674,005
Other languages
English (en)
Inventor
Gregory Heck
Tichafa Munyikwa
Jean Goley
James Roberts
Scott Johnson
Ty Vaughn
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Monsanto Technology LLC
Original Assignee
Monsanto Technology LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Monsanto Technology LLC filed Critical Monsanto Technology LLC
Priority to US11/674,005 priority Critical patent/US20070259785A1/en
Assigned to MONSANTO TECHNOLOGY LLC reassignment MONSANTO TECHNOLOGY LLC ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: HECK, GREGORY R., JOHNSON, SCOTT C., VAUGHN, TY T., GOLEY, JEAN C., MUNYIKWA, TICHAFA R.I., ROBERTS, JAMES K.
Publication of US20070259785A1 publication Critical patent/US20070259785A1/en
Priority to US13/305,688 priority patent/US10941398B2/en
Priority to US13/960,646 priority patent/US20140080755A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/10—Applications; Uses in screening processes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates to stable expression of RNAi constructs in plants to enable genetic control of plant pathogens and pests.
  • the invention provides methods and compositions for improving the efficacy of dsRNAs derived from such constructs.
  • Short strands of complementary double stranded RNA when present in, or introduced into, living cells may specifically affect the expression of a “target” gene when regions of nucleotide sequence similarity are shared between the dsRNA and the target gene transcript.
  • RNA molecules may comprise complementary sequences separated by a “spacer” region such that double stranded regions of RNA are formed.
  • the dsRNA may be cleaved by enzymes known as dimeric RNase III ribonucleases (also called “dicer” enzymes) into segments approximately 21-25 base pairs in length; called siRNAs (“short interfering RNAs” or “small interfering RNAs”).
  • RNAi RNA-induced silencing complex
  • Caenorhabditis elegans Fire et al., 1998), Drosophila melanogaster , insects including Coleoptera (Bucher et al., 2002) and Lepidoptera (Uhlirova et al.
  • dsRNA present in plants may also guide DNA methylation of targeted chromatin regions, resulting in gene silencing (e.g. Wassenegger et al., 1994; Carthew, 2001; Zilberman et al., 2004).
  • RNAi RNAi-mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated transgenic mediated by RNAi constructs in transgenic crops.
  • dsRNA produced from a transgene in planta although targeted to another organism, may evoke in planta responses such as cleavage (“dicing”) of a transgene transcript, as well as silencing of the cognate transgene in the transgenic host plant. These responses could reduce or eliminate dsRNA production and hence efficacy against a target organism.
  • dicing cleavage
  • FIG. 1A - 1 B Alignment of a 100 bp segment of the Dv49 target with related sequences from other organisms representing multiple genera, orders and phyla. Sequences differing from Diabrotica virgifera virgifera (Dv49) are highlighted. Amino acid alignment (a.a.) for the Dv49 conceptual translation is shown below the nucleotide sequence. Reynolds scores were calculated for the Dv49 sequence and are shown below the amino acid alignment—the score position corresponds to nucleotide 19 of the antisense strand 21mer. Data from the embedded 26mer efficacy scan are presented below the Reynolds score.
  • FIG. 2 Segments of coding sequence from a Na/K-exchanging ATPase (putative Drosophila gene, CG9261, ortholog) aligned from multiple Diabrotica spp. Sequence conforming to the group consensus is boxed and shaded. Sequencing has shown presence of alleles in some instances (e.g. “R” at position 49 of NCR sequence).
  • FIG. 3 Phylogenetic tree determined using a 559 bp segment of Dv26 and the ClustalW algorithm in the DNASTAR software package (Madison, Wis.).
  • FIG. 4 Design for transgene that reduces direct contiguous sequence identity between transcript of gene and resulting dsRNA transcript. Transcription unit could be terminated by a synthetic sequence derived from siRNAs that are not productively incorporated into RISC.
  • FIG. 5 Small efficacious dsRNA segments for insertion into expression cassette at indicated sites.
  • FIG. 6 300 bp segments of Diabrotica virgifera V-ATPase subunit A for assay as dsRNA in WCR diet bio-assay.
  • UTC untreated control.
  • EST a short V-ATPase subunit A cDNA clone that lacked sections 1 and 2.
  • FIG. 7 Dv49 embedded approx. 26mer efficacy scan fed at 1 ppm.
  • FIG. 8 Dv49 embedded approx. 26mer efficacy scan fed at 0.2 ppm.
  • FIG. 9 Dv49 scan 14 27mer segment scanned as 21mers and tested for efficacy at 0.2 ppm.
  • the invention provides a method of obtaining a nucleic acid segment providing a desired level of suppression of a target gene, comprising: a) obtaining a starting nucleic acid molecule substantially complementary to a target gene; b) preparing a plurality of nucleic acid segments from the starting nucleic acid molecule; c) assaying the nucleic acid segments for the ability to suppress expression of the target gene when expressed as a dsRNA in a cell comprising the target gene; and d) identifying at least a first nucleic acid segment from the plurality of nucleic acid segments that provides a desired level of suppression of the target gene when expressed as a dsRNA.
  • the nucleic acid segments may comprise from about 21 to about 26 contiguous nucleotide portions of said starting nucleic acid molecule, including about 22, 23, 24, and 25 nucleotide portions. In certain embodiments, the segments comprise overlapping portions of said starting nucleic acid molecule and in specific embodiments may be adjoining segments. In further embodiments, the nucleic acid segments may be defined as comprising from about 0.1% to about 98% of said target gene, for example, including about 0.2%, 0.4%, 0.75%, 2%, 5%, 10%, 15%, 25%, 40%, 60%, 75% and 90%.
  • nucleic acid segments may be ranked according to the level of suppression of the target gene obtained when the nucleic acid segments are expressed as dsRNA.
  • the desired level of suppression of the target gene may be from about 1% to about 100% suppression of the expression of said target gene. In certain embodiments, the desired level of suppression may be complete suppression or incomplete suppression of the target gene.
  • the target gene may be a plant, insect, fungal, bacterial or vertebrate organism, including a crop pest or pathogen gene.
  • Assaying the nucleic acid segments for the ability to suppress the target gene may comprise expressing the segments as a dsRNA in a cell comprising the target gene and determining the level of suppression of the target gene.
  • this may comprise calculating a Reynolds score for the nucleic acid segments.
  • assaying the nucleic acid segments for the ability to suppress the target gene comprises providing said segments as dsRNA molecules in the diet of an organism comprising the target gene and determining the level of suppression of the target gene. Determining the level of suppression of the target gene may comprise observing morbidity, mortality, or stunting of said organism.
  • the invention provides a method of suppressing the expression of a target gene in a cell comprising a) obtaining a nucleic acid segment according to a method provided herein; and b) providing a dsRNA expressed from the nucleic acid to a host cell comprising the target gene to suppress the expression of the target gene.
  • providing the dsRNA expressed from the nucleic acid segment to the host cell may comprise expressing the nucleic acid segment in the host cell in sense and antisense orientation.
  • Providing the dsRNA expressed from the nucleic acid segment to the host cell may comprise providing a diet comprising the dsRNA to the cell or an organism comprising the cell and allowing the cell to take up the dsRNA.
  • the host cell is a pest cell and providing the dsRNA expressed from the nucleic acid to the pest cell comprises expressing the dsRNA in a plant cell and allowing a pest comprising the cell to feed on the plant cell.
  • suppressing the expression of the target gene in the pest cell is manifested by a phenotypic effect on said cell or the pest comprising the cell.
  • the phenotypic effect may be programmed cell death.
  • the invention provides a method for modulating the expression of at least a first gene in an organism comprising (a) providing as a dsRNA at least a first nucleic acid segment obtained by a method of the invention to said organism, wherein said dsRNA segment is specific for said gene in said organism; and (b) observing a phenotypic effect in said organism.
  • the phenotypic effect may be selected from the group consisting of cessation of vegetative growth, cessation of reproductive growth, cessation of feeding, mortality, morbidity, stunting, paralysis, inhibition of sexual reproduction, molt inhibition, flightless, and failure to emerge from pupal stage.
  • the invention provides a method for modulating the level of expression of a gene in a plant pest comprising providing in the diet of said pest at least a first dsRNA molecule, and observing a phenotypic effect of suppression of one or more genes in said pest, wherein said dsRNA molecule is produced from a nucleotide sequence that exhibits substantial homology with a corresponding DNA sequence of one or more essential genes in said pest, and wherein said nucleotide sequence is a nucleic acid segment identified according to a method provided herein.
  • the invention provides a method for inhibiting plant pest infestation comprising expressing a dsRNA molecules obtained according to a method of the invention in a transgenic plant and providing the plant or a part or tissue thereof to one or more pests comprising said nucleotide sequence, and observing a phenotypic effect in said organism, wherein the phenotypic effect is sufficient to inhibit infestation of said transgenic plant by said pest.
  • the invention provides a method for protecting a plant from pest infestation comprising expressing a dsRNA molecules obtained according to the invention in a transgenic plant, providing said plant or a part or tissue thereof to one or more pests comprising said nucleotide sequence, and observing a phenotypic effect in the organism, wherein the phenotypic effect is sufficient to inhibit infestation of the transgenic plant by the pest.
  • the invention also provides a plant protected from pest infestation according to any of the methods described herein, as well as a plant regenerated from such a cell, and also a seed or progeny produced from such a plant, wherein said seed or progeny comprises a nucleotide sequence obtained according to the invention.
  • the invention provides a method of producing an expression construct for expressing a dsRNA with reduced transgene silencing in a plant cell, comprising: (a) preparing an expression construct comprising a first sequence, a second sequence, and a third polynucleotide sequence, wherein the third polynucleotide sequence is linked to the first polynucleotide sequence by the second polynucleotide sequence and the third polynucleotide sequence is substantially the reverse complement of the first polynucleotide sequence; and (b) introducing an intron into at least one of the first and third polynucleotide sequences or introducing said expression construct into the intron, wherein the first and third polynucleotide sequences hybridize when transcribed into RNA and form a dsRNA molecule stabilized by the second polynucleotide sequence after intron splicing, and wherein the expression construct exhibits reduced transgene silencing in a plant cell transformed with
  • the intron is introduced into at least one of the first and third polynucleotide sequences. In another embodiment, the intron is introduced into the first and third polynucleotide sequences. In further embodiments, the expression construct is introduced into the intron.
  • the invention provides a method of controlling feeding by a target crop pest or pathogen or progeny thereof on a plant comprising introducing into the plant an expression construct prepared by any of the methods disclosed herein.
  • the construct may be introduced, for example, by direct genetic transformation or by transformation of a parent plant and/or progenitor cell.
  • the invention further provides an expression construct prepared according to any of the methods disclosed herein. Still further provided are transgenic plants and plant cell transformed with an expression construct disclosed herein.
  • the invention provides a method of increasing the pest or pathogen-inhibitory activity of a dsRNA, comprising: (a) obtaining a first nucleic acid segment that when expressed as a dsRNA and taken up by a target crop pest or pathogen inhibits feeding by the target crop pest or pathogen or progeny thereof; and (b) linking the first nucleic acid segment to a second nucleic acid segment to create a longer nucleic acid segment, wherein the second nucleic acid segment is a nucleic acid that does not inhibit feeding by the target crop pest or pathogen or progeny thereof when expressed as a dsRNA, and wherein a dsRNA expressed from the longer nucleic acid exhibits increased potency of inhibition of feeding by the target crop pest or pathogen or progeny thereof relative to the dsRNA expressed from the first nucleic acid segment alone.
  • the first nucleic acid segment is obtained by a method comprising the steps of: I) obtaining a starting nucleic acid molecule that when expressed as a dsRNA and taken up by a target crop pest or pathogen inhibits feeding by the target crop pest or pathogen or progeny thereof; II) selecting at least a first portion of the starting nucleic acid molecule that inhibits feeding by a target crop pest or pathogen or a progeny thereof following uptake of a dsRNA expressed from said portion; and III) employing the portion as said the first nucleic acid segment in step a).
  • the starting nucleic acid molecule may be a cDNA.
  • step II) comprises preparing a series of overlapping or consecutive portions from the starting nucleic acid molecule and identifying from said portions at least a first portion that inhibits feeding by a target crop pest or pathogen or a progeny thereof when expressed as a dsRNA and taken up by the target crop pest or pathogen.
  • the method of increasing the pest or pathogen-inhibitory activity of a dsRNA may further comprise in particular embodiments producing a recombinant vector comprising a first, a second and a third polynucleotide sequence, wherein the first polynucleotide sequence comprises the longer nucleotide segment and wherein the third polynucleotide sequence is linked to the first polynucleotide sequence by the second polynucleotide sequence, and wherein the third polynucleotide sequence is substantially the reverse complement of the first polynucleotide sequence such that the first and the third polynucleotide sequences hybridize when transcribed into a ribonucleic acid to form the double stranded ribonucleotide molecule stabilized by the linked second ribonucleotide sequence.
  • the second nucleotide segment is not substantially complementary to a nucleotide sequence of the target crop pest or pathogen.
  • one or both of the first nucleic acid segment and the third nucleic acid segment comprises an intron.
  • the method may also comprise introducing an intron into said first nucleic acid segment.
  • the first nucleic acid segment may comprise about 19 to about 80, about 19 to about 50 and about 21 to about 30 contiguous bases substantially complementary to a coding sequence of the target crop pest or pathogen.
  • the longer nucleic acid segment may comprise at least about 80 bases, including at least about 100 bases and from about 80 bp to about 250 bases.
  • the target crop pest or pathogen is an insect and may be a Coleopteran, Lepidopteran, Homopteran, or Hemipteran, e.g. a Diabrotica spp. In other embodiments the target crop pest or pathogen is a nematode.
  • the invention further provides a method for producing an expression construct for expressing a dsRNA with increased specificity of pest or pathogen-inhibitory activity comprising: (a) obtaining a starting nucleic acid molecule substantially complementary to at least a first coding sequence of a target crop pest or pathogen; (b) selecting a region within the starting molecule that when expressed as a dsRNA inhibits feeding by the target crop pest or pathogen or progeny thereof following uptake of the dsRNA expressed from the region by the target crop pest or pathogen; (c) linking the region to a second nucleic acid molecule to produce an expression construct, wherein the second nucleic acid molecule when expressed as a dsRNA does not inhibit feeding by a target crop pest or pathogen or progeny thereof following uptake of the dsRNA.
  • the starting nucleic acid molecule utilized by the method may be a cDNA from the target crop pest or pathogen, such as an insect or nematode.
  • the insect may be a Coleopteran, Lepidopteran, Homopteran, or Hemipteran insect, including an insect selected from the group consisting of: D. virgifera virgifera; D. virgifera zeae; D. undecimpunctata; D. balteata; D. barberi ; and D. speciosa .
  • the first nucleic acid segment may comprise about 19 to about 80, about 19 to about 50 and about 21 to about 30 contiguous bases substantially complementary to a coding sequence of the target crop pest or pathogen.
  • the longer nucleic acid segment may comprise at least about 80 bases, including at least about 100 bases and from about 80 bp to about 250 bases.
  • a further aspect of the invention provides a method comprising identifying at least a second region within the starting molecule that when expressed as a dsRNA inhibits feeding by the target crop pest or pathogen or progeny thereof, and linking the second region to the second nucleic acid molecule or a third nucleic acid molecule that when expressed as a dsRNA does not inhibit feeding by a target crop pest or pathogen or progeny thereof following uptake of the dsRNA expressed from the third nucleic acid molecule by the target plant pest or pathogen.
  • the region is not substantially complementary to a nucleic acid of a non-target crop pest or pathogen.
  • the region is complementary to a nucleic acid unique to the species in which the target crop pest or pathogen is classified. In yet other embodiments, the region is complementary to a nucleic acid unique to the genus in which the target crop pest or pathogen is classified.
  • the region is unique to Diabrotica spp., including those selected from the group consisting of Diabrotica undecimpunctata howardii (Southern Corn Rootworm (SCR)), Diabrotica virgifera virgifera (Western Corn Rootworm (WCR)), Diabrotica barberi (Northern Corn Rootworm (NCR)), Diabrotica virgifera zeae (Mexican Corn Rootworm (MCR)), Diabrotica balteata, Diabrotica viridula , and Diabrotica speciosa (Brazilian Corn Rootworm (BZR)).
  • SCR Southern Corn Rootworm
  • WCR Western Corn Rootworm
  • NCR Northern Corn Rootworm
  • MCR Microbrotica virgifera zeae
  • Diabrotica balteata Diabrotica viridula
  • Diabrotica speciosa Brazilian Corn Rootworm (BZR)
  • the invention provides a method of controlling feeding by a target crop plant pest or pathogen or progeny thereof on a plant comprising introducing into the plant an expression construct or dsRNA prepared by the foregoing method.
  • the invention also provides a plant cell transformed with an expression construct prepared by the foregoing method.
  • the invention provides a method of enhancing the control of a target crop pest or pathogen in a plant comprising expressing in the cells of the plant at least two dsRNA sequences that function upon uptake by the pest or pathogen to inhibit the expression of at least a first target coding sequence within the target crop pest or pathogen, wherein the two dsRNA sequences are substantially complementary to two non-contiguous portions of the first target coding sequence or to two different coding sequences of the target crop pest or pathogen.
  • the invention provides a method wherein the two dsRNA sequences comprises about 19 bp to about 80 bp, or about 19 bp to about 50 bp, or about 21 bp to about 30 bp in length.
  • the two dsRNA sequences are substantially complementary to at least two target coding sequences of the target crop pest or pathogen.
  • the method may further comprise expressing in the cells of the plant at least a third dsRNA sequence that functions upon uptake by the pest or pathogen to inhibit the expression of a third target coding sequence within the target crop pest or pathogen, wherein the third dsRNA sequence is substantially complementary to a portion of the third target coding sequence.
  • a method is provided wherein the two dsRNA sequences are expressed from regions selected from a starting nucleic acid molecule that when expressed as a dsRNA inhibits feeding by a target crop pest or pathogen or progeny thereof following uptake of the dsRNA by the target crop pest or pathogen.
  • the starting nucleic acid molecule may further be a cDNA from the target crop pest or pathogen.
  • the provided method further comprises expressing a polynucleotide sequence in the cell selected from the group consisting of a patatin, a Bacillus thuringiensis insecticidal protein, a Xenorhabdus insecticidal protein, a Photorhabdus insecticidal protein, a Bacillus laterosporus insecticidal protein, and a Bacillus sphaericus insecticidal protein.
  • exemplary polynucleotides may encode a Bacillus thuringiensis insecticidal protein selected from the group consisting of a Cry1, a Cry2, a Cry3, or a coleopteran toxic protein selected from the group consisting of a TIC851, a CryET70, ET29, a binary insecticidal protein CryET33 and CryET34, a binary insecticidal protein CryET80 and CryET76, a binary insecticidal protein ET29 and TIC810, a binary insecticidal protein TIC100 and TIC101, and a binary insecticidal protein PS149B1, or other coleopteran toxic protein (e.g.
  • control agent(s) include one or more polynucleotides of the present invention that express a dsRNA and at least one other agent toxic to a plant pest such as an insect or a nematode.
  • the invention further provides a method wherein the target coding sequence encodes a protein, the predicted function of which is selected from the group consisting of muscle formation, juvenile hormone formation, juvenile hormone regulation, ion regulation and transport, digestive enzyme synthesis, maintenance of cell membrane potential, feeding site formation, feeding site development, feeding site maintenance, infection, molting, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone sensing, antennae formation, wing formation, leg formation, development and differentiation, egg formation, larval maturation, digestive enzyme formation, haemolymph synthesis, haemolymph maintenance, neurotransmission, cell division, energy metabolism, respiration, and apoptosis.
  • a protein the predicted function of which is selected from the group consisting of muscle formation, juvenile hormone formation, juvenile hormone regulation, ion regulation and transport, digestive enzyme synthesis, maintenance of cell membrane potential, feeding site formation, feeding site development, feeding site maintenance, infection, molting, amino acid biosynthesis, amino acid degradation, sperm formation, p
  • the invention provides a method wherein two coding sequences are targeted.
  • the two target coding sequences may perform at least two functions essential for target crop pest or pathogen survival that are suppressed by the dsRNA sequences, the functions being selected from the group consisting of feeding by the pest or pathogen, cell apoptosis, cell differentiation and development, capacity or desire for sexual reproduction, muscle formation, muscle twitching, muscle contraction, juvenile hormone formation, juvenile hormone regulation, ion regulation and transport, maintenance of cell membrane potential, amino acid biosynthesis, amino acid degradation, sperm formation, pheromone synthesis, pheromone sensing, antennae formation, wing formation, leg formation, egg formation, larval maturation, digestive enzyme formation, haemolymph synthesis, haemolymph maintenance, neurotransmission, larval stage transition, pupation, emergence from pupation, cell division, energy metabolism, respiration, and formation of cytoskeletal structure.
  • the invention further provides a method of resistance management, comprising contacting a target organism with at least a first nucleic acid segment of the present invention, and one or more agent(s) selected from the group consisting of: a patatin, a Bacillus thuringiensis insecticidal protein, a Xenorhabdus insecticidal protein, a Photorhabdus insecticidal protein, a Bacillus laterosporus insecticidal protein, a Bacillus sphaericus insecticidal protein, or other insecticidal Bt toxin as set forth at the website: lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/index.html., a biocontrol agent, and an insecticide.
  • a patatin a Bacillus thuringiensis insecticidal protein
  • a Xenorhabdus insecticidal protein a Photorhabdus insecticidal protein
  • the methods enhance the specificity of small interfering RNA (siRNA) or related segments produced from plant transgenes that encode dsRNA, and that provide dsRNA-mediated suppression of target gene expression in plant pests and plant pathogens.
  • the transgene construct and target sequence size is optimized for production and delivery of one or more ribonucleotides effective in the cells of specific target species, while avoiding production of non-specific siRNAs that might otherwise modulate gene expression in an unintended manner.
  • the invention reduces the potential for silencing of the transgene in the plant by disrupting continuous target sequence with introns, thereby preventing feedback that would recognize the gene and lead to silencing in the plant.
  • Sequences that specifically target pest or pathogen species may be engineered into plant expression constructs, such as those with inverted repeats or by use of other methods for eliciting the formation of dsRNA.
  • siRNAs By cloning siRNAs or by empirical determination via presentation of dsRNA segments to cells or whole pests that scan across a target sequence, 21-24mers that effectively lead to target message degradation can be determined.
  • novel sequence structure for expression in planta can be created.
  • This sequence structure can be further designed to yield dsRNA molecules, encoding one or more siRNA molecules that are effectively taken up by the target species, while at the same time resulting in formation of siRNAs specific for modulating expression of a specific ortholog, homolog, or allele of a target gene in a target species.
  • a dsRNA construct that targets that member based on sequence polymorphism between the members of a gene family.
  • specific target sequences e.g. siRNA-sized, approximately 20-25 base pairs in length
  • the efficacy of specific siRNA-sized ribonucleotide sequences can be determined by practical evaluations in bio-assays or through the use of predictive tools (e.g. Reynolds scores; Reynolds et al., 2004) that consider biophysical parameters that are common to effective or ineffective siRNAs.
  • predictive tools e.g. Reynolds scores; Reynolds et al., 2004
  • RNA enhances the ability to produce highly effective and specific transgenic constructs.
  • WCR western corn rootworm
  • a 50 bp segment of the WCR V-ATPase subunit A is sufficient to elicit mortality when tandemly duplicated 5 times (250 bp total), but is ineffective as a 50 bp monomer.
  • the 50 bp segment embedded in a neutral carrier sequence to yield a total dsRNA of 100 bp was also effective.
  • one or more siRNA sequence can be embedded for transcription within longer sequences.
  • Such sequences may be used to demonstrate the effectiveness of any candidate siRNA, independent of adjacent naturally occurring sequences, allowing for enhanced flexibility in designing transgene constructs that encode dsRNA.
  • Naturally occurring adjacent sequences that demonstrate less efficacy or specificity may be left out of a dsRNA construct, while the construct nevertheless encodes the necessary sequence, and sequence length, to yield efficacious siRNA upon expression within a plant host cell and uptake and processing in a cell of a target organism.
  • This knowledge enables the creation of novel chimeric sequences that incorporate chosen sequences encoding siRNAs into highly effective primary suppression transcripts.
  • a transgene designed by the present methods may also have dsRNA segment(s) encoding siRNA sequences interrupted through intron placement. Inclusion of one or more intron sequences in the target sequence may enhance production and stability of a primary transcript that ultimately yields an effective siRNA, while displaying a reduced propensity to be silenced in the plant cell. Additional sequence such as 5′ and 3′ untranslated regions (UTRs) and other sequence, for instance to make exons of at least a minimal required size for plant processing, may be produced by combining sequences (e.g. direct tandem sense sequence) that do not elicit effective siRNAs. Additional exon sequences may be created from sequence that does not give rise to productive siRNAs.
  • UTRs 5′ and 3′ untranslated regions
  • Additional exon sequences may be created from sequence that does not give rise to productive siRNAs.
  • This arrangement may result in a reduced potential to silence the transgene (e.g. via methylation and eventual transcriptional silencing in a plant host cell) because the gene is distinct in sequence from the processed transcript that generates siRNAs, which might otherwise cause transgene silencing via changes in chromatin structure.
  • the presence of introns in the siRNA regions of the primary transcript may also slow overall processing and improve the longevity or stability of the dsRNA that results ( FIG. 4 ).
  • Additional target sequences may be added by extending the primary transcriptional unit with more introns and exons designed as above. Overlapping potent siRNAs and placing the intron within the overlap could expand the number of target sequences while minimizing the number of required introns within the construct ( FIG. 5 ).
  • One or more distinct sequences, each encoding siRNAs targeting expression of one or more target genes and that modulate gene expression in a target organism, may be deployed.
  • Suppression of expression of two or more target genes allows for provision of multiple modes of action via dsRNA-mediated gene suppression against a target organism. Multiple modes of action may also be achieved in transgenic plants by combining one or more dsRNA-mediated approaches with other means, such as Bacillus -derived insecticidal peptides (e.g. crystal proteins), to interfere with the growth and development of target organisms. Combining several or multiple sequences encoding potent siRNAs, possibly in conjunction with other means, also allows development of durable pest resistance management schemes.
  • the invention provides recombinant DNA constructs for use in achieving stable transformation of a host plant cell.
  • Transformed host cells may express effective levels of preferred dsRNA molecules and hence siRNA from the recombinant DNA constructs, to modulate gene expression in target cells.
  • Isolated and purified nucleotide segments may be provided from cDNA and/or genomic libraries. Deduced nucleotide sequence information allows identification of pairs of nucleotide sequences which may be derived from any preferred invertebrate pest, such as an insect, for use as thermal amplification primers to generate the dsRNA and siRNA molecules of the present invention.
  • nucleic acid refers to a single or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases.
  • the “nucleic acid” may also optionally contain non-naturally occurring or altered nucleotide bases that permit correct read through by a polymerase and do not reduce expression of a polypeptide encoded by that nucleic acid.
  • nucleotide sequence or “nucleic acid sequence” refers to both the sense and antisense strands of a nucleic acid as either individual single strands or in the duplex.
  • RNA ribonucleic acid
  • RNAi inhibitor RNA
  • dsRNA double stranded RNA
  • siRNA small interfering RNA
  • mRNA messenger RNA
  • miRNA miRNA
  • micro-RNA miRNA
  • sRNA small RNA
  • tRNA transfer RNA, whether charged or discharged with a corresponding acylated amino acid
  • cRNA complementary RNA
  • deoxyribonucleic acid DNA is inclusive of cDNA and genomic DNA and DNA-RNA hybrids.
  • nucleic acid segment “nucleotide sequence segment”, or more generally “segment” will be understood by those in the art as a functional term that includes both genomic sequences, ribosomal RNA sequences, transfer RNA sequences, messenger RNA sequences, operon sequences and smaller engineered nucleotide sequences that express, or may be adapted to express, polynucleotides, proteins, polypeptides or peptides.
  • nucleotide sequences the expression of which results in an RNA sequence which is substantially homologous to an RNA molecule of a targeted gene in a target organism, such as a plant pest or pathogen.
  • a target organism such as a plant pest or pathogen.
  • the term “substantially homologous” or “substantial homology”, with reference to a nucleic acid sequence, includes a nucleotide sequence that hybridizes under stringent conditions to a coding sequence as set forth in the sequence listing, or the complements thereof. Sequences that hybridize under stringent conditions are those that allow an antiparallel alignment to take place between the two sequences, and the two sequences are then able, under stringent conditions, to form hydrogen bonds with corresponding bases on the opposite strand to form a duplex molecule that is sufficiently stable under the stringent conditions to be detectable using methods well known in the art.
  • Substantially homologous sequences have preferably from about 70% to about 80% sequence identity, or more preferably from about 80% to about 85% sequence identity, or most preferable from about 90% to about 95% sequence identity, to about 99% sequence identity, to a nucleotide sequence as set forth in the sequence listing, or the complements thereof.
  • sequence identity As used herein, the term “sequence identity”, “sequence similarity” or “homology” is used to describe sequence relationships between two or more nucleotide sequences. The percentage of “sequence identity” between two sequences is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • a sequence that is identical at every position in comparison to a reference sequence is said to be identical to the reference sequence and vice-versa.
  • a first nucleotide sequence when observed in the 5′ to 3′ direction is said to be a “complement” of, or complementary to, a second or reference nucleotide sequence observed in the 3′ to 5′ direction if the first nucleotide sequence exhibits complete complementarity with the second or reference sequence.
  • nucleic acid sequence molecules are said to exhibit “complete complementarity” when every nucleotide of one of the sequences read 5′ to 3′ is complementary to every nucleotide of the other sequence when read 3′ to 5′.
  • a nucleotide sequence that is complementary to a reference nucleotide sequence will exhibit a sequence identical to the reverse complement sequence of the reference nucleotide sequence.
  • a “comparison window” refers to a conceptual segment of at least 6 contiguous positions, usually about 50 to about 100, more usually about 100 to about 150, in which a sequence is compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • the comparison window may comprise additions or deletions (i.e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences Those skilled in the art should refer, for example, to the detailed methods used for sequence alignment in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Drive Madison, Wis., USA).
  • the present invention provides DNA sequences capable of being expressed as an RNA in a cell or microorganism to inhibit target gene expression in a cell, tissue or organ of a target organism.
  • the sequences may comprise a DNA molecule coding for one or more different nucleotide sequences, wherein each of the different nucleotide sequences comprises a sense nucleotide sequence and an antisense nucleotide sequence.
  • the sequences may be connected by a spacer sequence.
  • the spacer sequence can constitute part of the sense nucleotide sequence or the antisense nucleotide sequence and is found within the dsRNA molecule between the sense and antisense sequences.
  • the sense nucleotide sequence or the antisense nucleotide sequence is substantially identical to the nucleotide sequence of the target gene or a derivative thereof or a complementary sequence thereto.
  • the dsDNA molecule may be placed operably under the control of a promoter sequence that functions in the cell, tissue or organ of the host expressing the dsDNA to produce dsRNA molecules.
  • plant expression construct refers to a recombinant DNA molecule comprising a promoter functional in a plant cell operably linked to a DNA sequence that encodes dsRNA, and a 3′ transcription termination polynucleotide molecule.
  • the invention also provides a DNA sequence for expression in a cell of a plant that, upon expression of the DNA to RNA and being taken up by a target organism, such as a plant pathogen or plant pest, achieves suppression of a target gene in a cell, tissue or organ of a target organism.
  • the dsRNA may comprise one or multiple structural gene sequences, wherein each of the structural gene sequences comprises a sense nucleotide sequence and an antisense nucleotide sequence that may be connected by a spacer sequence that forms a loop within the complementary sense and antisense sequences.
  • An intron sequence with appropriate splice sites may be placed in at least one of the sense and antisense nucleotide sequences.
  • the sense nucleotide sequence or the antisense nucleotide sequence, apart from any intron present, is substantially identical to the nucleotide sequence of the target gene, derivative thereof, or sequence complementary thereto.
  • the one or more structural gene sequences may be placed operably under the control of one or more promoter sequences, at least one of which is operable in the cell, tissue or organ of a host organism for expression of the transcript.
  • a gene sequence or fragment for control of gene expression in a target organism according to the invention may be cloned between two tissue specific promoters, which are operable in a transgenic plant cell, and therein expressed to produce mRNA in the transgenic plant cell that form dsRNA molecules thereto.
  • the dsRNA molecules contained in plant tissues may be taken up by a target organism so that the intended suppression of the target gene expression is achieved.
  • a nucleotide sequence provided by the present invention may comprise an inverted repeat separated by a “spacer sequence.”
  • the spacer sequence may be a region comprising any sequence of nucleotides that facilitates secondary structure formation between each repeat, where this is required.
  • the spacer sequence is part of the sense or antisense coding sequence for mRNA.
  • the spacer sequence may alternatively comprise any combination of nucleotides or homologues thereof that are capable of being linked covalently to a nucleic acid molecule.
  • the spacer sequence may comprise, for example, a sequence of nucleotides of at least about 10-100 nucleotides in length, or alternatively at least about 100-200 nucleotides in length, at least 200-400 about nucleotides in length, or at least about 400-500 nucleotides in length.
  • nucleic acid molecules or fragments of the nucleic acid molecules or other nucleic acid molecules in the sequence listing are capable of specifically hybridizing to other nucleic acid molecules under certain circumstances.
  • two nucleic acid molecules are said to be capable of specifically hybridizing to one another if the two molecules are capable of forming an anti-parallel, double-stranded nucleic acid structure.
  • a nucleic acid molecule is said to be the complement of another nucleic acid molecule if they exhibit complete complementarity.
  • Two molecules are said to be “minimally complementary” if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under at least conventional “low-stringency” conditions.
  • the molecules are said to be complementary if they can hybridize to one another with sufficient stability to permit them to remain annealed to one another under conventional “high-stringency” conditions.
  • Conventional stringency conditions are described by Sambrook, et al., (1989), and by Haymes et al., (1985).
  • nucleic acid molecule or a fragment of the nucleic acid molecule to serve as a primer or probe it needs only be sufficiently complementary in sequence to be able to form a stable double-stranded structure under the particular solvent and salt concentrations employed.
  • Appropriate stringency conditions which promote DNA hybridization are, for example, 6.0 ⁇ sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0 ⁇ SSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology (1989).
  • the salt concentration in the wash step can be selected from a low stringency of about 2.0 ⁇ SSC at 50° C. to a high stringency of about 0.2 ⁇ SSC at 50° C.
  • the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22° C., to high stringency conditions at about 65° C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed.
  • a nucleic acid for use in the present invention will exhibit at least from about 80%, or at least from about 90%, or at least from about 95%, or at least from about 98% or even about 100% sequence identity with one or more nucleic acid molecules as set forth in the sequence listing.
  • Nucleic acids of the present invention may also be synthesized, either completely or in part, especially where it is desirable to provide plant-preferred sequences, by methods known in the art. Thus, all or a portion of the nucleic acids of the present invention may be synthesized using codons preferred by a selected host. Species-preferred codons may be determined, for example, from the codons used most frequently in the proteins expressed in a particular host species. Other modifications of the nucleotide sequences may result in mutants having slightly altered activity.
  • dsRNA or siRNA nucleotide sequences comprise double strands of polymerized ribonucleotide and may include modifications to the phosphate-sugar backbone or the nucleoside. Modifications in RNA structure may be tailored to allow specific genetic inhibition. In one embodiment, the dsRNA molecules may be modified through an enzymatic process so that siRNA molecules may be generated. The siRNA can efficiently mediate the down-regulation effect for some target genes in some target organisms.
  • This enzymatic process may be accomplished by utilizing an RNAse III enzyme or a DICER enzyme, present in the cells of an insect, a vertebrate animal, a fungus or a plant in the eukaryotic RNAi pathway (Elbashir et al., 2002; Hamilton and Baulcombe, 1999).
  • This process may also utilize a recombinant DICER or RNAse III introduced into the cells of an organism through recombinant DNA techniques that are readily known to those skilled in the art. Both the DICER enzyme and RNAse III, being naturally occurring in an organism, or being made through recombinant DNA techniques, cleave larger dsRNA strands into smaller oligonucleotides.
  • the DICER enzymes specifically cut the dsRNA molecules into siRNA pieces each of which is about 19-25 nucleotides in length while the RNAse III enzymes normally cleave the dsRNA molecules into 12-15 base-pair siRNA.
  • the siRNA molecules produced by either of the enzymes have 2 to 3 nucleotide 3′ overhangs, and 5′ phosphate and 3′ hydroxyl termini.
  • RNAse III enzyme The siRNA molecules generated by RNAse III enzyme are the same as those produced by Dicer enzymes in the eukaryotic RNAi pathway and are hence then targeted and degraded by an inherent cellular RNA-degrading mechanism after they are subsequently unwound, separated into single-stranded RNA and hybridize with the RNA sequences transcribed by the target gene.
  • This process results in the effective degradation or removal of the RNA sequence encoded by the nucleotide sequence of the target gene in the target organism.
  • the outcome is the silencing of a particularly targeted nucleotide sequence within the target organism. Detailed descriptions of enzymatic processes can be found in Hannon (2002).
  • a nucleotide sequence of the present invention can be recorded on computer readable media.
  • “computer readable media” refers to any tangible medium of expression that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as floppy discs, hard disc, storage medium, and magnetic tape: optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; optical character recognition formatted computer files, and hybrids of these categories such as magnetic/optical storage media.
  • magnetic storage media such as floppy discs, hard disc, storage medium, and magnetic tape
  • optical storage media such as CD-ROM
  • electrical storage media such as RAM and ROM
  • optical character recognition formatted computer files and hybrids of these categories such as magnetic/optical storage media.
  • “recorded” refers to a process for storing information on computer readable medium.
  • a skilled artisan can readily adopt any of the presently known methods for recording information on computer readable medium to generate media comprising the nucleotide sequence information of the present invention.
  • a variety of data storage structures are available to a skilled artisan for creating a computer readable medium having recorded thereon a nucleotide sequence of the present invention. The choice of the data storage structure will generally be based on the means chosen to access the stored information.
  • a variety of data processor programs and formats can be used to store the nucleotide sequence information of the present invention on computer readable medium.
  • sequence information can be represented in a word processing text file, formatted in commercially-available software such as WordPerfect and Microsoft Word, or represented in the form of an ASCII text file, stored in a database application, such as DB2, Sybase, Oracle, or the like.
  • a database application such as DB2, Sybase, Oracle, or the like.
  • the skilled artisan can readily adapt any number of data processor structuring formats (e.g. text file or database) in order to obtain computer readable medium having recorded thereon the nucleotide sequence information of the present invention.
  • Computer software is publicly available which allows a skilled artisan to access sequence information provided in a computer readable medium.
  • Software that implements the BLAST (Altschul et al., 1990) and BLAZE (Brutlag, et al., 1993) search algorithms on a Sybase system can be used to identify open reading frames (ORFs) within sequences such as the Unigenes and EST's that are provided herein and that contain homology to ORFs or proteins from other organisms.
  • ORFs open reading frames
  • ORFs are protein-encoding fragments within the sequences of the present invention and are useful in producing commercially important proteins such as enzymes used in amino acid biosynthesis, metabolism, transcription, translation, RNA processing, nucleic acid and a protein degradation, protein modification, and DNA replication, restriction, modification, recombination, and repair.
  • the present invention further provides systems, particularly computer-based systems, which contain the sequence information described herein. Such systems are designed to identify commercially important fragments of the nucleic acid molecule of the present invention.
  • a computer-based system refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention.
  • the minimum hardware means of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means.
  • a target structural motif refers to any rationally selected sequence or combination of sequences in which the sequences or sequence(s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif.
  • target motifs include, but are not limited to, enzymatic active sites and signal sequences.
  • Nucleic acid target motifs include, but are not limited to, promoter sequences, cis elements, hairpin structures, siRNAs, and inducible expression elements (protein binding sequences).
  • a recombinant DNA vector may, for example, be a linear or a closed circular plasmid.
  • the vector system may be a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the bacterial host.
  • a bacterial vector may be an expression vector. Nucleic acid molecules as set forth in the sequence listing, or fragments thereof, can, for example, be suitably inserted into a vector under the control of a suitable promoter that functions in one or more microbial hosts to drive expression of a linked coding sequence or other DNA sequence.
  • vectors are available for this purpose, and selection of the appropriate vector will depend mainly on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector.
  • Each vector contains various components depending on its function (amplification of DNA or expression of DNA) and the particular host cell with which it is compatible.
  • the vector components for bacterial transformation generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more selectable marker genes, and an inducible promoter allowing the expression of exogenous DNA.
  • Selection genes may contain a selection gene, also referred to as a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics, herbicides, or other toxins, e.g., ampicillin, neomycin, methotrexate, glyphosate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli. Those cells that are successfully transformed with a heterologous protein or fragment thereof produce a protein conferring drug resistance and thus survive the selection regimen.
  • An expression vector for producing a mRNA can also contain an inducible promoter that is recognized by the host organism and is operably linked to the nucleic acid encoding, the nucleic acid molecule, or fragment thereof, of interest.
  • Inducible promoters suitable for use with bacterial hosts include ⁇ -lactamase promoter, E. coli ⁇ phage PL and PR promoters, E. coli galactose promoter, arabinose promoter, alkaline phosphatase promoter, tryptophan (trp) promoter, and the lactose operon promoter and variations thereof and hybrid promoters such as the tac promoter.
  • trp tryptophan
  • operably linked means that the regulatory sequence causes regulated expression of the linked structural nucleotide sequence.
  • regulatory sequences or “control elements” refer to nucleotide sequences located upstream (5′ non-coding sequences), within, or downstream (3′ non-translated sequences) of a structural nucleotide sequence, and which influence the timing and level or amount of transcription, RNA processing or stability, or translation of the associated structural nucleotide sequence. Regulatory sequences may include promoters, translation leader sequences, introns, enhancers, stem-loop structures, repressor binding sequences, and polyadenylation recognition sequences and the like.
  • the expression constructs can be integrated into the host cell genome with an integrating vector.
  • Integrating vectors typically contain at least one sequence homologous to the chromosome that allows the vector to integrate. Integrations appear to result from recombination between homologous DNA in the vector and the chromosome in the case of bacteria.
  • integrating vectors constructed with DNA from various Bacillus strains integrate into the Bacillus chromosome (EP 0 127,328). Integrating vectors may also be comprised of bacteriophage or transposon sequences. Suicide vectors are also known in the art.
  • Suitable vectors containing one or more of the above-listed components employs standard recombinant DNA techniques. Isolated plasmids or DNA fragments can be cleaved, tailored, and re-ligated in the form desired to generate the plasmids required.
  • Examples of available bacterial expression vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as BluescriptTM (Stratagene, La Jolla, Calif.); pIN vectors (Van Heeke and Schuster, 1989); and the like.
  • a yeast recombinant construct can typically include one or more of the following: a promoter sequence, fusion partner sequence, leader sequence, transcription termination sequence, a selectable marker. These elements can be combined into an expression cassette, which may be maintained in a replicon, such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as yeast or bacteria.
  • a replicon such as an extrachromosomal element (e.g., plasmids) capable of stable maintenance in a host, such as yeast or bacteria.
  • the replicon may have two replication systems, thus allowing it to be maintained, for example, in yeast for expression and in a prokaryotic host for cloning and amplification.
  • yeast-bacteria shuttle vectors examples include YEp24 (Botstein et al., 1979), pCl/1 (Brake et al., 1984), and YRp17 (Stinchcomb et al., 1982).
  • a replicon may be either a high or low copy number plasmid.
  • a high copy number plasmid will generally have a copy number ranging from about 5 to about 200, and typically about 10 to about 150.
  • a host containing a high copy number plasmid will preferably have at least about 10, and more preferably at least about 20 copies.
  • Useful yeast promoter sequences can be derived from genes encoding enzymes in the metabolic pathway. Examples of such genes include alcohol dehydrogenase (ADH) (EP 0 284044), enolase, glucokinase, glucose-6-phosphate isomerase, glyceraldehyde-3-phosphate-dehydrogenase (GAP or GAPDH), hexokinase, phosphofructokinase, 3-phosphoglycerate mutase, and pyruvate kinase (PyK) (EP 0 3215447).
  • ADH alcohol dehydrogenase
  • GAP or GAPDH glyceraldehyde-3-phosphate-dehydrogenase
  • hexokinase phosphofructokinase
  • 3-phosphoglycerate mutase 3-phosphoglycerate mutase
  • pyruvate kinase PyK
  • yeast promoters that do not occur in nature also function as yeast promoters.
  • hybrid promoters include the ADH regulatory sequence linked to the GAP transcription activation region (U.S. Pat. Nos. 4,876,197 and 4,880,734).
  • transcription terminator sequences and other yeast-recognized termination sequences such as those coding for glycolytic enzymes, are known to those of skill in the art.
  • the expression constructs can be integrated into the yeast genome with an integrating vector.
  • Integrating vectors typically contain at least one sequence homologous to a yeast chromosome that allows the vector to integrate, and preferably contain two homologous sequences flanking the expression construct. Integrations appear to result from recombination between homologous DNA in the vector and the yeast chromosome (Orr-Weaver et al., 1983).
  • An integrating vector may be directed to a specific locus in yeast by selecting the appropriate homologous sequence for inclusion in the vector. See Orr-Weaver et al., supra.
  • One or more expression constructs may integrate, possibly affecting levels of recombinant protein produced (Rine et al., 1983).
  • the present invention also contemplates transformation of a nucleotide sequence of the present invention into a plant to achieve inhibitory levels of expression of one or more dsRNA molecules.
  • a transformation vector can be readily prepared using methods available in the art.
  • the transformation vector typically comprises one or more nucleotide sequences capable of being transcribed to an RNA molecule substantially homologous and/or complementary to one or more nucleotide sequences encoded by the genome of the target organism, and may comprise an intron sequence within the otherwise homologous or complementary sequence such that uptake by the organism of the RNA transcribed and processed from the one or more nucleotide sequences results in down-regulation of expression of at least one of the respective nucleotide sequences of the genome of the target organism.
  • the transformation vector may be termed a dsDNA construct and may also be defined as a recombinant molecule, a pest or disease control agent, a genetic molecule or a chimeric genetic construct.
  • a chimeric genetic construct of the present invention may comprise, for example, nucleotide sequences encoding one or more antisense transcripts, one or more sense transcripts, one or more of each of the aforementioned, wherein all or part of a transcript therefrom is homologous to all or part of an RNA molecule comprising an RNA sequence encoded by a nucleotide sequence within the genome of a target organism.
  • a plant transformation vector comprises an isolated and purified DNA molecule comprising a heterologous promoter operatively linked to one or more nucleotide sequences of the present invention.
  • the nucleotide sequence may be selected from among those as set forth in the sequence listing, or a fragment thereof.
  • the nucleotide sequence can include a segment coding for all or part of an RNA present within a targeted organism.
  • the RNA transcript may comprise inverted repeats of all or a part of a targeted RNA.
  • the DNA molecule comprising the expression vector may also contain a functional intron sequence positioned either upstream of the coding sequence or even within the coding sequence, and may also contain a five prime (5′) untranslated leader sequence (i.e., a UTR or 5′-UTR) positioned between the promoter and the point of translation initiation.
  • a functional intron sequence positioned either upstream of the coding sequence or even within the coding sequence, and may also contain a five prime (5′) untranslated leader sequence (i.e., a UTR or 5′-UTR) positioned between the promoter and the point of translation initiation.
  • a plant transformation vector may contain sequences from one or more genes, thus allowing production of more than one dsRNA for inhibiting expression of a gene or genes in cells of a target organism.
  • segments of DNA whose sequence corresponds to that present in different genes can be combined into a single composite DNA segment for expression in a transgenic plant.
  • a plasmid of the present invention already containing at least one DNA segment can be modified by the sequential insertion of additional DNA segments between the enhancer and promoter and terminator sequences.
  • the genes to be inhibited can be obtained from the same target species in order to enhance the effectiveness of the control agent.
  • the genes can be derived from different pathogen or pest organisms in order to broaden the range of pathogens against which the agent(s) is/are effective.
  • a polycistronic DNA element can be fabricated as illustrated and disclosed in Application Publication No. US 2004-0029283.
  • Promoters that function in different plant species are also well known in the art. Promoters useful for expression of polypeptides in plants include those that are inducible, viral, synthetic, or constitutive as described in Odell et al. (1985), and/or promoters that are temporally regulated, spatially regulated, and spatio-temporally regulated. Preferred promoters include the enhanced CaMV35S promoters, and the FMV35S promoter. A fragment of the CaMV35S promoter exhibiting root-specificity may also be preferred. A number of tissue-specific promoters have been identified and are known in the art (e.g. U.S. Pat. Nos. 5,110,732; 5,837,848; Hirel et al. 1992; Stahl et al. 2004; Busk et al., 1997).
  • a recombinant DNA vector or construct of the present invention typically comprises a selectable marker that confers a selectable phenotype on plant cells.
  • Selectable markers may also be used to select for plants or plant cells that contain the exogenous nucleic acids encoding polypeptides or proteins of the present invention.
  • the marker may encode biocide resistance, antibiotic resistance (e.g., kanamycin, G418 bleomycin, hygromycin, etc.), or herbicide resistance (e.g., glyphosate, etc.).
  • selectable markers include, but are not limited to, a neo gene which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc., a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene which encodes glyphosate resistance; a nitrilase gene which confers resistance to bromoxynil; a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulfonylurea resistance; and a methotrexate resistant DHFR gene. Examples of such selectable markers are illustrated in U.S. Pat. Nos. 5,550,318; 5,633,435; 5,780,708 and 6,118,047.
  • a recombinant vector or construct of the present invention may also include a screenable marker.
  • Screenable markers may be used to monitor expression.
  • Exemplary screenable markers include a ⁇ -glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known (Jefferson, 1987; Jefferson et al., 1987); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., 1988); a ⁇ -lactamase gene (Sutcliffe et al., 1978), a gene which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al., 1986) a xylE gene (Zukowsky et al., 1983) which encodes a catechol di
  • Preferred plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens (e.g. U.S. Pat. Nos. 4,536,475, 4,693,977, 4,886,937, 5,501,967 and EP 0 122 791).
  • Agrobacterium rhizogenes plasmids are also useful and known in the art.
  • Other preferred plant transformation vectors include those disclosed, e.g., by Herrera-Estrella (1983); Bevan (1983), Klee (1985) and EPO 0 120 516.
  • Suitable methods for transformation of host cells for use with the current invention are believed to include virtually any method by which DNA can be introduced into a cell (see, for example, Miki et al., 1993), such as by transformation of protoplasts (U.S. Pat. No. 5,508,184; Omirulleh et al., 1993), by desiccation/inhibition-mediated DNA uptake (Potrykus et al., 1985), by electroporation (U.S. Pat. No. 5,384,253), by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. No. 5,302,523; and U.S. Pat. No.
  • Agrobacterium for example, Horsch et al., 1985.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria which genetically transform plant cells.
  • the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes carry genes responsible for genetic transformation of the plant.
  • Descriptions of Agrobacterium vector systems and methods for Agrobacterium -mediated gene transfer are provided by numerous references, including Gruber et al., 1993; Miki et al., 1993, Moloney et al., 1989, and U.S. Pat. Nos.
  • Plant transformation vectors can be prepared, for instance, by inserting the dsRNA producing nucleic acids disclosed herein into plant transformation vectors and introducing these into plants.
  • One known vector system has been derived by modifying the natural gene transfer system of Agrobacterium tumefaciens .
  • the natural system comprises large Ti (tumor-inducing) plasmids containing a large segment, known as the T-DNA, which is transferred to transformed plant cells.
  • Another segment of the Ti plasmid, the vir region is responsible for T-DNA transfer.
  • the T-DNA region is bordered by terminal repeats.
  • the tumor-inducing genes have been deleted and the functions of the vir region are utilized to transfer foreign DNA bordered by the T-DNA border sequences.
  • the T-region may also contain a selectable marker for efficient recovery of transgenic cells and plants, and a multiple cloning site for inserting sequences for transfer, such as a dsRNA encoding nucleic acid.
  • Transgenic plants may be regenerated from a transformed plant cell by methods well known in the field of plant cell culture.
  • a transgenic plant formed using Agrobacterium transformation methods typically contains a single simple recombinant DNA sequence inserted into one chromosome and is referred to as a transgenic event. Such transgenic plants can be referred to as being heterozygous for the inserted exogenous sequence.
  • a transgenic plant homozygous with respect to a transgene can be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single exogenous gene sequence to itself, for example an F0 plant, to produce F1 seed.
  • One fourth of the F1 seed produced will be homozygous with respect to the transgene.
  • Germinating F1 seed results in plants that can be tested for heterozygosity, typically using a SNP assay or a thermal amplification assay that allows for the distinction between heterozygotes and homozygotes (i.e., a zygosity assay). Crossing a heterozygous plant with itself or another heterozygous plant results in only heterozygous progeny.
  • the present invention provides, as an example, a transformed host plant for a pathogenic target organism, transformed plant cells and transformed plants and their progeny.
  • the transformed plant cells and transformed plants may be engineered to express one or more of the dsRNA sequences including siRNA, under the control of a heterologous promoter to provide a pest or pathogen-protective effect. These sequences may be used for gene suppression in a pest or pathogen, thereby reducing the level or incidence of disease caused by the pathogen on a protected transformed host organism.
  • gene suppression are intended to refer to any of the well-known methods for reducing the levels of protein produced as a result of gene transcription to mRNA and subsequent translation of the mRNA.
  • Gene suppression is also intended to mean the reduction of protein expression from a gene or a coding sequence including posttranscriptional gene suppression and transcriptional suppression.
  • Posttranscriptional gene suppression is mediated by the homology between of all or a part of a mRNA transcribed from a gene or coding sequence targeted for suppression and the corresponding double stranded RNA used for suppression, and refers to the substantial and measurable reduction of the amount of available mRNA available in the cell for binding by ribosomes.
  • the transcribed RNA can be in the sense orientation to effect what is called co-suppression, in the anti-sense orientation to effect what is called anti-sense suppression, or in both orientations producing a dsRNA to effect RNA interference (RNAi).
  • RNAi RNA interference
  • Transcriptional suppression is mediated by the presence in the cell of a dsRNA gene suppression agent exhibiting substantial sequence identity to a target DNA sequence or the complement thereof.
  • Gene suppression can be effective against target genes in plant pests or pathogens that may take up or contact plant material containing gene suppression agents, specifically designed to inhibit or suppress the expression of one or more homologous or complementary sequences in the cells of the target organism.
  • Post-transcriptional gene suppression by anti-sense or sense oriented RNA to regulate gene expression in plant cells is disclosed in U.S. Pat. Nos. 5,107,065, 5,759,829, 5,283,184, and 5,231,020.
  • the use of dsRNA to suppress genes in plants is disclosed in WO 99/53050, WO 99/49029, U.S. Patent Application Publication No. 2003/0175965, and 2003/0061626, U.S. patent application Ser. No. 10/465,800, and U.S. Pat. Nos. 6,506,559, and 6,326,193.
  • a beneficial method of gene suppression employs both sense-oriented and anti-sense-oriented, transcribed RNA which is stabilized, e.g., as a hairpin and stem and loop structure.
  • a preferred DNA construct for effecting gene suppression in a target organism is one in which a first segment encodes an RNA exhibiting an anti-sense orientation exhibiting substantial identity to a segment of a gene targeted for suppression, which is linked to a second “spacer” segment, and to a third segment encoding an RNA exhibiting substantial complementarity to the first segment.
  • Such a construct forms a stem and loop structure by hybridization of the first segment with the third segment, and a loop structure from the second segment nucleotide sequences linking the first and third segments (see WO94/01550, WO98/05770, US 2002/0048814, and US 2003/0018993).
  • a nucleotide sequence for which in vitro expression results in transcription of a stabilized RNA sequence that is substantially homologous to an RNA molecule that comprises an RNA sequence encoded by a nucleotide sequence within the genome of the target organism.
  • a down-regulation of the nucleotide sequence corresponding to the target gene in the cells of a target organism is effected.
  • Inhibition of a target gene using the stabilized dsRNA technology of the present invention is sequence-specific in that nucleotide sequences corresponding to the duplex region of the RNA are targeted for genetic inhibition. RNA containing a nucleotide sequences identical to a portion of the target gene is preferred for inhibition. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence may also be found to be effective for inhibition. In performance of the present invention, it is preferred that the inhibitory dsRNA and the portion of the target gene share at least from about 80% sequence identity, or from about 90% sequence identity, or from about 95% sequence identity, or from about 99% sequence identity, or even about 100% sequence identity.
  • the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript.
  • a less than full length sequence exhibiting a greater homology compensates for a longer less homologous sequence.
  • the length of the identical nucleotide sequences may be at least about 20, 50, 100, 200, 300, 400, 500 or at least about 1000 bases. Normally, a sequence of greater than about 20 nucleotides is to be used.
  • the introduced nucleic acid molecule may not need to possess absolute homology, and may not need to be full length, relative to either the primary transcription product or fully processed mRNA of the target gene.
  • Inhibition of target gene expression may be quantified by measuring either the endogenous target RNA or the protein produced by translation of the target RNA and the consequences of inhibition can be confirmed by examination of the outward properties of the cell or organism. Techniques for quantifying RNA and proteins are well known to one of ordinary skill in the art.
  • gene expression is inhibited by at least 10%, preferably by at least 33%, more preferably by at least 50%, and yet more preferably by at least 80%.
  • gene expression is inhibited by at least 80%, more preferably by at least 90%, more preferably by at least 95%, or by at least 99% within cells in the target organism so that a significant inhibition takes place.
  • Significant inhibition is intended to refer to sufficient inhibition that results in a detectable phenotype (e.g., cessation of vegetative or reproductive growth, feeding, mortality, etc.) or a detectable decrease in RNA and/or protein corresponding to the target gene being inhibited.
  • inhibition occurs in substantially all cells of the target organism, in other preferred embodiments inhibition occurs in only a subset of cells expressing the gene.
  • dsRNA molecules may be synthesized either in vivo or in vitro.
  • the dsRNA may be formed by a single self-complementary RNA strand or from two complementary RNA strands.
  • Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro.
  • Inhibition may be targeted by specific transcription in an organ, tissue, or cell type; stimulation of an environmental condition (e.g., infection, stress, temperature, chemical inducers); and/or engineering transcription at a developmental stage or age.
  • the RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus.
  • RNA, dsRNA, siRNA, or miRNA of the present invention may be produced chemically or enzymatically by one skilled in the art through manual or automated reactions or in vivo in another organism.
  • RNA may also be produced by partial or total organic synthesis; any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • the RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6).
  • a cellular RNA polymerase e.g., T3, T7, SP6
  • the use and production of an expression construct are known in the art (see, for example, WO 97/32016; U.S. Pat. Nos.
  • the RNA may be purified prior to introduction into the cell.
  • RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
  • the RNA may be used with no or a minimum of purification to avoid losses due to sample processing.
  • the RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.
  • a regulatory region e.g., promoter, enhancer, silencer, and polyadenylation
  • the nucleotide sequences for use in producing RNA molecules may be operably linked to one or more promoter sequences functional in a microorganism, a fungus or a plant host cell.
  • the nucleotide sequences are placed under the control of an endogenous promoter, normally resident in the host genome.
  • the endogenous promoter is thus typically a heterologous promoter with respect to the transgene.
  • nucleotide sequence of the present invention under the control of an operably linked promoter sequence, may further be flanked by additional sequences that advantageously affect its transcription and/or the stability of a resulting transcript.
  • additional sequences are generally located upstream of the operably linked promoter and/or downstream of the 3′ end of the expression construct and may occur both upstream of the promoter and downstream of the 3′ end of the expression construct, although such an upstream sequence only is also contemplated.
  • the term “gene suppression agent” refers to a particular RNA molecule consisting of a first RNA segment, a second RNA segment, and a third RNA segment.
  • the first and the third RNA segments lie within the length of the RNA molecule, are substantially inverted repeats of each other, and are linked together by the second RNA segment.
  • At least one of the nucleotide sequences encoding the first and third RNA segments may comprise an intron sequence.
  • the complementarity between the first and the third RNA segments upon removal of the intron results in the ability of the two segments to hybridize in vivo and in vitro to form a double stranded molecule, i.e., a stem, linked together at one end of each of the first and third segments by the second segment which forms a loop, so that the entire structure forms into a stem and loop structure, or an even more tightly hybridizing structures may form into a stem-loop knotted structure.
  • the first and the third segments correspond invariably and not respectively to a sense and an antisense sequence with respect to the target RNA transcribed from the target gene in the target organism that is suppressed by the ingestion or uptake of the dsRNA molecule.
  • the control agent can also be a substantially purified (or isolated) nucleic acid molecule and more specifically nucleic acid molecules or nucleic acid fragment molecules thereof from a genomic DNA (gDNA) or cDNA library.
  • the fragments may comprise smaller oligonucleotides having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues.
  • the term “genome” as it applies to cells of a target organism or a host plant encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components of the cell.
  • the DNA's of the present invention introduced into plant cells can therefore be either chromosomally integrated or organelle-localized.
  • the term “genome” as it applies to bacteria encompasses both the chromosome and plasmids within a bacterial host cell.
  • the DNA's of the present invention introduced into bacterial host cells can therefore be either chromosomally integrated or plasmid-localized.
  • target organism or “target crop pest” refers to Ascomycetes, Basidiomycetes, Deuteromycetes, Oomycetes, viruses, nematodes, insects, and the like that are present in the environment and that may infect, cause disease, or infest host plant material transformed to express or coated with a double stranded gene suppression agent containing the gene suppression agent.
  • phytopathogenic microorganism refers to microorganisms that can cause plant disease, including viruses, bacteria, fungi, oomycetes, chytrids, algae, and nematodes.
  • plant pest refers to insects such as beetles, grasshoppers, weevils, aphids, mites, leafhoppers, thrips, whiteflies, rootworms, borers, grubs, and the like.
  • a “pathogen resistance” or “pest resistance” trait is a characteristic of a host plant that causes the plant host to be resistant to attack from a pest or pathogen that typically is capable of inflicting damage or loss to the plant. Such resistance can arise from a natural mutation or more typically from incorporation of recombinant DNA that confers resistance.
  • a recombinant DNA can, for example, be transcribed into a RNA molecule that forms a dsRNA molecule within the tissues or fluids of the recombinant plant. Formation of the RNA molecule may also include processing, such as intron splicing.
  • the dsRNA molecule is comprised in part of a segment of RNA that is identical to a corresponding RNA segment encoded from a DNA sequence within a pest or pathogen that prefers to cause disease on the recombinant plant. Expression of the corresponding gene within the target organism is suppressed by the dsRNA, and the suppression of expression of the gene in the target organism results in the plant being resistant to the pest or pathogen.
  • Fire et al. (U.S. Pat. No. 6,506,599) generically described inhibition of pest infestation, providing specifics only about several nucleotide sequences that were effective for inhibition of gene function in the nematode species Caenorhabditis elegans .
  • US 2003/0061626 describes the use of dsRNA for inhibiting gene function in a variety of nematode pests.
  • US 2003/0150017 describes using dsDNA sequences to transform host cells to express corresponding dsRNA sequences that are substantially identical to target sequences in specific pests, and particularly describe constructing recombinant plants expressing such dsRNA sequences for ingestion by various plant pests, facilitating down-regulation of a gene in the genome of the pest organism and improving the resistance of the plant to the pest infestation.
  • dsRNA The modulatory effect of dsRNA is applicable to a variety of genes expressed in a pest or pathogen, including, for example, endogenous genes responsible for cellular metabolism or cellular transformation, including house keeping genes, transcription factors and other genes which encode polypeptides involved in cellular metabolism.
  • the phrase “inhibition of gene expression” or “inhibiting expression of a target gene in the cell of a target organism” refers to the absence (or observable decrease) within the target organism in the level of protein and/or mRNA product from the target gene. Specificity refers to the ability to inhibit the target gene without manifest effects on other genes of the cell and without any effects on any gene within the cell that is producing the dsRNA molecule.
  • the inhibition of gene expression of the target gene in the target organism may result in novel phenotypic traits in the target organism. To create a durable transgenic trait, production of dsRNA and/or its processing into siRNA would need to occur over both the developmental lifetime time of the individual transgenic crop plant and over generational time of a target organism.
  • the present invention provides in part a delivery system for the delivery of the target organism control agents by ingestion of host cells or the contents of the cells.
  • the present invention involves generating a transgenic plant cell or a plant that contains a recombinant DNA construct transcribing the stabilized dsRNA molecules of the present invention.
  • taking up refers to the process of an agent coming in contact with, or entering, a cell of a target organism. This may occur, for instance, by diffusion, active uptake, ingestion, feeding, injection, or soaking.
  • the phrase “generating a transgenic plant cell or a plant” refers to the methods of employing the recombinant DNA technologies readily available in the art (e.g., by Sambrook, et al., 1989) to construct a plant transformation vector transcribing the stabilized dsRNA molecules of the present invention, to transform the plant cell or the plant and to generate the transgenic plant cell or the transgenic plant that contain the transcribed, stabilized dsRNA molecules.
  • the invention also provides methods comprising exposure of a target organism to one or more control agent(s) of the present invention incorporated in a spray mixer and applied to the surface of a host, such as a host plant, including as a seed treatment (e.g. U.S. Pat. No. 6,551,962).
  • Such control agent(s) may thus provide for exposure of a target organism by means of a dsRNA of the invention that targets suppression of one or more essential or pathogenicity related gene(s) in the target organism in combination with one or more of the following: a Bt toxin as set forth in the website (lifesci.sussex.ac.uk/home/Neil_Crickmore/Bt/index.html), a biocontrol agent, an insecticide, and a seed treatment. Methods for formulating and applying such seed treatments are well known in the art.
  • Such applications may include an insecticide known in the art. Examples are set forth in U.S. Pat. No. 6,551,962, including a carbaryl insecticide, fenvalerate, esfenvalerate, malathion, a carbofuran insecticide, chloropyrifos, fonophos, phorate, terbufos, permethrin, a neonicotinoid, and tefluthrin among others.
  • a combination of lethality may be provided to a target organism, yielding a means for resistance management to prevent development of resistance by a target organism to a particular pesticidal composition.
  • Biocontrol agents are known in the art, and may include, for instance, naturally-occurring or recombinant bacteria or fungi from the genera Rhizobium, Bacillus, Pseudomonas, Serratia, Clavibacter, Trichoderma, Glomus, Gliocladium and mycorrhizal fungi, among others.
  • a method for such resistance management is also provided by the invention.
  • Combinations of control agent(s) that may be employed with the invention include one or more polynucleotides that comprise or express a dsRNA of the present invention and at least one other agent toxic to an insect such as a coleopteran. Such combinations may be used to provide a “synergistic” effect. When it is said that some effects are “synergistic”, it is meant to include the synergistic effects of the combination on the pesticidal activity (or efficacy) of the combination of the dsRNA and the pesticide.
  • ingestion of the control agent(s) by a pest or pathogen organism delivers the control agents to the cells of the organism.
  • the RNA molecules themselves are encapsulated in a synthetic matrix such as a polymer and applied to the surface of a host such as a plant. Ingestion of the host cells by a target organism permits delivery of the control agents to the organism and results in down-regulation of a target gene in the organism.
  • compositions of the present invention can be incorporated within the seeds of a plant species either as a product of expression from a recombinant gene incorporated into a genome of the plant cells, or incorporated into a coating or seed treatment that is applied to the seed before planting.
  • the plant cell containing a recombinant gene is considered herein to be a transgenic event.
  • the present invention provides in part a delivery system for the delivery of disease control agents to target organisms.
  • the stabilized dsRNA or siRNA molecules of the present invention may be directly introduced into the cells of a target organism, or introduced into an extracellular space (e.g. the plant apoplast).
  • Methods for introduction may include direct mixing of RNA with media for the organism, as well as engineered approaches in which a species that is a host is engineered to express the dsRNA or siRNA.
  • the dsRNA or siRNA molecules may be incorporated into, or overlaid on the top of, growth media.
  • the RNA may be sprayed onto a plant surface.
  • the dsRNA or siRNA may be expressed by microorganisms and the microorganisms may be applied onto a plant surface or introduced into a root or stem by a physical means such as an injection.
  • a plant may be genetically engineered to express the dsRNA or siRNA in an amount sufficient to affect target gene expression in the target organism known to infect or infest a plant host.
  • dsRNA's produced by chemical or enzymatic synthesis may be formulated in a manner consistent with common agricultural practices and used as spray-on products for controlling plant disease.
  • the formulations may include the appropriate stickers and wetters required for efficient foliar coverage as well as UV protectants to protect dsRNAs from UV damage.
  • Such additives are commonly used in the bioinsecticide industry and are well known to those skilled in the art.
  • Such applications could be combined with other spray-on insecticide applications, biologically based or not, to enhance plant protection from infection or insect feeding damage.
  • the RNA molecules may also be combined with another control agent, for instance an insecticidal agent such as a Cry protein, or insecticidal fragment thereof.
  • the present invention also relates to recombinant DNA constructs for expression in a microorganism.
  • Exogenous nucleic acids from which an RNA of interest is transcribed can be introduced into a microbial host cell, such as a bacterial cell or a fungal cell, using methods known in the art.
  • the nucleotide sequences of the present invention may be introduced into a wide variety of prokaryotic and eukaryotic microorganism hosts to produce the stabilized dsRNA or siRNA molecules.
  • organism includes prokaryotic and eukaryotic species such as bacteria, and fungi. Fungi include yeasts and filamentous fungi, among others.
  • Illustrative prokaryotes both Gram-negative and Gram-positive, include Enterobacteriaceae, such as Escherichia, Erwinia, Shigella, Salmonella , and Proteus ; Bacillaceae; Rhizobiaceae, such as Rhizobium ; Spirillaceae, such as photobacterium; Zymomonas, Serratia, Aeromonas, Vibrio, Desulrovibrio, Spirillum ; Lactobacillaceae; Pseudomonadaceae, such as Pseudomonas and Acetobacter ; Azotobacteraceae, Actinomycetales , and Nitrobacteraceae.
  • Enterobacteriaceae such as Escherichia, Erwinia, Shigella, Salmonella , and Proteus
  • Bacillaceae Rhizobiaceae, such as Rhizobium
  • Spirillaceae such as photobacterium
  • Zymomonas Ser
  • fungi such as Phycomycetes and Ascomycetes which includes filamentous fungi such as Sclerotinia, Erysiphe , and the like, and yeast, such as Saccharomyces and Schizosaccharomyces ; Basidiomycetes, such as Rhodotorula, Aureobasidium, Sporobolomyces , and the like; and Oomycetes, such as Phytophthora.
  • Phycomycetes and Ascomycetes which includes filamentous fungi such as Sclerotinia, Erysiphe , and the like, and yeast, such as Saccharomyces and Schizosaccharomyces ; Basidiomycetes, such as Rhodotorula, Aureobasidium, Sporobolomyces , and the like; and Oomycetes, such as Phytophthora.
  • the present invention provides a transgenic plant including, without limitation, alfalfa, corn, canola, rice, soybean, tobacco, turfgrass, and wheat, among others.
  • the present invention provides seeds and plants having one or more transgenic event(s). Combinations of events are referred to as “stacked” transgenic events. These stacked transgenic events can be events that are directed at the same target organism, or they can be directed at different target pathogens or pests.
  • a seed having the ability to express a nucleic acid provided herein also has the ability to express at least one other agent, including, but not limited to, an RNA molecule the sequence of which is derived from the sequence of an RNA expressed in a target pathogen and that forms a double stranded RNA structure upon expressing in the seed or cells of a plant grown from the seed, wherein the ingestion of one or more cells of the plant by the target pathogen results in the suppression of expression of the RNA in the cells of the target pathogen.
  • at least one other agent including, but not limited to, an RNA molecule the sequence of which is derived from the sequence of an RNA expressed in a target pathogen and that forms a double stranded RNA structure upon expressing in the seed or cells of a plant grown from the seed, wherein the ingestion of one or more cells of the plant by the target pathogen results in the suppression of expression of the RNA in the cells of the target pathogen.
  • a seed having the ability to express a dsRNA the sequence of which is derived from a target organism also has a transgenic event that provides herbicide tolerance.
  • a herbicide tolerance gene provides resistance to glyphosate, N-(phosphonomethyl)glycine, including the isopropylamine salt form of such herbicide.
  • Benefits provided by the present invention may include, but are not limited to: the ease of introducing dsRNA into the target organism's cells, the low concentration of dsRNA which can be used, the stability of dsRNA, and the effectiveness of the inhibition.
  • the ability to use a low concentration of a stabilized dsRNA avoids several disadvantages of anti-sense interference.
  • the present invention is not limited to in vitro use or to specific sequence compositions, to a particular set of target genes, a particular portion of the target gene's nucleotide sequence, or a particular transgene or to a particular delivery method, as opposed to the some of the available techniques known in the art, such as antisense and co-suppression.
  • genetic manipulation becomes possible in organisms that are not classical genetic models.
  • the target gene should preferably exhibit a low degree of sequence identity with corresponding genes in a plant or a vertebrate animal.
  • the degree of the sequence identity is less than approximately 80%. More preferably the degree of the sequence identity is less than approximately 70%. Most preferably the degree of the sequence identity is less than approximately 60%.
  • transgenic plants can be prepared by crossing a first plant having a recombinant DNA construct with a second plant lacking the construct.
  • recombinant DNA for gene suppression can be introduced into first plant line that is amenable to transformation to produce a transgenic plant that can be crossed with a second plant line to introgress the recombinant DNA for gene suppression into the second plant line.
  • the present invention can be, in practice, combined with other disease control traits in a plant to achieve desired traits for enhanced control of plant disease.
  • Combining disease control traits that employ distinct modes-of-action can provide protected transgenic plants with superior consistency and durability over plants harboring a single control trait because of the reduced probability that resistance will develop in the field.
  • the invention also relates to commodity products containing one or more of the sequences of the present invention, and produced from a recombinant plant or seed containing one or more of the nucleotide sequences of the present invention are specifically contemplated as embodiments of the present invention.
  • a commodity product containing one or more of the sequences of the present invention is intended to include, but not be limited to, meals, oils, crushed or whole grains or seeds of a plant, or any food product comprising any meal, oil, or crushed or whole grain of a recombinant plant or seed containing one or more of the sequences of the present invention.
  • the detection of one or more of the sequences of the present invention in one or more commodity or commodity products contemplated herein is defacto evidence that the commodity or commodity product is composed of a transgenic plant designed to express one or more of the nucleotides sequences of the present invention for the purpose of controlling plant disease using dsRNA mediated gene suppression methods.
  • the present invention provides methods for obtaining a nucleic acid comprising a nucleotide sequence for producing a dsRNA including siRNA.
  • a method comprises: (a) probing a cDNA or gDNA library with a hybridization probe comprising all or a portion of a nucleotide sequence or a homolog thereof from a targeted organism; (b) identifying a DNA clone that hybridizes with the hybridization probe; (c) isolating the DNA clone identified in step (b); and (d) sequencing the cDNA or gDNA fragment that comprises the clone isolated in step (c) wherein the sequenced nucleic acid molecule transcribes all or a substantial portion of the RNA nucleotide acid sequence or a homolog thereof.
  • a method of the present invention for obtaining a nucleic acid fragment comprising a nucleotide sequence for producing a substantial portion of a dsRNA or siRNA comprises: (a) synthesizing first and a second oligonucleotide primers corresponding to a portion of one of the nucleotide sequences from a targeted organism; and (b) amplifying a cDNA or gDNA insert present in a cloning vector using the first and second oligonucleotide primers of step (a) wherein the amplified nucleic acid molecule transcribes a substantial portion of the a substantial portion of a dsRNA or siRNA of the present invention.
  • a target gene may be derived from a pest or pathogen species that causes damage to the crop plants and subsequent yield losses. It is contemplated that several criteria may be employed in the selection of preferred target genes.
  • the gene may be one whose protein product has a rapid turnover rate, so that dsRNA inhibition will result in a rapid decrease in protein levels. In certain embodiments it is advantageous to select a gene for which a small drop in expression level results in deleterious effects for the target organism. If it is desired to target a broad range of pest or pathogen species, a gene is selected that is highly conserved across these species.
  • a gene is selected that contains regions that are poorly conserved between individual species, or between the target and other organisms. In certain embodiments it may be desirable to select a gene that has no known homologs in other organisms.
  • the term “derived from” refers to a specified nucleotide sequence that may be obtained from a particular specified source or species, albeit not necessarily directly from that specified source or species.
  • target genes for use in the present invention may include, for example, those that play important roles in the viability, growth, feeding, development, reproduction and infectivity of the target organism. These target genes may be one of the house keeping genes, transcription factors and the like. Additionally, the nucleotide sequences for use in the present invention may also be derived from plant, viral, bacterial or insect genes whose functions have been established from literature and the nucleotide sequences of which share substantial similarity with the target genes in the genome of a target organism. According to one aspect of the present invention, the target sequences may essentially be derived from the targeted organism.
  • the dsRNA or siRNA molecules, or polynucleotides that encode them may be obtained by polymerase chain (PCRTM) amplification of a target gene sequences derived from a gDNA or cDNA library or portions thereof.
  • the DNA library may be prepared using methods known to the ordinary skilled in the art and DNA/RNA may be extracted. Genomic DNA or cDNA libraries generated from a target organism may be used for PCRTM amplification for production of the dsRNA or siRNA.
  • the target genes may be then be PCRTM amplified and sequenced using the methods readily available in the art.
  • One skilled in the art may be able to modify the PCRTM conditions to ensure optimal PCRTM product formation.
  • the confirmed PCRTM product may be used as a template for in vitro transcription to generate sense and antisense RNA with the included minimal promoters.
  • nucleic acid sequences identified and isolated from any pest or pathogen species may be used in the present invention for control of plant disease.
  • the nucleic acid may be derived from a Western Corn Rootworm ( Diabrotica virgifera virgifera ).
  • the isolated nucleic acids may be useful, for example, in identifying a target gene and one or more sequences within the gene that encode effective siRNA molecules. They may also be useful in constructing a recombinant vector according to the method of the present invention that produces stabilized dsRNAs or siRNAs of the present invention for protecting plants from the rootworm. Therefore, in one embodiment, the present invention comprises isolated and purified nucleotide sequences that may be used as plant pest or disease control agents.
  • nucleic acids that may be used in the present invention may also comprise isolated and substantially purified Unigenes and EST nucleic acid molecules or nucleic acid fragment molecules thereof.
  • EST nucleic acid molecules may encode significant portions of, or indeed most of, the polypeptides.
  • the fragments may comprise smaller oligonucleotides having from about 15 to about 250 nucleotide residues, and more preferably, about 15 to about 30 nucleotide residues.
  • the nucleic acid molecules for use in the present invention may be from cDNA libraries from a target organism of interest.
  • Nucleic acid molecules and fragments thereof from a pest or pathogen species may be employed to obtain other nucleic acid molecules from other species for use in the present invention to produce desired dsRNA and siRNA molecules.
  • Such nucleic acid molecules include the nucleic acid molecules that encode the complete coding sequence of a protein and promoters and flanking sequences of such molecules.
  • nucleic acid molecules include nucleic acid molecules that encode for gene family members. Such molecules can be readily obtained by using the above-described nucleic acid molecules or fragments thereof to screen cDNA or genomic DNA libraries. Methods for forming such libraries are well known in the art.
  • coding sequence refers to a nucleotide sequence that is translated into a polypeptide, usually via mRNA, when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a translation start codon at the 5′-terminus and a translation stop codon at the 3′-terminus.
  • a coding sequence can include, but is not limited to, genomic DNA, cDNA, EST and recombinant nucleotide sequences.
  • recombinant DNA or “recombinant nucleotide sequence” refers to DNA that contains a genetically engineered modification through manipulation via mutagenesis, restriction enzymes, and the like.
  • PCRTM may be used to amplify an appropriately selected segment of the gene in the pathogen for use in the present invention.
  • PCRTM primers may be designed based on the sequence as found in another organism from which the gene has been cloned.
  • the primers are designed to amplify a DNA segment of sufficient length for use in the present invention.
  • DNA either genomic DNA or cDNA
  • the PCRTM primers are used to amplify the DNA segment. Amplification conditions are selected so that amplification will occur even if the primers do not exactly match the target sequence.
  • the gene (or a portion thereof) may be cloned from a gDNA or cDNA library prepared from the pathogen species, using the known gene as a probe.
  • Bio-assay of dsRNA constructs encoding portions of the western corn rootworm ( Diabrotica virgifera virgifera ; WCR) V-ATPase subunit A gene demonstrated efficacy in gene suppression. Additional work has determined that a 50 bp segment of the WCR V-ATPase subunit A gene (SEQ ID NO:1), when presented as a dsRNA, is sufficient to elicit mortality when tandemly duplicated 5 times, but is ineffective as a 50 bp monomer (Table 1). The 50 bp segment embedded in a neutral carrier for a total dsRNA of 100 bp was also effective, indicating that there are size restrictions on efficient uptake of dsRNA into insects susceptible to RNAi.
  • the 100 bp segment of the Dv49 target was amplified, using cycling conditions described in Table 4, to produce an antisense template using oligonucleotides Dv49-1 (SEQ ID NO:5) and Dv49-2 (SEQ ID NO:6); and a separate sense template using oligonucleotides Dv49-3 (SEQ ID NO:7) and Dv49-4 (SEQ ID NO:8).
  • Dv49-1 SEQ ID NO:5
  • Dv49-2 SEQ ID NO:6
  • a separate sense template using oligonucleotides Dv49-3 (SEQ ID NO:7) and Dv49-4 (SEQ ID NO:8).
  • T7 RNA polymerase promoters are shown in lower case (SEQ ID NO:5-8) Target Name Sequence DNA Orientation Comments
  • Dv49-1 AAGAAGAAACGATTGGAAAAG Dv49 sense For synthesis of AC 100 mer template for dsRNA production of anti-sense strand when used with Dv49-2.
  • Dv49-2 taatacgactcactataggCA
  • Dv49 antisense For synthesis of GTATTTGTGCTAGCTCCTTC 100 mer template for dsRNA production of anti-sense strand when used with Dv49-1.
  • Dv49 antisense For synthesis of C 100 mer template for dsRNA production of sense strand when used with Dv49-4.
  • Dv49-4 taatacgactcactataggAA
  • Dv49 sense For synthesis of GAAGAAACGATTGGAAAAGAC 100 mer template for dsRNA production of sense strand when
  • Step Temp (° C.) Time 1 94 2 minutes 2 94 30 seconds 3 52 30 seconds 4 72 30 seconds 5 go to step 2, 33 times 6 72 2 minutes 7 hold at 10 forever
  • reaction conditions 1 ⁇ Sigma REDtaq buffer, 200 ⁇ M each dNTP, 0.4 ⁇ M each oligonucleotide primer, approximately 200 pg of pMON78428 template, and 2 U of REDtaq polymerase (Sigma, Cat. #D4309) in a 50 ⁇ l reaction volume.
  • Five ⁇ l of each PCR reaction was used to produce a single stranded transcript with the MEGAshortscriptTM kit (Ambion, Cat. #1354) according to manufacturer's instructions.
  • the sense and antisense reactions were mixed, heated to 75° C. for 5 min and allowed to cool to room temperature.
  • the 100 bp fragment was used as a template for dsRNA synthesis, and the dsRNA was subjected to insect bioassay.
  • mortality of WCR was 100% with the 100 bp dsRNA (Table 5).
  • No mortality was observed when feeding dsRNA derived from the vector backbone (180 bp) by itself.
  • 26 bp segments scanning through the 100mer base sequence in a 5 bp register were cloned as follows: 26 bp segments derived from the 100 bp Dv49 test sequence were produced synthetically (Integrated DNA Technologies) as sense and antisense oligonucleotides.
  • Pairs of oligonucleotides used in cloning (SEQ ID NO:9-38) were annealed and a 3′ A-overhang was added by setting up the following reaction: 1 ⁇ Sigma REDtaq buffer, 200 ⁇ M each dNTP, 0.4 ⁇ M each oligonucleotide primer and 2 U of REDtaq polymerase and incubation at 75° C. for 2 minutes followed by 20 minutes at 50° C. Two ⁇ l of each PCR reaction was ligated into the PCR2.1-TOPO vector in a TOPO-TA cloning reaction (Invitrogen, Cat. #45-0641) according to manufacturer's instructions and transformed into E. coli TOP10 cells.
  • TOPO-TA cloning reaction Invitrogen, Cat. #45-0641
  • RNA synthesis was prepared using oligonucleotides pCR2.1-5 and pCR2.1-6 (SEQ ID NO:39-40), the cycling conditions in Table 4, and the same reaction conditions used to amplify the Dv49 100mer template.
  • a blank vector no corn rootworm sequence
  • pMON98397 was also amplified to serve as a control for the vector sequences.
  • Fresh PCR product was amplified from verified clones for dsRNA synthesis. Amplifications were visualized on 1-3% agarose gels stained with ethidium bromide to ensure proper size and quality. An aliquot of 5 ⁇ l was used in dsRNA synthesis directly from the PCR tube.
  • RNAi Kit (Ambion, Cat #1626) with the following alterations: transcription was carried out at 37° C. overnight in a convection oven. Final dsRNA products were quantified by absorption at 260 nm, and visualized on a 1-3% agarose gel to ensure intactness of the product. All samples for insect bioassay were diluted to a final concentration (e.g. 1 ppm) in 10 mM Tris pH 6.8. Twenty ⁇ l of each sample were applied to 200 ⁇ l of insect diet and allowed to absorb into the diet before addition of a WCR neonate. Stunting and mortality of larvae was scored at day 12.
  • dsRNA corresponding to the resulting fragments Scan 0 to Scan 14 ( FIG. 1 ) was amplified in a larger neutral carrier (vector backbone sequence), using pCR2.1-5 and pCR2.1-6 oligonucleotides, and dsRNA was synthesized for a total dsRNA length of 206 bp. Since cloning into the pCR2.1-TOPO vector recapitulated the original Dv49 context for some of the cloned 26mer segments, the sequence interrogated for efficacy was actually 27-28 bp in size in some instances.
  • the dsRNAs synthesized from the 26mers When fed at 1 ppm, the dsRNAs synthesized from the 26mers resulted in a range of mortality from no significant difference from the untreated control to approximately 95% mortality with the scan 7 segment ( FIG. 7 ; Table 5). When fed at 0.2 ppm, the dsRNAs synthesized from the 26mers resulted in a range of mortality from no significant difference from the untreated control to 97% mortality with the scan 3 segment ( FIG. 8 ; Table 5).
  • Scan segment 14 of the 26mer analysis Twenty one bp segments derived from Scan segment 14 of the 26mer analysis were synthesized as above except the ends were modified so that when annealed a Hind III restriction site compatible overhang was created at the 5′ end and an Spe I restriction site compatible overhang at the 3′ end of each oligonucleotides (SEQ ID NO:41-54). These were ligated into a Hind III/Spe I cut pCR2.1-TOPO backbone. Attempts were made to clone all seven possible 21mer sequences that could be produced from Scan 14. Cloning of Scan 15 failed and the cloned Scan 17 sequence was found to contain a point mutation that is likely responsible for its poor activity. Scan segments 16-21 were amplified to produce templates and dsRNA was prepared as for the 26mer scan. The final size of each dsRNA was 184 bp. Samples were diluted, applied at 0.2 ppm and scored as above.
  • FIG. 1 a 100 bp segment of WCR Dv49 used in the 26 bp scan was compared to a number of related sequences from other species (Table 7; SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:55-72). Sequences for the Dv49 orthologs among Diabrotica sp. were found to be highly conserved. From the alignment it is possible to see variation at some locations (e.g. the highly efficacious scan 3 segment), that differs significantly between Diabrotica and all other species examined—even other beetle species such as Tribolium castaneum .
  • Small efficacious units such as the scan 3 segment could be vulnerable to nucleotide variation. Natural mutation or pre-existing allelic variation within or between species could reduce the ability to initiate gene suppression targeted against an organism. This potential impact was examined using the sequence corresponding to Dv49, scan segment 3, from Diabrotica barberi . This species has a single nucleotide polymorphism when compared to all other Diabrotica sp. that were sequenced ( FIG. 1 ). Assay of the Scan 3 segment from Diabrotica barberi (Db49 scan 3 segment) revealed it was much less effective than the native Diabrotica virgifera scan 3 segment in initiating WCR larval mortality (Table 8).
  • Optimal sequences used for pest RNAi should buffer this potential gene diversity by ensuring that sufficient numbers of highly effective siRNAs can be created from the transgenic construct to target the full range of intended species.
  • TABLE 8 Impact of Dv49 dsRNA single nucleotide polymorphism on a cloned 26 bp segment (Scan 3) from two Diabrotica species when assayed in western corn rootworm bio-assay.
  • Desirable transgenic RNAi crops would specifically target certain pest species but minimize potential for interactions with unintended species. For instance, ideally one would have a single, simple dsRNA construct that targets a critical gene(s) from Diabrotica virgifera virgifera (western corn rootworm, WCR), Diabrotica virgifera zeae (Mexican corn rootworm, MCR), and Diabrotica barberi (northern corn rootworm, NCR).
  • Diabrotica virgifera virgifera western corn rootworm, WCR
  • Diabrotica virgifera zeae Mexican corn rootworm
  • NCR Diabrotica barberi
  • Diabrotica undecimpunctata howardii corn rootworm, SCR
  • Diabrotica undecimpunctata undecimpunctata western spotted cucumber beetle
  • Diabrotica speciosa European spotted cucumber beetle
  • Diabrotica viridula could also be included among the target species. Selection of gene sequences for inclusion in dsRNA constructs would be optimal with alignments of gene targets from multiple species and populations and also pertinent non-target organisms. cDNA segments coding for Dv49 orthologs from a variety of organisms and populations were sequenced for comparison.
  • RT-PCR using RNA derived from adults and/or larvae served a source material for obtaining novel sequence.
  • specific or degenerate primer sets were used to amplify sequences based on information from internal WCR EST libraries and publicly available insect sequences. At least two independent PCR products were examined to develop a consensus for each sequence.
  • alleles were observable in the amplification products from multiple individuals. Alleles were also discernable from sequences present in the EST collections themselves when multiple overlapping ESTs were present for a given sequence. In these instances degenerate nucleotide designations were specified. These degeneracies do not denote ambiguous sequencing reads. Sequencing of target segments from multiple regional representatives of selected species may be performed in order to understand allelic variation on a regional scale.
  • sequence identity corresponded to previously observed phylogenetic relationships (e.g. Clark et al., 2001).
  • WCR and MCR are closely related and NCR, also in the virgifera species group, bears many common stretches of identity.
  • SCR and BCB are clearly more distinctive as members of the fucata species group.
  • Each Diabrotica spp. exhibits unique small nucleotide polymorphisms (SNPs). If any of the SNPs fall into critical regions that give rise to efficacious siRNAs, they may affect efficacy of a given sequence used in a dsRNA construct.
  • target sequences from related Diabrotica spp. such as BCB and SCR, may also help to determine likely polymorphic regions amongst relatively closely related species of diabroticine beetles when sequence information is not available.
  • Target sequences from additional target genes were also obtained. These target sequences included putative orthologs of the following genes: mov34 (Flybase CG3416; SEQ ID NO:107-109); Na/K-exchanging ATPase (Flybase CG9261; SEQ ID NO:110-114); ribosomal protein L19 (Flybase CG2746; SEQ ID NO:115-118); RNA polymerase (Flybase CG3180; SEQ ID NO:119-121); ribosomal protein S9 (Flybase CG3395; SEQ ID NO:122-125); v-ATPase subunit 2 (Flybase CG3762; SEQ ID NO:126-135), in addition to carrier protein Flybase CG8055 orthologs (SEQ ID NO:2; SEQ ID NO:3; SEQ ID NO:61-64).
  • a 100 bp segment of Diabrotica virgifera V-ATPase subunit A was chosen for detailed efficacy mapping in a manner similar to that used to scan across a 100 bp segment of Dv49.
  • This 100 bp segment was taken from a larger region that showed high efficacy at a discriminating dose ( FIG. 6 ).
  • This 100 bp region had multiple potential siRNAs with high predicted Reynolds scores and low secondary structure.
  • Oligonucleotide pairs (vATP100-1 and vATP100-2; vATP100-3 and vATP100-4 (SEQ ID NO:73-76) were synthesized to allow amplification of template for sense or anti-sense strand transcripts. The transcript strands can then be annealed to create a 100 bp dsRNA.
  • bp segments were selected for fine mapping efficacy, tiling across the base sequence in 5 bp register. Oligonucleotides for each were synthesized as sense and anti-sense pairs (vATP — 26-1 to vATP — 26-30; SEQ ID NO:77-106). After annealing, the duplexes are cloned via sticky-end ligation using nucleotides added for annealing with Spe I/Eco RI cut vector (pCR2.1-TOPO). Once clones are sequence verified, templates for dsRNA synthesis are prepared using oligonucleotides pCR2.1-5 and pCR2.1-6, as for Dv49 scan in Example 2.
  • nucleotide sequences that encode potent siRNA derived from Diabrotica virgifera V-ATPase subunit A may be included with sequences derived, for instance, from Diabrotica virgifera Dv49, in an RNAi expression construct to yield a dsRNA-encoding construct which exhibits multiple modes of action in suppressing growth and development of the target organism.
  • T7 RNA polymerase promoters have been incorporated (lower case) (SEQ ID NOs:73-76).
  • Target Name Sequence DNA Orientation Comments vATP100-1 taatacgactcactatagGACTTCA V-ATPAse sense for amplifying ACCCAATCAAC subunit A sense template to make 100 mer segment of WCR V-ATPase vATP100-2 GAATCATTTTGTGTTTGACAAGG V-ATPAse anti-sense for amplifying subunit A sense template to make 100 mer segment of WCR V-ATPase vATP100-3 GACTTCAACCCAATCAACATC V-ATPAse sense for amplifying subunit A anti-sense template to make 100 mer segment of WCR V-ATPase vATP100-4 taatacgactcactatagGAATCAT V-ATPAse anti-sense for amplifying TTTGTTTGAC subunit A anti-sense template to make 100 mer segment of W
  • siRNA-sized regions that most specifically target the pests of interest while minimizing SNP variation that could reduce effectiveness.
  • plant produced siRNAs originating from known transgenes are cloned, and efficacy is confirmed by bioassay, any differences in effective siRNA production between crop and pest species given the same base target sequence may become apparent.
  • Those sequences that effectively suppress gene expression in target insects, and have reduced capacity to initiate transgene suppression in planta may be selected for further analysis. Additionally, identification of effective and ineffective siRNAs allows further optimization of constructs.
  • UTRs or other expression elements are chosen for inclusion in a transgene construct coding for dsRNA, choosing those elements with minimal potential to produce effective siRNAs may be desired. This could be extended to coding regions when codon optimization is performed, resulting in reduction in the potential for effective siRNA production or matches to endogenous miRNAs, unless such siRNA were desired.
  • one or more corresponding dsRNA segments is stably expressed via a transgene in planta.
  • the goal is production of a primary transcript that ultimately yields effective siRNAs when consumed by the targeted pest, but has a reduced propensity to undergo post-transcriptional gene silencing (PTGS) because the transgene has the sequences that give rise to siRNA disrupted through intron placement (e.g. illustrated in FIGS. 4-5 ).
  • PTGS post-transcriptional gene silencing
  • Additional sequence such as 5′ and 3′ untranslated regions (UTRs) and “filler” (to make exons of at least minimal required size for plant processing) can be produced by combining sequences (e.g. direct tandem sense sequence) that do not elicit effective siRNAs.
  • sequences e.g. direct tandem sense sequence
  • the efficacy can be determined by practical evaluation of these in bio-assay or through the use of predictive tools (e.g. Reynolds scores) that consider biophysical parameters that a common to effective or ineffective siRNAs.
  • Such construct designs could result from identification of small regions exhibiting high efficacy against pest species. Regions that give rise to potent siRNAs may be disrupted by introns such as small segments of the natural gene target order or synthetic arrangements such as overlapping siRNAs as illustrated in FIG. 5 . Additional exon sequences and UTRs could be created from sequence that does not give rise to productive siRNAs (i.e. those sequences shown in bio-assay or via predictive algorithms to be poorly utilized by the RNA-induced silencing complex (RISC) (Hammond et al., 2000).
  • RISC RNA-induced silencing complex
  • the engineered transgene is distinct from the processed transcript as a result of disrupting the continuity of potential siRNAs, such an arrangement could result in a reduced potential to silence the transgene, including methylation and eventual transcriptional silencing via the RNA-induced initiation of transcriptional gene silencing (RITS) complex (Verdel et al. 2004).
  • the presence of introns in the primary transcript may also slow overall processing and potentially increase the longevity of the larger primary dsRNA transcript, thus enhancing uptake potential.
  • Other designs for stabilizing “large” dsRNAs e.g. inclusion of a nucleolar targeting sequence
  • Additional target sequences are added by extending the primary transcriptional unit with one or more additional introns and exons designed as above so that a longer dsRNA transcript could be created. Overlapping potent siRNAs and placing the intron within the overlap could expand the number of potential target sequences while minimizing the number of required introns within the construct.
US11/674,005 2006-02-13 2007-02-12 SELECTING AND STABILIZING dsRNA CONSTRUCTS Abandoned US20070259785A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
US11/674,005 US20070259785A1 (en) 2006-02-13 2007-02-12 SELECTING AND STABILIZING dsRNA CONSTRUCTS
US13/305,688 US10941398B2 (en) 2006-02-13 2011-11-28 Selecting and stabilizing dsRNA constructs
US13/960,646 US20140080755A1 (en) 2006-02-13 2013-08-06 SELECTING AND STABILIZING dsRNA CONSTRUCTS

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US77273606P 2006-02-13 2006-02-13
US11/674,005 US20070259785A1 (en) 2006-02-13 2007-02-12 SELECTING AND STABILIZING dsRNA CONSTRUCTS

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/305,688 Division US10941398B2 (en) 2006-02-13 2011-11-28 Selecting and stabilizing dsRNA constructs

Publications (1)

Publication Number Publication Date
US20070259785A1 true US20070259785A1 (en) 2007-11-08

Family

ID=38372198

Family Applications (3)

Application Number Title Priority Date Filing Date
US11/674,005 Abandoned US20070259785A1 (en) 2006-02-13 2007-02-12 SELECTING AND STABILIZING dsRNA CONSTRUCTS
US13/305,688 Active 2028-09-21 US10941398B2 (en) 2006-02-13 2011-11-28 Selecting and stabilizing dsRNA constructs
US13/960,646 Abandoned US20140080755A1 (en) 2006-02-13 2013-08-06 SELECTING AND STABILIZING dsRNA CONSTRUCTS

Family Applications After (2)

Application Number Title Priority Date Filing Date
US13/305,688 Active 2028-09-21 US10941398B2 (en) 2006-02-13 2011-11-28 Selecting and stabilizing dsRNA constructs
US13/960,646 Abandoned US20140080755A1 (en) 2006-02-13 2013-08-06 SELECTING AND STABILIZING dsRNA CONSTRUCTS

Country Status (7)

Country Link
US (3) US20070259785A1 (zh)
EP (2) EP1984511A2 (zh)
CN (2) CN101384721A (zh)
AR (1) AR059570A1 (zh)
AU (1) AU2007214547B2 (zh)
CA (2) CA2836368C (zh)
WO (1) WO2007095496A2 (zh)

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080317881A1 (en) * 2007-05-09 2008-12-25 Devgen N.V. Method for sustainable transgene transcription
US20100050294A1 (en) * 2006-12-04 2010-02-25 Xiaoya Chen Method for modifying insect resistance of plants by utilizing rnai technique
WO2010123904A1 (en) 2009-04-20 2010-10-28 Monsanto Technology Llc Multiple virus resistance in plants
US20110171135A1 (en) * 2008-07-22 2011-07-14 Essam Enan Pest-control compositions and methods having high target and low non-target activity
US20140296503A1 (en) * 2013-01-01 2014-10-02 A.B. Seeds Ltd. ISOLATED dsRNA MOLECULES AND METHODS OF USING SAME FOR SILENCING TARGET MOLECULES OF INTEREST
US9121022B2 (en) 2010-03-08 2015-09-01 Monsanto Technology Llc Method for controlling herbicide-resistant plants
US20160024518A1 (en) * 2013-03-13 2016-01-28 Brian McGonigle Production of small interfering rnas in planta
US9365863B2 (en) 2013-05-08 2016-06-14 Monsanto Technology Llc Compositions and methods for deploying a transgenic refuge seed blend
US9416363B2 (en) 2011-09-13 2016-08-16 Monsanto Technology Llc Methods and compositions for weed control
US9422558B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US9422557B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US9441240B2 (en) 2012-05-08 2016-09-13 Monsanto Technology Llc Corn event MON 87411
US9540642B2 (en) 2013-11-04 2017-01-10 The United States Of America, As Represented By The Secretary Of Agriculture Compositions and methods for controlling arthropod parasite and pest infestations
US9777288B2 (en) 2013-07-19 2017-10-03 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
US10077451B2 (en) 2012-10-18 2018-09-18 Monsanto Technology Llc Methods and compositions for plant pest control
US10240161B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10334848B2 (en) 2014-01-15 2019-07-02 Monsanto Technology Llc Methods and compositions for weed control using EPSPS polynucleotides
US10378012B2 (en) 2014-07-29 2019-08-13 Monsanto Technology Llc Compositions and methods for controlling insect pests
US10435701B2 (en) 2013-03-14 2019-10-08 Monsanto Technology Llc Methods and compositions for plant pest control
US10557138B2 (en) 2013-12-10 2020-02-11 Beeologics, Inc. Compositions and methods for virus control in Varroa mite and bees
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
US10612019B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10609930B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10655136B2 (en) 2015-06-03 2020-05-19 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
US10801028B2 (en) 2009-10-14 2020-10-13 Beeologics Inc. Compositions for controlling Varroa mites in bees
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10808249B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
US10883103B2 (en) 2015-06-02 2021-01-05 Monsanto Technology Llc Compositions and methods for delivery of a polynucleotide into a plant
US10888579B2 (en) 2007-11-07 2021-01-12 Beeologics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US10968449B2 (en) 2015-01-22 2021-04-06 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US10988764B2 (en) 2014-06-23 2021-04-27 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
CN113234724A (zh) * 2021-05-18 2021-08-10 华中农业大学 一种防治白蚁的dsRNA及其应用
US11091770B2 (en) 2014-04-01 2021-08-17 Monsanto Technology Llc Compositions and methods for controlling insect pests
CN114058562A (zh) * 2021-11-19 2022-02-18 杭州师范大学 一种表达dsRNA的重组沙雷菌及其应用
US11807857B2 (en) 2014-06-25 2023-11-07 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060021087A1 (en) 2004-04-09 2006-01-26 Baum James A Compositions and methods for control of insect infestations in plants
PL2431473T3 (pl) * 2005-09-16 2017-05-31 Monsanto Technology Llc Sposoby genetycznej kontroli inwazji owadów u roślin i kompozycje do tego przeznaczone
CA2622671C (en) * 2005-09-16 2020-12-22 Devgen Nv Methods for controlling pests using rnai
CN101421406B (zh) 2006-02-13 2016-08-31 孟山都技术有限公司 用于产生改变的种子油组成的核酸构建体和方法
CN102115726B (zh) * 2010-12-16 2012-07-18 中国农业科学院农产品加工研究所 一株寡养单胞菌及其应用
UY33851A (es) * 2010-12-30 2012-07-31 Dow Agrosciences Llc Moléculas de ácido nucleico que confieren resistencia a las plagas de coleópteros
US9693555B2 (en) 2011-03-18 2017-07-04 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Insect-combating preparation and method based on RNAi technology
CA2890235A1 (en) * 2012-06-22 2013-12-27 Syngenta Participations Ag Biological control of coleopteran pests
MX366975B (es) 2014-03-12 2019-08-01 Univ Sydney Produccion de arn en plantas superiores.
UY36442A (es) * 2014-12-16 2016-07-29 Dow Agrosciences Llc Supresión de arni parental de gen kruppel para el control de las plagas de hemípteros
CN107249297A (zh) * 2015-02-18 2017-10-13 先锋国际良种公司 增强共混庇护的效果
EP3429619A1 (en) * 2016-03-14 2019-01-23 Redbiotec AG Means and methods for treating hsv
CN109844134B (zh) * 2016-08-16 2023-05-05 塔驰莱特Ip有限公司 闭合线性dna的生产
KR20190122647A (ko) * 2016-12-06 2019-10-30 페블 랩스 유에스에이 인코포레이티드 식물 병원체의 생물방제를 위한 시스템 및 방법
CN107557365A (zh) * 2017-08-31 2018-01-09 长江师范学院 一种双元靶标dsRNA及合成方法和应用
CN114561411A (zh) * 2022-03-14 2022-05-31 贵州大学 Dicer1基因及其dsRNA在害虫防治中的应用

Citations (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5107065A (en) * 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5759829A (en) * 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US6326193B1 (en) * 1999-11-05 2001-12-04 Cambria Biosciences, Llc Insect control agent
US20020048814A1 (en) * 2000-08-15 2002-04-25 Dna Plant Technology Corporation Methods of gene silencing using poly-dT sequences
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030018993A1 (en) * 2000-08-15 2003-01-23 Neal Gutterson Methods of gene silencing using inverted repeat sequences
US20030061626A1 (en) * 1998-07-03 2003-03-27 Geert Plaetinck Characterisation of gene function using double stranded RNA inhibition
US20030150017A1 (en) * 2001-11-07 2003-08-07 Mesa Jose Ramon Botella Method for facilitating pathogen resistance
US20040029283A1 (en) * 2002-06-21 2004-02-12 Fillatti Joanne J. Intron double stranded RNA constructs and uses thereof
US7507811B2 (en) * 2002-11-14 2009-03-24 Dharmacon, Inc. siRNA targeting KRAS

Family Cites Families (53)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4693977A (en) 1982-08-23 1987-09-15 Queen's University At Kingston Enzyme immobilization for producing cephalosporin antibiotics
US4536475A (en) 1982-10-05 1985-08-20 Phytogen Plant vector
US4876197A (en) 1983-02-22 1989-10-24 Chiron Corporation Eukaryotic regulatable transcription
NL8300698A (nl) 1983-02-24 1984-09-17 Univ Leiden Werkwijze voor het inbouwen van vreemd dna in het genoom van tweezaadlobbige planten; agrobacterium tumefaciens bacterien en werkwijze voor het produceren daarvan; planten en plantecellen met gewijzigde genetische eigenschappen; werkwijze voor het bereiden van chemische en/of farmaceutische produkten.
NZ207765A (en) 1983-04-15 1987-03-06 Lubrizol Genetics Inc Plant expression of transferred dna(t-dna)from plasmids associated with agrobacterium sp
JPS59205983A (ja) 1983-04-28 1984-11-21 ジエネツクス・コ−ポレイシヨン 異種遺伝子を原核微生物で発現させる方法
US4880734A (en) 1984-05-11 1989-11-14 Chiron Corporation Eukaryotic regulatable transcription
US4886937A (en) 1985-05-20 1989-12-12 North Carolina State University Method for transforming pine
CA1293460C (en) 1985-10-07 1991-12-24 Brian Lee Sauer Site-specific recombination of dna in yeast
US5015580A (en) 1987-07-29 1991-05-14 Agracetus Particle-mediated transformation of soybean plants and lines
ATE87032T1 (de) 1986-12-05 1993-04-15 Ciba Geigy Ag Verbessertes verfahren zur transformation von pflanzlichen protoplasten.
DK175243B1 (da) 1987-03-23 2004-07-19 Zymogenetics Inc Ekspressionsvektor, der er i stand til at styre ekspression af heterologe gener eller cDNA i gær, gærværtscelle samt fremgangsmåde til öget produktion af proteiner i gærværtsceller
EP0315447A3 (en) 1987-11-06 1990-07-18 Teijin Limited Method of immunological measurement of human protein s and reagent and kit therefor
US5614395A (en) 1988-03-08 1997-03-25 Ciba-Geigy Corporation Chemically regulatable and anti-pathogenic DNA sequences and uses thereof
US5789214A (en) 1988-03-08 1998-08-04 Novartis Finance Corporation Method of inducing gene transcription in a plant
US5416011A (en) 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5110732A (en) 1989-03-14 1992-05-05 The Rockefeller University Selective gene expression in plants
US5302523A (en) 1989-06-21 1994-04-12 Zeneca Limited Transformation of plant cells
US5501967A (en) 1989-07-26 1996-03-26 Mogen International, N.V./Rijksuniversiteit Te Leiden Process for the site-directed integration of DNA into the genome of plants
US5550318A (en) 1990-04-17 1996-08-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
US7705215B1 (en) 1990-04-17 2010-04-27 Dekalb Genetics Corporation Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof
WO1991010725A1 (en) 1990-01-22 1991-07-25 Dekalb Plant Genetics Fertile transgenic corn plants
US5484956A (en) 1990-01-22 1996-01-16 Dekalb Genetics Corporation Fertile transgenic Zea mays plant comprising heterologous DNA encoding Bacillus thuringiensis endotoxin
US5837848A (en) 1990-03-16 1998-11-17 Zeneca Limited Root-specific promoter
US5639949A (en) 1990-08-20 1997-06-17 Ciba-Geigy Corporation Genes for the synthesis of antipathogenic substances
US6403865B1 (en) 1990-08-24 2002-06-11 Syngenta Investment Corp. Method of producing transgenic maize using direct transformation of commercially important genotypes
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
JP3234598B2 (ja) 1990-11-23 2001-12-04 プラント・ジエネテイツク・システムズ・エヌ・ベー 単子葉植物の形質転換方法
US5384253A (en) 1990-12-28 1995-01-24 Dekalb Genetics Corporation Genetic transformation of maize cells by electroporation of cells pretreated with pectin degrading enzymes
US5593874A (en) 1992-03-19 1997-01-14 Monsanto Company Enhanced expression in plants
NZ255028A (en) 1992-07-02 1997-03-24 Hybridon Inc Antisense oligonucleotides resistant to nucleolytic degradation
US5591616A (en) 1992-07-07 1997-01-07 Japan Tobacco, Inc. Method for transforming monocotyledons
HUT70467A (en) 1992-07-27 1995-10-30 Pioneer Hi Bred Int An improved method of agrobactenium-mediated transformation of cultvred soyhean cells
US5527695A (en) 1993-01-29 1996-06-18 Purdue Research Foundation Controlled modification of eukaryotic genomes
US6118047A (en) 1993-08-25 2000-09-12 Dekalb Genetic Corporation Anthranilate synthase gene and method of use thereof for conferring tryptophan overproduction
US5693512A (en) 1996-03-01 1997-12-02 The Ohio State Research Foundation Method for transforming plant tissue by sonication
DE19631919C2 (de) 1996-08-07 1998-07-16 Deutsches Krebsforsch Anti-Sinn-RNA mit Sekundärstruktur
US5981840A (en) 1997-01-24 1999-11-09 Pioneer Hi-Bred International, Inc. Methods for agrobacterium-mediated transformation
GB9710475D0 (en) 1997-05-21 1997-07-16 Zeneca Ltd Gene silencing
US20090077685A1 (en) 1998-06-16 2009-03-19 Buehler Robert E Nucleic acid molecules and other molecules associated with plants
KR101085210B1 (ko) 1998-03-20 2011-11-21 커먼웰쓰 사이언티픽 앤드 인더스트리얼 리서치 오가니제이션 유전자 발현 조절방법
JP5015373B2 (ja) 1998-04-08 2012-08-29 コモンウェルス サイエンティフィック アンド インダストリアル リサーチ オーガニゼイション 改良表現型を得るための方法及び手段
US6506599B1 (en) 1999-10-15 2003-01-14 Tai-Wook Yoon Method for culturing langerhans islets and islet autotransplantation islet regeneration
AU2848800A (en) 1999-01-14 2000-08-01 Monsanto Technology Llc Soybean transformation method
AU3512300A (en) 1999-03-05 2000-09-21 Epigenesis Pharmaceuticals, Inc. Method for validating/invalidating target(s) and pathways
WO2001019859A2 (en) * 1999-09-15 2001-03-22 Monsanto Technology Llc LEPIDOPTERAN-ACTIVE BACILLUS THURINGIENSIS δ-ENDOTOXIN COMPOSITIONS AND METHODS OF USE
WO2001037654A2 (en) * 1999-11-24 2001-05-31 Dna Plant Technology Corporation METHOD OF EXPRESSING dsRNA IN PLANTS TO INHIBIT INSECT PESTS
US6551962B1 (en) 2000-10-06 2003-04-22 Monsanto Technology Llc Method for deploying a transgenic refuge
EP1620541A2 (en) 2003-05-07 2006-02-01 Monsanto Technology LLC A method of increasing yield in a plant and genes useful therefor
WO2005049841A1 (en) * 2003-11-17 2005-06-02 Commonwealth Scientific And Industrial Research Organisation Insect resistance using inhibition of gene expression
US20060021087A1 (en) * 2004-04-09 2006-01-26 Baum James A Compositions and methods for control of insect infestations in plants
WO2006020697A2 (en) 2004-08-10 2006-02-23 Cardinal Cg Company Lcd mirror system and method
US8088976B2 (en) 2005-02-24 2012-01-03 Monsanto Technology Llc Methods for genetic control of plant pest infestation and compositions thereof

Patent Citations (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5107065A (en) * 1986-03-28 1992-04-21 Calgene, Inc. Anti-sense regulation of gene expression in plant cells
US5759829A (en) * 1986-03-28 1998-06-02 Calgene, Inc. Antisense regulation of gene expression in plant cells
US5231020A (en) * 1989-03-30 1993-07-27 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US5283184A (en) * 1989-03-30 1994-02-01 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
US6506559B1 (en) * 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
US20030061626A1 (en) * 1998-07-03 2003-03-27 Geert Plaetinck Characterisation of gene function using double stranded RNA inhibition
US6326193B1 (en) * 1999-11-05 2001-12-04 Cambria Biosciences, Llc Insect control agent
US20020048814A1 (en) * 2000-08-15 2002-04-25 Dna Plant Technology Corporation Methods of gene silencing using poly-dT sequences
US20030018993A1 (en) * 2000-08-15 2003-01-23 Neal Gutterson Methods of gene silencing using inverted repeat sequences
US20030150017A1 (en) * 2001-11-07 2003-08-07 Mesa Jose Ramon Botella Method for facilitating pathogen resistance
US20040029283A1 (en) * 2002-06-21 2004-02-12 Fillatti Joanne J. Intron double stranded RNA constructs and uses thereof
US7507811B2 (en) * 2002-11-14 2009-03-24 Dharmacon, Inc. siRNA targeting KRAS

Cited By (63)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100050294A1 (en) * 2006-12-04 2010-02-25 Xiaoya Chen Method for modifying insect resistance of plants by utilizing rnai technique
US8895805B2 (en) * 2006-12-04 2014-11-25 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Method for modifying insect resistance of plants by utilizing RNAi technique
US20080317881A1 (en) * 2007-05-09 2008-12-25 Devgen N.V. Method for sustainable transgene transcription
US20130160160A1 (en) * 2007-05-09 2013-06-20 Devgen Nv Method for sustainable transgene transcription
US10888579B2 (en) 2007-11-07 2021-01-12 Beeologics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US20110171135A1 (en) * 2008-07-22 2011-07-14 Essam Enan Pest-control compositions and methods having high target and low non-target activity
WO2010123904A1 (en) 2009-04-20 2010-10-28 Monsanto Technology Llc Multiple virus resistance in plants
EP3260545A1 (en) 2009-04-20 2017-12-27 Monsanto Technology LLC Multiple virus resistance in plants
US10801028B2 (en) 2009-10-14 2020-10-13 Beeologics Inc. Compositions for controlling Varroa mites in bees
US9121022B2 (en) 2010-03-08 2015-09-01 Monsanto Technology Llc Method for controlling herbicide-resistant plants
US9988634B2 (en) 2010-03-08 2018-06-05 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
US11812738B2 (en) 2010-03-08 2023-11-14 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
US9416363B2 (en) 2011-09-13 2016-08-16 Monsanto Technology Llc Methods and compositions for weed control
US10808249B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10435702B2 (en) 2011-09-13 2019-10-08 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US9422557B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US9422558B2 (en) 2011-09-13 2016-08-23 Monsanto Technology Llc Methods and compositions for weed control
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
US10428338B2 (en) 2011-09-14 2019-10-01 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
US10316330B2 (en) 2012-05-08 2019-06-11 Monsanto Technology Llc Corn event MON 87411
US11788099B2 (en) 2012-05-08 2023-10-17 Monsanto Technology Llc Corn event MON 87411
US11859198B2 (en) 2012-05-08 2024-01-02 Monsanto Technology Llc Corn event MON 87411
US11414672B2 (en) 2012-05-08 2022-08-16 Monsanto Technology Llc Corn event MON 87411
US9441240B2 (en) 2012-05-08 2016-09-13 Monsanto Technology Llc Corn event MON 87411
US10240162B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10934555B2 (en) 2012-05-24 2021-03-02 Monsanto Technology Llc Compositions and methods for silencing gene expression
US10240161B2 (en) 2012-05-24 2019-03-26 A.B. Seeds Ltd. Compositions and methods for silencing gene expression
US10077451B2 (en) 2012-10-18 2018-09-18 Monsanto Technology Llc Methods and compositions for plant pest control
US10844398B2 (en) 2012-10-18 2020-11-24 Monsanto Technology Llc Methods and compositions for plant pest control
US20140296503A1 (en) * 2013-01-01 2014-10-02 A.B. Seeds Ltd. ISOLATED dsRNA MOLECULES AND METHODS OF USING SAME FOR SILENCING TARGET MOLECULES OF INTEREST
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
US10041068B2 (en) * 2013-01-01 2018-08-07 A. B. Seeds Ltd. Isolated dsRNA molecules and methods of using same for silencing target molecules of interest
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
US10609930B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US10612019B2 (en) 2013-03-13 2020-04-07 Monsanto Technology Llc Methods and compositions for weed control
US20160024518A1 (en) * 2013-03-13 2016-01-28 Brian McGonigle Production of small interfering rnas in planta
US10435701B2 (en) 2013-03-14 2019-10-08 Monsanto Technology Llc Methods and compositions for plant pest control
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
US9365863B2 (en) 2013-05-08 2016-06-14 Monsanto Technology Llc Compositions and methods for deploying a transgenic refuge seed blend
US9777288B2 (en) 2013-07-19 2017-10-03 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
US11377667B2 (en) 2013-07-19 2022-07-05 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US10597676B2 (en) 2013-07-19 2020-03-24 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9856495B2 (en) 2013-07-19 2018-01-02 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US9540642B2 (en) 2013-11-04 2017-01-10 The United States Of America, As Represented By The Secretary Of Agriculture Compositions and methods for controlling arthropod parasite and pest infestations
US10927374B2 (en) 2013-11-04 2021-02-23 Monsanto Technology Llc Compositions and methods for controlling arthropod parasite and pest infestations
US10100306B2 (en) 2013-11-04 2018-10-16 Monsanto Technology Llc Compositions and methods for controlling arthropod parasite and pest infestations
US10557138B2 (en) 2013-12-10 2020-02-11 Beeologics, Inc. Compositions and methods for virus control in Varroa mite and bees
US10334848B2 (en) 2014-01-15 2019-07-02 Monsanto Technology Llc Methods and compositions for weed control using EPSPS polynucleotides
US11091770B2 (en) 2014-04-01 2021-08-17 Monsanto Technology Llc Compositions and methods for controlling insect pests
US10988764B2 (en) 2014-06-23 2021-04-27 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
US11807857B2 (en) 2014-06-25 2023-11-07 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
US10378012B2 (en) 2014-07-29 2019-08-13 Monsanto Technology Llc Compositions and methods for controlling insect pests
US11124792B2 (en) 2014-07-29 2021-09-21 Monsanto Technology Llc Compositions and methods for controlling insect pests
US10968449B2 (en) 2015-01-22 2021-04-06 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
US10883103B2 (en) 2015-06-02 2021-01-05 Monsanto Technology Llc Compositions and methods for delivery of a polynucleotide into a plant
US10655136B2 (en) 2015-06-03 2020-05-19 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
CN113234724A (zh) * 2021-05-18 2021-08-10 华中农业大学 一种防治白蚁的dsRNA及其应用
CN114058562A (zh) * 2021-11-19 2022-02-18 杭州师范大学 一种表达dsRNA的重组沙雷菌及其应用

Also Published As

Publication number Publication date
CA2836368A1 (en) 2007-08-23
CA2637363C (en) 2016-04-05
CN105385679A (zh) 2016-03-09
AR059570A1 (es) 2008-04-16
CA2836368C (en) 2020-04-07
EP2426206A3 (en) 2012-06-13
WO2007095496A3 (en) 2008-07-17
WO2007095496A8 (en) 2008-10-02
EP1984511A2 (en) 2008-10-29
EP2426206A2 (en) 2012-03-07
CN101384721A (zh) 2009-03-11
EP2426206B1 (en) 2018-06-13
CN105385679B (zh) 2020-05-26
WO2007095496A2 (en) 2007-08-23
US20120192317A1 (en) 2012-07-26
US10941398B2 (en) 2021-03-09
AU2007214547B2 (en) 2012-09-20
EP2426206B8 (en) 2018-10-31
AU2007214547A1 (en) 2007-08-23
US20140080755A1 (en) 2014-03-20
CA2637363A1 (en) 2007-08-23

Similar Documents

Publication Publication Date Title
US10941398B2 (en) Selecting and stabilizing dsRNA constructs
Mao et al. Plant-mediated RNAi of a gap gene-enhanced tobacco tolerance against the Myzus persicae
US20110061128A1 (en) IN PLANTA RNAi CONTROL OF FUNGI
US9994844B2 (en) Parental RNAi suppression of chromatin remodeling genes to control coleopteran pests
US20180305694A1 (en) Parental rnai suppression of hunchback gene to control hemipteran pests
US20180305713A1 (en) Parental rnai suppression of chromatin remodeling genes to control coleopteran pests
CN103596575B (zh) 瘿蜂防治剂
US20160208253A1 (en) Parental rnai suppression of kruppel gene to control coleopteran pests
JP2018524004A (ja) 害虫を制御するためのｐｒｐ８核酸分子
US20180334683A1 (en) Structure specific recognition protein 1 (ssrp1) nucleic acid molecules to control insect pests
Adeyinka et al. Host-induced silencing of the CpCHI gene resulted in developmental abnormalities and mortality in maize stem borer (Chilo partellus)
US20160222407A1 (en) Parental rnai suppression of hunchback gene to control coleopteran pests
JP2018531579A (ja) 害虫を制御するためのｓｎａｐ２５核酸分子
US20180282756A1 (en) Pre-mrna processing factor 19 (prp19) nucleic acid molecules to control insect pests
JP2018520655A (ja) 害虫を制御するためのｓｐｔ６核酸分子

Legal Events

Date Code Title Description
AS Assignment

Owner name: MONSANTO TECHNOLOGY LLC, MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:HECK, GREGORY R.;MUNYIKWA, TICHAFA R.I.;GOLEY, JEAN C.;AND OTHERS;REEL/FRAME:019607/0615;SIGNING DATES FROM 20070706 TO 20070712

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION