US20060282911A1 - Methods and compositions to enhance plant breeding - Google Patents

Methods and compositions to enhance plant breeding Download PDF

Info

Publication number
US20060282911A1
US20060282911A1 US11/441,915 US44191506A US2006282911A1 US 20060282911 A1 US20060282911 A1 US 20060282911A1 US 44191506 A US44191506 A US 44191506A US 2006282911 A1 US2006282911 A1 US 2006282911A1
Authority
US
United States
Prior art keywords
plant
haplotype
transgene
crop
breeding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/441,915
Inventor
Jason Bull
David Butruille
Sam Eathington
Marlin Edwards
Anju Gupta
Richard Johnson
Wayne Kennard
Jennifer Rinehart
Kunsheng Wu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Monsanto Technology LLC
Original Assignee
Monsanto Technology LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=37137417&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=US20060282911(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Monsanto Technology LLC filed Critical Monsanto Technology LLC
Priority to US11/441,915 priority Critical patent/US20060282911A1/en
Assigned to MONSANTO TECHNOLOGY, L.L.C. reassignment MONSANTO TECHNOLOGY, L.L.C. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: EDWARDS, MARLIN, GUPTA, ANJU, KENNARD, WAYNE, WU, KUNSHENG, JOHNSON, RICHARD, BULL, JASON, EATHINGTON, SAM, RINEHART, JENNIFER, BUTRUILLE, DAVID
Publication of US20060282911A1 publication Critical patent/US20060282911A1/en
Priority to US12/640,069 priority patent/US8754289B2/en
Priority to US14/283,630 priority patent/US9605272B2/en
Priority to US15/433,124 priority patent/US10273498B2/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275Glyphosate
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/54Leguminosae or Fabaceae, e.g. soybean, alfalfa or peanut
    • A01H6/542Glycine max [soybean]
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/18Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds
    • A01N57/20Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds containing acyclic or cycloaliphatic radicals
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • C12N15/821Non-antibiotic resistance markers, e.g. morphogenetic, metabolic markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01NPRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N2300/00Combinations or mixtures of active ingredients covered by classes A01N27/00 - A01N65/48 with other active or formulation relevant ingredients, e.g. specific carrier materials or surfactants, covered by classes A01N25/00 - A01N65/48
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the invention relates to the field of plant breeding and plant biotechnology, in particular to a transgene inserted into genetic linkage with a genomic region of a plant, and to the use of the transgene/genomic region to enhance the germplasm and to accumulate other favorable genomic regions in breeding populations.
  • transgenic crop plants During the development of transgenic crop plants much effort is concentrated on optimization of the insertion and expression of the transgene, and then introgressing the transgene throughout the breeding population by classical breeding methods.
  • the site of insertion of a transgene into the host genome has been a concern for at least two reasons; (i) the region where it inserted may modulate the level of expression of the transgene, and (ii) the insertion of the transgene may disrupt the normal function or expression of a gene near or where it has been inserted.
  • the selection of genomic locations that are beneficial for gene integration provides for suitable levels of stable expression of an introduced gene, or genes, and generally does not negatively affect other agronomic characteristics of the crop plant.
  • the genomic region in which the transgene has been inserted also provides agronomic phenotypes to the crop plant. These phenotypes have their own value in a breeding program and these regions should be considered when selecting among multiple transgene insertion events.
  • Transgene insertion events into genomic regions that are associated with improved performance with respect to an agronomic trait or multiple trait index result in an improved phenotype in the crop plant and progeny derived from the crop plant that contain the transgene and the associated improved phenotype.
  • Selecting for the transgenic event necessarily results in selecting a segment of the host genome that surrounds it, and the improved phenotypic effect. Further improvements involve the identification of molecular markers for the tracking and maintenance of the genomic segment with the associated transgene. This is an area that has not been adequately addressed in current plant breeding with transgene insertion events.
  • the present invention provides consideration to estimating the value of the genomic region and the transgene event. This value can then be used as a criterion for selecting among multiple transgenic events.
  • linkage drag around a transgene is minimized and valuable genomic regions are selected that contain the transgene for breeding into the germplasm of a crop.
  • the present invention provides a method of breeding with transgenic plants.
  • this method comprises providing a database identifying a value of an agronomic trait for at least two distinct haplotypes of the genome for a set of germplasm.
  • the method further comprises transforming a parent plant with recombinant DNA to produce at least two transgenic events wherein the recombinant DNA is inserted into linkage with the at least two distinct haplotypes of the genome of the parent plant.
  • the database may then be referenced to estimate the value of the agronomic trait for the events linked to the distinct haplotypes, and transgenic event having a higher referenced breeding value may then be selected for breeding into a germplasm.
  • the present invention provides a method for improving plant germplasm by accumulation of one or more haplotypes in a germplasm.
  • the method comprises inserting a transgene into a genome of a first plant, and then determining a map location of the transgene in the genome.
  • the map location may be correlated to a linked haplotype, wherein the transgene and the haplotype comprise a T-type genomic region.
  • the first plant may then be crossed with a second plant.
  • the second plant may contain at least one T-type genomic region or haplotype that is different from the first plant T-type genomic region.
  • At least one progeny plant may then be selected, the progeny plant having detectable expression of the transgene or its phenotype and comprising in its genome the T-type genomic region of the first plant and at least one T-type genomic or haplotype of the second plant.
  • the progeny plant may be used in activities related to germplasm improvement, which can be selected from use of the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING, or any combination of these.
  • the present invention includes a method for breeding of a crop plant, in particular a soybean or corn plant with enhanced agronomic and transgenic traits comprising a preferred T-type genomic region.
  • a transgene of the T-type genomic region is further defined as conferring a preferred property like herbicide tolerance, disease resistance, insect or pest resistance, altered fatty acid, protein or carbohydrate metabolism, increased grain yield, increased oil, increased nutritional content, increased growth rates, enhanced stress tolerance, or altered morphological characteristics, or any combination of these.
  • the present invention provides a novel method for mapping at least one genomic region of insertion of a transgene.
  • This method involves indirect mapping and does not require the establishment of a de novo population segregating for a transgene.
  • the method comprises first identifying at least a first polymorphism between the parent lines of a mapping population in the corresponding genomic region adjacent to a transgenic insertion event in a transformed plant or line, then assaying the progeny plants of the mapping population for the polymorphism. Linkage analysis may be performed to determine a map position of the polymorphism and thereby a map location of the transgenic insertion event. The map location in the mapping population may then be correlated to a haplotype of the transformed plant and its progeny.
  • corn means Zea mays or maize and includes all plant varieties that can be bred with corn, including wild maize species.
  • soybean means Glycine max and includes all plant varieties that can be bred with soybean, including wild soybean species.
  • a transgenic “event” is produced by transformation of a plant cell with heterologous DNA, i.e., a nucleic acid construct that includes a transgene of interest, regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location.
  • the term “event” refers to the original transformant and progeny of the transformant that include the heterologous DNA.
  • the term “event” also refers to progeny produced by a sexual outcross between the transformant and another variety that include the heterologous DNA.
  • the present invention overcomes the deficiencies of the current transgene breeding methods by describing a T-type genomic region, defined as a transgene and a linked haplotype genomic region, through which the genetically linked transgene and haplotype are selected and then introgressed into germplasm through breeding.
  • the selection of the T-type genomic region is based on the estimation of a T-value that the T-type genomic region provides to the germplasm of the crop plant.
  • the basis of the valuation distinguishes and selects improved T-type genomic regions for use in a breeding method, and selects and advances plants comprising the improved T-type genomic regions.
  • the genomic locations for gene integration are favorable based on providing suitable levels of stable expression of an introduced gene, or genes, and for identifying transgene associations with favorable haplotype regions that also provide beneficial agronomic characteristics to the germplasm.
  • additional value can be built into a transgenic event and its use for developing superior germplasm.
  • the inventors have realized that additional consideration should be given to the genomic region that is linked to the transgene insertion. As a transgene is diffused by breeding methods into plant germplasm a portion of the genetic region linked to the transgene is also diffused.
  • linkage drag By giving consideration to the genetic region linked to a transgene it is possible to implement biotechnological and breeding strategies to increase the overall value of the transgene and the genetic region to which it is linked to enhance germplasm improvement and minimize the risk of advancement of less favorable genetic regions, often referred to as linkage drag.
  • T-type genomic regions of new glyphosate tolerant soybean events have been identified that comprise a glyphosate tolerance transgene with suitable levels of expression in linkage with a haplotype.
  • the highest yielding T-type was identified as event 19788 (also referred to as MON89788) and provided for the replacement of the T-type genomic region of event 40-3-2 with a haplotype in the same genomic region with improved yield as determined in a side-by-side comparison. This finding will have significant impact on enhancing the germplasm of glyphosate tolerant soybean.
  • T-type genomic regions of insect tolerant soybean events are identified that comprise an insect resistance transgene with suitable levels of expression in linkage with a haplotype.
  • the event GM — 19459 was selected from a population of transgenic soybean events. These events contain a transgene inserted into the soybean genome that expresses a protein toxic to Lepidopteran insect pests of soybean.
  • the various haplotype genomic regions have been mapped to assist in the selection of an event with the most favorable T-type genomic region.
  • T-type genomic regions of insect tolerant corn events are identified that comprise an insect resistance transgene with suitable levels of expression in linkage with a haplotype.
  • the insect tolerant corn event is selected from a population of transgenic corn events. These events contain a transgene inserted into the corn genome that expresses a protein toxic to Lepidopteran insect pests of corn.
  • the various haplotype genomic regions are mapped to assist in the selection of an event with the most favorable T-type genomic region.
  • Any transgene inserted into the genome of a crop plant that can be mapped to a genomic location can then be compared to a haplotype marker developed in that location to determine if the location comprises a haplotype with an enhanced breeding value.
  • the current invention provides genetic markers and methods for the identification and breeding of T-type genomic regions in soybean.
  • the invention therefore allows for the first time the creation of soybean plants that combine the value of a transgene and an agronomically elite, or favorable haplotype.
  • Favorable haplotypes are at least identified as those that have been inherited more frequently than expected in a plant population.
  • loci comprising a T-type genomic region may be introduced into potentially any desired soybean plant.
  • Molecular markers are provided that when used in a marker assisted breeding program provide a means to identify and maintain the association of the favorable haplotype and the transgene to provide the valuable T-type genomic region.
  • the present invention provides examples of transgenes that provide herbicide and insect resistant phenotypes to the soybean plants, other transgenes that provide stress tolerance, disease tolerance, enhanced protein, oil, amino acid or other feed quality, nutrition or processing traits are also contemplated as aspects of the present invention and germplasm comprising these T-types would be crossed to provide a stacked trait product with preferred T-type genomic regions.
  • the current invention provides genetic markers and methods for the identification and breeding of T-type genomic regions in corn.
  • the invention therefore allows for the first time the creation of corn plants that combine the value of a transgene and an agronomically elite, or favorable haplotype.
  • loci comprising a T-type genomic region may be introduced into potentially any desired corn plant.
  • Molecular markers are provided that when used in a marker assisted breeding program provide a means to identify and maintain the association of the favorable haplotype and the transgene to provide the valuable T-type genomic region.
  • the present invention provides examples of transgenes that provide an insect resistant phenotype to the corn plant, other transgenes that provide stress tolerance, herbicide tolerance, enhanced protein, oil, amino acid or other feed quality, nutrition or processing traits are also contemplated as aspects of the present invention and germplasm comprising these T-type would be crossed to provide a stacked trait product with preferred T-type genomic regions.
  • a T-type genomic region is a novel genetic composition comprising at least one transgene, with suitable levels of expression, in genetic linkage with a haplotype.
  • the linkage of a transgene with a haplotype should have no observable deleterious effect on the functional integrity of the haplotype due to the local insertion of the transgene.
  • a haplotype of a T-type genomic region could be functionally enhanced as a result of the integration into genetic linkage of a transgene.
  • the T-type genomic region composition has the benefit of the transgene and the haplotype with which it is linked.
  • the T-type genomic region is the genetic composition through which a transgene is diffused into germplasm by breeding.
  • a haplotype of a T-type genomic region comprises at least two biallelic markers approximately 10 cM apart, or at least one pluriallelic locus within 5 cM of the transgene and with high polymorphic information content. Changes in a haplotype, brought about by recombination for example, may result in the modification of a haplotype so that it only comprises a portion of the original (parental) haplotype physically linked to the transgene. Any such change in a haplotype would be included in our definition of what constitutes a T-type genomic region so long as the functional integrity of the T-type genomic region is unchanged or improved.
  • the linkage of the transgene to the haplotype or functional portion thereof that provides the desirable phenotype is preferably within about 5 cM, or within about 2 cM, or within about 1 cM of the haplotype region.
  • the functional integrity of a haplotype is considered to be unchanged if its value is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm (breeding germplasm, breeding population, collection of elite inbred lines, population of random mating individuals, biparental cross), or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germ
  • the benefit or value of the plant comprising in its genome a T-type genomic region is estimated by a T-value, which depends on the value of the transgene trait and the value of the haplotype to which the transgene is linked.
  • the value of a transgene of a T-type genomic region can be estimated from the value of the trait that the transgene encodes. This value depends on the transgene trait (for example, including but not limited to: herbicide tolerance, insect resistance, disease resistance, improved nutrition, enhanced yield, improved processing trait, or stress tolerance) and could be estimated from increased crop plant output, or decrease in inputs required for crop cultivation, or any combination of these.
  • the transgene trait also has value as a selectable or scorable marker.
  • a transgene comprising a recombinant construct may further comprise a selectable marker or scorable marker.
  • the nucleic acid sequence serving as the selectable or scorable marker functions to produce a phenotype in cells which facilitates their identification relative to cells not containing the marker.
  • selectable markers include, but are not limited to, a neo or nptII gene (Potrykus et al., 1991), which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc.; a bar gene which codes for bialaphos resistance; glyphosate resistant EPSP synthase, glyphosate resistant mutant EPSP synthase (Hinchee et al., 1988) which encodes glyphosate resistance, glyphosate inactivating enzymes; a nitrilase gene which confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulphonylurea resistance (European Patent Application No. 0154204); and a methotrexate resistant DHFR gene (Thillet et al., 1988).
  • a neo or nptII gene
  • scorable markers include: a ⁇ -glucuronidase or uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known (Jefferson, 1987; Jefferson et al., 1987); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., 1988); a ⁇ -lactamase gene (Sutcliffe et al., 1978), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al., 1986); a xylE gene (Zukowsky et al., 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an ⁇ -amylase gene (Ikatu el al., 1990); a
  • selectable or scorable markers are also genes that encode a secretable marker whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers that encode a secretable antigen that can be identified by antibody interaction, or even secretable enzymes which can be detected catalytically.
  • Selectable secreted marker proteins fall into a number of classes, including small, diffusible proteins which are detectable, (e.g., by ELISA), small active enzymes which are detectable in extracellular solution (e.g., ⁇ -amylase, ⁇ -lactamase, phosphinothricin transferase), or proteins which are inserted or trapped in the cell wall (such as proteins which include a leader sequence such as that found in the expression unit of extension or tobacco PR-S).
  • small, diffusible proteins which are detectable, (e.g., by ELISA)
  • small active enzymes which are detectable in extracellular solution
  • proteins which are inserted or trapped in the cell wall such as proteins which include a leader sequence such as that found in the expression unit of extension or tobacco PR-S.
  • proteins which include a leader sequence such as that found in the expression unit of extension or tobacco PR-S.
  • a marker is preferably GUS, green fluorescent protein (GFP), neomycin phosphotransferase II (nptII), luciferase (LUX), an antibiotic resistance gene coding sequence, or an herbicide resistance gene coding sequence.
  • the selectable agent can be an antibiotic, for example including but not limited to, kanamycin, hygromycin, or a herbicide, for example including but not limited to, glyphosate, glufosinate, 2,4-D, and dicamba.
  • the T-type genomic region has a value in marker-assisted selection and marker-assisted breeding applications. Selection for a transgene and a favorable haplotype in the case where they comprise a T-type genomic region requires only one marker, whereas at least two markers would be required if the transgene and favorable haplotype are unlinked. This potential value would increase as more T-type genomic regions are accumulated or stacked together in a germplasm.
  • the T-value can be changed or modified by changing expression of the transgene, wherein a change is brought about at the level of transgene expression, or in the timing of transgene expression, or in the localization of transgene expression, or any combination of these. It is anticipated by this invention that the change in T-value brought by a change in any of the components of transgene expression could be effected through cis-acting (local) or trans-acting (can act at a distance not simply on the DNA molecule in which they occur) factors, or a combination of these.
  • the T-value can be changed or modified by changing the haplotype with which the transgene is tightly linked.
  • a preferred embodiment of the present invention is the improvement of the T-value by selecting or directing the transgene of an existing T-type genomic into tight linkage with a different recipient haplotype, wherein the different haplotype is associated with additional value and improved with respect to an agronomic trait or a multiple trait index over the existing T-type haplotype as determined in a side-by-side or head-to-head comparison.
  • a change in the haplotype could also be brought about by generating or selecting for at least one recombinant T-type haplotype that is improved with respect to an agronomic trait or a multiple trait index over the existing T-type haplotype as determined in a replicated side-by-side or head-to-head comparison.
  • Another preferred embodiment of the present invention is to build additional value into a new or novel transgene event by selecting or directing the transgene into linkage with a recipient haplotype that has a breeding value that is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or alleles conferring agronomic fitness to a crop plant or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germplasm can be taken as evidence of its high value, or any combination of these.
  • Another embodiment of the present invention is a selection of a plant or line for transformation with at least a first transgene, wherein the selection of the plant or line is based on it comprising in its genome a high proportion of recipient haplotypes that have a breeding value that is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or alleles conferring agronomic fitness to a crop plant or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germplasm can be taken as evidence of its high value, or any combination of these.
  • This invention anticipates an accumulating or stacking of T-type genomic regions into plants or lines by addition of transgenes by transformation, or by crossing parent plants or lines containing different T-type genomic regions, or any combination of these.
  • the value of the accumulated or stacked T-type genomic regions can be estimated by a composite T-value, which depends on a combination of the value of the transgene traits and the value of the haplotype(s) to which the transgenes are linked.
  • the present invention further anticipates that the composite T-value can be improved by modifying the components of expression of one or each of the stacked transgenes.
  • the present invention anticipates that additional value can be built into the composite T-value by selection of at least one recipient haplotype with a favorable breeding value to which one or any of the transgenes are linked, or by selection of plants or lines for stacking transgenes by transformation or by breeding or by any combination of these.
  • Transgenic crops for which a method of the present invention can be applied include, but are not limited to herbicide tolerant crops, for example, Roundup Ready® Cotton 1445 and 88913; Roundup Ready® corn GA21, nk603, MON802, MON809; Roundup Ready® Sugar beet GTSB77 and H7-1; Roundup Ready® Canola RT73 and GT200; oilseed rape ZSR500, Roundup Ready® Soybean 40-3-2, MON89788-containing soybean, Roundup Ready® Bentgrass ASR368, HCN10, HCN28 and HCN92 canola, MS1 and RF1 canola, OXY-235 canola, PHY14, PHY35 and PHY36 canola, RM3-3, RM3-4 and RM3-6 chicory, A2704-12, A2704-21, A5547-35, A5547-127 soybean, GU262 soybean, W62 and W98 soybean, 19-51A cotton, 31807 and 31808 cotton,
  • Herbicides for which transgenic plant tolerance has been demonstrated and the method of the present invention can be applied include but are not limited to: glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, dalapon, dicamba, 2,4-D, cyclohezanedione, protoporphyrinogen oxidase inhibitors, and isoxaflutole herbicides.
  • Polynucleotide molecules encoding proteins involved in herbicide tolerance include, but are not limited to a polynucleotide molecule encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) described in U.S. Pat. No. 5,627,061, U.S. Pat. No. 5,633,435, U.S. Pat. No. 6,040,497 and in U.S. Pat. No.
  • EPSPS 5-enolpyruvylshikimate-3-phosphate synthase
  • a promoter of a transgene of the present invention can express genes that encode for phosphinothricin acetyltransferase, glyphosate resistant EPSPS, aminoglycoside phosphotransferase, hydroxyphenyl pyruvate dehydrogenase, hygromycin phosphotransferase, neomycin phosphotransferase, dalapon dehalogenase, bromoxynil resistant nitrilase, dicamba mono-oxygenase, anthranilate synthase, glyphosate oxidoreductase, glyphosate-N-acetyl transferase, or glyphosate decarboxylase.
  • Transgenic crops for which the method of the present invention can be applied include, but are not limited to, insect resistant crops, for example, cotton events, such as MON15985, 281-24-236, 3006-210-23, MON531, MON757, MON1076, and COT102; or corn events, such as MIR604, BT176, BT11, CBH-351, DAS-06275-8, DBT418, MON80100, MON810, MON863, TC1507, MIR152V, 3210M, and 3243M.
  • insect resistant crops for example, cotton events, such as MON15985, 281-24-236, 3006-210-23, MON531, MON757, MON1076, and COT102
  • corn events such as MIR604, BT176, BT11, CBH-351, DAS-06275-8, DBT418, MON80100, MON810, MON863, TC1507, MIR152V, 3210M, and 3243M.
  • Insect resistant transgenic crops can provide tolerance to insect pest feeding damage and have been shown to be effective against certain Lepidopterans, and Coleopterans plant pests, and other transgenic crops that may also provide resistance to plant pests such as, certain members of Hemiptera, Homoptera, Heteroptera, Orthoptera, Thysanoptera, and plant parasitic nematodes.
  • Disease resistant transgenic crops for example, virus resistant papaya 55-1/63-1, and virus resistant squash CZW-3 and ZW20.
  • Male sterility transgenic crops for example, PHY14, PHY35 and PHY36 canola and corn events 676, 678, 680, MS3 and MS6. Additional transgenic crop plants may also provide resistance to fungal and bacterial organisms that cause plant disease.
  • the present invention contemplates the above listed transgenic crops and germplasm comprising the T-type genomic regions for use in breeding and stacking of T-type genomic regions, or haplotypes identified by an indirect mapping method, or any combination of these to increase T-type value or to enhance overall germplasm quality as described in the methods of the present invention.
  • Haplotypes A “haplotype” is a segment of DNA in the genome of an organism that is assumed to be identical by descent for different individuals when the knowledge of identity by state at one or more loci is the same in the different individuals, and that the regional amount of linkage disequilibrium in the vicinity of that segment on the physical or genetic map is high.
  • a haplotype can be tracked through populations and its statistical association with a given trait can be analyzed.
  • a haplotype association study allows one to define the frequency and the type of the ancestral carrier haplotype.
  • An “association study” is a genetic experiment where one tests the level of departure from randomness between the segregation of alleles at one or more marker loci and the value of individual phenotype for one or more traits. Association studies can be done on quantitative or categorical traits, accounting or not for population structure and/or stratification.
  • a haplotype analysis is important in that it increases the statistical power of an analysis involving individual biallelic markers.
  • a haplotype frequency analysis the frequency of the possible haplotypes based on various combinations of the identified biallelic markers of the invention is determined.
  • the haplotype frequency is then compared for distinct populations and mapping population.
  • a favorable haplotype can be selected based on its frequency in a set of germplasm, generally a frequency of 50 percent or more would indicate that the haplotype has value in the germplasm.
  • a haplotype that occurs at a high frequency would be favorable for targeting with a transgene or selection of a T-type wherein the haplotype has a high frequency in the germplasm would be considered favorable.
  • a haplotype occurring at any frequency in the germplasm can be correlated to a trait and the haplotype can be given a value based on a single trait or a combination of traits.
  • a favorable haplotype will provide one or more favorable traits to a germplasm. In general, any method known in the art to test whether a trait and a genotype show a statistically significant correlation may be used.
  • Methods for determining the statistical significance of a correlation between a phenotype and a genotype, in this case a haplotype may be determined by any statistical test known in the art and with any accepted threshold of statistical significance being required. The application of particular methods and thresholds of significance are well with in the skill of the ordinary practitioner of the art.
  • linkage disequilibrium which is the level of departure from random association between two or more loci in a population, often persists over large chromosomal segments.
  • LD linkage disequilibrium
  • the amount of pair-wise LD was plotted against the distance in centiMorgans (cM, one hundredth of a Morgan, on average one recombination per meiosis, recombination is the result of the reciprocal exchange of chromatid segment between homologous chromosome paired at meiosis, and it is usually observed through the association of alleles at linked loci from different grandparents in the progeny) between the markers for a reference germplasm set, for example, a set of 791 soybean elite US lines and 1211 SNP loci with a rare allele frequency greater than 5 percent.
  • a 200 data points moving average curve was an indicator of the presence of LD even for loci 10 cM apart.
  • haplotype region that is a chromosome segment a few centiMorgans long that persists over multiple generations of breeding and that is carried by one or more breeding lines.
  • This segment can be identified with multiple linked marker loci it contains, and the common haplotype identity at these loci in two lines gives a high degree of confidence of the identity by descent of the entire subjacent chromosome segment carried by these lines.
  • Markers are then grouped based on their proximity. This grouping may be arbitrary (e.g. “start from one end of the chromosome and include all markers that are within 10 cM of the first marker included in the segment, before starting the next segment”) or based on some statistical analysis (e.g. “define segment breakpoints based on LD patterns between adjacent loci”).
  • identity by state (IBS) at the marker locus is a good predictor of identity by descent (IBD) at the chromosomal region surrounding the marker locus.
  • IBD identity by descent
  • IBS identity by state
  • the base reference germplasm has to be defined (collection of elite inbred lines, population of random mating individuals, etc.) and a representative sample (or the all population) has to be genotyped.
  • the haplotype frequency can then be determined by simple counting if considering a set of inbred individuals.
  • Estimation methods that employ computing techniques like the Expectation/Maximization algorithm will be needed if individuals genotyped are heterozygous at more the one loci in the segment and linkage phase is unknown (Excoffier and Slatkin, 1995).
  • EM expectation-maximization
  • haplotype estimates and the identity of each chromosome segment for each candidate host line, it is further possible to rank lines according to their probability of giving rise to events located in high value haplotypes.
  • probability distributions of an event to be located in a chromosome segment could be used, according to the degree of knowledge acquired on the physical size of each segment and the random or pattern-following mode of insertion of a transgene in the genome.
  • Alternative approaches can be employed to perform association studies: genome-wide association studies, candidate region association studies and candidate gene association studies.
  • the biallelic markers of the present invention may be incorporated in any map of genetic markers of a plant genome in order to perform genome-wide association studies.
  • the present invention comprises methods to detect an association between a haplotype and a favorable property or a multiple trait index.
  • a multiple trait index is a numerical entity that is calculated through the combination of single trait values in a formula. Most often calculated as a linear combination of traits or normalized derivations of traits, it can also be the result of more sophisticated calculations (for example, use of ratios between traits). This MTI can then be used in genetic analysis as if it where a trait.
  • a favorable haplotype provides a favorable property to a parent plant and to the progeny of the parent when selected by a marker means or phenotypic means.
  • the method of the present invention provides for selection of favorable haplotypes and the accumulation of favorable haplotypes in a breeding population, for example one or more of the haplotypes identified in the present invention.
  • a transgene is associated with a favorable haplotype to create a T-type that is accumulated with other favorable haplotypes to enhance a germplasm.
  • Another embodiment of this invention is a method for enhancing accumulation of one or more haplotypes in a germplasm.
  • the transformation of a plant cell with a transgene means that the transgene DNA has been inserted into a genomic DNA region of the plant.
  • Genomic regions defined as haplotype regions include genetic information and provide phenotypic traits to the plant. Variations in the genetic information result in variation of the phenotypic trait and the value of the phenotype can be measured.
  • the genetic mapping of the haplotype regions and genetic mapping of a transgene insertion event allows for a determination of linkage of a transgene insertion with a haplotype.
  • transgene that has a DNA sequence that is novel in the genome of a transformed plant can in itself serve as a genetic marker of the transgene and the genomic region in which it has inserted.
  • a transgene that was inserted into the genome of a soybean plant provides for the expression of a glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase that has a DNA coding sequence comprised within SEQ ID NO:28 disclosed in U.S. Pat. No. 6,660,911 and SEQ ID NO:9 disclosed in U.S. Pat. No. 5,633,435, both herein incorporated by reference, from which a DNA primer or probe molecule can be selected to function as a genetic marker for the transgene in the genome.
  • a transgene may provide a means to select for plants that have the insert and the linked haplotype region. Selection may be due to tolerance to an applied phytotoxic chemical such as a herbicide or antibiotic. Selection may be due to detection of a product of a transgene, for example, an mRNA or protein product. Selection may be conducted by detection of the transgene DNA inserted into the genome of the plant.
  • a transgene may also provide a phenotypic selection means, such as, a morphological phenotype that is easily to observe, this could be a seed color, seed germination characteristic, seedling growth characteristic, leaf appearance, plant architecture, plant height, and flower and fruit morphology, or selection based on an agronomic phenotype, such as, yield, herbicide tolerance, disease tolerance, insect tolerance, enhance feed quality, drought tolerance, cold tolerance, or any other agronomic trait provided by a transgene.
  • a phenotypic selection means such as, a morphological phenotype that is easily to observe, this could be a seed color, seed germination characteristic, seedling growth characteristic, leaf appearance, plant architecture, plant height, and flower and fruit morphology, or selection based on an agronomic phenotype, such as, yield, herbicide tolerance, disease tolerance, insect tolerance, enhance feed quality, drought tolerance, cold tolerance, or any other agronomic trait provided by a transgene.
  • transgenic events that have a transgene insertion into tight linkage with favorable haplotype regions and selection of these events for use in a breeding program to enhance the accumulation of favorable haplotype regions.
  • the method includes: a) inserting a transgene into a genome of a plant cell and regenerating the plant cell into an intact transformed plant using plant transformation and regeneration methods previously described and known in the art of plant biotechnology; and b) determining a map location of the transgene in the genome of the transformed plant using DNA markers of the transgene and linked genomic regions; and c) correlating the map location to a tightly linked haplotype, wherein the transgene and the haplotype comprises a T-type genomic region in the transformed plant; and d) crossing the transformed plant with a second plant that may also be transformed to contain at least one T-type genomic region that is different from the first transformed plant T-type genomic region or the second plant may contain a favorable haplotype region identified by genetic markers that is different from the first transformed plant; and e) selecting at least one progeny plant by detecting expression of the transgene of the first plant or selecting by the presence of a marker associated with the transgene, wherein the progeny plant comprises in its genome at least a portion
  • the present invention contemplates that preferred T-type genomic regions are selected from a large population of T-type genomic regions, and the preferred T-type genomic regions have an enhanced T-value in the germplasm of a crop plant.
  • the preferred T-type genomic region can be used in the described breeding method to accumulate other beneficial T-type genomic regions and favorable haplotype regions and maintain these in a breeding population to enhance the overall germplasm of the crop plant.
  • Crop plants considered for use in the method include but are not limited to, corn, soybean, cotton, wheat, rice, canola, oilseed rape, sugar beet, sorghum, millet, alfalfa, vegetable crops, forest trees, and fruit crops.
  • Another embodiment of this invention is a method for indirect mapping at least one T-type genomic region. Mapping of the T-type genomic region in the genome of a plant provides for selection of favorable haplotype regions that comprise the T-type genomic region.
  • the present invention provides a method for mapping of the transgene insertion event and its association with a genomic region and location on a genome map of a plant. The method may include the following steps:
  • the genome flanking the transgene insertion event can comprise a DNA segment of from a few hundred to tens of thousands of nucleotide base pairs or a sufficient length to identify a polymorphism.
  • the genomic flanking region can be from the 5′ or 3′ end of the transgene insert location extending into the genome from the insert site.
  • the “polymerase chain reaction” (PCR) is a process of in vitro geometrical amplification of a target DNA segment through the use of a heat-resistant DNA polymerase and cyclic variation of temperature to allow for repetitive denaturing, primer annealing and amplification or template DNA.
  • PCR polymerase chain reaction
  • Paralogous sequences are two sequences of DNA with a high degree of similarity but belong to different loci on the genome.
  • mapping population is a set of individuals where alleles at marker loci and possibly at one or a plurality of Quantitative Trait Loci (QTL) are segregating, in a way that presence of linkage disequilibrium can be taken of evidence as proximity on the chromosome and there is a positive correlations between proximity and disequilibrium.
  • the mapping population is the same plant species or a plant species demonstrating synteny or colinearity. These populations can be used to estimate the relative positions of marker loci among themselves or between these and QTLs. Generally mapping populations are segregating populations.
  • the method can be applied to any crop species, particular important crop species are, for example, corn, soybean, cotton, wheat, rice, canola, oilseed rape, sugar beet, sorghum, millet, alfalfa, vegetable crops, forest trees, and fruit crops.
  • crops for example, corn, soybean, cotton, wheat, rice, canola, oilseed rape, sugar beet, sorghum, millet, alfalfa, vegetable crops, forest trees, and fruit crops.
  • maps available to one skilled in the art for one or more of these crops by way of example, genetic maps are referenced for maize (Lee et al., 2002), soybean (Ferreira et al., 2000), cotton (Lacape et al., 2003), and canola (Cheung et al., 1997).
  • De novo mapping populations can also be generated for any crop of interest and a genetic map crated that is useful in the present invention to map the haplotype regions in which a transgene
  • Identification of cloned genomic DNA regions for example, those contained in a Bac library can be probed with DNA markers developed to identify the haplotype linked with a transgenic insertion. Additional DNA markers can be developed by sequencing the Bac clones and inspecting for polymorphisms in the sequence. Genes of interest can be isolated from the Bac clones that can be used as transgenes to improve the performance of the same crop species or different crop species.
  • Means for preparing recombinant vectors are well known in the art. Methods for making recombinant vectors particularly suited to plant transformation include, without limitation, those described in U.S. Pat. Nos. 4,971,908, 4,940,835, 4,769,061 and 4,757,011. These type of vectors have also been reviewed (Rodriguez et al., 1988; Glick et al., 1993).
  • Typical vectors useful for expression of nucleic acids in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens (Rogers et al., 1987). Other recombinant vectors useful for plant transformation, including the pCaMVCN transfer control vector, have also been described (Fromm et al., 1985). Many crops species have been transformed to contain one or more transgenes of agronomic importance that in themselves provides a favorable property to the plant. One example is a transgene that confers herbicide tolerance to the crop plant.
  • Transgenes that encode herbicide tolerance proteins that have been transformed and expressed in plants include, for example, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein conferring glyphosate resistance and proteins conferring resistance to others herbicides, such as glufosinate or bromoxynil (Comai et al., 1985; Gordon-Kamm et al., 1990; Stalker et al., 1988; Eichholtz et al., 1987; Shah et al., 1986; Charest et al., 1990).
  • EPSPS 5-enolpyruvylshikimate-3-phosphate synthase
  • Further examples include the expression of enzymes such as dihydrofolate reductase and acetolactate synthase, mutant ALS and AHAS enzymes that confer resistance to imidazalinone or a sulfonylurea herbicides (Lee et al., 1988 and Miki et al., 1990), a phosphinothricin-acetyl-transferase conferring phosphinothricin resistance (European application No.
  • enzymes such as dihydrofolate reductase and acetolactate synthase, mutant ALS and AHAS enzymes that confer resistance to imidazalinone or a sulfonylurea herbicides (Lee et al., 1988 and Miki et al., 1990), a phosphinothricin-acetyl-transferase conferring phosphinothricin resistance (European application No.
  • proteins conferring resistance to phenoxy proprionic acids and cycloshexones such as sethoxydim and haloxyfop (Marshall et al., 1992); and proteins conferring resistance to triazine (psbA and gs+genes) and benzonitrile (nitrilase encoding gene, Przibila et al. (1991).
  • a plant of the present invention may also comprise a transgene that confers resistance to insect, pest, viral, or bacterial attack.
  • a transgene conferring resistance to a pest such as soybean cyst nematode was described in PCT Application WO96/30517 and PCT Application WO93/19181.
  • Jones et al. (1994) describe cloning of the tomato Cf-9 gene for resistance to Cladosporium fulvum );
  • Martin et al. (1993) describe a tomato Pto gene for resistance to Pseudomonas syringae pv.
  • Mindrinos et al. (1994) describe an Arabidopsis RSP2 gene for resistance to Pseudomonas syringae.
  • Bacillus thuringiensis endotoxins may also be used for insect resistance, for example, Geiser et al. (1986).
  • viral coat proteins as transgenes in transformed plant cells is known to impart resistance to viral infection and/or disease development affected by the virus from which the coat protein gene is derived, as well as by related viruses (Beachy et al., 1990).
  • Transgenes may also be used conferring increased nutritional value or another value-added trait.
  • One example is modified fatty acid metabolism, for example, by transforming a plant with an antisense gene of stearoyl-ACP desaturase to increase stearic acid content of the plant, (Knutzon et al., 1992).
  • a sense desaturase gene may also be introduced to alter fatty acid content.
  • Phytate content may be modified by introduction of a phytase-encoding gene to enhance breakdown of phytate, adding more free phosphate to the transformed plant.
  • Modified carbohydrate composition may also be affected, for example, by transforming plants with a gene coding for an enzyme that alters the branching pattern of starch (Shiroza et al., 1988, nucleotide sequence of Streptococcus mutants fructosyltransferase gene); Steinmetz et al. (1985) (nucleotide sequence of Bacillus subtilis levansucrase gene); Pen et al. (1992), production of transgenic plants that express Bacillus lichenifonnis ⁇ -amylase); Elliot et al. (1993), nucleotide sequences of tomato invertase genes); S ⁇ gaard et al. (1993), site-directed mutagenesis of barley ⁇ -amylase gene; and Fisher et al. (1993), maize endosperm starch branching enzyme II.
  • an enzyme that alters the branching pattern of starch (Shiroza et al., 1988, nucleot
  • Transgenes may also be used to alter protein metabolism.
  • U.S. Pat. No. 5,545,545 describes lysine-insensitive maize dihydrodipicolinic acid synthase (DHPS), which is substantially resistant to concentrations of L-lysine which otherwise inhibit the activity of native DHPS.
  • DHPS lysine-insensitive maize dihydrodipicolinic acid synthase
  • EP 0640141 describes sequences encoding lysine-insensitive aspartokinase (AK) capable of causing a higher than normal production of threonine, as well as a subfragment encoding antisense lysine ketoglutarate reductase for increasing lysine.
  • AK lysine-insensitive aspartokinase
  • a transgene may be employed that alters plant carbohydrate metabolism.
  • fructokinase genes are known for use in metabolic engineering of fructokinase gene expression in transgenic plants and their fruit (U.S. Pat. No. 6,031,154).
  • transgenes that may be used are genes that alter grain yield.
  • U.S. Pat. No. 6,486,383 describes modification of starch content in plants with subunit proteins of adenosine diphosphoglucose pyrophosphorylase (“ADPG PPase”).
  • ADPG PPase adenosine diphosphoglucose pyrophosphorylase
  • transgenic plants are discussed in which the introduction and expression of particular DNA molecules results in the formation of easily mobilized phosphate pools outside the vacuole and an enhanced biomass production and/or altered flowering behavior.
  • U.S. Pat. No. 6,774,284 describes DNA encoding a plant lipase and methods of use thereof for controlling senescence in plants.
  • U.S. Pat. No. 6,140,085 provides FCA genes for altering flowering characteristics, particularly timing of flowering.
  • U.S. Pat. No. 5,637,785 discusses genetically modified plants having modulated flower development such as having early floral meristem development and comprising a structural gene encoding the LEAFY protein in its genome.
  • U.S. Pat. No. 6,184,440 discusses genetically engineered plants which display altered structure or morphology as a result of expressing a cell wall modulation transgene.
  • cell wall modulation transgenes include a cellulose binding domain, a cellulose binding protein, or a cell wall modifying protein or enzyme such as endoxyloglucan transferase, xyloglucan endo-transglycosylase, an expansin, cellulose synthase, or a novel isolated endo-1,4- ⁇ -glucanase.
  • a transgene that provides a favorable property can be associated with plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance.
  • a transgene that provides a beneficial agronomic trait to crop plants may be, for example, include but is not limited to the following examples of genetic elements comprising herbicide resistance (U.S. Pat. No. 5,633,435 and U.S. Pat. No. 5,463,175), increased yield (U.S. Pat. No. 5,716,837), insect control (U.S. Pat. No. 6,063,597; U.S. Pat. No. 6,063,756; U.S. Pat. No. 6,093,695; U.S. Pat. No.
  • a transcribable polynucleotide molecule can effect the above mentioned plant characteristic or phenotype by encoding a RNA molecule that causes the targeted inhibition of expression of an endogenous gene, for example via antisense, inhibitory RNA (RNAi), or cosuppression-mediated mechanisms.
  • the RNA could also be a catalytic RNA molecule (i.e., a ribozyme) engineered to cleave a desired endogenous mRNA product.
  • Certain RNA molecules can also be expressed in plant cells that inhibit targets in organisms other than plants, for example, insects that feed on the plant cells and ingest the inhibitory RNA, or nematodes that feed on plant cells and ingest the inhibitory RNA.
  • any transcribable polynucleotide molecule that encodes a transcribed RNA molecule that affects a phenotype or morphology change of interest may be useful for the practice of the present invention.
  • Breeding techniques take advantage of a plant's method of pollination. There are two general methods of pollination: self-pollination, which occurs if pollen from one flower is transferred to the same or another flower of the same plant, and cross-pollination, which occurs if pollen comes to it from a flower on a different plant. Plants that have been self-pollinated and selected for type over many generations become homozygous at almost all gene loci and produce a uniform population of true breeding progeny, homozygous plants.
  • pedigree breeding may be used.
  • the pedigree breeding method for specific traits involves crossing two genotypes. Each genotype can have one or more desirable characteristics lacking in the other; or, each genotype can complement the other. If the two original parental genotypes do not provide all of the desired characteristics, other genotypes can be included in the breeding population. Superior plants that are the products of these crosses are selfed and are again advanced in each successive generation. Each succeeding generation becomes more homogeneous as a result of self-pollination and selection.
  • this method of breeding involves five or more generations of selfing and selection: S 1 ⁇ S 2 ; S 2 ⁇ S 3 ; S 3 ⁇ S 4 ; S 4 ⁇ S 5 , etc.
  • a selfed generation (S) may be considered to be a type of filial generation (F) and may be named F as such. After at least five generations, the inbred plant is considered genetically pure.
  • Each breeding program should include a periodic, objective evaluation of the efficiency of the breeding procedure. Evaluation criteria vary depending on the goal and objectives. Promising advanced breeding lines are thoroughly tested and compared to appropriate standards in environments representative of the commercial target area(s) for generally three or more years. Identification of individuals that are genetically superior because genotypic value can be masked by confounding plant traits or environmental factors. One method of identifying a superior plant is to observe its performance relative to other experimental plants and to one or more widely grown standard varieties. Single observations can be inconclusive, while replicated observations provide a better estimate of genetic worth.
  • Mass and recurrent selections can be used to improve populations of either self-or cross-pollinating crops.
  • a genetically variable population of heterozygous individuals is either identified or created by intercrossing several different parents. The best plants are selected based on individual superiority, outstanding progeny, or excellent combining ability. The selected plants are intercrossed to produce a new population in which further cycles of selection are continued.
  • Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several reference books (Allard, 1960; Simmonds, 1979; Sneep and Hendriksen, 1979; Fehr, 1987; Fehr, 1987).
  • the effectiveness of selecting for genotypes with enhanced traits of interest will depend upon: 1) the extent to which the variability in the traits of interest of individual plants in a population is the result of genetic factors and is thus transmitted to the progenies of the selected genotypes; and 2) how much the variability in the traits of interest among the plants is due to the environment in which the different genotypes are growing.
  • a favorable property such as yield of a harvested plant product, for example yield of a grain, seed, fruit, fiber, forage
  • an agronomic trait for example, pest resistance such as disease resistance, insect resistance, nematode resistance, or improved growth rate, and stress tolerance
  • an improved processed product of the plant for example, fatty acid profile, amino acid profile, nutritional content, fiber quality
  • the inheritance of traits ranges from control by one major gene whose expression is not influenced by the environment (i.e., qualitative characters) to control by many genes whose effects are greatly influenced by the environment (i.e., quantitative characters). Breeding for quantitative traits such as yield is further characterized by the fact that: 1) the differences resulting from the effect of each gene are small, making it difficult or impossible to identify them individually; 2) the number of genes contributing to a character is large, so that distinct segregation ratios are seldom, if ever, obtained; and 3) the effects of the genes may be expressed in different ways based on environmental variation. Therefore, the accurate identification of transgressive segregates or superior genotypes with the traits of interest is extremely difficult and its success is dependent on the plant breeder's ability to minimize the environmental variation affecting the expression of the quantitative character in the population.
  • Introgression of a particular genomic region in a set of genomic regions that contain a transgene, or transgenes into a plant germplasm is defined as the result of the process of backcross conversion.
  • a plant germplasm into which a novel DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid.
  • an introgression of a particular genomic region or transgene may be conducted by a forward breeding process.
  • a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid.
  • the genetic markers linked to a T-type genomic region may be used to assist in breeding for the purpose of producing soybean plants with increased yield and a transgenic trait.
  • Backcrossing and marker-assisted selection, or forward breeding and marker-assisted selection in particular can be used with the present invention to introduce the T-type genomic region into any variety by conversion of that variety.
  • marker sequences are provided that are genetically linked and can be used to follow the selection of the soybean or corn haplotypes.
  • Genomic libraries from multiple corn or soybean lines are made by isolating genomic DNA from different corn or soybean lines by Plant DNAzol Reagent” from Life Technologies now Invitrogen (Invitrogen Life Technologies, Carlsbad, Calif.). Genomic DNA are digested with Pst 1 endonuclease restriction enzyme, size-fractionated over 1 percent agarose gel and ligated in plasmid vector for sequencing by standard molecular biology techniques as described in Sambrook et al. These libraries are sequenced by standard procedures on ABI Prism®377 DNA Sequencer using commercially available reagents (Applied Biosystems, Foster City, Calif.).
  • sequences are assembles to identify non-redundant sequences by Pangea Clustering and Alignment Tools that is available from DoubleTwist Inc., Oakland, Calif. Sequence from multiple corn or soybean lines are assembled into loci having one or more polymorphisms, such as SNPs and/or Indels. Candidate polymorphisms are qualified by the following parameters:
  • MAS marker-assisted selection
  • Marker-assisted selection comprises the mapping of phenotypic traits and relies on the ability to detect genetic differences between individuals.
  • a “genetic map” is the representation of the relative position of characterized loci (DNA markers or any other locus for which allele can be identified) along the chromosomes. The measure of distance is relative to the frequency of crossovers event between sister chromatids at meiosis. The genetic differences, or “genetic markers” are then correlated with phenotypic variations using statistical methods. In a preferred case, a single gene encoding a protein responsible for a phenotypic trait is detectable directly by a mutation which results in the variation in phenotype. More commonly, multiple genetic loci each contribute to the observed phenotype.
  • DNA markers are Restriction Fragment Length Polymorphisms (RFLP), Amplified Fragment Length Polymorphisms (AFLP), Simple Sequence Repeats (SSR), Single Nucleotide Polymorphisms (SNP), Insertion/Deletion Polymorphisms (Indels), Variable Number Tandem Repeats (VNTR), and Random Amplified Polymorphic DNA (RAPD), and others known to those skilled in the art.
  • RFLP Restriction Fragment Length Polymorphisms
  • AFLP Amplified Fragment Length Polymorphisms
  • SSR Simple Sequence Repeats
  • SNP Single Nucleotide Polymorphisms
  • Indels Insertion/Deletion Polymorphisms
  • VNTR Variable Number Tandem Repeats
  • RAPD Random Amplified Polymorphic DNA
  • the plant can be selfed to create a true breeding line with the same genotype, or it can be crossed with a plant with the same marker or with other desired characteristics to create a sexually crossed hybrid generation.
  • Methods of marker-assisted selection (MAS) using a variety of genetic markers are provided. Plants selected by MAS using the methods are provided.
  • Marker-assisted introgression involves the transfer of a chromosome region defined by one or more markers from one germplasm to a second germplasm.
  • the initial step in that process is the localization of the genomic region or transgene by gene mapping, which is the process of determining the position of a gene or genomic region relative to other genes and genetic markers through linkage analysis.
  • the basic principle for linkage mapping is that the closer together two genes are on a chromosome, then the more likely they are to be inherited together. Briefly, a cross is generally made between two genetically compatible but divergent parents relative to traits under study. Genetic markers can then be used to follow the segregation of traits under study in the progeny from the cross, often a backcross (BCl), F 2 , or recombinant inbred population.
  • BCl backcross
  • a suitable recurrent parent is an important step for a successful backcrossing procedure.
  • the goal of a backcross protocol is to alter or substitute a trait or characteristic in the original inbred.
  • one or more loci of the recurrent inbred is modified or substituted with the desired gene from the nonrecurrent (donor) parent, while retaining essentially all of the rest of the desired genetic, and therefore the desired physiological and morphological, constitution of the original inbred.
  • the choice of the particular donor parent will depend on the purpose of the backcross.
  • the exact backcrossing protocol will depend on the characteristic or trait being altered to determine an appropriate testing protocol. It may be necessary to introduce a test of the progeny to determine if the desired characteristic has been successfully transferred.
  • the term “transformed” refers to a cell, tissue, organ, or organism into which has been introduced a foreign polynucleotide molecule, such as a construct.
  • the introduced polynucleotide molecule may be integrated into the genomic DNA of the recipient cell, tissue, organ, or organism such that the introduced polynucleotide molecule is inherited by subsequent progeny.
  • a “transgenic” or “transformed” cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing such a transgenic plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of a foreign polynucleotide molecule.
  • a plant transformation construct containing a polynucleotide molecule of the present invention may be introduced into plants by any plant transformation method.
  • Methods and materials for transforming plants by introducing a plant expression construct into a plant genome in the practice of this invention can include any of the well-known and demonstrated methods including electroporation as illustrated in U.S. Pat. No. 5,384,253; microprojectile bombardment as illustrated in U.S. Pat. No. 5,015,580; U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,880; U.S. Pat. No. 6,160,208; U.S. Pat. No. 6,399,861; and U.S. Pat. No.
  • cre-lox recombination system of bacteriophage P1
  • the cre-lox system utilizes the cre recombinase isolated from bacteriophage P1 in conjunction with the DNA sequences (termed lox sites) it recognizes. This recombination system has been effective for achieving recombination in plant cells (U.S. Pat. No.
  • Yoder el al. U.S. Pat. No. 5,482,852 and U.S. Pat. No. 5,792,924, both of which are incorporated herein by reference
  • constructs containing the sequence of the transposase enzyme and the transposase recognition sequences to provide a method for genetically altering plants that contain a desired gene free of vector and/or marker sequences.
  • Zinc finger endonucleases can be specifically designed to recognize a DNA sequence and can target specific DNA sequences in a genome to create a recombination site useful for the insertion of a transgene (Wright et al., 2005; U.S. Pat. No.
  • a transgene that contains additional recombination sites when it is a component of a preferred T-type genomic region provides an opportunity to add additional transgenes to the T-type genomic region, thereby increasing the value of the region in a germplasm.
  • the present invention contemplates that the T-type genomic region is also a site for specific recombination activities to remove or add new genetic material to the genomic region.
  • This example illustrates identifying soybean haplotypes useful in databases for practicing the methods of this invention.
  • the chromosomes of soybean were divided into haplotypes by following the hereditability of a large set of makers. Allelic forms of the haplotypes were identified for a set of 4 haplotypes which are listed in Table 1.
  • a haplotype mapped to a genomic location is identified by reference, for example C8W6H5 refers to chromosome 8, window 6 in that chromosome and haplotype 5 in that window (genomic region);
  • SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus;
  • START_POS refers to the start position of the marker in the DNA amplicon;
  • HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window.
  • the database comprises computed values of agronomic traits, for example, yield, maturity, plant height, and lodging, for the specific allelic soybean haplotypes and the haplotype frequency in a set of breeding lines.
  • Other traits can be measured, for example, yield of a grain, seed, fruit, fiber, forage, oil; or an agronomic trait, for example, pest resistance such as disease resistance, insect resistance, nematode resistance, or improved growth rate, and stress tolerance; or an improved processed product of the plant, for example, fatty acid profile, amino acid profile, nutritional content, fiber quality and a database compiled for the values of each haplotype for these other traits.
  • the agronomic trait values of these haplotypes represent the predicted population change in mean value for the trait listed if the haplotype was fixed in the germplasm, everything else staying the same.
  • the values for “yield” are in bushels of soybeans per acre.
  • the values for “maturity” are in days (maturity of a soybean line is the relative flowering time of that line compared to a set of standard checks of defined maturity).
  • the values for “plant height” are in inches of height measured from the soil surface to the tip of the uppermost plant tissue at maturity.
  • the breeding values for each of the haplotypes are used to select the haplotype that in combination with a transgene will be the most beneficial for the improvement of the germplasm of the crop.
  • the breeding value is a combination of measured traits and the estimation of how these traits will affect germplasm improvement.
  • the soybean haplotypes associated with the transgenic events for glyphosate tolerance were measured and the results shown in Table 2.
  • the Haplotype C8W6H5 would be a favorable haplotype for its effect on yield, and haplotype C 18W3H8 would be a favorable haplotype for its very high frequency in the germplasm (94 percent), indicating that little variability is present in the target soy germplasm for this chromosome segment, making the diffusion process of a transgenic event in it neutral.
  • Haplotype C19W3H6 is generally neutral with respect to yield. TABLE 2 The calculated breeding values of four haplotypes described for yield, maturity, plant height, and lodging. The frequency of the haplotype in the soybean germplasm was estimated from a sample of 365 soybean lines. Frequency Yield Plant in a (Bushels/ Maturity height Lodging breeding Haplotype acre) (Days) (inches) (%) population C8W6H5 1.689 0.989 ⁇ 0.195 ⁇ 0.027 21% C16W8H43 ⁇ 0.447 ⁇ 0.211 ⁇ 0.514 ⁇ 0.101 42% C18W3H8 0.000 0.000 0.000 0.000 0.000 0.000 0.000 0.000 94% C19W3H6 ⁇ 0.071 0.232 ⁇ 0.495 0.001 58%
  • haplotype regions were determined for each of the four new glyphosate tolerant soybean events. 17194 is linked to haplotype C16W8H43, 17426 is linked to haplotype C18W3H8, 19703 is linked to haplotype C19W3H6, and 19788 is linked to haplotype C8W6H5.
  • Table 2 This represents the predicted population change in mean value for the trait listed if the haplotype was fixed in the germplasm, everything else staying the same.
  • the T-type of 19788 and the associated C8W6H5 haplotype is the most favorable of the four T-types that were measured. This result demonstrates that it is important in a process to improve crop performance through transgenic methods that both transgenic events and the linked haplotype regions are evaluated to continue to enhance crop productivity.
  • the new glyphosate tolerant events were compared in replicated field trials to a backcross conversion of 40-3-2 into A3244 germplasm. This was demonstrated in replicated field trials including yield data collected from seventeen locations in the United States.
  • the A3244 (U.S. Pat. No. 5,659,114, ATCC number 97549) is an elite soybean germplasm from Asgrow (Monsanto, St Louis, Mo.) that was used as the parent line for transformation to generate the new glyphosate tolerant soybean events 17194, 17426, 19703, and 19788.
  • the haplotype regions and breeding values of each were determined for four haplotype regions in which an insect tolerance gene was inserted into the genome of a soybean plant.
  • the relative breeding value for each haplotype regions is shown in Table 3, the definitions of the measurements are the same as described in Example 2.
  • the table is a database for determining the haplotype and its breeding value in which an insect tolerance gene was inserted (a T-type).
  • a transgenic event comprising the T-type is selected using the database information.
  • a particular event, GM — 19459 contains the T-type of the insect tolerance gene associated with C6W4H1 haplotype that is a favorable haplotype for maturity.
  • TABLE 3 The calculated breeding values for yield, maturity, plant height, and lodging of four haplotypes for the insect tolerant soybean events.
  • the frequency of the haplotype in the germplasm was estimated from 2589 soybean lines. Yield Plant (Bushels/ Maturity height Lodging Haplotype Haplotype acre) (Days) (inches) (%) frequency C1W1H2 0.075 0.244 0.057 0.018 16% C1W2H1 0.160 0.314 0.069 0.022 67% C14W7H2 0.130 0.648 ⁇ 0.101 ⁇ 0.069 62% C6W4H1 ⁇ 0.156 ⁇ 0.111 — 0.070 29%
  • haplotypes were identified for a set of 4 haplotypes associated with transgenic insect resistant soybeans as listed in Table 4.
  • C1W1H2 refers to chromosome 1, window 1 in that chromosome and haplotype 2 in that window (genomic region);
  • SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus;
  • START_POS refers to the start position of the marker in the DNA amplicon;
  • HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window; “NA” indicated another marker allele is not present.
  • This example illustrates the haplotype regions and breeding values that were determined for four haplotype regions in which an insect tolerance gene was inserted into the genome of a corn plant (LH172).
  • the relative breeding value for each haplotype regions is shown in Tabel 5, the definitions of the measurements are the same as described in Example 2.
  • the table is a database for determining the haplotype and its breeding value in which an insect tolerance gene was inserted (a T-type).
  • a transgenic event comprising the T-type is selected using the database information.
  • a particular event contains the T-type of the insect tolerance gene associated with the C1W36H2 haplotype.
  • TABLE 5 Calculated breeding value for yield of four haplotypes for insect tolerant corn events.
  • the frequency of the haplotype in the germplasm was estimated from 6335 corn lines.
  • Haplotype Yield (Bushels/acre)
  • Haplotype frequency C1W19H14 0.168 9.2%
  • haplotypes were identified for a set of 4 haplotypes for the transgenic insect resistant corn as listed in Table 6.
  • C1W19H14 refers to chromosome 1, window 19 in that chromosome and haplotype 14 in that window (genomic region);
  • SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus;
  • START_POS refers to the start position of the marker in the DNA amplicon;
  • HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window.
  • DNA markers are identified in the genomic region flanking a transgene insert to provide a means to identify the genomic location of the transgene by comparison of the DNA markers to a mapping population.
  • DNA markers can be developed to any transgenic event by isolation of the genomic region, sequencing of the region, isolation of the same region in a mapping population of the crop plant, and determining the location relative to markers known in the mapping population. The association of the transgene with mapped phenotypes, quantitative trait loci comprising a haplotype genomic region can be determined.
  • a DNA primer pair was selected from a DNA sequence that extends into the genome 5′ to the transgene insertion site (SEQ ID NO:55 and 56) and into the 3′ genomic region relative to the transgene insertion site (SEQ ID NO:57-58).
  • a DNA amplification method was used to produce DNA products that comprise a portion of the soybean genome from the 5′ and 3′ regions of the transgene insertion site. These DNA products were sequenced.
  • the same primer pairs were used to amplify DNA from seven soybean lines (507354, Minsoy, Noir, HS1, PIC, 88788, A3244) that are parents of four mapping populations.
  • SNP119 SEQ ID NO:59
  • Table 7 shows the allelic composition at this position on eight lines tested.
  • TABLE 7 Polymorphism at flanking sequences in different soybean lines comprising MON89788. 5′ Flanking 3′ Flanking Position 2809 119 507354 A T Minsoy A T Noir A T HS1 A T PIC T C 88788 T A3244 T 507355 A T
  • a Taqman® (PE Applied Biosystems, Foster City, Calif.) end point assay was developed from SNP119 in accordance to instructions provided by the manufacturer. Primer and probe sequences are given in Table 8.
  • Map position of SNP119 was determined by placing the allelic scores against the existing allelic data set using MapMaker (Lincoln and Lander, 1990). SNP119 was found on linkage group D1a+Q (Song, Q. J., et al., 2004). Thus, MON89788 was indirectly mapped to this same position.
  • the ATCC accession number is PTA-6708 deposited on May 11, 2005.
  • the deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced as necessary during that period.
  • DNA molecules of the present invention can be isolated from the genome of the deposited material and the sequence corrected if necessary, additional DNA molecules for use as probes or primers for the haplotype regions disclosed herein can be isolated from the deposited material.
  • compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Environmental Sciences (AREA)
  • Pest Control & Pesticides (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Botany (AREA)
  • Developmental Biology & Embryology (AREA)
  • Insects & Arthropods (AREA)
  • Physiology (AREA)
  • Dentistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Nutrition Science (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Cultivation Of Plants (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)

Abstract

The present invention provides breeding methods and compositions to enhance the germplasm of a plant. The methods describe the identification and accumulation of transgenes and favorable haplotype genomic regions in the germplasm of a breeding population of crop plants.

Description

  • This application claims the benefit of U.S. Provisional Application No. 60/685,584, filed May 27, 2005, the entire text of which is specifically incorporated by reference herein
  • BACKGROUND OF THE INVENTION
  • 1. Field of the Invention
  • The invention relates to the field of plant breeding and plant biotechnology, in particular to a transgene inserted into genetic linkage with a genomic region of a plant, and to the use of the transgene/genomic region to enhance the germplasm and to accumulate other favorable genomic regions in breeding populations.
  • 2. Description of Related Art
  • Breeding has advanced from selection for economically important traits in plants and animals based on phenotypic records of the individual and its relatives to the use of molecular genetics to identify genomic regions that contain the valuable genetic traits. Information at the DNA level has lead to faster genetic accumulation of valuable traits into a germplasm than that achieved based on the phenotypic data only. The development of transgenic crops has further revolutionized breeding and agricultural crop production. The outstanding success of genetically engineered crops is evident from the fact that the area of farmland devoted to transgenic crops has grown from a negligible acreage ten years ago to well over half the acreage for major crops in agriculturallyimportant countries such as USA, Canada, Brazil and Argentina. In addition to the development of input traits, plant biotechnology also holds great promise for the future development of output traits that will directly benefit consumers, like nutritionally superior foods, such as the vitamin A enriched rice, unsaturated oils, and agricultural products of medical value to name a few. The potential for commercial success of a transgene encoding a new or improved input or output trait is a great incentive for development of novel transgenes and their deployment through breeding these genes into elite germplasm.
  • During the development of transgenic crop plants much effort is concentrated on optimization of the insertion and expression of the transgene, and then introgressing the transgene throughout the breeding population by classical breeding methods. The site of insertion of a transgene into the host genome has been a concern for at least two reasons; (i) the region where it inserted may modulate the level of expression of the transgene, and (ii) the insertion of the transgene may disrupt the normal function or expression of a gene near or where it has been inserted. The selection of genomic locations that are beneficial for gene integration provides for suitable levels of stable expression of an introduced gene, or genes, and generally does not negatively affect other agronomic characteristics of the crop plant.
  • The genomic region in which the transgene has been inserted also provides agronomic phenotypes to the crop plant. These phenotypes have their own value in a breeding program and these regions should be considered when selecting among multiple transgene insertion events. Transgene insertion events into genomic regions that are associated with improved performance with respect to an agronomic trait or multiple trait index result in an improved phenotype in the crop plant and progeny derived from the crop plant that contain the transgene and the associated improved phenotype. Selecting for the transgenic event necessarily results in selecting a segment of the host genome that surrounds it, and the improved phenotypic effect. Further improvements involve the identification of molecular markers for the tracking and maintenance of the genomic segment with the associated transgene. This is an area that has not been adequately addressed in current plant breeding with transgene insertion events.
  • There is a need in the art of plant breeding to identify genomic regions associated with improved performance with respect to an agronomic trait or multiple trait index that are linked with a transgene insertion event and then select for these transgene-genomic regions for dispersion into the breeding population of the crop. The present invention provides consideration to estimating the value of the genomic region and the transgene event. This value can then be used as a criterion for selecting among multiple transgenic events. A further benefit is that linkage drag around a transgene is minimized and valuable genomic regions are selected that contain the transgene for breeding into the germplasm of a crop.
  • SUMMARY OF THE INVENTION
  • The present invention provides a method of breeding with transgenic plants. In one aspect, this method comprises providing a database identifying a value of an agronomic trait for at least two distinct haplotypes of the genome for a set of germplasm. The method further comprises transforming a parent plant with recombinant DNA to produce at least two transgenic events wherein the recombinant DNA is inserted into linkage with the at least two distinct haplotypes of the genome of the parent plant. The database may then be referenced to estimate the value of the agronomic trait for the events linked to the distinct haplotypes, and transgenic event having a higher referenced breeding value may then be selected for breeding into a germplasm.
  • The present invention provides a method for improving plant germplasm by accumulation of one or more haplotypes in a germplasm. The method comprises inserting a transgene into a genome of a first plant, and then determining a map location of the transgene in the genome. The map location may be correlated to a linked haplotype, wherein the transgene and the haplotype comprise a T-type genomic region. The first plant may then be crossed with a second plant. The second plant may contain at least one T-type genomic region or haplotype that is different from the first plant T-type genomic region. At least one progeny plant may then be selected, the progeny plant having detectable expression of the transgene or its phenotype and comprising in its genome the T-type genomic region of the first plant and at least one T-type genomic or haplotype of the second plant. The progeny plant may be used in activities related to germplasm improvement, which can be selected from use of the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING, or any combination of these.
  • The present invention includes a method for breeding of a crop plant, in particular a soybean or corn plant with enhanced agronomic and transgenic traits comprising a preferred T-type genomic region. A transgene of the T-type genomic region is further defined as conferring a preferred property like herbicide tolerance, disease resistance, insect or pest resistance, altered fatty acid, protein or carbohydrate metabolism, increased grain yield, increased oil, increased nutritional content, increased growth rates, enhanced stress tolerance, or altered morphological characteristics, or any combination of these.
  • The present invention provides a novel method for mapping at least one genomic region of insertion of a transgene. This method involves indirect mapping and does not require the establishment of a de novo population segregating for a transgene. The method comprises first identifying at least a first polymorphism between the parent lines of a mapping population in the corresponding genomic region adjacent to a transgenic insertion event in a transformed plant or line, then assaying the progeny plants of the mapping population for the polymorphism. Linkage analysis may be performed to determine a map position of the polymorphism and thereby a map location of the transgenic insertion event. The map location in the mapping population may then be correlated to a haplotype of the transformed plant and its progeny.
  • DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
  • The definitions and methods provided define the present invention and guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art. Definitions of common terms in molecular biology may also be found in Rieger et al. (1991); and Lewin (1994). The nomenclature for DNA bases as set forth at 37 CFR § 1.822 is used.
  • As used herein, the term “corn” means Zea mays or maize and includes all plant varieties that can be bred with corn, including wild maize species.
  • As used herein, the term “soybean” means Glycine max and includes all plant varieties that can be bred with soybean, including wild soybean species.
  • As used herein, the term “comprising” means “including but not limited to”.
  • A transgenic “event” is produced by transformation of a plant cell with heterologous DNA, i.e., a nucleic acid construct that includes a transgene of interest, regeneration of a population of plants resulting from the insertion of the transgene into the genome of the plant, and selection of a particular plant characterized by insertion into a particular genome location. The term “event” refers to the original transformant and progeny of the transformant that include the heterologous DNA. The term “event” also refers to progeny produced by a sexual outcross between the transformant and another variety that include the heterologous DNA.
  • The present invention overcomes the deficiencies of the current transgene breeding methods by describing a T-type genomic region, defined as a transgene and a linked haplotype genomic region, through which the genetically linked transgene and haplotype are selected and then introgressed into gernplasm through breeding. The selection of the T-type genomic region is based on the estimation of a T-value that the T-type genomic region provides to the germplasm of the crop plant. The basis of the valuation distinguishes and selects improved T-type genomic regions for use in a breeding method, and selects and advances plants comprising the improved T-type genomic regions. The genomic locations for gene integration are favorable based on providing suitable levels of stable expression of an introduced gene, or genes, and for identifying transgene associations with favorable haplotype regions that also provide beneficial agronomic characteristics to the germplasm. By considering the beneficial aspects of both the transgene and the genomic region to which it is genetically linked, additional value can be built into a transgenic event and its use for developing superior germplasm. In an unexpected outcome from extensive experience in breeding with transgenic plants, the inventors have realized that additional consideration should be given to the genomic region that is linked to the transgene insertion. As a transgene is diffused by breeding methods into plant germplasm a portion of the genetic region linked to the transgene is also diffused. By giving consideration to the genetic region linked to a transgene it is possible to implement biotechnological and breeding strategies to increase the overall value of the transgene and the genetic region to which it is linked to enhance germplasm improvement and minimize the risk of advancement of less favorable genetic regions, often referred to as linkage drag.
  • For example, in one aspect of the present invention, T-type genomic regions of new glyphosate tolerant soybean events have been identified that comprise a glyphosate tolerance transgene with suitable levels of expression in linkage with a haplotype. The highest yielding T-type was identified as event 19788 (also referred to as MON89788) and provided for the replacement of the T-type genomic region of event 40-3-2 with a haplotype in the same genomic region with improved yield as determined in a side-by-side comparison. This finding will have significant impact on enhancing the germplasm of glyphosate tolerant soybean. A significant portion of recent soybean breeding has utilized lines containing the Roundup Ready® trait found in event 40-3-2 (Padgette et al., 1995), with possibly as much as 80-95% of the soybean germplasm offered for sale in the United States currently containing this transgenic event. In order to continue to enhance soybean germplasm, it is desirable to be able to identify glyphosate tolerant events that also have favorable haplotype genomic regions and replace the 40-3-2 T-type genomic region in the germplasm, therefore providing elite agronomic traits of the parental line to the progeny.
  • In another aspect of the present invention, T-type genomic regions of insect tolerant soybean events are identified that comprise an insect resistance transgene with suitable levels of expression in linkage with a haplotype. The event GM19459 was selected from a population of transgenic soybean events. These events contain a transgene inserted into the soybean genome that expresses a protein toxic to Lepidopteran insect pests of soybean. The various haplotype genomic regions have been mapped to assist in the selection of an event with the most favorable T-type genomic region.
  • In another aspect of the present invention, T-type genomic regions of insect tolerant corn events are identified that comprise an insect resistance transgene with suitable levels of expression in linkage with a haplotype. The insect tolerant corn event is selected from a population of transgenic corn events. These events contain a transgene inserted into the corn genome that expresses a protein toxic to Lepidopteran insect pests of corn. The various haplotype genomic regions are mapped to assist in the selection of an event with the most favorable T-type genomic region.
  • Any transgene inserted into the genome of a crop plant that can be mapped to a genomic location can then be compared to a haplotype marker developed in that location to determine if the location comprises a haplotype with an enhanced breeding value.
  • In one embodiment, the current invention provides genetic markers and methods for the identification and breeding of T-type genomic regions in soybean. The invention therefore allows for the first time the creation of soybean plants that combine the value of a transgene and an agronomically elite, or favorable haplotype. Favorable haplotypes are at least identified as those that have been inherited more frequently than expected in a plant population. Using the methods of the present invention, loci comprising a T-type genomic region may be introduced into potentially any desired soybean plant. Molecular markers are provided that when used in a marker assisted breeding program provide a means to identify and maintain the association of the favorable haplotype and the transgene to provide the valuable T-type genomic region. The present invention provides examples of transgenes that provide herbicide and insect resistant phenotypes to the soybean plants, other transgenes that provide stress tolerance, disease tolerance, enhanced protein, oil, amino acid or other feed quality, nutrition or processing traits are also contemplated as aspects of the present invention and germplasm comprising these T-types would be crossed to provide a stacked trait product with preferred T-type genomic regions.
  • In another embodiment, the current invention provides genetic markers and methods for the identification and breeding of T-type genomic regions in corn. The invention therefore allows for the first time the creation of corn plants that combine the value of a transgene and an agronomically elite, or favorable haplotype. Using the methods of the present invention, loci comprising a T-type genomic region may be introduced into potentially any desired corn plant. Molecular markers are provided that when used in a marker assisted breeding program provide a means to identify and maintain the association of the favorable haplotype and the transgene to provide the valuable T-type genomic region. The present invention provides examples of transgenes that provide an insect resistant phenotype to the corn plant, other transgenes that provide stress tolerance, herbicide tolerance, enhanced protein, oil, amino acid or other feed quality, nutrition or processing traits are also contemplated as aspects of the present invention and germplasm comprising these T-type would be crossed to provide a stacked trait product with preferred T-type genomic regions.
  • T-type Genomic Region and the Concept of T-type Value
  • A T-type genomic region is a novel genetic composition comprising at least one transgene, with suitable levels of expression, in genetic linkage with a haplotype. In a preferred embodiment the linkage of a transgene with a haplotype should have no observable deleterious effect on the functional integrity of the haplotype due to the local insertion of the transgene. Additionally a haplotype of a T-type genomic region could be functionally enhanced as a result of the integration into genetic linkage of a transgene. The T-type genomic region composition has the benefit of the transgene and the haplotype with which it is linked. The T-type genomic region is the genetic composition through which a transgene is diffused into germplasm by breeding.
  • In a preferred embodiment of the present invention, a haplotype of a T-type genomic region comprises at least two biallelic markers approximately 10 cM apart, or at least one pluriallelic locus within 5 cM of the transgene and with high polymorphic information content. Changes in a haplotype, brought about by recombination for example, may result in the modification of a haplotype so that it only comprises a portion of the original (parental) haplotype physically linked to the transgene. Any such change in a haplotype would be included in our definition of what constitutes a T-type genomic region so long as the functional integrity of the T-type genomic region is unchanged or improved. The linkage of the transgene to the haplotype or functional portion thereof that provides the desirable phenotype is preferably within about 5 cM, or within about 2 cM, or within about 1 cM of the haplotype region. The functional integrity of a haplotype is considered to be unchanged if its value is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm (breeding germplasm, breeding population, collection of elite inbred lines, population of random mating individuals, biparental cross), or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germplasm can be taken as evidence of its high value, or any combination of these.
  • The benefit or value of the plant comprising in its genome a T-type genomic region is estimated by a T-value, which depends on the value of the transgene trait and the value of the haplotype to which the transgene is linked. The value of a transgene of a T-type genomic region can be estimated from the value of the trait that the transgene encodes. This value depends on the transgene trait (for example, including but not limited to: herbicide tolerance, insect resistance, disease resistance, improved nutrition, enhanced yield, improved processing trait, or stress tolerance) and could be estimated from increased crop plant output, or decrease in inputs required for crop cultivation, or any combination of these. The transgene trait also has value as a selectable or scorable marker. This has value in breeding applications to one skilled in the art because the ability to select or score for the transgene trait results in the simultaneous selection of the linked haplotype. For example in the case of a cross made with a plant comprising a T-type, wherein the transgene encodes a herbicide tolerance, spraying the progeny of that cross with the herbicide would have a high probability of selecting for the transgene and the tightly linked parental or recombinant haplotype. DNA markers that are developed to define the haplotype can be used to confirm the integrity of the T-type in the progeny of the cross.
  • A transgene comprising a recombinant construct may further comprise a selectable marker or scorable marker. The nucleic acid sequence serving as the selectable or scorable marker functions to produce a phenotype in cells which facilitates their identification relative to cells not containing the marker.
  • Examples of selectable markers include, but are not limited to, a neo or nptII gene (Potrykus et al., 1991), which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc.; a bar gene which codes for bialaphos resistance; glyphosate resistant EPSP synthase, glyphosate resistant mutant EPSP synthase (Hinchee et al., 1988) which encodes glyphosate resistance, glyphosate inactivating enzymes; a nitrilase gene which confers resistance to bromoxynil (Stalker et al., 1988); a mutant acetolactate synthase gene (ALS) which confers imidazolinone or sulphonylurea resistance (European Patent Application No. 0154204); and a methotrexate resistant DHFR gene (Thillet et al., 1988).
  • Other exemplary scorable markers include: a β-glucuronidase or uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known (Jefferson, 1987; Jefferson et al., 1987); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al., 1988); a β-lactamase gene (Sutcliffe et al., 1978), which encodes an enzyme for which various chromogenic substrates are known (e.g., PADAC, a chromogenic cephalosporin); a luciferase gene (Ow et al., 1986); a xylE gene (Zukowsky et al., 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an β-amylase gene (Ikatu el al., 1990); a tyrosinase gene (Katz et al., 1983), which encodes an enzyme capable of oxidizing tyrosine to DOPA and dopaquinone (which in turn condenses to melanin); and an P-galactosidase, which will turn a chromogenic β-galactose substrate.
  • Included within the terms “selectable or scorable markers” are also genes that encode a secretable marker whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers that encode a secretable antigen that can be identified by antibody interaction, or even secretable enzymes which can be detected catalytically. Selectable secreted marker proteins fall into a number of classes, including small, diffusible proteins which are detectable, (e.g., by ELISA), small active enzymes which are detectable in extracellular solution (e.g., β-amylase, β-lactamase, phosphinothricin transferase), or proteins which are inserted or trapped in the cell wall (such as proteins which include a leader sequence such as that found in the expression unit of extension or tobacco PR-S). Other possible selectable marker genes will be apparent to those of skill in the art.
  • A marker is preferably GUS, green fluorescent protein (GFP), neomycin phosphotransferase II (nptII), luciferase (LUX), an antibiotic resistance gene coding sequence, or an herbicide resistance gene coding sequence. The selectable agent can be an antibiotic, for example including but not limited to, kanamycin, hygromycin, or a herbicide, for example including but not limited to, glyphosate, glufosinate, 2,4-D, and dicamba.
  • The T-type genomic region has a value in marker-assisted selection and marker-assisted breeding applications. Selection for a transgene and a favorable haplotype in the case where they comprise a T-type genomic region requires only one marker, whereas at least two markers would be required if the transgene and favorable haplotype are unlinked. This potential value would increase as more T-type genomic regions are accumulated or stacked together in a germplasm.
  • The T-value can be changed or modified by changing expression of the transgene, wherein a change is brought about at the level of transgene expression, or in the timing of transgene expression, or in the localization of transgene expression, or any combination of these. It is anticipated by this invention that the change in T-value brought by a change in any of the components of transgene expression could be effected through cis-acting (local) or trans-acting (can act at a distance not simply on the DNA molecule in which they occur) factors, or a combination of these.
  • Additionally, the T-value can be changed or modified by changing the haplotype with which the transgene is tightly linked. A preferred embodiment of the present invention is the improvement of the T-value by selecting or directing the transgene of an existing T-type genomic into tight linkage with a different recipient haplotype, wherein the different haplotype is associated with additional value and improved with respect to an agronomic trait or a multiple trait index over the existing T-type haplotype as determined in a side-by-side or head-to-head comparison. A change in the haplotype could also be brought about by generating or selecting for at least one recombinant T-type haplotype that is improved with respect to an agronomic trait or a multiple trait index over the existing T-type haplotype as determined in a replicated side-by-side or head-to-head comparison.
  • Another preferred embodiment of the present invention is to build additional value into a new or novel transgene event by selecting or directing the transgene into linkage with a recipient haplotype that has a breeding value that is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or alleles conferring agronomic fitness to a crop plant or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germplasm can be taken as evidence of its high value, or any combination of these.
  • Another embodiment of the present invention is a selection of a plant or line for transformation with at least a first transgene, wherein the selection of the plant or line is based on it comprising in its genome a high proportion of recipient haplotypes that have a breeding value that is not negative with respect to yield, or is not positive with respect to maturity, or is null with respect to maturity, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment in a set of germplasm, or amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome in a set of germplasm, or alleles conferring agronomic fitness to a crop plant or the haplotype being present with a frequency of 50 percent or more in a breeding population or a set of germplasm can be taken as evidence of its high value, or any combination of these.
  • This invention anticipates an accumulating or stacking of T-type genomic regions into plants or lines by addition of transgenes by transformation, or by crossing parent plants or lines containing different T-type genomic regions, or any combination of these. The value of the accumulated or stacked T-type genomic regions can be estimated by a composite T-value, which depends on a combination of the value of the transgene traits and the value of the haplotype(s) to which the transgenes are linked. The present invention further anticipates that the composite T-value can be improved by modifying the components of expression of one or each of the stacked transgenes. Additionally, the present invention anticipates that additional value can be built into the composite T-value by selection of at least one recipient haplotype with a favorable breeding value to which one or any of the transgenes are linked, or by selection of plants or lines for stacking transgenes by transformation or by breeding or by any combination of these.
  • Transgenic crops for which a method of the present invention can be applied include, but are not limited to herbicide tolerant crops, for example, Roundup Ready® Cotton 1445 and 88913; Roundup Ready® corn GA21, nk603, MON802, MON809; Roundup Ready® Sugar beet GTSB77 and H7-1; Roundup Ready® Canola RT73 and GT200; oilseed rape ZSR500, Roundup Ready® Soybean 40-3-2, MON89788-containing soybean, Roundup Ready® Bentgrass ASR368, HCN10, HCN28 and HCN92 canola, MS1 and RF1 canola, OXY-235 canola, PHY14, PHY35 and PHY36 canola, RM3-3, RM3-4 and RM3-6 chicory, A2704-12, A2704-21, A5547-35, A5547-127 soybean, GU262 soybean, W62 and W98 soybean, 19-51A cotton, 31807 and 31808 cotton, BXN cotton, FP967 flax, LLRICE06 and LLRICE62 rice, MON71800 wheat, 676 and 678 and 680 corn, B16 corn, Bt11 corn, CBH-351 corn, DAS-06275-8 corn, DBT418 corn, MS3 and MS6 corn, T14 and T25 corn, H177 corn, and TC1507 corn. Herbicides for which transgenic plant tolerance has been demonstrated and the method of the present invention can be applied, include but are not limited to: glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, dalapon, dicamba, 2,4-D, cyclohezanedione, protoporphyrinogen oxidase inhibitors, and isoxaflutole herbicides. Polynucleotide molecules encoding proteins involved in herbicide tolerance are known in the art, and include, but are not limited to a polynucleotide molecule encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) described in U.S. Pat. No. 5,627,061, U.S. Pat. No. 5,633,435, U.S. Pat. No. 6,040,497 and in U.S. Pat. No. 5,094,945 for glyphosate tolerance, all of which are hereby incorporated by reference; polynucleotides encoding a glyphosate oxidoreductase, glyphosate-N-acetyl transferase, or glyphosate decarboxylase (GOX, U.S. Pat. No. 5,463,175; GAT, US Patent publications 20030083480 and 20050246798; glyphosate decarboxylase, US Patent publications 20060021093; 20060021094; 20040177399, herein incorporated by reference in their entirety); a polynucleotide molecule encoding bromoxynil nitrilase (Bxn) described in U.S. Pat. No. 4,810,648 for bromoxynil tolerance, which is hereby incorporated by reference; a polynucleotide molecule encoding phytoene desaturase (crtI) described in Misawa et al, (1993) and Misawa et al, (1994) for norflurazon tolerance; a polynucleotide molecule encoding acetohydroxyacid synthase (AHAS, aka ALS) described in Sathasiivan et al. (1990) for tolerance to sulfonylurea herbicides; and the bar gene described in DeBlock, et al. (1987) for glufosinate and bialaphos tolerance; resistant hydroxyphenyl pyruvate dehydrogenase (HPPD, U.S. Pat. No. 6,768,044). A promoter of a transgene of the present invention can express genes that encode for phosphinothricin acetyltransferase, glyphosate resistant EPSPS, aminoglycoside phosphotransferase, hydroxyphenyl pyruvate dehydrogenase, hygromycin phosphotransferase, neomycin phosphotransferase, dalapon dehalogenase, bromoxynil resistant nitrilase, dicamba mono-oxygenase, anthranilate synthase, glyphosate oxidoreductase, glyphosate-N-acetyl transferase, or glyphosate decarboxylase.
  • Transgenic crops for which the method of the present invention can be applied include, but are not limited to, insect resistant crops, for example, cotton events, such as MON15985, 281-24-236, 3006-210-23, MON531, MON757, MON1076, and COT102; or corn events, such as MIR604, BT176, BT11, CBH-351, DAS-06275-8, DBT418, MON80100, MON810, MON863, TC1507, MIR152V, 3210M, and 3243M. Insect resistant transgenic crops can provide tolerance to insect pest feeding damage and have been shown to be effective against certain Lepidopterans, and Coleopterans plant pests, and other transgenic crops that may also provide resistance to plant pests such as, certain members of Hemiptera, Homoptera, Heteroptera, Orthoptera, Thysanoptera, and plant parasitic nematodes. Disease resistant transgenic crops, for example, virus resistant papaya 55-1/63-1, and virus resistant squash CZW-3 and ZW20. Male sterility transgenic crops, for example, PHY14, PHY35 and PHY36 canola and corn events 676, 678, 680, MS3 and MS6. Additional transgenic crop plants may also provide resistance to fungal and bacterial organisms that cause plant disease.
  • The present invention contemplates the above listed transgenic crops and germplasm comprising the T-type genomic regions for use in breeding and stacking of T-type genomic regions, or haplotypes identified by an indirect mapping method, or any combination of these to increase T-type value or to enhance overall germplasm quality as described in the methods of the present invention.
  • Haplotypes A “haplotype” is a segment of DNA in the genome of an organism that is assumed to be identical by descent for different individuals when the knowledge of identity by state at one or more loci is the same in the different individuals, and that the regional amount of linkage disequilibrium in the vicinity of that segment on the physical or genetic map is high. A haplotype can be tracked through populations and its statistical association with a given trait can be analyzed. Thus, a haplotype association study allows one to define the frequency and the type of the ancestral carrier haplotype. An “association study” is a genetic experiment where one tests the level of departure from randomness between the segregation of alleles at one or more marker loci and the value of individual phenotype for one or more traits. Association studies can be done on quantitative or categorical traits, accounting or not for population structure and/or stratification.
  • A haplotype analysis is important in that it increases the statistical power of an analysis involving individual biallelic markers. In a first stage of a haplotype frequency analysis, the frequency of the possible haplotypes based on various combinations of the identified biallelic markers of the invention is determined. The haplotype frequency is then compared for distinct populations and mapping population. Generally, as a result of prior germplasm improvement, the greater the haplotype frequency in a population of set of germplasm the greater its value has been to the germplasm, described as the alleles associated with agronomic fitness of a crop plant (U.S. Pat. No. 5,437,697, herein incorporated by reference in its entirety). A favorable haplotype can be selected based on its frequency in a set of germplasm, generally a frequency of 50 percent or more would indicate that the haplotype has value in the germplasm. A haplotype that occurs at a high frequency would be favorable for targeting with a transgene or selection of a T-type wherein the haplotype has a high frequency in the germplasm would be considered favorable. A haplotype occurring at any frequency in the germplasm can be correlated to a trait and the haplotype can be given a value based on a single trait or a combination of traits. A favorable haplotype will provide one or more favorable traits to a germplasm. In general, any method known in the art to test whether a trait and a genotype show a statistically significant correlation may be used. Methods for determining the statistical significance of a correlation between a phenotype and a genotype, in this case a haplotype, may be determined by any statistical test known in the art and with any accepted threshold of statistical significance being required. The application of particular methods and thresholds of significance are well with in the skill of the ordinary practitioner of the art.
  • In plant breeding populations, linkage disequilibrium (LD), which is the level of departure from random association between two or more loci in a population, often persists over large chromosomal segments. Although it is possible for one to be concerned with the individual effect of each gene in the segment, for a practical plant breeding purpose, what generally matters is what is the average impact the region has for the trait(s) of interest(s) when present in a line, hybrid or variety. The amount of pair-wise LD (using the r2 statistics) was plotted against the distance in centiMorgans (cM, one hundredth of a Morgan, on average one recombination per meiosis, recombination is the result of the reciprocal exchange of chromatid segment between homologous chromosome paired at meiosis, and it is usually observed through the association of alleles at linked loci from different grandparents in the progeny) between the markers for a reference germplasm set, for example, a set of 791 soybean elite US lines and 1211 SNP loci with a rare allele frequency greater than 5 percent. A 200 data points moving average curve was an indicator of the presence of LD even for loci 10 cM apart. Thus when predicting average effect of chromosome segments, one should consider segments a few centiMorgans long, and this is the acception given to a haplotype region, that is a chromosome segment a few centiMorgans long that persists over multiple generations of breeding and that is carried by one or more breeding lines. This segment can be identified with multiple linked marker loci it contains, and the common haplotype identity at these loci in two lines gives a high degree of confidence of the identity by descent of the entire subjacent chromosome segment carried by these lines.
  • One should specify what the favorable haplotypes are and what their frequency in the germplasm is. Thus, one would obtain or generate a molecular marker survey of the germplasm under consideration for breeding and/or propagation of a transformation event. This marker survey will generate a fingerprint of each line. These markers are assumed to have their approximate genomic map position known. To simplify downstream analyses, quality assurance and missing data estimations steps may need to be implemented at this stage to produce a complete and accurate data matrix (marker genotype by line). Error detections and missing data estimations may require the use of parent-offspring tests, LD between marker loci, interval mapping, re-genotyping, etc.
  • Markers are then grouped based on their proximity. This grouping may be arbitrary (e.g. “start from one end of the chromosome and include all markers that are within 10 cM of the first marker included in the segment, before starting the next segment”) or based on some statistical analysis (e.g. “define segment breakpoints based on LD patterns between adjacent loci”).
  • When a large set of lines is considered, and multiple lines have the same allele at a marker locus, it is needed to ascertain whether identity by state (IBS) at the marker locus is a good predictor of identity by descent (IBD) at the chromosomal region surrounding the marker locus. “Identity by descent” (IBD) characterizes two loci/segment of DNA that are carried by two or more individuals and are all derived from the same ancestor. “Identity by state” (IBS) characterizes two loci/segments of DNA that are carried by two or more individuals and have the same alleles at the observable loci. A good indication that a number of marker loci in a segment are enough to characterize IBD for the segment is that they can predict the allele present at other marker loci within the segment.
  • To estimate the frequency of a haplotype, the base reference germplasm has to be defined (collection of elite inbred lines, population of random mating individuals, etc.) and a representative sample (or the all population) has to be genotyped. The haplotype frequency can then be determined by simple counting if considering a set of inbred individuals. Estimation methods that employ computing techniques like the Expectation/Maximization algorithm will be needed if individuals genotyped are heterozygous at more the one loci in the segment and linkage phase is unknown (Excoffier and Slatkin, 1995). Preferably, a method based on an expectation-maximization (EM) algorithm (Dempster et al. 1977) leading to maximum-likelihood estimates of haplotype frequencies under the assumption of Hardy-Weinberg proportions (random mating) is used (Excoffier and Slatkin, 1995). With the haplotype estimates, and the identity of each chromosome segment for each candidate host line, it is further possible to rank lines according to their probability of giving rise to events located in high value haplotypes. Several probability distributions of an event to be located in a chromosome segment could be used, according to the degree of knowledge acquired on the physical size of each segment and the random or pattern-following mode of insertion of a transgene in the genome. Alternative approaches can be employed to perform association studies: genome-wide association studies, candidate region association studies and candidate gene association studies. The biallelic markers of the present invention may be incorporated in any map of genetic markers of a plant genome in order to perform genome-wide association studies.
  • The present invention comprises methods to detect an association between a haplotype and a favorable property or a multiple trait index. A multiple trait index (MTI) is a numerical entity that is calculated through the combination of single trait values in a formula. Most often calculated as a linear combination of traits or normalized derivations of traits, it can also be the result of more sophisticated calculations (for example, use of ratios between traits). This MTI can then be used in genetic analysis as if it where a trait. A favorable haplotype provides a favorable property to a parent plant and to the progeny of the parent when selected by a marker means or phenotypic means. The method of the present invention provides for selection of favorable haplotypes and the accumulation of favorable haplotypes in a breeding population, for example one or more of the haplotypes identified in the present invention. A particular embodiment of the present invention, a transgene is associated with a favorable haplotype to create a T-type that is accumulated with other favorable haplotypes to enhance a germplasm.
  • Accumulation of T-type Genomic Regions and Favorable Haplotypes
  • Another embodiment of this invention is a method for enhancing accumulation of one or more haplotypes in a germplasm. The transformation of a plant cell with a transgene means that the transgene DNA has been inserted into a genomic DNA region of the plant. Genomic regions defined as haplotype regions include genetic information and provide phenotypic traits to the plant. Variations in the genetic information result in variation of the phenotypic trait and the value of the phenotype can be measured. The genetic mapping of the haplotype regions and genetic mapping of a transgene insertion event allows for a determination of linkage of a transgene insertion with a haplotype. Any transgene that has a DNA sequence that is novel in the genome of a transformed plant can in itself serve as a genetic marker of the transgene and the genomic region in which it has inserted. For example, in the present invention, a transgene that was inserted into the genome of a soybean plant provides for the expression of a glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase that has a DNA coding sequence comprised within SEQ ID NO:28 disclosed in U.S. Pat. No. 6,660,911 and SEQ ID NO:9 disclosed in U.S. Pat. No. 5,633,435, both herein incorporated by reference, from which a DNA primer or probe molecule can be selected to function as a genetic marker for the transgene in the genome.
  • Additionally, a transgene may provide a means to select for plants that have the insert and the linked haplotype region. Selection may be due to tolerance to an applied phytotoxic chemical such as a herbicide or antibiotic. Selection may be due to detection of a product of a transgene, for example, an mRNA or protein product. Selection may be conducted by detection of the transgene DNA inserted into the genome of the plant. A transgene may also provide a phenotypic selection means, such as, a morphological phenotype that is easily to observe, this could be a seed color, seed germination characteristic, seedling growth characteristic, leaf appearance, plant architecture, plant height, and flower and fruit morphology, or selection based on an agronomic phenotype, such as, yield, herbicide tolerance, disease tolerance, insect tolerance, enhance feed quality, drought tolerance, cold tolerance, or any other agronomic trait provided by a transgene.
  • During the development of improved crop plants by insertion of transgenic genes often hundreds of plants are produced with different transgene insertion locations. These insertion events occur throughout the genome of the plant and are incorporated into tight linkage with many different haplotype regions. The present invention provides for the screening of transgenic events that have a transgene insertion into tight linkage with favorable haplotype regions and selection of these events for use in a breeding program to enhance the accumulation of favorable haplotype regions. The method includes: a) inserting a transgene into a genome of a plant cell and regenerating the plant cell into an intact transformed plant using plant transformation and regeneration methods previously described and known in the art of plant biotechnology; and b) determining a map location of the transgene in the genome of the transformed plant using DNA markers of the transgene and linked genomic regions; and c) correlating the map location to a tightly linked haplotype, wherein the transgene and the haplotype comprises a T-type genomic region in the transformed plant; and d) crossing the transformed plant with a second plant that may also be transformed to contain at least one T-type genomic region that is different from the first transformed plant T-type genomic region or the second plant may contain a favorable haplotype region identified by genetic markers that is different from the first transformed plant; and e) selecting at least one progeny plant by detecting expression of the transgene of the first plant or selecting by the presence of a marker associated with the transgene, wherein the progeny plant comprises in its genome at least a portion of the T-type genomic region of the first plant and at least one T-type genomic region or favorable haplotype of the second plant; and f) using the progeny plant in activities related to germplasm improvement the activities selected from the group consisting of using the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING (e.g. McCallum et al., 2000).
  • Using this method, the present invention contemplates that preferred T-type genomic regions are selected from a large population of T-type genomic regions, and the preferred T-type genomic regions have an enhanced T-value in the germplasm of a crop plant. Additionally, the preferred T-type genomic region can be used in the described breeding method to accumulate other beneficial T-type genomic regions and favorable haplotype regions and maintain these in a breeding population to enhance the overall germplasm of the crop plant. Crop plants considered for use in the method include but are not limited to, corn, soybean, cotton, wheat, rice, canola, oilseed rape, sugar beet, sorghum, millet, alfalfa, vegetable crops, forest trees, and fruit crops.
  • Genome Mapping of a T-type Genomic Region
  • Another embodiment of this invention is a method for indirect mapping at least one T-type genomic region. Mapping of the T-type genomic region in the genome of a plant provides for selection of favorable haplotype regions that comprise the T-type genomic region. The present invention provides a method for mapping of the transgene insertion event and its association with a genomic region and location on a genome map of a plant. The method may include the following steps:
      • (a) Obtaining the DNA sequence of the genome flanking the transgene insertion event;
      • (b) Comparing the DNA sequence chromatogram to eliminate paralogous sequences when two or more sequences of high homology are obtained;
      • (c) Searching for the DNA sequence in a sequence database to verify whether the insertion event has interrupted an endogenous gene;
      • (d) Designing one or a plurality of pairs of DNA primer molecules on either or both the 5′ and 3′ genomic regions flanking the transgene insertion. When multiple pairs of primers are designed, it can be done in such a way as to obtain overlapping PCR products from each genomic flanking region to ensure substantial coverage of the associated genomic DNA;
      • (e) Using the parent lines of a mapping population(s) as template for PCR;
      • (f) Sequencing the PCR products obtained from these primers/line combinations;
      • (g) Identifying SNPs, or other polymorphic feature such as indels or SSRs, between the parents of at least one of the mapping populations;
      • (h) Repeating steps (d) through (g) on additional flanking sequence, sliding away from the site of insertion in the 5′ and 3′ directions, until polymorphic sites are found, or to obtain additional ones;
      • (i) Designing an assay to score the progeny plants of the mapping population(s);
      • (j) Perform a linkage analysis to ascertain the map position of these polymorphism and consequently of the location of the event;
      • (k) Correlate map position with the location of a haplotype region.
  • The genome flanking the transgene insertion event can comprise a DNA segment of from a few hundred to tens of thousands of nucleotide base pairs or a sufficient length to identify a polymorphism. The genomic flanking region can be from the 5′ or 3′ end of the transgene insert location extending into the genome from the insert site. The “polymerase chain reaction” (PCR) is a process of in vitro geometrical amplification of a target DNA segment through the use of a heat-resistant DNA polymerase and cyclic variation of temperature to allow for repetitive denaturing, primer annealing and amplification or template DNA. “Paralogous sequences” are two sequences of DNA with a high degree of similarity but belong to different loci on the genome. A “mapping population” is a set of individuals where alleles at marker loci and possibly at one or a plurality of Quantitative Trait Loci (QTL) are segregating, in a way that presence of linkage disequilibrium can be taken of evidence as proximity on the chromosome and there is a positive correlations between proximity and disequilibrium. The mapping population is the same plant species or a plant species demonstrating synteny or colinearity. These populations can be used to estimate the relative positions of marker loci among themselves or between these and QTLs. Generally mapping populations are segregating populations. The method can be applied to any crop species, particular important crop species are, for example, corn, soybean, cotton, wheat, rice, canola, oilseed rape, sugar beet, sorghum, millet, alfalfa, vegetable crops, forest trees, and fruit crops. There are maps available to one skilled in the art for one or more of these crops, by way of example, genetic maps are referenced for maize (Lee et al., 2002), soybean (Ferreira et al., 2000), cotton (Lacape et al., 2003), and canola (Cheung et al., 1997). De novo mapping populations can also be generated for any crop of interest and a genetic map crated that is useful in the present invention to map the haplotype regions in which a transgene has inserted.
  • Identification of cloned genomic DNA regions for example, those contained in a Bac library can be probed with DNA markers developed to identify the haplotype linked with a transgenic insertion. Additional DNA markers can be developed by sequencing the Bac clones and inspecting for polymorphisms in the sequence. Genes of interest can be isolated from the Bac clones that can be used as transgenes to improve the performance of the same crop species or different crop species.
  • Recombinant Vectors and Transgenes
  • Means for preparing recombinant vectors are well known in the art. Methods for making recombinant vectors particularly suited to plant transformation include, without limitation, those described in U.S. Pat. Nos. 4,971,908, 4,940,835, 4,769,061 and 4,757,011. These type of vectors have also been reviewed (Rodriguez et al., 1988; Glick et al., 1993).
  • Typical vectors useful for expression of nucleic acids in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens (Rogers et al., 1987). Other recombinant vectors useful for plant transformation, including the pCaMVCN transfer control vector, have also been described (Fromm et al., 1985). Many crops species have been transformed to contain one or more transgenes of agronomic importance that in themselves provides a favorable property to the plant. One example is a transgene that confers herbicide tolerance to the crop plant. Transgenes that encode herbicide tolerance proteins that have been transformed and expressed in plants include, for example, a 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein conferring glyphosate resistance and proteins conferring resistance to others herbicides, such as glufosinate or bromoxynil (Comai et al., 1985; Gordon-Kamm et al., 1990; Stalker et al., 1988; Eichholtz et al., 1987; Shah et al., 1986; Charest et al., 1990). Further examples include the expression of enzymes such as dihydrofolate reductase and acetolactate synthase, mutant ALS and AHAS enzymes that confer resistance to imidazalinone or a sulfonylurea herbicides (Lee et al., 1988 and Miki et al., 1990), a phosphinothricin-acetyl-transferase conferring phosphinothricin resistance (European application No. 0 242 246), proteins conferring resistance to phenoxy proprionic acids and cycloshexones, such as sethoxydim and haloxyfop (Marshall et al., 1992); and proteins conferring resistance to triazine (psbA and gs+genes) and benzonitrile (nitrilase encoding gene, Przibila et al. (1991).
  • A plant of the present invention may also comprise a transgene that confers resistance to insect, pest, viral, or bacterial attack. For example, a transgene conferring resistance to a pest, such as soybean cyst nematode was described in PCT Application WO96/30517 and PCT Application WO93/19181. Jones et al. (1994) describe cloning of the tomato Cf-9 gene for resistance to Cladosporium fulvum); Martin et al. (1993) describe a tomato Pto gene for resistance to Pseudomonas syringae pv. and Mindrinos et al. (1994) describe an Arabidopsis RSP2 gene for resistance to Pseudomonas syringae. Bacillus thuringiensis endotoxins may also be used for insect resistance, for example, Geiser et al. (1986).
  • The expression of viral coat proteins as transgenes in transformed plant cells is known to impart resistance to viral infection and/or disease development affected by the virus from which the coat protein gene is derived, as well as by related viruses (Beachy et al., 1990).
  • Transgenes may also be used conferring increased nutritional value or another value-added trait. One example is modified fatty acid metabolism, for example, by transforming a plant with an antisense gene of stearoyl-ACP desaturase to increase stearic acid content of the plant, (Knutzon et al., 1992). A sense desaturase gene may also be introduced to alter fatty acid content. Phytate content may be modified by introduction of a phytase-encoding gene to enhance breakdown of phytate, adding more free phosphate to the transformed plant. Modified carbohydrate composition may also be affected, for example, by transforming plants with a gene coding for an enzyme that alters the branching pattern of starch (Shiroza et al., 1988, nucleotide sequence of Streptococcus mutants fructosyltransferase gene); Steinmetz et al. (1985) (nucleotide sequence of Bacillus subtilis levansucrase gene); Pen et al. (1992), production of transgenic plants that express Bacillus lichenifonnis α-amylase); Elliot et al. (1993), nucleotide sequences of tomato invertase genes); Søgaard et al. (1993), site-directed mutagenesis of barley α-amylase gene; and Fisher et al. (1993), maize endosperm starch branching enzyme II.
  • Transgenes may also be used to alter protein metabolism. For example, U.S. Pat. No. 5,545,545 describes lysine-insensitive maize dihydrodipicolinic acid synthase (DHPS), which is substantially resistant to concentrations of L-lysine which otherwise inhibit the activity of native DHPS. Similarly, EP 0640141 describes sequences encoding lysine-insensitive aspartokinase (AK) capable of causing a higher than normal production of threonine, as well as a subfragment encoding antisense lysine ketoglutarate reductase for increasing lysine.
  • A transgene may be employed that alters plant carbohydrate metabolism. For example, fructokinase genes are known for use in metabolic engineering of fructokinase gene expression in transgenic plants and their fruit (U.S. Pat. No. 6,031,154). Further examples of transgenes that may be used are genes that alter grain yield. For example, U.S. Pat. No. 6,486,383 describes modification of starch content in plants with subunit proteins of adenosine diphosphoglucose pyrophosphorylase (“ADPG PPase”). In EP0797673, transgenic plants are discussed in which the introduction and expression of particular DNA molecules results in the formation of easily mobilized phosphate pools outside the vacuole and an enhanced biomass production and/or altered flowering behavior. Still further known are genes for altering plant maturity. U.S. Pat. No. 6,774,284 describes DNA encoding a plant lipase and methods of use thereof for controlling senescence in plants. U.S. Pat. No. 6,140,085 provides FCA genes for altering flowering characteristics, particularly timing of flowering. U.S. Pat. No. 5,637,785 discusses genetically modified plants having modulated flower development such as having early floral meristem development and comprising a structural gene encoding the LEAFY protein in its genome.
  • Genes for altering plant morphological characteristics are also known and may be used in accordance with the invention. U.S. Pat. No. 6,184,440 discusses genetically engineered plants which display altered structure or morphology as a result of expressing a cell wall modulation transgene. Examples of cell wall modulation transgenes include a cellulose binding domain, a cellulose binding protein, or a cell wall modifying protein or enzyme such as endoxyloglucan transferase, xyloglucan endo-transglycosylase, an expansin, cellulose synthase, or a novel isolated endo-1,4-β-glucanase.
  • A transgene that provides a favorable property can be associated with plant morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance. A transgene that provides a beneficial agronomic trait to crop plants may be, for example, include but is not limited to the following examples of genetic elements comprising herbicide resistance (U.S. Pat. No. 5,633,435 and U.S. Pat. No. 5,463,175), increased yield (U.S. Pat. No. 5,716,837), insect control (U.S. Pat. No. 6,063,597; U.S. Pat. No. 6,063,756; U.S. Pat. No. 6,093,695; U.S. Pat. No. 5,942,664; and U.S. Pat. No. 6,110,464), fungal disease resistance (U.S. Pat. No. 5,516,671; U.S. Pat. No. 5,773,696; U.S. Pat. No. 6,121,436; U.S. Pat. No. 6,316,407, and U.S. Pat. No. 6,506,962), virus resistance (U.S. Pat. No. 5,304,730 and U.S. Pat. No. 6,013,864), nematode resistance (U.S. Pat. No. 6,228,992), bacterial disease resistance (U.S. Pat. No. 5,516,671), starch production (U.S. Pat. No. 5,750,876 and U.S. Pat. No. 6,476,295), modified oils production (U.S. Pat. No. 6,444,876), high oil production (U.S. Pat. No. 5,608,149 and U.S. Pat. No. 6,476,295), modified fatty acid content (U.S. Pat. No. 6,537,750), high protein production (U.S. Pat. No. 6,380,466), fruit ripening (U.S. Pat. No. 5,512,466), enhanced animal and human nutrition (U.S. Pat. No. 5,985,605 and U.S. Pat. No. 6,171,640), biopolymers (U.S. Pat. No. 5,958,745 and U.S. Patent Publication US20030028917), environmental stress resistance (U.S. Pat. No. 6,072,103), pharmaceutical peptides (U.S. Pat. No. 6,080,560), improved processing traits (U.S. Pat. No. 6,476,295), improved digestibility (U.S. Pat. No. 6,531,648) low raffinose (U.S. Pat. No. 6,166,292), industrial enzyme production (U.S. Pat. No. 5,543,576), improved flavor (U.S. Pat. No. 6,011,199), nitrogen fixation (U.S. Pat. No. 5,229,114), hybrid seed production (U.S. Pat. No. 5,689,041), and biofuel production (U.S. Pat. No. 5,998,700), the genetic elements, methods, and transgenes described in the patents listed above are hereby incorporated by reference.
  • Alternatively, a transcribable polynucleotide molecule can effect the above mentioned plant characteristic or phenotype by encoding a RNA molecule that causes the targeted inhibition of expression of an endogenous gene, for example via antisense, inhibitory RNA (RNAi), or cosuppression-mediated mechanisms. The RNA could also be a catalytic RNA molecule (i.e., a ribozyme) engineered to cleave a desired endogenous mRNA product. Certain RNA molecules can also be expressed in plant cells that inhibit targets in organisms other than plants, for example, insects that feed on the plant cells and ingest the inhibitory RNA, or nematodes that feed on plant cells and ingest the inhibitory RNA. Thus, any transcribable polynucleotide molecule that encodes a transcribed RNA molecule that affects a phenotype or morphology change of interest may be useful for the practice of the present invention.
  • Breeding and Markers
  • Breeding techniques take advantage of a plant's method of pollination. There are two general methods of pollination: self-pollination, which occurs if pollen from one flower is transferred to the same or another flower of the same plant, and cross-pollination, which occurs if pollen comes to it from a flower on a different plant. Plants that have been self-pollinated and selected for type over many generations become homozygous at almost all gene loci and produce a uniform population of true breeding progeny, homozygous plants.
  • In development of suitable varieties, pedigree breeding may be used. The pedigree breeding method for specific traits involves crossing two genotypes. Each genotype can have one or more desirable characteristics lacking in the other; or, each genotype can complement the other. If the two original parental genotypes do not provide all of the desired characteristics, other genotypes can be included in the breeding population. Superior plants that are the products of these crosses are selfed and are again advanced in each successive generation. Each succeeding generation becomes more homogeneous as a result of self-pollination and selection. Typically, this method of breeding involves five or more generations of selfing and selection: S1→S2; S2→S3; S3→S4; S4→S5, etc. A selfed generation (S) may be considered to be a type of filial generation (F) and may be named F as such. After at least five generations, the inbred plant is considered genetically pure.
  • Each breeding program should include a periodic, objective evaluation of the efficiency of the breeding procedure. Evaluation criteria vary depending on the goal and objectives. Promising advanced breeding lines are thoroughly tested and compared to appropriate standards in environments representative of the commercial target area(s) for generally three or more years. Identification of individuals that are genetically superior because genotypic value can be masked by confounding plant traits or environmental factors. One method of identifying a superior plant is to observe its performance relative to other experimental plants and to one or more widely grown standard varieties. Single observations can be inconclusive, while replicated observations provide a better estimate of genetic worth.
  • Mass and recurrent selections can be used to improve populations of either self-or cross-pollinating crops. A genetically variable population of heterozygous individuals is either identified or created by intercrossing several different parents. The best plants are selected based on individual superiority, outstanding progeny, or excellent combining ability. The selected plants are intercrossed to produce a new population in which further cycles of selection are continued. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in one of several reference books (Allard, 1960; Simmonds, 1979; Sneep and Hendriksen, 1979; Fehr, 1987; Fehr, 1987).
  • The effectiveness of selecting for genotypes with enhanced traits of interest (for example, a favorable property such as yield of a harvested plant product, for example yield of a grain, seed, fruit, fiber, forage; or an agronomic trait, for example, pest resistance such as disease resistance, insect resistance, nematode resistance, or improved growth rate, and stress tolerance; or an improved processed product of the plant, for example, fatty acid profile, amino acid profile, nutritional content, fiber quality) in a breeding program will depend upon: 1) the extent to which the variability in the traits of interest of individual plants in a population is the result of genetic factors and is thus transmitted to the progenies of the selected genotypes; and 2) how much the variability in the traits of interest among the plants is due to the environment in which the different genotypes are growing. The inheritance of traits ranges from control by one major gene whose expression is not influenced by the environment (i.e., qualitative characters) to control by many genes whose effects are greatly influenced by the environment (i.e., quantitative characters). Breeding for quantitative traits such as yield is further characterized by the fact that: 1) the differences resulting from the effect of each gene are small, making it difficult or impossible to identify them individually; 2) the number of genes contributing to a character is large, so that distinct segregation ratios are seldom, if ever, obtained; and 3) the effects of the genes may be expressed in different ways based on environmental variation. Therefore, the accurate identification of transgressive segregates or superior genotypes with the traits of interest is extremely difficult and its success is dependent on the plant breeder's ability to minimize the environmental variation affecting the expression of the quantitative character in the population.
  • The likelihood of identifying a transgressive segregant is greatly reduced as the number of traits combined into one genotype is increased. Consequently, all the breeder can generally hope for is to obtain a favorable assortment of genes for the first complex character combined with a favorable assortment of genes for the second character into one genotype in addition to a selected gene.
  • Introgression of a particular genomic region in a set of genomic regions that contain a transgene, or transgenes into a plant germplasm is defined as the result of the process of backcross conversion. A plant germplasm into which a novel DNA sequence has been introgressed may be referred to as a backcross converted genotype, line, inbred, or hybrid. Additionally, an introgression of a particular genomic region or transgene may be conducted by a forward breeding process. Similarly a plant genotype lacking the desired DNA sequence may be referred to as an unconverted genotype, line, inbred, or hybrid. During breeding, the genetic markers linked to a T-type genomic region may be used to assist in breeding for the purpose of producing soybean plants with increased yield and a transgenic trait. Backcrossing and marker-assisted selection, or forward breeding and marker-assisted selection in particular can be used with the present invention to introduce the T-type genomic region into any variety by conversion of that variety.
  • In another embodiment of this invention marker sequences are provided that are genetically linked and can be used to follow the selection of the soybean or corn haplotypes. Genomic libraries from multiple corn or soybean lines are made by isolating genomic DNA from different corn or soybean lines by Plant DNAzol Reagent” from Life Technologies now Invitrogen (Invitrogen Life Technologies, Carlsbad, Calif.). Genomic DNA are digested with Pst 1 endonuclease restriction enzyme, size-fractionated over 1 percent agarose gel and ligated in plasmid vector for sequencing by standard molecular biology techniques as described in Sambrook et al. These libraries are sequenced by standard procedures on ABI Prism®377 DNA Sequencer using commercially available reagents (Applied Biosystems, Foster City, Calif.). All sequences are assembles to identify non-redundant sequences by Pangea Clustering and Alignment Tools that is available from DoubleTwist Inc., Oakland, Calif. Sequence from multiple corn or soybean lines are assembled into loci having one or more polymorphisms, such as SNPs and/or Indels. Candidate polymorphisms are qualified by the following parameters:
      • (a) The minimum length of a contig or singleton for a consensus alignment is 200 bases.
      • (b) The percentage identity of observed bases in a region of 15 bases on each side of a candidate SNP is at least 75 percent.
      • (c) The minimum Phred quality in each contig at a polymorphism site is 35.
      • (d) The minimum Phred quality in a region of 15 bases on each side of the polymorphism site is 20.
  • Read data from automated sequencers varies significantly in quality due to the nature of nucleotides in a polynucleotide molecule and number of other reasons (Ewing et al., 1998). Many algorithms were developed to address the issue of accurate base pair calling (Giddings et al., 1993; Berno, 1996; Lawrence and Solovyev, 1994). The most widely used algorithm calculates the quality of the sequence as “q” in equation q=×−10×log 10(p), where p is the estimated error probability of that base call (Ewing and Green, 1998). Thus a base call having a probability of 1/1000 of being incorrect in a particular sequence is assigned a quality score of 30. Quality scores are also referred as “Phred Scores”.
  • Selection of Plants using Marker-Assisted Selection
  • A primary motivation for development of molecular markers in crop species is the potential for increased efficiency in plant breeding through marker-assisted selection (MAS). Genetic marker alleles (an “allele” is an alternative sequence at a locus) are used to identify plants that contain a desired genotype at multiple loci, and that are expected to transfer the desired genotype, along with a desired phenotype to their progeny. Genetic marker alleles can be used to identify plants that contain desired genotype at one marker locus, several loci, or a haplotype, and that would be expected to transfer the desired genotype, along with a desired phenotype to their progeny.
  • Marker-assisted selection comprises the mapping of phenotypic traits and relies on the ability to detect genetic differences between individuals. A “genetic map” is the representation of the relative position of characterized loci (DNA markers or any other locus for which allele can be identified) along the chromosomes. The measure of distance is relative to the frequency of crossovers event between sister chromatids at meiosis. The genetic differences, or “genetic markers” are then correlated with phenotypic variations using statistical methods. In a preferred case, a single gene encoding a protein responsible for a phenotypic trait is detectable directly by a mutation which results in the variation in phenotype. More commonly, multiple genetic loci each contribute to the observed phenotype.
  • The presence and/or absence of a particular genetic marker allele in the genome of a plant exhibiting a favorable phenotypic trait is made by any method listed above using markers, for example, DNA markers are Restriction Fragment Length Polymorphisms (RFLP), Amplified Fragment Length Polymorphisms (AFLP), Simple Sequence Repeats (SSR), Single Nucleotide Polymorphisms (SNP), Insertion/Deletion Polymorphisms (Indels), Variable Number Tandem Repeats (VNTR), and Random Amplified Polymorphic DNA (RAPD), and others known to those skilled in the art. If the nucleic acids from the plant are positive for a desired genetic marker, the plant can be selfed to create a true breeding line with the same genotype, or it can be crossed with a plant with the same marker or with other desired characteristics to create a sexually crossed hybrid generation. Methods of marker-assisted selection (MAS) using a variety of genetic markers are provided. Plants selected by MAS using the methods are provided.
  • Marker-assisted introgression involves the transfer of a chromosome region defined by one or more markers from one germplasm to a second germplasm. The initial step in that process is the localization of the genomic region or transgene by gene mapping, which is the process of determining the position of a gene or genomic region relative to other genes and genetic markers through linkage analysis. The basic principle for linkage mapping is that the closer together two genes are on a chromosome, then the more likely they are to be inherited together. Briefly, a cross is generally made between two genetically compatible but divergent parents relative to traits under study. Genetic markers can then be used to follow the segregation of traits under study in the progeny from the cross, often a backcross (BCl), F2, or recombinant inbred population.
  • The selection of a suitable recurrent parent is an important step for a successful backcrossing procedure. The goal of a backcross protocol is to alter or substitute a trait or characteristic in the original inbred. To accomplish this, one or more loci of the recurrent inbred is modified or substituted with the desired gene from the nonrecurrent (donor) parent, while retaining essentially all of the rest of the desired genetic, and therefore the desired physiological and morphological, constitution of the original inbred. The choice of the particular donor parent will depend on the purpose of the backcross. The exact backcrossing protocol will depend on the characteristic or trait being altered to determine an appropriate testing protocol. It may be necessary to introduce a test of the progeny to determine if the desired characteristic has been successfully transferred. In the case of the present invention, one may test the progeny lines generated during the backcrossing program as well as using the marker system described herein to select lines based upon markers rather than visual traits, the markers are indicative of the preferred T-type genomic region or a genomic region comprising a favorable haplotype.
  • Transformed Plants and Plant Cells
  • As used herein, the term “transformed” refers to a cell, tissue, organ, or organism into which has been introduced a foreign polynucleotide molecule, such as a construct. The introduced polynucleotide molecule may be integrated into the genomic DNA of the recipient cell, tissue, organ, or organism such that the introduced polynucleotide molecule is inherited by subsequent progeny. A “transgenic” or “transformed” cell or organism also includes progeny of the cell or organism and progeny produced from a breeding program employing such a transgenic plant as a parent in a cross and exhibiting an altered phenotype resulting from the presence of a foreign polynucleotide molecule. A plant transformation construct containing a polynucleotide molecule of the present invention may be introduced into plants by any plant transformation method. Methods and materials for transforming plants by introducing a plant expression construct into a plant genome in the practice of this invention can include any of the well-known and demonstrated methods including electroporation as illustrated in U.S. Pat. No. 5,384,253; microprojectile bombardment as illustrated in U.S. Pat. No. 5,015,580; U.S. Pat. No. 5,550,318; U.S. Pat. No. 5,538,880; U.S. Pat. No. 6,160,208; U.S. Pat. No. 6,399,861; and U.S. Pat. No. 6,403,865; Agrobacterium-mediated transformation as illustrated in U.S. Pat. No. 5,824,877; U.S. Pat. No. 5,591,616; U.S. Pat. No. 5,981,840; and U.S. Pat. No. 6,384,301; and protoplast transformation as illustrated in U.S. Pat. No. 5,508,184, all of which are hereby incorporated by reference.
  • Methods for specifically transforming dicots are well known to those skilled in the art. Transformation and plant regeneration using these methods have been described for a number of crops including, but not limited to, cotton (Gossypium hirsutum), soybean (Glycine max), peanut (Arachis hypogaea), alfalfa (Medicago sativa), and members of the genus Brassica.
  • Methods for transforming monocots are well known to those skilled in the art. Transformation and plant regeneration using these methods have been described for a number of crops including, but not limited to, barley (Hordeum vulgarae); maize (Zea mays); oats (Avena sativa); orchard grass (Dactylis glomerata); rice (Oryza sativa, including indica and japonica varieties); sorghum (Sorghum bicolor); sugar cane (Saccharum sp); tall fescue (Festuca arundinacea); turfgrass species (e.g. species: Agrostis stolonifera, Poa pratensis, Stenotaphrum secundatum); and wheat (Triticum aestivum). It is apparent to those of skill in the art that a number of transformation methodologies can be used and modified for production of stable transgenic plants from any number of target crops of interest. Methods for introducing a transgene are well known in the art and include biological and physical, plant transformation protocols. See, for example, Miki et al. (1993). Once a transgene is introduced into a variety it may readily be transferred by crossing. By using backcrossing, essentially all of the desired morphological and physiological characteristics of a variety are recovered in addition to the locus transferred into the variety via the backcrossing technique. Backcrossing and forward breeding methods can be used with the present invention to improve or introduce a characteristic into a plant (Poehlman and Sleper, 1995; Fehr, 1987a, b; Sprague and Dudley, 1988).
  • Site-Specific Integration of Transgenes
  • A number of site-specific recombination-mediated methods have been developed for incorporating transgene into plant genomes, as well as for deleting unwanted genetic elements from plant and animal cells. For example, the cre-lox recombination system of bacteriophage P1, described by Abremski et al. (1983); Sternberg et al. (1981) and others, has been used to promote recombination in a variety of cell types. The cre-lox system utilizes the cre recombinase isolated from bacteriophage P1 in conjunction with the DNA sequences (termed lox sites) it recognizes. This recombination system has been effective for achieving recombination in plant cells (U.S. Pat. No. 5,658,772), animal cells (U.S. Pat. No. 4,959,317 and U.S. Pat. No. 5,801,030), and in viral vectors (Hardy et al., 1997). Targeting and control of insertion or removal of transgene sequences in a plant genome can be achieved by the use of molecular recombination method (U.S. Pat. No. 6,573,425). An introduced polynucleotide molecule comprising a heterologous recombination site incorporated into a haplotype region is within the scope of the prevent invention.
  • Wahl et al. (U.S. Pat. No. 5,654,182) used the site-specific FLP recombinase system of Saccharomyces cerevisiae to delete DNA sequences in eukaryotic cells. The deletions were designed to accomplish either inactivation of a gene or activation of a gene by bringing desired DNA fragments into association with one another. Activity of the FLP recombinase in plants has been demonstrated (Lyznik et al, 1996; Luo et al., 2000).
  • Others have used transposons, or mobile genetic elements that transpose when a transposase gene is present in the same genome, to separate target genes from ancillary sequences. Yoder el al. (U.S. Pat. No. 5,482,852 and U.S. Pat. No. 5,792,924, both of which are incorporated herein by reference) used constructs containing the sequence of the transposase enzyme and the transposase recognition sequences to provide a method for genetically altering plants that contain a desired gene free of vector and/or marker sequences. Other methods that use DNA sequence directed bacteriophage recombinase or transposases to target specific regions are described in US 20020132350 and EP 1308516 (both of which are incorporated herein by reference). Zinc finger endonucleases can be specifically designed to recognize a DNA sequence and can target specific DNA sequences in a genome to create a recombination site useful for the insertion of a transgene (Wright et al., 2005; U.S. Pat. No. 7,030,215; US 20050208489; US 20050064474, herein incorporated by reference in their entirety), for example, targeted to a haplotype comprising the DNA sequences listed in the sequence listing of the present invention and contained in the genome of a corn or soybean plant is contemplated by the inventors.
  • A transgene that contains additional recombination sites when it is a component of a preferred T-type genomic region provides an opportunity to add additional transgenes to the T-type genomic region, thereby increasing the value of the region in a germplasm. The present invention contemplates that the T-type genomic region is also a site for specific recombination activities to remove or add new genetic material to the genomic region.
  • The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.
  • EXAMPLE 1 Identification of Haplotypes
  • This example illustrates identifying soybean haplotypes useful in databases for practicing the methods of this invention. The chromosomes of soybean were divided into haplotypes by following the hereditability of a large set of makers. Allelic forms of the haplotypes were identified for a set of 4 haplotypes which are listed in Table 1. With reference to Table 1, a haplotype mapped to a genomic location is identified by reference, for example C8W6H5 refers to chromosome 8, window 6 in that chromosome and haplotype 5 in that window (genomic region); SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus; START_POS refers to the start position of the marker in the DNA amplicon; HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window.
    TABLE 1
    Summary information of marker loci used to characterize
    four soybean haplotypes associated with the glyphosate
    tolerant soybean events, including the sequence identification
    (SEQ ID and marker ID number) and the position of the
    polymorphism (START POS) being used to characterize alleles
    (HAP ALLELE) in these sequences.
    Other
    START HAP marker
    Haplotype SEQ_ID POS ALLELE states
    C8W6H5 1 962360 277 * G
    2 1324623 785 A T
    3 1271382 239 A G
    C16W8H43 4 1271562 351 A G
    5 894632 193 G C
    6 928368 320 A G
    7 1267271 563 C A
    8 1271614 126 A G
    9 1271496 359 T G
    C18W3H8 10 1271924 603 G A
    11 1267375 741 T C
    12 860401 372 G C
    C19W3H6 13 1271355 283 T C
    14 1271476 546 A C
    15 825651 294 T C
  • EXAMPLE 2 Preparation of a Database with Agronomic Traits and Haplotypes
  • This example illustrates the preparation of a database useful in a method of this invention. With reference to Table 2 the database comprises computed values of agronomic traits, for example, yield, maturity, plant height, and lodging, for the specific allelic soybean haplotypes and the haplotype frequency in a set of breeding lines. Other traits can be measured, for example, yield of a grain, seed, fruit, fiber, forage, oil; or an agronomic trait, for example, pest resistance such as disease resistance, insect resistance, nematode resistance, or improved growth rate, and stress tolerance; or an improved processed product of the plant, for example, fatty acid profile, amino acid profile, nutritional content, fiber quality and a database compiled for the values of each haplotype for these other traits. The agronomic trait values of these haplotypes represent the predicted population change in mean value for the trait listed if the haplotype was fixed in the germplasm, everything else staying the same. The values for “yield” are in bushels of soybeans per acre. The values for “maturity” are in days (maturity of a soybean line is the relative flowering time of that line compared to a set of standard checks of defined maturity). The values for “plant height” are in inches of height measured from the soil surface to the tip of the uppermost plant tissue at maturity. The values of “lodging” are a percent of plants compared to a set of standard checks (lodging is a phenomenon in which the main stem of crop plants has moved from the vertical by a large angle, sometimes to the point of the plants being laying on the ground).
  • The breeding values for each of the haplotypes are used to select the haplotype that in combination with a transgene will be the most beneficial for the improvement of the germplasm of the crop. The breeding value is a combination of measured traits and the estimation of how these traits will affect germplasm improvement. The soybean haplotypes associated with the transgenic events for glyphosate tolerance were measured and the results shown in Table 2. The Haplotype C8W6H5 would be a favorable haplotype for its effect on yield, and haplotype C 18W3H8 would be a favorable haplotype for its very high frequency in the germplasm (94 percent), indicating that little variability is present in the target soy germplasm for this chromosome segment, making the diffusion process of a transgenic event in it neutral. Haplotype C19W3H6 is generally neutral with respect to yield.
    TABLE 2
    The calculated breeding values of four haplotypes described
    for yield, maturity, plant height, and lodging. The frequency
    of the haplotype in the soybean germplasm was estimated
    from a sample of 365 soybean lines.
    Frequency
    Yield Plant in a
    (Bushels/ Maturity height Lodging breeding
    Haplotype acre) (Days) (inches) (%) population
    C8W6H5 1.689 0.989 −0.195 −0.027 21%
    C16W8H43 −0.447 −0.211 −0.514 −0.101 42%
    C18W3H8 0.000 0.000 0.000 0.000 94%
    C19W3H6 −0.071 0.232 −0.495 0.001 58%
  • The haplotype regions were determined for each of the four new glyphosate tolerant soybean events. 17194 is linked to haplotype C16W8H43, 17426 is linked to haplotype C18W3H8, 19703 is linked to haplotype C19W3H6, and 19788 is linked to haplotype C8W6H5. The relative effect of these haplotypes was measured as illustrated in Table 2. This represents the predicted population change in mean value for the trait listed if the haplotype was fixed in the germplasm, everything else staying the same. The T-type of 19788 and the associated C8W6H5 haplotype is the most favorable of the four T-types that were measured. This result demonstrates that it is important in a process to improve crop performance through transgenic methods that both transgenic events and the linked haplotype regions are evaluated to continue to enhance crop productivity.
  • The new glyphosate tolerant events were compared in replicated field trials to a backcross conversion of 40-3-2 into A3244 germplasm. This was demonstrated in replicated field trials including yield data collected from seventeen locations in the United States. The A3244 (U.S. Pat. No. 5,659,114, ATCC number 97549) is an elite soybean germplasm from Asgrow (Monsanto, St Louis, Mo.) that was used as the parent line for transformation to generate the new glyphosate tolerant soybean events 17194, 17426, 19703, and 19788. The results of the yield study showed that 40-3-2 A3244 backcross yielded an average of 60.7 bu/acre, 19788 an average of 65.6 bu/acre, 19703 an average of 65.7 bu/acre, 17426 an average of 65.3 bu/acre, and 17194 an average of 65.8 bu/acre. The four new lines have an approximate yield advantage of 5 bu/acre over the same genotype with the introgressed 40-3-2 T-type genomic region. When the haplotype of each is considered then the most favorable event is 19788.
  • These analyses demonstrate the value of determining the T-type for each transgenic event that is being developed as a commercial product. Failure to consider the agronomic effects of the haplotype region in which the transgene has introgressed can result in the introduction of a low performing event into the germplasm of a crop.
  • EXAMPLE 3 Use of Breeding Values
  • The haplotype regions and breeding values of each were determined for four haplotype regions in which an insect tolerance gene was inserted into the genome of a soybean plant. The relative breeding value for each haplotype regions is shown in Table 3, the definitions of the measurements are the same as described in Example 2. The table is a database for determining the haplotype and its breeding value in which an insect tolerance gene was inserted (a T-type). A transgenic event comprising the T-type is selected using the database information. A particular event, GM19459, contains the T-type of the insect tolerance gene associated with C6W4H1 haplotype that is a favorable haplotype for maturity.
    TABLE 3
    The calculated breeding values for yield, maturity, plant
    height, and lodging of four haplotypes for the insect tolerant
    soybean events. The frequency of the haplotype in the germplasm
    was estimated from 2589 soybean lines.
    Yield Plant
    (Bushels/ Maturity height Lodging Haplotype
    Haplotype acre) (Days) (inches) (%) frequency
    C1W1H2 0.075 0.244 0.057 0.018 16%
    C1W2H1 0.160 0.314 0.069 0.022 67%
    C14W7H2 0.130 0.648 −0.101 −0.069 62%
    C6W4H1 −0.156 −0.111 0.070 29%
  • Allelic forms of the haplotypes were identified for a set of 4 haplotypes associated with transgenic insect resistant soybeans as listed in Table 4. With reference to Table 4, a haplotype mapped to a genomic location is identified by reference, for example C1W1H2 refers to chromosome 1, window 1 in that chromosome and haplotype 2 in that window (genomic region); SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus; START_POS refers to the start position of the marker in the DNA amplicon; HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window; “NA” indicated another marker allele is not present.
    TABLE 4
    Summary information of marker loci used to characterize four soybean
    haplotypes associated with the insect tolerant soybean events, including
    the sequence identification (SEQ ID and marker ID number) and the
    position of the polymorphism (START POS) being used to characterize
    alleles (HAP ALLELE) in these sequences.
    Other
    START HAP marker
    Haplotype SEQ_ID POS ALLELE states
    C1W1H2 16 NS0092678 0 C T
    17 NS0092617 0.4 A G
    18 NS0101549 1.4 A G
    19 NS0127917 1.4 C A
    20 NS0120003 1.8 A T
    21 NS0118494 3 C T
    22 NS0124158 3 A G
    C1W2H1 23 NS0101025 11.3 C T
    24 NS0101038 11.3 A C
    25 NS0127234 11.3 T G
    26 NS0129173 11.3 T A
    27 NS0097228 16.2 C NA
    C14W7H2 28 NS0096079 68.5 T C
    C6W4H1 29 NS0125775 30.3 G C
    30 NS0130788 30.3 T C
    31 NS0093984 32.9 C T
    32 NS0096925 32.9 A *
  • EXAMPLE 4 Application to Corn Breeding
  • This example illustrates the haplotype regions and breeding values that were determined for four haplotype regions in which an insect tolerance gene was inserted into the genome of a corn plant (LH172). The relative breeding value for each haplotype regions is shown in Tabel 5, the definitions of the measurements are the same as described in Example 2. The table is a database for determining the haplotype and its breeding value in which an insect tolerance gene was inserted (a T-type). A transgenic event comprising the T-type is selected using the database information. A particular event contains the T-type of the insect tolerance gene associated with the C1W36H2 haplotype.
    TABLE 5
    Calculated breeding value for yield of four haplotypes for
    insect tolerant corn events. The frequency of the haplotype
    in the germplasm was estimated from 6335 corn lines.
    Haplotype Yield (Bushels/acre) Haplotype frequency
    C1W19H14 0.168 9.2%
    C1W30H4 −0.781 3.3%
    C1W36H2 0.008  18%
    C8W4H5 0.377  15%
  • Allelic forms of the haplotypes were identified for a set of 4 haplotypes for the transgenic insect resistant corn as listed in Table 6. With reference to Table 6, a haplotype mapped to a genomic location is identified by reference, for example C1W19H14 refers to chromosome 1, window 19 in that chromosome and haplotype 14 in that window (genomic region); SEQ_ID provides reference to the sequence listing and the marker ID number is an arbitrary identifying name for a DNA amplicon associated with the a marker locus; START_POS refers to the start position of the marker in the DNA amplicon; HAP allele refers to the nucleotide of an SNP/Indel marker at the Start position where * indicates a deletion of an Indel; “other marker states” identifies another nucleotide allele of markers in the window.
    TABLE 6
    Summary information of marker loci used to characterize
    four corn haplotypes associated with the insect tolerant corn
    events, including the sequence id (SEQ ID and marker ID number)
    and the position of the polymorphism (START POS) being used to
    characterize alleles (HAP ALLELE) in these sequences.
    Other
    START HAP marker
    Haplotype SEQ_ID POS ALLELE states
    C1W19H14 33 NC0053983 109.4 T C
    34 NC0113263 110.1 A G
    35 NC0008901 110.8 T C
    36 NC0143254 110.9 A G
    37 NC0030198 111 A G
    38 NC0080733 111 T G
    39 NC0104474 111 C T
    40 NC0033728 113.3 C A
    41 NC0029506 113.6 C G
    C1W30H4 42 NC0039502 195.5 G A
    43 NC0111626 196.4 T C
    44 NC0008982 198.4 A G
    45 NC0040427 199.4 G T
    46 NC0033427 199.8 G T
    47 NC0148362 200 G A
    C1W36H2 48 NC0146570 237 T G
    49 NC0008996 238.1 A T
    50 NC0013490 240.7 T C
    C8W4H5 51 NC0111628 57.3 A G
    52 NC0026720 58.7 A C
    53 NC0037392 60 C T
    54 NC0027485 60.1 C T
  • EXAMPLE 5 Indirect Mapping of a T-type Genomic Region
  • DNA markers are identified in the genomic region flanking a transgene insert to provide a means to identify the genomic location of the transgene by comparison of the DNA markers to a mapping population. DNA markers can be developed to any transgenic event by isolation of the genomic region, sequencing of the region, isolation of the same region in a mapping population of the crop plant, and determining the location relative to markers known in the mapping population. The association of the transgene with mapped phenotypes, quantitative trait loci comprising a haplotype genomic region can be determined.
  • For example, for MON89788 a DNA primer pair was selected from a DNA sequence that extends into the genome 5′ to the transgene insertion site (SEQ ID NO:55 and 56) and into the 3′ genomic region relative to the transgene insertion site (SEQ ID NO:57-58). A DNA amplification method was used to produce DNA products that comprise a portion of the soybean genome from the 5′ and 3′ regions of the transgene insertion site. These DNA products were sequenced. The same primer pairs were used to amplify DNA from seven soybean lines (507354, Minsoy, Noir, HS1, PIC, 88788, A3244) that are parents of four mapping populations. A single nucleotide polymorphism (SNP) was identified at position 119 (SNP119, SEQ ID NO:59) from the 3′ flanking sequences when comparing sequences across different lines. Table 7 shows the allelic composition at this position on eight lines tested.
    TABLE 7
    Polymorphism at flanking sequences in different
    soybean lines comprising MON89788.
    5′ Flanking 3′ Flanking
    Position 2809 119
    507354 A T
    Minsoy A T
    Noir A T
    HS1 A T
    PIC T C
    88788 T
    A3244 T
    507355 A T
  • A Taqman® (PE Applied Biosystems, Foster City, Calif.) end point assay was developed from SNP119 in accordance to instructions provided by the manufacturer. Primer and probe sequences are given in Table 8. To map the SNP119 polymophism, an F2 population, derived from a cross between HSl×PI407305 (PIC), consisting of 140 individuals, was used. Map position of SNP119 was determined by placing the allelic scores against the existing allelic data set using MapMaker (Lincoln and Lander, 1990). SNP119 was found on linkage group D1a+Q (Song, Q. J., et al., 2004). Thus, MON89788 was indirectly mapped to this same position.
    TABLE 8
    Primer and probe molecules for Taqman assay
    for mapping haplotype
    Forward Primer 19788_3E-119F CGTTCTCGACTTCAACCATATGTGA
    SEQ ID NO:60
    Reverse Primer 19788_3E-119R GCATGGAATAAAGCGGAAAGGAAAG
    SEQ ID NO:61
    VIC Probe 19788_3E-119V2 CCATGGTATCATAGGCA
    SEQ ID NO:62
    Fam Probe 19788_3E-119M2 CCATGGTATCGTAGGCA
    SEQ ID NO:63
  • A deposit of Monsanto Technology LLC, soybean seed comprising event MON89788 disclosed above and recited in the claims, has been made under the Budapest Treaty with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110. The ATCC accession number is PTA-6708 deposited on May 11, 2005. The deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced as necessary during that period. DNA molecules of the present invention can be isolated from the genome of the deposited material and the sequence corrected if necessary, additional DNA molecules for use as probes or primers for the haplotype regions disclosed herein can be isolated from the deposited material.
  • All publications, patents and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
  • All of the compositions and methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.
  • REFERENCES
  • The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.
    • U.S. Pat. No. 4,757,011
    • U.S. Pat. No. 4,769,061
    • U.S. Pat. No. 4,810,648
    • U.S. Pat. No. 4,940,835
    • U.S. Pat. No. 4,959,317
    • U.S. Pat. No. 4,971,908
    • U.S. Pat. No. 5,015,580
    • U.S. Pat. No. 5,094,945
    • U.S. Pat. No. 5,229,114
    • U.S. Pat. No. 5,304,730
    • U.S. Pat. No. 5,384,253
    • U.S. Pat. No. 5,437,697
    • U.S. Pat. No. 5,463,175
    • U.S. Pat. No. 5,482,852
    • U.S. Pat. No. 5,508,184
    • U.S. Pat. No. 5,512,466
    • U.S. Pat. No. 5,516,671
    • U.S. Pat. No. 5,538,880
    • U.S. Pat. No. 5,543,576
    • U.S. Pat. No. 5,545,545
    • U.S. Pat. No. 5,550,318
    • U.S. Pat. No. 5,591,616
    • U.S. Pat. No. 5,608,149
    • U.S. Pat. No. 5,627,061
    • U.S. Pat. No. 5,633,435
    • U.S. Pat. No. 5,637,785
    • U.S. Pat. No. 5,654,182
    • U.S. Pat. No. 5,658,772
    • U.S. Pat. No. 5,659,114
    • U.S. Pat. No. 5,689,041
    • U.S. Pat. No. 5,716,837
    • U.S. Pat. No. 5,750,876
    • U.S. Pat. No. 5,773,696
    • U.S. Pat. No. 5,792,924
    • U.S. Pat. No. 5,801,030
    • U.S. Pat. No. 5,824,877
    • U.S. Pat. No. 5,942,664
    • U.S. Pat. No. 5,958,745
    • U.S. Pat. No. 5,981,840
    • U.S. Pat. No. 5,985,605
    • U.S. Pat. No. 5,998,700
    • U.S. Pat. No. 6,011,199
    • U.S. Pat. No. 6,013,864
    • U.S. Pat. No. 6,031,154
    • U.S. Pat. No. 6,040,497
    • U.S. Pat. No. 6,063,597
    • U.S. Pat. No. 6,063,756
    • U.S. Pat. No. 6,072,103
    • U.S. Pat. No. 6,080,560
    • U.S. Pat. No. 6,093,695
    • U.S. Pat. No. 6,110,464
    • U.S. Pat. No. 6,121,436
    • U.S. Pat. No. 6,140,085
    • U.S. Pat. No. 6,160,208
    • U.S. Pat. No. 6,166,292
    • U.S. Pat. No. 6,171,640
    • U.S. Pat. No. 6,184,440
    • U.S. Pat. No. 6,228,992
    • U.S. Pat. No. 6,316,407
    • U.S. Pat. No. 6,380,466
    • U.S. Pat. No. 6,384,301
    • U.S. Pat. No. 6,399,861
    • U.S. Pat. No. 6,403,865
    • U.S. Pat. No. 6,444,876
    • U.S. Pat. No. 6,476,295
    • U.S. Pat. No. 6,476,295
    • U.S. Pat. No. 6,476,295
    • U.S. Pat. No. 6,486,383
    • U.S. Pat. No. 6,506,962
    • U.S. Pat. No. 6,531,648
    • U.S. Pat. No. 6,537,750
    • U.S. Pat. No. 6,660,911
    • U.S. Pat. No. 6,768,044
    • U.S. Pat. No. 6,774,284
    • U.S. Pat. No. 7,030,215
    • U.S. Publn. 20020132350
    • U.S. Publn. 20030083480
    • U.S. Publn. 20040177399
    • U.S. Publn. 20050064474
    • U.S. Publn. 20050208489
    • U.S. Publn. 20050246798
    • U.S. Publn. 20060021093
    • U.S. Publn. 20060021094
    • U.S. Publn. 20030028917
    • Abremski etal., Cell, 32:1301-1311, 1983.
    • Allard, “Principles of Plant Breeding,” John Wiley Sons, NY, U. of CA, Davis, Calif., 50-98, 1960
    • Beachy et al., Ann. Rev. Phytopathol., 28:451, 1990.
    • Berno, Genome Research, 6:80-91, 1996.
    • Charest et al., Plant Cell Rep., 8:643, 1990.
    • Cheung et al., Theor. Appl. Genet., 94:569-582, 1997.
    • Comai et al., Nature, 317:741-744, 1985.
    • DeBlock, et al., EMBO J., 6:2513-2519, 1987.
    • Dellaporta et al., Stadler Symposium, 11:263-282, 1988.
    • Dempster etal. J R. Stat. Soc., 39B:1-38, 1977.
    • Eichholtz et al., Somatic Cell Mol. Genet., 13:67, 1987.
    • Elliot et al., Plant Molec. Biol., 21:515, 1993.
    • European Appln. 0 242 246
    • European Appln. 0640141
    • European Appln. 0797673
    • European Appln. 1308516
    • European Patent Appln. 0154204
    • Ewing et al., Genome Research, 8:175-185, 1998.
    • Excoffier and Slatkin, Biol. Evol., 12(5):921-927, 1995.
    • Fehr, In: Principles of variety development, Theory and Technique, (Vol 1) and In: Crop Species Soybean (Vol 2), Iowa State Univ., Macmillian Pub. Co., NY, 360-376, 1987b.
    • Fehr, In: Soybeans: Improvement, Production and Uses, 2nd Ed., Manograph., 16:249, 1987a.
    • Ferreira et al., J Hered., 91:392-396, 2000.
    • Fisher et al., Plant Physiol., 102:1045, 1993.
    • Fromm et al., Proc. Natl. Acad. Sci. USA, 82(17):5824-5828, 1985.
    • Geiser et al., Gene, 48:109, 1986.
    • Giddings et al., Nucleic Acid Res., 21:4530-4540, 1993.
    • Glick et al., In: Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Fla., 1993.
    • Gordon-Kamm et al., Plant Cell, 2:603-618, 1990.
    • Hardy et al., J Virology, 71:1842, 1997.
    • Hinchee el al., Bio/Technology, 6:915-922, 1988.
    • Ikatu et al., Bio/Technol., 8:241-242, 1990.
    • Jefferson et al., EMBO J, 6:3901-3907, 1987.
    • Jefferson, Plant Mol. Biol, Rep., 5:387-405, 1987.
    • Jones el al., Science, 266:789, 1994.
    • Katz et al., J Gen. Microbiol., 129:2703-2714, 1983.
    • Knutzon et al., Proc. Natl. Acad. Sci. USA, 89:2624, 1992.
    • Lacape et al., Genome, 46:612-626, 2003.
    • Lawrence and Solovyev; Nucleic Acid Res., 22:1272 1280, 1994.
    • Lee et al., EMBO J, 7:1241, 1988.
    • Lee et al., Plant Mol. Biol., 48: 53-461, 2002.
    • Lewin, In: Genes V, Oxford University Press, NY, 1994.
    • Lincoln and Lander, Mapping Genes Controlling Quantitative Traits Using MAPMAKER/QTL, Whitehead Institute for Biomedical Research, Massachusetts, 1990.
    • Luo et al., Plant J, 23:423-430, 2000.
    • Lyznik et al, Nucleic Acids Res., 24:3784-3789, 1996.
    • Marshall et al., Theor. Appl. Genet., 83:435, 1992.
    • Martin et al., Science, 262:1432, 1993.
    • McCallum et al. (2000) Plant Physiol. 123:439-442, 2000.
    • Miki et al., In: Methods in Plant Molecular Biology and Biotechnology, Glick and Thompson (Eds.), CRC Press, Inc., Boca Raton, 67-88, 1993.
    • Miki et al., Theor. Appl. Genet., 80:449, 1990.
    • Mindrinos et al., Cell, 78:1089, 1994.
    • Misawa et al, Plant J, 4:833-840, 1993.
    • Misawa et al, Plant J, 6:481-489, 1994.
    • Ow et al., Science, 234:856-859, 1986.
    • Padgette et al., Crop Sci., 35:1451-1461, 1995.
    • PCT Appln. W093/19181
    • PCT Appin. W096/30517
    • Pen et al., Bio/Technology, 10:292, 1992.
    • Poehlman and Sleper, In: Breeding Field Crops, Iowa State University Press, Ames, 1995.
    • Potrykus et al., Ann. Rev. Plant Physiol. Plant Mol. Biol., 42: 205, 1991.
    • Przibila et al., Plant Cell, 3:169, 1991.
    • Rieger et al., In: Glossary of Genetics. Classical and Molecular, 5th Ed., Springer-Verlag, NY, 1991.
    • Rodriguez et al., In: Vectors. A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston, 1988.
    • Rogers et al., Methods In Enzymology, 153:253-277, 1987.
    • Sambrook et al.
    • Sathasiivan et al., Nucl. Acids Res., 18:2188-2193, 1990.
    • Shah et al., Science, 233:478, 1986.
    • Shiroza et al., J Bacteol., 170:810, 1988.
    • Simmonds, In: Principles of crop improvement, Longman, Inc., NY, 369-399, 1979.
    • Sneep and Hendriksen, In: Plant breeding perspectives, Wageningen (Ed.), Center for Agricultural Publishing and Documentation, 1979.
    • Søgaard et al., J Biol. Chem., 268:22480, 1993.
    • Song, Q. J., et al, Theor. Appl. Genetics 109:122-128, 2004.
    • Sprague and Dudley, In: Corn and Corn Improvement, 3rd Ed., Crop Science of America, Inc.; Soil Science of America, Inc., Wisconsin. 881-883; 901-918, 1988.
    • Stalker et al., J Biol. Chem., 263:6310-6314, 1988.
    • Stalker et al., Science, 242:419-423, 1988.
    • Steinmetz et al., Mol. Gen. Genet., 20:220, 1985.
    • Stemberg et al. Cold Spring Harbor Symp. Quant. Biol. 45:297-309, 1981.
    • Sutcliffe et al., Proc. Natl. Acad. Sci. USA, 75:3737-3741, 1978.
    • Thillet et al., J Biol. Chem., 263:12500-12508, 1988.
    • Wright et al., Plant Journal, 44:693-705, 2005.
    • Zukowsky et al., Proc. Natl. Acad Sci. USA, 80:1101-1105, 1983.

Claims (37)

1. A method of breeding a transgenic plant comprising the steps of
(a) providing a database identifying a value of at least one agronomic trait for at least two distinct haplotypes of the genome for a set of germplasm;
(b) transforming a parent plant with a recombinant DNA to produce at least two transgenic events, wherein the recombinant DNA is inserted into linkage with the at least two distinct haplotypes of the genome of said parent plant;
(c) referencing the database for the value of said agronomic trait for the events linked to the distinct haplotypes; and
(d) selecting a plant for breeding, said plant comprising the transgenic event having a higher referenced value haplotype.
2. The method of claim 1, wherein the recombinant DNA is selected from the group consisting of DNA encoding a selectable marker, DNA encoding a scorable marker, a DNA recombination site, DNA encoding a protein providing an agronomic enhancement, and DNA for gene suppression.
3. The method of claim 1, wherein said at least one agronomic trait is yield or a multiple trait index.
4. The method of claim 1 wherein said transgenic event selected for breeding has the recombinant DNA linked to a haplotype wherein the haplotype is selected from the group consisting of not negative with respect to yield, not positive with respect to maturity, null with respect to maturity, amongst the favorable 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment, amongst the favorable 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome.
5. The method of claim 1, wherein a progeny plant of the plant selected for breeding is selected by marker-assisted selection.
6. The method of claim 1, wherein a progeny plant of the plant selected for breeding is selected by detection of expression of the transgene or expression of the transgene agronomic trait.
7. The method of claim 1, wherein the plant is a crop plant selected from the group consisting of a forage crop, oilseed crop, grain crop, fruit crop, vegetable crop, fiber crop, spice crop, nut crop, turf crop, sugar crop, beverage crop, and forest crop.
8. The method of claim 7, wherein the oilseed crop is selected from the group consisting of soybean, canola, oil seed rape, oil palm, sunflower, olive, corn, cottonseed, peanut, flaxseed, safflower, and coconut.
9. The method of claim 8, wherein the soybean has in its genome at least one genetic marker that is genetically linked to a haplotype selected from the group consisting of C8W6H5, C18W3H8, C19W3H6, C16W8H43, C1W1H2, C1W2H1, C14W7H2, and C6W4H1; and said haplotype further comprises a linked transgene.
10. The method of claim 9, wherein the genetic marker is a DNA marker selected from the group consisting of SEQ ID NO: 1-32.
11. The method of claim 6, further comprising the step of crossing the progeny plant with a third soybean plant to produce additional progeny plants.
12. The method of claim 7, wherein said grain crop is corn and has in its genome at least one genetic marker that is genetically linked to a haplotype selected from the group consisting of C1W19H14, C1W30H4, C1W36H2 and C8W4H5; and said haplotype further comprises a linked transgene.
13. The method of claim 12, wherein said genetic marker is a DNA marker selected from the group consisting of SEQ ID NO: 33-54.
14. The method of claim 1, wherein the recombinant DNA and the haplotype are linked at a genetic distance of 0 to within about 10 cM.
15. The method of claim 1, wherein the recombinant DNA and the haplotype are linked at a distance of 0 to within about 5 cM.
16. The method of claim 4, wherein a haplotype allele is associated with agronomic fitness or occurs at a frequency of 50 percent or more in a breeding population or a set of germplasm.
17. The method of claim 2, wherein the agronomic enhancement is selected from the group consisting of herbicide tolerance, disease resistance, insect or pest resistance, altered fatty acid, protein or carbohydrate metabolism, increased grain yield, increased oil, altered plant maturity, enhanced stress tolerance, and altered morphological characteristics.
18. The method of claim 17, wherein the herbicide tolerance is selected from the group consisting of glyphosate, glufosinate, sulfonylureas, imidazolinones, bromoxynil, dalapon, dicamba, 2,4-D, cyclohezanedione, protoporphyrinogen oxidase inhibitors, and isoxaflutole tolerance.
19. The method of claim 6, wherein the progeny plant contains at least a portion of the haplotype of the plant selected for breeding wherein the portion is selected from the group consisting of at least 10 cM, at least 5 cM, and at least 1 cM.
20. The method of claim 19, wherein using the progeny plant in activities related to germplasm improvement the activities selected from the group consisting of using the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING.
21. A method for inserting a transgene into a plant haplotype comprising:
(a) incorporating into genetic linkage with a haplotype, a target site comprising at least a first recombination site; and
(b) introducing into a plant cell a transgene expression cassette comprising at least a first recombination site, wherein the first recombination site of the expression cassette flanks a polynucleotide comprising a transgene of interest; and
(c) providing a recombinase that recognizes and implements recombination of the expression cassette at the first recombination site thereby creating a preferred T-type genomic region, wherein the preferred T-type genomic region has an estimated T-type value,
wherein preferred means selected for a haplotype that previously did not contain a transgene or is preferred over a haplotype that previously contained a transgene wherein the haplotype is selected from the group consisting of not negative with respect to yield, is not positive with respect to maturity, null with respect to maturity, amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment, amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome.
22. The method of claim 21, wherein the recombination site is selected from the group consisting of FRT, mutant FRT, LOX, mutant LOX sites, and zinc finger nuclease modified site.
23. The method of claim 21, wherein a haplotype allele is associated with agronomic fitness or occurs at a frequency of 50 percent or more in a breeding population or a set of germplasm.
24. The method of claim 21, wherein the recombinase is cre or flp.
25. A method for mapping at least one T-Type transgene event comprising:
(a) identifying from the flanking sequence surrounding at least a first transgenic event in a transformed plant or line at least a first polymorphism between the parent lines of a mapping population, wherein the transformed plant or line may be different from the parent lines of the mapping population; and
(b) assaying the progeny plants of the mapping population for the polymorphism,
(c) performing a linkage analysis to determine a map position of the polymorphism and thereby a map location of the transgenic event; and
(d) correlating the map location to a haplotype of the transformed plant.
26. A method for enhancing accumulation of one or more T-type genomic regions in a germplasm comprising:
(a) inserting a transgene into a genome of a first plant; and
(b) determining a map location of the transgene in the genome; and
(c) correlating the map location to a haplotype, wherein the transgene and the haplotype comprises a T-type genomic region; and
(d) crossing the first plant with a second plant that contains at least one T-type genomic region or haplotype that is different from the first plant T-type genomic region;
(e) selecting at least one progeny plant by detecting expression of the transgene of the first plant, wherein the progeny plant comprises in its genome at least a portion of the T-type genomic region of the first plant and at least one T-type genomic region or haplotype of the second plant;
(f) using the progeny plant in activities related to germplasm improvement the activities selected from the group consisting of using the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING.
27. A crop plant comprising a preferred T-type genomic region, wherein a transgene of the T-type genomic region is further defined as conferring a trait selected from the group consisting of herbicide tolerance, disease resistance, insect or pest resistance, altered fatty acid, protein or carbohydrate metabolism, increased grain yield, increased oil, altered plant maturity, enhanced stress tolerance, and altered morphological characteristics; and the haplotype of the T-type genomic region is selected from the group consisting of not negative with respect to yield, is not positive with respect to maturity, null with respect to maturity, amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype at the same chromosome segment, amongst the best 50 percent with respect to an agronomic trait or a multiple trait index when compared to any other haplotype across the entire genome.
28. The method of claim 27, wherein a haplotype has a high value if it is present with a frequency of 50 percent or more in a breeding population or a set of germplasm.
29. The crop plant of claim 27, wherein the preferred T-type genomic region comprises a transgene and a haplotype that are genetically linked within a distance of 0 to about 10 cM.
30. The crop plant of claim 27, wherein the preferred T-type genomic region comprises a transgene and a haplotype that are genetically linked within a distance of 0 to about 5 cM.
31. The crop plant of claim 27, wherein said crop plant is a transgenic herbicide tolerant soybean plant and wherein the transgene is genetically linked to a haplotype identified as C8W6H5.
32. The soybean plant of claim 31, wherein the genetic marker is selected from the group consisting of SEQ ID NO: 1, 2, 3 and 59.
33. The crop plant of claim 27, wherein said crop plant is a transgenic insect tolerant soybean plant and wherein the transgene is genetically linked to a haplotype identified as C6W4H1.
34. The soybean plant of claim 33, wherein the genetic marker is selected from the group consisting of: SEQ ID NO: 29-32.
35. The crop plant of claim 27, wherein said crop plant is a transgenic insect tolerant corn plant and wherein the transgene is genetically linked to a haplotype identified as C1W36H2.
36. The corn plant of claim 35, wherein the genetic marker is selected from the group consisting of: SEQ ID NO: 48-50.
37. A method for enhancing accumulation of one or more haplotypes in a germplasm comprising:
(a) determining a map location of a transgene in the genome; and
(b) correlating the map location to a haplotype, wherein the transgene and the haplotype comprises a T-type genomic region; and
(c) crossing the first plant with a second plant that contains at least one T-type genomic region or haplotype that is different from the first plant T-type genomic region;
(d) selecting at least one progeny plant by detecting expression of the transgene of the first plant, wherein the progeny plant comprises in its genome at least a portion of the T-type genomic region of the first plant and at least one T-type genomic region or haplotype of the second plant;
(e) using the progeny plant in activities related to germplasm improvement the activities selected from the group consisting of using the plant for making breeding crosses, further testing of the plant, advancement of the plant through self fertilization, use of the plant or parts thereof for transformation, use of the plant or parts thereof for mutagenesis, and use of the plant or parts thereof for TILLING.
US11/441,915 2005-05-27 2006-05-26 Methods and compositions to enhance plant breeding Abandoned US20060282911A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US11/441,915 US20060282911A1 (en) 2005-05-27 2006-05-26 Methods and compositions to enhance plant breeding
US12/640,069 US8754289B2 (en) 2005-05-27 2009-12-17 Methods and compositions to enhance plant breeding
US14/283,630 US9605272B2 (en) 2005-05-27 2014-05-21 Methods and compositions to enhance plant breeding
US15/433,124 US10273498B2 (en) 2005-05-27 2017-02-15 Methods and compositions to enhance plant breeding

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US68558405P 2005-05-27 2005-05-27
US11/441,915 US20060282911A1 (en) 2005-05-27 2006-05-26 Methods and compositions to enhance plant breeding

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/640,069 Continuation US8754289B2 (en) 2005-05-27 2009-12-17 Methods and compositions to enhance plant breeding

Publications (1)

Publication Number Publication Date
US20060282911A1 true US20060282911A1 (en) 2006-12-14

Family

ID=37137417

Family Applications (16)

Application Number Title Priority Date Filing Date
US11/441,915 Abandoned US20060282911A1 (en) 2005-05-27 2006-05-26 Methods and compositions to enhance plant breeding
US11/441,914 Active 2027-07-12 US7632985B2 (en) 2005-05-27 2006-05-26 Soybean event MON89788 and methods for detection thereof
US11/441,918 Active 2027-02-12 US7608761B2 (en) 2005-05-27 2006-05-26 Method for disease control in MON89788 soybean
US12/575,352 Active US8053184B2 (en) 2005-05-27 2009-10-07 Soybean event MON89788 and methods for detection thereof
US12/640,069 Active 2028-09-13 US8754289B2 (en) 2005-05-27 2009-12-17 Methods and compositions to enhance plant breeding
US13/214,081 Active 2028-06-03 US9017947B2 (en) 2005-05-27 2011-08-19 Soybean event MON89788 and methods for detection thereof
US14/283,630 Active US9605272B2 (en) 2005-05-27 2014-05-21 Methods and compositions to enhance plant breeding
US14/539,923 Active 2028-02-27 US9944945B2 (en) 2005-05-27 2014-11-12 Soybean event MON89788 and methods for detection thereof
US15/433,124 Active 2026-08-07 US10273498B2 (en) 2005-05-27 2017-02-15 Methods and compositions to enhance plant breeding
US15/933,148 Active US10738320B2 (en) 2005-05-27 2018-03-22 Soybean event MON89788 and methods for detection thereof
US16/292,489 Abandoned US20190185875A1 (en) 2005-05-27 2019-03-05 Methods and compositions to enhance plant breeding
US16/292,560 Abandoned US20190185876A1 (en) 2005-05-27 2019-03-05 Methods and compositions to enhance plant breeding
US16/918,877 Active US11390881B2 (en) 2005-05-27 2020-07-01 Soybean event MON89788 and methods for detection thereof
US17/847,949 Active US12018268B2 (en) 2005-05-27 2022-06-23 Soybean event MON89788 and methods for detection thereof
US18/088,859 Abandoned US20230159947A1 (en) 2005-05-27 2022-12-27 Soybean event mon89788 and methods for detection thereof
US18/661,289 Pending US20250092414A1 (en) 2005-05-27 2024-05-10 Soybean event mon89788 and methods for detection thereof

Family Applications After (15)

Application Number Title Priority Date Filing Date
US11/441,914 Active 2027-07-12 US7632985B2 (en) 2005-05-27 2006-05-26 Soybean event MON89788 and methods for detection thereof
US11/441,918 Active 2027-02-12 US7608761B2 (en) 2005-05-27 2006-05-26 Method for disease control in MON89788 soybean
US12/575,352 Active US8053184B2 (en) 2005-05-27 2009-10-07 Soybean event MON89788 and methods for detection thereof
US12/640,069 Active 2028-09-13 US8754289B2 (en) 2005-05-27 2009-12-17 Methods and compositions to enhance plant breeding
US13/214,081 Active 2028-06-03 US9017947B2 (en) 2005-05-27 2011-08-19 Soybean event MON89788 and methods for detection thereof
US14/283,630 Active US9605272B2 (en) 2005-05-27 2014-05-21 Methods and compositions to enhance plant breeding
US14/539,923 Active 2028-02-27 US9944945B2 (en) 2005-05-27 2014-11-12 Soybean event MON89788 and methods for detection thereof
US15/433,124 Active 2026-08-07 US10273498B2 (en) 2005-05-27 2017-02-15 Methods and compositions to enhance plant breeding
US15/933,148 Active US10738320B2 (en) 2005-05-27 2018-03-22 Soybean event MON89788 and methods for detection thereof
US16/292,489 Abandoned US20190185875A1 (en) 2005-05-27 2019-03-05 Methods and compositions to enhance plant breeding
US16/292,560 Abandoned US20190185876A1 (en) 2005-05-27 2019-03-05 Methods and compositions to enhance plant breeding
US16/918,877 Active US11390881B2 (en) 2005-05-27 2020-07-01 Soybean event MON89788 and methods for detection thereof
US17/847,949 Active US12018268B2 (en) 2005-05-27 2022-06-23 Soybean event MON89788 and methods for detection thereof
US18/088,859 Abandoned US20230159947A1 (en) 2005-05-27 2022-12-27 Soybean event mon89788 and methods for detection thereof
US18/661,289 Pending US20250092414A1 (en) 2005-05-27 2024-05-10 Soybean event mon89788 and methods for detection thereof

Country Status (24)

Country Link
US (16) US20060282911A1 (en)
EP (5) EP2275561A1 (en)
JP (2) JP5631544B2 (en)
KR (1) KR101076095B1 (en)
CN (4) CN101316513A (en)
AP (1) AP2693A (en)
AR (4) AR053497A1 (en)
AU (3) AU2006252801C1 (en)
BR (3) BRPI0610654B1 (en)
CA (3) CA2609854C (en)
CL (3) CL2013002680A1 (en)
ES (1) ES2603857T3 (en)
HK (2) HK1153232A1 (en)
IN (1) IN2007DE09378A (en)
MX (3) MX2007014972A (en)
NZ (1) NZ563718A (en)
PH (1) PH12007502677B1 (en)
PT (1) PT1885176T (en)
RU (1) RU2411720C2 (en)
SG (2) SG179442A1 (en)
UA (1) UA94582C2 (en)
UY (1) UY29570A1 (en)
WO (3) WO2006130436A2 (en)
ZA (2) ZA200710177B (en)

Cited By (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040083500A1 (en) * 1997-11-18 2004-04-29 Pioneer Hi-Bred International, Inc. Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US20060282915A1 (en) * 2005-05-27 2006-12-14 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US20070197474A1 (en) * 2004-03-30 2007-08-23 Clinton William P Methods for controlling plants pathogens using N-phosphonomethylglycine
US20090031438A1 (en) * 2007-06-22 2009-01-29 Monsanto Technology, Llc Methods & Compositions for Selection of Loci for Trait Performance & Expression
US20090133152A1 (en) * 2007-06-29 2009-05-21 Pioneer Hi-Bred International, Inc. Methods for altering the genome of a monocot plant cell
US20100167403A1 (en) * 2008-12-30 2010-07-01 Pioneer Hi-Bred International, Inc. Identification and selection of commercial-quality transgenic plant events
US20100173801A1 (en) * 2005-07-18 2010-07-08 Pioneer Hi-Bred International, Inc. Modified FRT Recombination Site Libraries and Methods of Use
US20100275286A1 (en) * 2007-05-31 2010-10-28 Monsanto Technology Llc Soybean Polymorphisms And Methods Of Genotyping
US20110015084A1 (en) * 2007-10-25 2011-01-20 Monsanto Technology Llc Methods for Identifying Genetic Linkage
US20110030107A1 (en) * 1997-11-18 2011-02-03 Pioneer Hi-Bred International, Inc. Compositions and methods for genetic modification of plants
US20110113509A1 (en) * 2008-03-11 2011-05-12 Precision Biosciences, Inc. Rationally-designed meganucleases for maize genome engineering
US20110123509A1 (en) * 2008-04-28 2011-05-26 Derek Jantz Fusion molecules of rationally-designed dna-binding proteins and effector domains
US20110203012A1 (en) * 2010-01-21 2011-08-18 Dotson Stanton B Methods and compositions for use of directed recombination in plant breeding
EP2511381A1 (en) 2007-06-08 2012-10-17 Monsanto Technology LLC Methods for sequence-directed molecular breeding
US20140338070A1 (en) * 2011-08-03 2014-11-13 Pioneer Hi-Bred International Methods and compositions for targeted integration in a plant
US20150047066A1 (en) * 2010-12-28 2015-02-12 Toyama Prefecture Plant having increased resistance or susceptibility to 4-hppd inhibitor
US20160024519A1 (en) * 2007-08-29 2016-01-28 Monsanto Technology Llc Methods and compositions for gray leaf spot resistance in corn
US10435699B2 (en) 2012-01-27 2019-10-08 E I Du Pont De Nemours And Company Methods and compositions for generating complex trait loci
US10555527B2 (en) 2009-05-18 2020-02-11 Monsanto Technology Llc Use of glyphosate for disease suppression and yield enhancement in soybean
US10822610B2 (en) 2011-03-23 2020-11-03 E. I. Du Pont De Nemours And Company Methods for producing a complex transgenic trait locus
US10961540B2 (en) * 2012-09-07 2021-03-30 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
US11130961B2 (en) 2009-09-17 2021-09-28 Monsanto Technology Llc Soybean transgenic event MON 87708 and methods of use thereof
US11193137B2 (en) 2010-06-04 2021-12-07 Monsanto Technology Llc Late season application of glyphosate for weed control in Brassica
EP3971283A1 (en) 2014-02-27 2022-03-23 Monsanto Technology LLC Compositions and methods for site directed genomic modification
US11560568B2 (en) 2014-09-12 2023-01-24 E. I. Du Pont De Nemours And Company Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use
US11788096B2 (en) 2020-07-31 2023-10-17 Inari Agriculture Technology, Inc. Excisable INHT31 transgenic soybean glyphosate tolerance locus
US12467056B2 (en) 2021-04-30 2025-11-11 Monsanto Technology Llc Plant regulatory elements and uses thereof
US12564191B2 (en) 2020-04-28 2026-03-03 Basf Se Pesticidal compounds

Families Citing this family (2447)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2535354C (en) * 2003-10-28 2011-03-15 Washington State University Research Foundation Suppression of foliar and soilborne pathogens
EP1729580B1 (en) 2004-03-30 2018-04-11 Monsanto Technology LLC Methods for controlling plant pathogens using n-phosphonomethylglycine
EA201270781A1 (en) * 2005-06-09 2013-09-30 Байер Кропсайенс Аг COMBINATION OF BIOLOGICALLY ACTIVE SUBSTANCES
DE102005026482A1 (en) * 2005-06-09 2006-12-14 Bayer Cropscience Ag Active substance combination, useful e.g. for combating unwanted phytopathogenic fungus, comprises herbicides e.g. glyphosate and active substances e.g. strobilurin, triazoles, valinamide and carboxamide
BRPI0614651A2 (en) * 2005-08-09 2011-04-12 Syngenta Participations Ag method for controlling phytopathogenic organisms
KR20080024780A (en) * 2006-09-14 2008-03-19 삼성전자주식회사 Molds for manufacturing cabinets of projection TVs and projection TVs
EP1922927A1 (en) * 2006-10-26 2008-05-21 Syngeta Participations AG A method for controlling soybean rust
WO2008092866A1 (en) 2007-01-29 2008-08-07 Scientific Institute Of Public Health (Iph) Transgenic plant event detection
EP1950311A1 (en) * 2007-01-29 2008-07-30 Scientific Institute of Public Health (IPH) Transgenic plant event detection
US8809636B2 (en) 2007-08-22 2014-08-19 Monsanto Technology Llc Soybean cultivar S060292
WO2009064652A1 (en) * 2007-11-15 2009-05-22 Monsanto Technology Llc Soybean plant and seed corresponding to transgenic event mon87701 and methods for detection thereof
US8629331B2 (en) * 2008-03-24 2014-01-14 Monsanto Technology Llc Soybean cultivar 7113111
US8729345B2 (en) * 2008-03-31 2014-05-20 Monsanto Technology Llc Soybean cultivar S070160
US8742210B2 (en) 2008-04-01 2014-06-03 Monsanto Technology Llc Soybean cultivar 7535357
US8653333B2 (en) * 2008-04-29 2014-02-18 Monsanto Technology Llc Soybean cultivar S070155
US8609938B2 (en) * 2008-04-29 2013-12-17 Monsanto Technology Llc Soybean cultivar 7904162
CN107699545A (en) * 2008-09-29 2018-02-16 孟山都技术公司 Soybean transgene time MON87705 and its detection method
CN101406201B (en) * 2008-11-25 2012-07-25 福建省农业科学院植物保护研究所 Medicament for destroying diseased plant of banana having quarantine Fusarium oxysporum and uses thereof
US8466348B2 (en) * 2009-05-01 2013-06-18 Monsanto Technology Llc Soybean cultivar 84343415
US8461423B2 (en) * 2009-05-08 2013-06-11 Monsanto Technology Llc Soybean cultivar 86142430
US8461424B2 (en) * 2009-05-08 2013-06-11 Montano Technology LLC Soybean cultivar S080178
CA2766374C (en) 2009-06-30 2017-10-03 Monsanto Technology Llc N-phosphonomethylglycine guanidine derivative salts
US8115069B2 (en) * 2009-07-02 2012-02-14 Monsanto Technology Llc Soybean variety A1016124
US8263831B2 (en) * 2009-07-02 2012-09-11 Monsanto Technology Llc Soybean variety A1016054
US8207407B2 (en) * 2009-07-02 2012-06-26 Monsanto Technology Llc Soybean variety A1016238
US8273962B2 (en) * 2009-07-02 2012-09-25 Monsanto Technology Llc Soybean variety A1016134
US8203039B2 (en) * 2009-07-02 2012-06-19 Monsanto Technology Llc Soybean variety A1016536
US8273961B2 (en) * 2009-07-02 2012-09-25 Monsanto Technology Llc Soybean variety A1015499
US8263830B2 (en) * 2009-07-02 2012-09-11 Monsanto Technology Llc Soybean variety A1015481
US8115068B2 (en) * 2009-07-02 2012-02-14 Monsanto Technology Llc Soybean variety A1016119
US8198516B2 (en) * 2009-07-02 2012-06-12 Monsanto Technology Llc Soybean variety A1016523
US8115071B2 (en) * 2009-07-02 2012-02-14 Monsanto Technology Llc Soybean variety A1016137
US8269070B2 (en) * 2009-07-02 2012-09-18 Monsanto Technology Llc Soybean variety A1015492
US8110728B2 (en) * 2009-07-02 2012-02-07 Monsanto Technology Llc Soybean variety A1016498
US8263829B2 (en) * 2009-07-02 2012-09-11 Monsanto Technology Llc Soybean variety A1015993
US8115070B2 (en) * 2009-07-02 2012-02-14 Monsanto Technology Llc Soybean variety A1016053
US8163982B2 (en) * 2009-07-02 2012-04-24 Monsanto Technology Llc Soybean variety A1016496
US8193424B2 (en) * 2009-07-09 2012-06-05 Monsanto Technology Llc Soybean variety A1016522
US8334433B2 (en) * 2009-07-09 2012-12-18 Monsanto Technology Llc Soybean variety A1016109
US8269071B2 (en) * 2009-07-09 2012-09-18 Monsanto Technology Llc Soybean variety A1015669
US8319032B2 (en) * 2009-07-09 2012-11-27 Monsanto Technology Llc Soybean variety A1015901
US8319031B2 (en) * 2009-07-09 2012-11-27 Monsanto Technology Llc Soybean variety A1016242
US8263832B2 (en) * 2009-07-09 2012-09-11 Monsanto Technology Llc Soybean variety A1016467
US8319033B2 (en) * 2009-07-09 2012-11-27 Monsanto Technology Llc Soybean variety A1016136
US8330000B2 (en) * 2009-07-09 2012-12-11 Monsanto Technology Llc Soybean variety A1015971
US8198517B2 (en) * 2009-07-09 2012-06-12 Monsanto Technology Llc Soybean variety A1016189
US8314294B2 (en) * 2009-07-15 2012-11-20 Monsanto Technology Llc Soybean variety A1016502
US8319035B2 (en) * 2009-07-15 2012-11-27 Monsanto Technology Llc Soybean variety A1016167
US9155327B2 (en) * 2009-07-15 2015-10-13 Monsanto Technology Llc Soybean variety A1016131
US8217230B2 (en) * 2009-07-15 2012-07-10 Monsanto Technology Llc Soybean variety A1016122
US8212121B2 (en) * 2009-07-15 2012-07-03 Monsanto Technology Llc Soybean variety A1016115
US8319034B2 (en) * 2009-07-15 2012-11-27 Monsanto Technology Llc Soybean variety A1016511
US8269072B2 (en) * 2009-07-15 2012-09-18 Monsanto Technology Llc Soybean variety A1016117
US8222490B2 (en) * 2009-07-15 2012-07-17 Monsanto Technology Llc Soybean variety A1016495
US8273965B2 (en) * 2009-07-16 2012-09-25 Monsanto Technology Llc Soybean variety A1015862
US8163983B2 (en) * 2009-07-16 2012-04-24 Monsanto Technology Llc Soybean variety A1016008
US8222491B2 (en) * 2009-07-16 2012-07-17 Monsanto Technology Llc Soybean variety A1016190
US8273966B2 (en) * 2009-07-16 2012-09-25 Monsanto Technology Llc Soybean variety A1016274
US8212122B2 (en) * 2009-07-16 2012-07-03 Monsanto Technology Llc Soybean variety A1016268
US8278512B2 (en) * 2009-07-16 2012-10-02 Monsanto Technology Llc Soybean variety A1015631
US8273963B2 (en) * 2009-07-16 2012-09-25 Monsanto Technology Llc Soybean variety A1016240
US8278511B2 (en) * 2009-07-16 2012-10-02 Monsanto Technology Llc Soybean variety A1016184
US8334434B2 (en) * 2009-07-16 2012-12-18 Monsanto Technology Llc Soybean variety A1016082
US8115072B2 (en) * 2009-07-16 2012-02-14 Monsanto Technology Llc Soybean variety A1015645
US8278513B2 (en) * 2009-07-17 2012-10-02 Monsanto Technology Llc Soybean variety A1016281
US8207409B2 (en) * 2009-07-17 2012-06-26 Monsanto Technology Llc Soybean variety A1016347
US8158864B2 (en) * 2009-07-17 2012-04-17 Monsanto Technology Llc Soybean variety A1015460
US8334435B2 (en) * 2009-07-17 2012-12-18 Monsanto Technology Llc Soybean variety A1016278
US8273964B2 (en) * 2009-07-17 2012-09-25 Monsanto Technology Llc Soybean variety A1015646
US8119869B2 (en) * 2009-07-17 2012-02-21 Monsanto Technology Llc Soybean variety A1016276
US8115074B2 (en) * 2009-07-17 2012-02-14 Monsanto Technology Llc Soybean variety A1015657
US8115075B2 (en) * 2009-07-17 2012-02-14 Monsanto Technology Llc Soybean variety A1016273
US8115076B2 (en) * 2009-07-17 2012-02-14 Monsanto Technology Llc Soybean variety A1016279
US8115073B2 (en) * 2009-07-20 2012-02-14 Monsanto Technology Llc Soybean variety A1015662
US8269073B2 (en) * 2009-07-20 2012-09-18 Monsanto Technology Soybean variety A1015632
US8158865B2 (en) * 2009-07-21 2012-04-17 Monsanto Technology Llc Soybean variety A1015484
US8203041B2 (en) * 2009-07-21 2012-06-19 Monsanto Technology Llc Soybean variety A1016334
US8278514B2 (en) * 2009-07-21 2012-10-02 Monsanto Technology Llc Soybean variety A1016515
US8203040B2 (en) * 2009-07-21 2012-06-19 Monsanto Technology Llc Soybean variety A1016332
US8207410B2 (en) * 2009-07-21 2012-06-26 Monsanto Technology Llc Soybean variety A1016317
JP5940977B2 (en) * 2009-08-11 2016-06-29 サンガモ バイオサイエンシーズ, インコーポレイテッド Homozygous organisms by targeted modification
US8426689B2 (en) * 2009-09-30 2013-04-23 M. S. Technologies LLC Soybean cultivar S080100
US8426688B2 (en) * 2009-09-30 2013-04-23 M.S. Technologies, Llc Soybean cultivar S080099
MX2012002726A (en) 2009-09-30 2012-04-11 Basf Se Low volatile amine salts of anionic pesticides.
US8420895B2 (en) * 2009-09-30 2013-04-16 M.S. Technologies Llc Soybean cultivar S080137
US8420896B2 (en) * 2009-10-23 2013-04-16 M.S. Technologies Llc Soybean cultivar S080120
PH12012501096A1 (en) * 2009-11-23 2012-10-29 BASF Agricultural Solutions Seed US LLC Elite event ee-gm3 and methods and kits for identifying such event in biological samples
NZ600375A (en) * 2009-11-23 2014-10-31 Bayer Cropscience Nv Herbicide tolerant soybean plants and methods for identifying same
UA113610C2 (en) * 2009-11-24 2017-02-27 THE TRANSGENIC SOY PLANE INCLUDING EVENT 416 SOY AAD-12
EA022553B1 (en) 2010-01-22 2016-01-29 Байер Интеллектуэль Проперти Гмбх Use of biologically active ingredient combination, kit and composition comprising biologically active ingredient combination for controlling animal pests and method for improving utilization of production potential of transgenic plant
EP2544531B1 (en) 2010-03-12 2020-12-02 Monsanto Technology LLC Plant health compositions comprising a water-soluble pesticide and a water-insoluble agrochemical
US8314295B2 (en) * 2010-03-26 2012-11-20 Monsanto Technology Llc Soybean variety D5624041
US8436226B2 (en) 2010-04-09 2013-05-07 Monsanto Technology Llc Soybean cultivar 1000679
US8455721B2 (en) 2010-04-16 2013-06-04 Monsanto Technology Llc Soybean cultivar 99401805
US8450565B2 (en) 2010-04-16 2013-05-28 Monsanto Technology Llc Soybean cultivar 98179010
US8440883B2 (en) 2010-04-16 2013-05-14 Monsanto Technology Llc Soybean cultivar S100004
US8426690B2 (en) * 2010-04-23 2013-04-23 Monsanto Technology Llc Soybean cultivar 98164635
CN102918394A (en) * 2010-05-28 2013-02-06 罗姆及哈斯公司 Methods for identifying compositions that alter wildtype expression of genes and proteins in a plant cell
US8283530B2 (en) 2010-07-08 2012-10-09 Monsanto Technology Llc Soybean variety A1023171
US8309811B2 (en) 2010-07-08 2012-11-13 Monsanto Technology Llc Soybean variety A1022841
US8309810B2 (en) 2010-07-08 2012-11-13 Monsanto Technology Llc Soybean variety A1019993
US8426691B2 (en) 2010-07-08 2013-04-23 Monsanto Technology Llc Soybean variety A1016011
US8324465B2 (en) 2010-07-08 2012-12-04 Monsanto Technology Llc Soybean variety A1023169
US8389813B2 (en) 2010-07-08 2013-03-05 Monsanto Technology Llc Soybean variety A1022840
US8383893B2 (en) 2010-07-08 2013-02-26 Monsanto Technology Llc Soybean variety A1020078
US8383892B2 (en) 2010-07-08 2013-02-26 Monsanto Technology Llc Soybean variety A1015895
US8283531B2 (en) 2010-07-08 2012-10-09 Monsanto Technology Llc Soybean variety A1023484
US8383894B2 (en) 2010-07-08 2013-02-26 Monsanto Technology Llc Soybean variety A1023199
US8293997B2 (en) 2010-07-15 2012-10-23 Monsanto Technology Llc Soybean variety A1024318
US8304624B2 (en) 2010-07-15 2012-11-06 Monsanto Technology Llc Soybean variety A1024320
US8319038B2 (en) 2010-07-15 2012-11-27 Monsanto Technology Llc Soybean variety A1024319
US8618362B2 (en) 2010-07-15 2013-12-31 Monsanto Technology Llc Soybean variety A1024337
US8404938B2 (en) 2010-07-15 2013-03-26 Monsanto Technology Llc Soybean variety A1022842
US8399743B2 (en) 2010-07-15 2013-03-19 Monsanto Technology Llc Soybean variety A1024305
US8395025B2 (en) 2010-07-15 2013-03-12 Monsanto Technology Llc Soybean variety A1024249
US8507762B2 (en) 2010-07-15 2013-08-13 Monsanto Technology Llc Soybean variety A1024315
US8293998B2 (en) 2010-07-15 2012-10-23 Monsanto Technology Llc Soybean variety A1024338
US8420897B2 (en) 2010-07-15 2013-04-16 Monsanto Technology Llc Soybean variety A1024301
US8304623B2 (en) 2010-07-15 2012-11-06 Monsanto Technology Llc Soybean variety A1024238
US8299333B2 (en) 2010-07-15 2012-10-30 Monsanto Technology Llc Soybean variety A1024289
US8395026B2 (en) 2010-07-15 2013-03-12 Monsanto Technology Llc Soybean variety A1024300
US8324468B2 (en) 2010-07-16 2012-12-04 Monsanto Technology Llc Soybean variety A1024223
US8324466B2 (en) 2010-07-16 2012-12-04 Monsanto Technology Llc Soybean variety A1024181
US8314302B2 (en) 2010-07-16 2012-11-20 Monsanto Technology Llc Soybean variety A1024184
US8309812B2 (en) 2010-07-16 2012-11-13 Monsanto Technology Llc Soybean variety A1024109
US8383895B2 (en) 2010-07-16 2013-02-26 Monsanto Technology Llc Soybean variety A1024198
US8319039B2 (en) 2010-07-16 2012-11-27 Monsanto Technology Llc Soybean variety A1024340
US8319040B2 (en) 2010-07-16 2012-11-27 Monsanto Technology Llc Soybean variety A1024255
US8309814B2 (en) 2010-07-16 2012-11-13 Monsanto Technology Llc Soybean variety A1024213
US8314303B2 (en) 2010-07-16 2012-11-20 Monsanto Technology Llc Soybean variety A1024197
US8293999B2 (en) 2010-07-16 2012-10-23 Monsanto Technology Llc Soybean variety A1024231
US8309813B2 (en) 2010-07-16 2012-11-13 Monsanto Technology Llc Soybean variety A1024212
US8367897B2 (en) 2010-07-16 2013-02-05 Monsanto Technology Llc Soybean variety A1024230
US8324467B2 (en) 2010-07-16 2012-12-04 Monsanto Technology Llc Soybean variety A1024216
US8420898B2 (en) 2010-07-16 2013-04-16 Monsanto Technology Llc Soybean variety A1024210
US8404939B2 (en) 2010-07-18 2013-03-26 Monsanto Technology Llc Soybean variety A1023485
US8399744B2 (en) 2010-07-19 2013-03-19 Monsanto Technology Llc Soybean variety A1023486
US8404940B2 (en) 2010-07-19 2013-03-26 Monsanto Technology Llc Soybean variety A1023596
US8455723B2 (en) 2010-07-19 2013-06-04 Monsanto Technology Llc Soybean variety A1023586
US8450566B2 (en) 2010-07-19 2013-05-28 Monsanto Technology Llc Soybean variety A1023611
US8399745B2 (en) 2010-07-19 2013-03-19 Monsanto Technology Llc Soybean variety A1023603
US8507763B2 (en) 2010-07-19 2013-08-13 Monsanto Technology Llc Soybean variety A1023510
US8502028B2 (en) 2010-07-19 2013-08-06 Monsanto Technology Llc Soybean variety A1023487
US8404942B2 (en) 2010-07-26 2013-03-26 Monsanto Technology Llc Soybean variety A1023673
US8455722B2 (en) 2010-07-26 2013-06-04 Monsanto Technology Llc Soybean variety A1023585
US8450569B2 (en) 2010-07-26 2013-05-28 Monsanto Technology Llc Soybean variety A1024227
US8404941B2 (en) 2010-07-26 2013-03-26 Monsanto Technology Llc Soybean variety A1023667
US8431776B2 (en) 2010-07-26 2013-04-30 Monsanto Technology Llc Soybean variety A1023535
US8507764B2 (en) 2010-07-28 2013-08-13 Monsanto Technology Llc Soybean variety A1023705
US8450570B2 (en) 2010-07-28 2013-05-28 Monsanto Technology Llc Soybean variety A1023833
US8389815B2 (en) 2010-07-28 2013-03-05 Monsanto Technology Llc Soybean variety A1023761
US8378182B2 (en) 2010-07-28 2013-02-19 Monsanto Technology Llc Soybean variety A1023748
US8410339B2 (en) 2010-07-28 2013-04-02 Monsanto Technology Llc Soybean variety A1023771
US8404943B2 (en) 2010-07-28 2013-03-26 Monsanto Technology Llc Soybean variety A1023694
US8378183B2 (en) 2010-07-28 2013-02-19 Monsanto Technology Llc Soybean variety A1023750
US8378181B2 (en) 2010-07-28 2013-02-19 Monsanto Technology Llc Soybean variety A1023729
US8383897B2 (en) 2010-07-28 2013-02-26 Monsanto Technology Llc Soybean variety A1023763
US8383898B2 (en) 2010-07-29 2013-02-26 Monsanto Technology Llc Soybean variety A1023788
US8404946B2 (en) 2010-07-29 2013-03-26 Monsanto Technology Llc Soybean variety A1023840
US8455724B2 (en) 2010-07-29 2013-06-04 Monsanto Technology Llc Soybean variety A1023941
US8431787B2 (en) 2010-07-29 2013-04-30 Monsanto Technology Llc Soybean variety A1023844
US8410340B2 (en) 2010-07-29 2013-04-02 Monsanto Technology Llc Soybean variety A1023838
US8404945B2 (en) 2010-07-29 2013-03-26 Monsanto Technology Llc Soybean variety A1023821
US8455726B2 (en) 2010-07-29 2013-06-04 Monsanto Technology Llc Soybean variety A1023981
US8436228B2 (en) 2010-07-29 2013-05-07 Monsanto Technology Llc Soybean variety A1023868
US8404944B2 (en) 2010-07-29 2013-03-26 Monsanto Technology Llc Soybean variety A1023795
US8471108B2 (en) 2010-07-29 2013-06-25 Monsanto Technology Llc Soybean variety A1023999
US8455725B2 (en) 2010-07-29 2013-06-04 Monsanto Technology Llc Soybean variety A1023969
US8420900B2 (en) 2010-07-29 2013-04-16 Monsanto Technology Llc Soybean variety A1024077
US8466349B2 (en) 2010-07-29 2013-06-18 Monsanto Technology Llc Soybean variety A1023943
US8404947B2 (en) 2010-07-29 2013-03-26 Monsanto Technology Llc Soybean variety A1024059
US8404949B2 (en) 2010-07-30 2013-03-26 Monsanto Technology Llc Soybean variety A1024103
US8431779B2 (en) 2010-07-30 2013-04-30 Monsanto Technology Llc Soybean variety A1024638
US8399746B2 (en) 2010-07-30 2013-03-19 Monsanto Technology Llc Soybean variety A1024350
US8415530B2 (en) 2010-07-30 2013-04-09 Monsanto Technology Llc Soybean variety A1024626
US8415531B2 (en) 2010-07-30 2013-04-09 Monsanto Technology Llc Soybean variety A1024629
US8404948B2 (en) 2010-07-30 2013-03-26 Monsanto Technology Llc Soybean variety A1024092
US8436227B2 (en) 2010-07-30 2013-05-07 Monsanto Technology Llc Soybean variety A1023511
US8420899B2 (en) 2010-07-30 2013-04-16 Monsanto Technology Llc Soybean variety A1023692
US8415532B2 (en) 2010-07-30 2013-04-09 Monsanto Technology Llc Soybean variety A1024630
US8420901B2 (en) 2010-07-30 2013-04-16 Monsanto Technology Llc Soybean variety A1024627
US8415533B2 (en) 2010-07-30 2013-04-09 Monsanto Technology Llc Soybean variety A1024631
US8450567B2 (en) 2010-07-30 2013-05-28 Monsanto Technology Llc Soybean variety A1024104
US8431778B2 (en) 2010-07-30 2013-04-30 Monsanto Technology Llc Soybean variety A1024341
US8420902B2 (en) 2010-07-30 2013-04-16 Monsanto Technology Llc Soybean variety A1024640
US8431781B2 (en) 2010-08-01 2013-04-30 Monsanto Technology Llc Soybean variety A1024666
US8455727B2 (en) 2010-08-01 2013-06-04 Monsanto Technology Llc Soybean variety A1024755
US8450568B2 (en) 2010-08-01 2013-05-28 Monsanto Technology Llc Soybean variety A1025240
US8420903B2 (en) 2010-08-01 2013-04-16 Monsanto Technology Llc Soybean variety A1024693
US8426692B2 (en) 2010-08-01 2013-04-23 Monsanto Technology Llc Soybean variety A1024702
US8455728B2 (en) 2010-08-01 2013-06-04 Monsanto Technology Llc Soybean variety A1025241
US8445754B2 (en) 2010-08-01 2013-05-21 Monsanto Technology Llc Soybean variety A1024705
US8431780B2 (en) 2010-08-01 2013-04-30 Monsanto Technology Llc Soybean variety A1024650
US8431788B2 (en) 2010-08-01 2013-04-30 Monsanto Technology Llc Soybean variety A1024763
US8395027B2 (en) 2010-08-02 2013-03-12 Monsanto Technology Llc Soybean variety A1024001
US8431777B2 (en) 2010-08-02 2013-04-30 Monsanto Technology Llc Soybean variety A1023849
US8431782B2 (en) 2010-08-18 2013-04-30 Monsanto Technology Llc Soybean variety A1024747
US8431786B2 (en) 2010-08-18 2013-04-30 Monsanto Technology Llc Soybean variety A1024751
US8426693B2 (en) 2010-08-18 2013-04-23 Monsanto Technology Llc Soybean variety A1024720
US8431783B2 (en) 2010-08-18 2013-04-30 Monsanto Technology Llc Soybean variety A1024748
US8431784B2 (en) 2010-08-18 2013-04-30 Monsanto Technology Llc Soybean variety A1024749
US8431785B2 (en) 2010-08-18 2013-04-30 Monsanto Technology Llc Soybean variety A1024750
US8455729B2 (en) 2010-08-18 2013-06-04 Monsanto Technology Llc Soybean variety A1015644
US8492617B2 (en) 2010-08-18 2013-07-23 Monsanto Technology Llc Soybean variety A1015881
BR112013003029A2 (en) * 2010-08-24 2016-09-13 Basf Se “AGROCHEMICAL MIXTURE, AGROCHEMICAL COMPOSITION, METHOD TO SYNERGICLY INCREASE THE HEALTH OF A PLANT AND USES OF A MIXTURE”
AR082871A1 (en) 2010-09-03 2013-01-16 Monsanto Technology Llc MOLECULAR MARKERS ASSOCIATED WITH THE YELLOW OF LEAVES IN GLOSSOL TOLERANT SOY
EP2460404A1 (en) 2010-12-01 2012-06-06 Basf Se Compositions containing identical polyamine salts of mixed anionic pesticides
AR083875A1 (en) 2010-11-15 2013-03-27 Bayer Cropscience Ag N-ARIL PIRAZOL (UNCLE) CARBOXAMIDS
WO2012072489A1 (en) 2010-11-29 2012-06-07 Bayer Cropscience Ag Alpha,beta-unsaturated imines
EP2460407A1 (en) 2010-12-01 2012-06-06 Bayer CropScience AG Agent combinations comprising pyridylethyl benzamides and other agents
KR20180096815A (en) 2010-12-01 2018-08-29 바이엘 인텔렉쳐 프로퍼티 게엠베하 Use of fluopyram for controlling nematodes in crops and for increasing yield
UA115766C2 (en) 2010-12-03 2017-12-26 ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі Stacked herbicide tolerance event 8264.44.06.1, related transgenic soybean lines, and detection thereof
US9540656B2 (en) 2010-12-03 2017-01-10 Dow Agrosciences Llc Stacked herbicide tolerance event 8291.45.36.2, related transgenic soybean lines, and detection thereof
TW201231655A (en) * 2010-12-15 2012-08-01 Syngenta Participations Ag Soybean event SYHT04R and compositions and methods for detection thereof
TWI667347B (en) * 2010-12-15 2019-08-01 瑞士商先正達合夥公司 Soybean event syht0h2 and compositions and methods for detection thereof
JP5511093B2 (en) 2010-12-22 2014-06-04 ダウ グローバル テクノロジーズ エルエルシー Synergistic combination of glyphosate compound and TBZ
MX2013007573A (en) * 2010-12-29 2013-07-22 Dow Agrosciences Llc Methods to determine zygosity in a bulked sample.
BR112013022998A2 (en) 2011-03-10 2018-07-03 Bayer Ip Gmbh method to improve seed germination.
EP3292761A1 (en) 2011-03-23 2018-03-14 Bayer Intellectual Property GmbH Active compound combinations
US8772584B2 (en) 2011-04-06 2014-07-08 Monsanto Technology Llc Soybean variety D6235241
US8766042B2 (en) 2011-04-06 2014-07-01 Monsanto Technology Llc Soybean variety D6652412
US8552268B2 (en) 2011-04-06 2013-10-08 Monsanto Technology Llc Soybean variety D6422351
US8530727B2 (en) 2011-04-06 2013-09-10 Monsanto Technology Llc Soybean variety D6897751
US8525004B2 (en) 2011-04-06 2013-09-03 Monsanto Technology Llc Soybean variety D6854249
CN103517900A (en) 2011-04-08 2014-01-15 拜耳知识产权有限责任公司 Fungicide hydroximoyl-tetrazole derivatives
WO2012143127A1 (en) 2011-04-22 2012-10-26 Bayer Cropsciences Ag Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound
CN102258052A (en) * 2011-04-26 2011-11-30 西南大学 Method for preventing and controlling diseases of mulberry fruits
WO2012150162A1 (en) 2011-05-02 2012-11-08 Basf Se A method for enhancing the performance of a pesticide with guanidines
BR112013029907A2 (en) 2011-06-01 2016-08-09 Basf Se “METHOD OF CONTROL OF UNWANTED VEGETATION AND USE OF A BASE”
WO2012171914A1 (en) 2011-06-14 2012-12-20 Bayer Intellectual Property Gmbh Use of an enaminocarbonyl compound in combination with a biological control agent
EP3228713A1 (en) 2011-06-30 2017-10-11 Monsanto Technology LLC Alfalfa plant and seed corresponding to transgenic event kk 179-2 and methods for detection thereof
TW201317353A (en) * 2011-07-13 2013-05-01 Dow Agrosciences Llc Stacked herbicide tolerance event 8264.42.32.1, related transgenic soybean lines, and detection thereof
US8604286B2 (en) 2011-07-14 2013-12-10 Monsanto Technology Llc Soybean variety A1023512
US8604287B2 (en) 2011-07-16 2013-12-10 Monsanto Technology Llc Soybean variety A1024175
US8604288B2 (en) 2011-07-17 2013-12-10 Monsanto Technology Llc Soybean variety A1024188
US8609947B2 (en) 2011-07-18 2013-12-17 Monsanto Technology Llc Soybean variety A1024710
US8609946B2 (en) 2011-07-18 2013-12-17 Monsanto Technology Llc Soybean variety A1024299
US8581053B2 (en) 2011-07-20 2013-11-12 Monsanto Technology Llc Soybean variety A1025921
US8748706B2 (en) 2011-07-22 2014-06-10 Monsanto Technology Llc Soybean variety A1025957
US8581055B2 (en) 2011-07-22 2013-11-12 Monsanto Technology Llc Soybean variety A1025937
US8735670B2 (en) 2011-07-22 2014-05-27 Monsanto Technology Llc Soybean variety A1025962
US8581054B2 (en) 2011-07-22 2013-11-12 Monsanto Technology Llc Soybean variety A1025934
US8618365B2 (en) 2011-07-22 2013-12-31 Monsanto Technology Llc Soybean variety A1025947
US8669431B2 (en) 2011-07-23 2014-03-11 Monsanto Technology Llc Soybean variety D2011907
US8674183B2 (en) 2011-07-23 2014-03-18 Monsanto Technology Llc Soybean variety A1026009
US8669430B2 (en) 2011-07-23 2014-03-11 Monsanto Technology Llc Soybean variety A1026025
US8609948B2 (en) 2011-07-23 2013-12-17 Monsanto Technology Llc Soybean variety A1026010
US8669429B2 (en) 2011-07-24 2014-03-11 Monsanto Technology Llc Soybean variety A1025983
US8669427B2 (en) 2011-07-24 2014-03-11 Monsanto Technology Llc Soybean variety A1025967
US8669428B2 (en) 2011-07-24 2014-03-11 Monsanto Technology Llc Soybean variety A1025977
BR102012019434B1 (en) * 2011-07-26 2021-11-09 Dow Agrosciences Llc PEST, INSECT, MOLECULE AND DIAGNOSTIC DNA SEQUENCE CONTROL METHODS FOR THE SOYBEAN EVENT 9582.814.19.1
US8772586B2 (en) 2011-07-28 2014-07-08 Monsanto Technology Llc Soybean variety S100302
US8816162B2 (en) 2011-07-28 2014-08-26 Monsanto Technology Llc Soybean variety A1026213
US8609950B2 (en) 2011-07-28 2013-12-17 Monsanto Technology Llc Soybean variety A1026170
US8847023B2 (en) 2011-07-28 2014-09-30 Monsanto Technology Llc Soybean variety A1026210
US8853497B2 (en) 2011-07-28 2014-10-07 Monsanto Technology Llc Soybean variety A1026219
US8779246B2 (en) 2011-07-28 2014-07-15 Monsanto Technology Llc Soybean variety S100303
US8822764B2 (en) 2011-07-28 2014-09-02 Monsanto Technology Llc Soybean variety A1026201
US8772587B2 (en) 2011-07-28 2014-07-08 Monsanto Technology Llc Soybean variety A1026175
US8785737B2 (en) 2011-07-29 2014-07-22 Monsanto Technology Llc Soybean variety A1026091
US8669432B2 (en) 2011-07-29 2014-03-11 Monsanto Technology Llc Soybean variety A1026033
US8735672B2 (en) 2011-07-29 2014-05-27 Monsanto Technology Llc Soybean variety A1026056
US8785736B2 (en) 2011-07-29 2014-07-22 Monsanto Technology Llc Soybean variety A1026088
US8735671B2 (en) 2011-07-29 2014-05-27 Monsanto Technology Llc Soybean variety A1026046
CA2842346A1 (en) 2011-08-02 2013-02-07 Basf Se Aqueous composition comprising a pesticide and a base selected from an alkali salt of hydrogencarbonate
US8614373B2 (en) 2011-08-04 2013-12-24 Monsanto Technology Llc Soybean variety A1026142
US8609949B2 (en) 2011-08-04 2013-12-17 Monsanto Technology Llc Soybean variety A1026154
US8637745B2 (en) 2011-08-04 2014-01-28 Monsanto Technology Llc Soybean variety A1026150
US8809639B2 (en) 2011-08-04 2014-08-19 Monsanto Technology Llc Soybean variety D2011909
US8779245B2 (en) 2011-08-04 2014-07-15 Monsanto Technology Llc Soybean variety A1026138
US8772589B2 (en) 2011-08-05 2014-07-08 Monsanto Technology Llc Soybean variety D2011912
US8772590B2 (en) 2011-08-05 2014-07-08 Monsanto Technology Llc Soybean variety A1026330
US8816163B2 (en) 2011-08-05 2014-08-26 Monsanto Technology Llc Soybean variety D2011911
US8779247B2 (en) 2011-08-05 2014-07-15 Monsanto Technology Llc Soybean variety A1026289
US8766045B2 (en) 2011-08-05 2014-07-01 Monsanto Technology Llc Soybean variety S100306
US8766046B2 (en) 2011-08-05 2014-07-01 Monsanto Technology Llc Soybean variety A1026311
US8816164B2 (en) 2011-08-05 2014-08-26 Monsanto Technology Llc Soybean variety A1026256
US8847024B2 (en) 2011-08-05 2014-09-30 Monsanto Technology Llc Soybean variety S100305
US8847026B2 (en) 2011-08-06 2014-09-30 Monsanto Technology Llc Soybean variety A1026436
US8658867B2 (en) 2011-08-06 2014-02-25 Monsanto Technology Llc Soybean variety A1026434
US8878015B2 (en) 2011-08-06 2014-11-04 Monsanto Technology Llc Soybean variety A1026415
US8658868B2 (en) 2011-08-06 2014-02-25 Monsanto Technology Llc Soybean variety A1026437
US8878014B2 (en) 2011-08-06 2014-11-04 Monsanto Technology Llc Soybean variety A1026413
US8878016B2 (en) 2011-08-06 2014-11-04 Monsanto Technology Llc Soybean variety A1026417
US8884109B2 (en) 2011-08-06 2014-11-11 Monsanto Technology Llc Soybean variety A1026419
US8884107B2 (en) 2011-08-07 2014-11-11 Monsanto Technology Llc Soybean variety A1026402
US8772591B2 (en) 2011-08-07 2014-07-08 Monsanto Technology Llc Soybean variety A1026332
US8822766B2 (en) 2011-08-07 2014-09-02 Monsanto Technology Llc Soybean variety A1026366
US8884106B2 (en) 2011-08-07 2014-11-11 Monsanto Technology Llc Soybean variety A1026397
US8604289B2 (en) 2011-08-07 2013-12-10 Monsanto Technology Llc Soybean variety A1026344
US8609951B2 (en) 2011-08-07 2013-12-17 Monsanto Technology Llc Soybean variety A1026335
US8653340B2 (en) 2011-08-07 2014-02-18 Monsanto Technology Llc Soybean variety A1026361
US8884105B2 (en) 2011-08-09 2014-11-11 Monsanto Technology Llc Soybean variety A1026393
US8829285B2 (en) 2011-08-09 2014-09-09 Monsanto Technology Llc Soybean variety A1026484
US8754296B2 (en) 2011-08-09 2014-06-17 Monsanto Technology Llc Soybean variety A1026474
US8653342B2 (en) 2011-08-09 2014-02-18 Monsanto Technology Llc Soybean variety A1026473
US8653341B2 (en) 2011-08-09 2014-02-18 Monsanto Technology Llc Soybean variety A1026458
US8748707B2 (en) 2011-08-09 2014-06-10 Monsanto Technology Llc Soybean variety A1026505
US8785739B2 (en) 2011-08-10 2014-07-22 Monsanto Technology Llc Soybean variety A1026577
US8884113B2 (en) 2011-08-10 2014-11-11 Monsanto Technology Llc Soybean variety A1026632
US8779248B2 (en) 2011-08-10 2014-07-15 Monsanto Technology Llc Soybean variety A1026561
US8884114B2 (en) 2011-08-10 2014-11-11 Monsanto Technology Llc Soybean variety D2011902
IN2014DN00156A (en) 2011-08-10 2015-05-22 Bayer Ip Gmbh
US8884112B2 (en) 2011-08-10 2014-11-11 Monsanto Technology Llc Soybean variety A1026631
US8722975B2 (en) 2011-08-10 2014-05-13 Monsanto Technology Llc Soybean variety D2011901
US8884115B2 (en) 2011-08-10 2014-11-11 Monsanto Technology Llc Soybean variety A1026591
US8772592B2 (en) 2011-08-10 2014-07-08 Monsanto Technology Llc Soybean variety A1026583
US8735675B2 (en) 2011-08-10 2014-05-27 Monsanto Technology Llc Soybean variety A1026643
US8748708B2 (en) 2011-08-11 2014-06-10 Monsanto Technology Llc Soybean variety A1026552
US8878018B2 (en) 2011-08-11 2014-11-04 Monsanto Technology Llc Soybean variety A1026622
US8884110B2 (en) 2011-08-11 2014-11-11 Monsanto Technology Llc Soybean variety A1026602
US8735674B2 (en) 2011-08-11 2014-05-27 Monsanto Technology Llc Soybean variety A1026548
US8735673B2 (en) 2011-08-11 2014-05-27 Monsanto Technology Llc Soybean variety A1026490
US8878017B2 (en) 2011-08-11 2014-11-04 Monsanto Technology Llc Soybean variety A1026611
US8785738B2 (en) 2011-08-11 2014-07-22 Monsanto Technology Llc Soybean variety A1026547
US8785740B2 (en) 2011-08-11 2014-07-22 Monsanto Technology Llc Soybean variety A1026597
US8754297B2 (en) 2011-08-11 2014-06-17 Monsanto Technology Llc Soybean variety A1026545
US8884111B2 (en) 2011-08-11 2014-11-11 Monsanto Technology Llc Soybean variety A1026616
US8822765B2 (en) 2011-08-11 2014-09-02 Monsanto Technology Llc Soybean variety D2011906
US8779249B2 (en) 2011-08-12 2014-07-15 Monsanto Technology Llc Soybean variety A1026562
US8440885B2 (en) * 2011-08-16 2013-05-14 Monsanto Technology Llc Soybean cultivar 08093572
US8772588B2 (en) 2011-08-16 2014-07-08 Monsanto Technology Llc Soybean variety A1026305
US8373032B1 (en) * 2011-08-16 2013-02-12 Monsanto Technology Llc Soybean cultivar 03284882
US8759618B2 (en) 2011-08-17 2014-06-24 Stine Seed Farm, Inc. Maize event HCEM485, compositions and methods for detecting and use thereof
US8748709B2 (en) 2011-08-19 2014-06-10 Monsanto Technology Llc Soybean variety A1026649
US8754298B2 (en) 2011-08-19 2014-06-17 Monsanto Technology Llc Soybean variety D2011903
US8735676B2 (en) 2011-08-19 2014-05-27 Monsanto Technology Llc Soybean variety A1026657
US8742224B2 (en) 2011-08-19 2014-06-03 Monsanto Technology Llc Soybean variety A1026645
US8735677B2 (en) 2011-08-19 2014-05-27 Monsanto Technology Llc Soybean variety A1026663
US8669435B2 (en) 2011-08-20 2014-03-11 Monsanto Technology Llc Soybean variety A1026754
US8680376B2 (en) 2011-08-20 2014-03-25 Monsanto Technology Llc Soybean variety A1026766
US8674187B2 (en) 2011-08-20 2014-03-18 Monsanto Technology Llc Soybean variety A1026807
US8674186B2 (en) 2011-08-20 2014-03-18 Monsanto Technology Llc Soybean variety A1026759
US8680377B2 (en) 2011-08-20 2014-03-25 Monsanto Technology Llc Soybean variety A1026767
US8921659B2 (en) 2011-08-20 2014-12-30 Monsanto Technology Llc Soybean variety A1026784
US8853498B2 (en) 2011-08-21 2014-10-07 Monsanto Technology Llc Soybean variety S100307
US8772596B2 (en) 2011-08-21 2014-07-08 Monsanto Technology Llc Soybean variety A1026832
US8754299B2 (en) 2011-08-21 2014-06-17 Monsanto Technology Llc Soybean variety A1026843
US8772595B2 (en) 2011-08-21 2014-07-08 Monsanto Technologyy LLC Soybean variety A1026828
US8772593B2 (en) 2011-08-21 2014-07-08 Monsanto Technology Llc Soybean variety A1026813
US8772594B2 (en) 2011-08-21 2014-07-08 Monsanto Technology Llc Soybean variety A1026823
US8604290B2 (en) 2011-08-22 2013-12-10 Monsanto Technology Llc Soybean variety A1026715
US8669433B2 (en) 2011-08-22 2014-03-11 Monsanto Technology Llc Soybean variety A1026705
US8829287B2 (en) 2011-08-22 2014-09-09 Monsanto Technology Llc Soybean variety A1026894
US8618368B2 (en) 2011-08-22 2013-12-31 Monsanto Technology Llc Soybean variety A1026729
US8674184B2 (en) 2011-08-22 2014-03-18 Monsanto Technology Llc Soybean variety A1026732
US8618366B2 (en) 2011-08-22 2013-12-31 Monsanto Technology Llc Soybean variety A1026711
US8618367B2 (en) 2011-08-22 2013-12-31 Monsanto Technology Llc Soybean variety D2011908
US8680375B2 (en) 2011-08-22 2014-03-25 Monsanto Technology Llc Soybean variety A1026730
BR112014003919A2 (en) 2011-08-22 2017-03-14 Bayer Cropscience Ag methods and means for modifying a plant genome
US8669434B2 (en) 2011-08-22 2014-03-11 Monsanto Technology Llc Soybean variety A1026708
US8822768B2 (en) 2011-08-22 2014-09-02 Monsanto Technology Llc Soybean variety A1026349
US8847025B2 (en) 2011-08-22 2014-09-30 Monsanto Technology Llc Soybean variety A1026642
US8642844B2 (en) 2011-08-23 2014-02-04 Monsanto Technology Llc Soybean variety D2011905
US8766047B2 (en) 2011-08-23 2014-07-01 Monsanto Technology Llc Soybean variety D2011904
US8614374B2 (en) 2011-08-23 2013-12-24 Monsanto Technology Llc Soybean variety A1026390
US8779242B2 (en) 2011-08-23 2014-07-15 Monsanto Technology Llc Soybean cultivar 09330782
US8809640B2 (en) 2011-08-23 2014-08-19 Monsanto Technology Llc Soybean variety A1026139
US8653343B2 (en) 2011-08-23 2014-02-18 Monsanto Technology Llc Soybean variety A1026677
US8822767B2 (en) 2011-08-24 2014-09-02 Monsanto Technology Llc Soybean variety A1026862
US8754300B2 (en) 2011-08-24 2014-06-17 Monsanto Technology Llc Soybean variety A1026846
US8829286B2 (en) 2011-08-24 2014-09-09 Monsanto Technology Llc Soybean variety A1026853
US8759627B2 (en) 2011-08-24 2014-06-24 Monsanto Technology Llc Soybean variety A1026848
US8816165B2 (en) 2011-08-24 2014-08-26 Monsanto Technology Llc Soybean variety A1026866
US8772597B2 (en) 2011-08-24 2014-07-08 Monsanto Technology Llc Soybean variety A1026857
US8674185B2 (en) 2011-08-25 2014-03-18 Monsanto Technology Llc Soybean variety A1026742
US8697954B2 (en) 2011-08-25 2014-04-15 Monsanto Technology Llc Soybean variety A1026431
US8217239B1 (en) * 2011-08-25 2012-07-10 Stine Seed Farm, Inc. Soybean cultivar 09114187
US8513498B2 (en) 2011-08-26 2013-08-20 Monsanto Technology Llc Soybean cultivar 00354818
EP2561759A1 (en) 2011-08-26 2013-02-27 Bayer Cropscience AG Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth
US8884108B2 (en) 2011-08-26 2014-11-11 Monsanto Technology Llc Soybean variety A1026416
US8415535B2 (en) 2011-08-26 2013-04-09 Monsanto Technology Llc Soybean cultivar 07115150
WO2013033143A2 (en) 2011-08-31 2013-03-07 Monsanto Technology Llc Molecular markers associated with stem canker resistance in soybean
WO2013033221A1 (en) 2011-08-31 2013-03-07 Monsanto Technology Llc Molecular markers associated with soybean tolerance to low iron growth conditions
CN103874681B (en) 2011-09-12 2017-01-18 拜耳知识产权有限责任公司 Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]methyl}-1,2,4-oxadizol-5(4H)-one derivatives
EP2755484A1 (en) 2011-09-16 2014-07-23 Bayer Intellectual Property GmbH Use of 5-phenyl- or 5-benzyl-2 isoxazoline-3 carboxylates for improving plant yield
UA115971C2 (en) 2011-09-16 2018-01-25 Байєр Інтеллектуал Проперті Гмбх Use of acylsulfonamides for improving plant yield
AR087873A1 (en) 2011-09-16 2014-04-23 Bayer Ip Gmbh USE OF PHENYLPIRAZOLIN-3-CARBOXYLATES TO IMPROVE PLANT PERFORMANCE
ES2628436T3 (en) 2011-10-04 2017-08-02 Bayer Intellectual Property Gmbh RNAi for the control of fungi and oomycetes by the inhibition of the sacropin dehydrogenase gene
AR088364A1 (en) * 2011-10-18 2014-05-28 Dow Agrosciences Llc MATERIALS AND METHODS FOR THE DETECTION OF THE ARYLOXIALCANOATE DIOXYGENASE GENE (AAD-12) IN PLANTS
US8389816B1 (en) * 2011-10-26 2013-03-05 Monsanto Technology Llc Soybean cultivar 02062556
US8431789B1 (en) 2011-10-26 2013-04-30 Monsanto Technology Llc Soybean cultivar 04184501
WO2013075817A1 (en) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives
US8791342B1 (en) * 2011-11-29 2014-07-29 Agrigenetics, Inc. Soybean cultivar 21202
US9725414B2 (en) 2011-11-30 2017-08-08 Bayer Intellectual Property Gmbh Fungicidal N-bicycloalkyl and N-tricycloalkyl pyrazole-4-(thio)carboxamide derivatives
WO2013092519A1 (en) 2011-12-19 2013-06-27 Bayer Cropscience Ag Use of anthranilic acid diamide derivatives for pest control in transgenic crops
WO2013098147A1 (en) 2011-12-29 2013-07-04 Bayer Intellectual Property Gmbh Fungicidal 3-[(pyridin-2-ylmethoxyimino)(phenyl)methyl]-2-substituted-1,2,4-oxadiazol-5(2h)-one derivatives
CN104039769B (en) 2011-12-29 2016-10-19 拜耳知识产权有限责任公司 3-[(1,3-thiazole-4-yl methoxyimino) (phenyl) methyl]-2-substituted-1,2,4-diazole-5 (2H) the-one derivant of antifungal
EP2806739A1 (en) 2012-01-25 2014-12-03 Bayer Intellectual Property GmbH Active compound combinations containing fluopyram and biological control agent
JP6182158B2 (en) 2012-01-25 2017-08-16 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Active compound combination comprising fluopyram, Bacillus and a biological control agent
PE20190345A1 (en) 2012-02-27 2019-03-07 Bayer Ip Gmbh ACTIVE COMPOUND COMBINATIONS
UY34690A (en) 2012-03-21 2013-09-30 Basf Se TANK MIXING ASSISTANT THAT INCLUDES AN ALKYL POLYGLUCIDE AND A BASE
UY34689A (en) 2012-03-21 2013-09-30 Basf Se Mixing aid in particulate solid tank comprising a base selected from a carbonate and / or a phosphate
AR090385A1 (en) 2012-03-21 2014-11-05 Basf Se MIXING ASSISTANT IN LIQUID OR PARTICULATED TANK THAT INCLUDES A SELECTED BASE OF A CARBONATE AND HYDROGENOCARBONATE MIXTURE
US20150051078A1 (en) 2012-03-21 2015-02-19 Basf Se Glyphosate tank mix adjuvant comprising a base selected from a carbonate and/or a phosphate
WO2013139949A1 (en) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprising a strigolactame compound for enhanced plant growth and yield
US8742222B2 (en) 2012-03-27 2014-06-03 Monsanto Technology Llc Soybean variety A1035754
US8754295B2 (en) 2012-03-27 2014-06-17 Monsanto Technology Llc Soybean variety A1035590
US8735669B2 (en) 2012-03-27 2014-05-27 Monsanto Technology Llc Soybean variety A1035724
US8742223B2 (en) 2012-03-27 2014-06-03 Monsanto Technology Llc Soybean variety A1035813
JP2015517996A (en) 2012-04-12 2015-06-25 バイエル・クロップサイエンス・アーゲーBayer Cropscience Ag N-acyl-2- (cyclo) alkylpyrrolidines and piperidines useful as fungicides
EP2838363A1 (en) 2012-04-20 2015-02-25 Bayer Cropscience AG N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives
AU2013251109B2 (en) 2012-04-20 2017-08-24 Bayer Cropscience Ag N-cycloalkyl-N-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives
EP2662370A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole benzofuranyl carboxamides
BR112014027644A2 (en) 2012-05-09 2017-06-27 Bayer Cropscience Ag 5-halopyrazole indanyl carboxamides
CN104768934B (en) 2012-05-09 2017-11-28 拜耳农作物科学股份公司 Pyrazole indanyl carboxamide
EP2662362A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole indanyl carboxamides
EP2662361A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazol indanyl carboxamides
EP2662363A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole biphenylcarboxamides
EP2662360A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole indanyl carboxamides
EP2662364A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole tetrahydronaphthyl carboxamides
AR091104A1 (en) 2012-05-22 2015-01-14 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS THAT INCLUDE A LIPO-CHYTOOLIGOSACARIDE DERIVATIVE AND A NEMATICIDE, INSECTICIDE OR FUNGICIDE COMPOUND
US10604767B2 (en) 2012-05-23 2020-03-31 Monsanto Technology Llc Haplotypes associated with improved dicamba tolerance and glyphosate tolerance in transgenic soybean plants
US8704048B2 (en) 2012-05-30 2014-04-22 Monsanto Technology Llc Soybean variety A1035473
US8802936B2 (en) 2012-05-30 2014-08-12 Monsanto Technology Llc Soybean variety A1035898
TR201816257T4 (en) 2012-05-30 2018-11-21 Bayer Cropscience Ag Composition comprising a biological control agent and trifloxystrobin.
US8796516B2 (en) 2012-05-30 2014-08-05 Monsanto Technology Llc Soybean variety A1036023
US8716568B2 (en) 2012-05-30 2014-05-06 Monsanto Technology Llc Soybean variety A1035869
US8729350B2 (en) 2012-05-30 2014-05-20 Monsanto Technology Llc Soybean variety A1035501
KR20150023475A (en) 2012-05-30 2015-03-05 바이엘 크롭사이언스 아게 Composition comprising a biological control agent and a fungicide selected from inhibitors of the lipid membrane synthesis, the melanine biosynthesis, the nucleic acid synthesis or the signal transduction
HRP20181752T1 (en) 2012-05-30 2018-12-28 Bayer Cropscience Ag Composition comprising a biological control agent and fluopicolide
US8722976B2 (en) 2012-05-30 2014-05-13 Monsanto Technology Llc Soybean variety A1035502
PT2854552T (en) 2012-05-30 2019-07-25 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide selected from inhibitors of amino acid or protein biosynthesis, inhibitors of atp production and inhibitors of the cell wall synthesis
US8704047B2 (en) 2012-05-30 2014-04-22 Monsanto Technology Llc Soybean variety A1035441
WO2013178658A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and an insecticide
EP3281526A1 (en) 2012-05-30 2018-02-14 Bayer CropScience Aktiengesellschaft Composition comprising a biological control agent and a fungicide
CN107027809A (en) 2012-05-30 2017-08-11 拜耳作物科学股份公司 The composition of fungicide comprising biocontrol agent and selected from Respiratory Chain Complex I or II inhibitor
EP2854535A1 (en) 2012-05-30 2015-04-08 Bayer Cropscience AG Compositions comprising a biological control agent and an insecticide
US8907166B2 (en) 2012-05-31 2014-12-09 Monsanto Technology Llc Soybean variety A1036233
US8822769B2 (en) 2012-05-31 2014-09-02 Monsanto Technology Llc Soybean variety A1036056
US8901383B2 (en) 2012-05-31 2014-12-02 Monsanto Technology Llc Soybean variety A1036218
US8912398B2 (en) 2012-05-31 2014-12-16 Monsanto Technology Llc Soybean variety A1036175
US9043966B2 (en) 2012-05-31 2015-06-02 Monsanto Technology Llc Soybean variety A1037439
US9029643B2 (en) 2012-05-31 2015-05-12 Monsanto Technology Llc Soybean variety A1036300
US8884116B2 (en) 2012-05-31 2014-11-11 Monsanto Technology Llc Soybean variety A1037458
US8901385B2 (en) 2012-05-31 2014-12-02 Monsanto Technology Llc Soybean variety A1037442
US8889954B2 (en) 2012-05-31 2014-11-18 Monsanto Technology Llc Soybean variety A1037429
US9043967B2 (en) 2012-05-31 2015-06-02 Monsanto Technology Llc Soybean variety A1037446
US8816166B2 (en) 2012-05-31 2014-08-26 Monsanto Technology Llc Soybean variety A1036077
US8927813B2 (en) 2012-05-31 2015-01-06 Monsanto Technology Llc Soybean variety A1036054
US8901384B2 (en) 2012-05-31 2014-12-02 Monsanto Technology Llc Soybean variety A1036257
US8895813B2 (en) 2012-05-31 2014-11-25 Monsanto Technology Llc Soybean variety A1037445
US8962933B2 (en) 2012-06-01 2015-02-24 Monsanto Technology Llc Soybean variety A1037459
US8901389B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037489
US8921660B2 (en) 2012-06-01 2014-12-30 Monsanto Technology Llc Soybean variety A1037511
US8907168B2 (en) 2012-06-01 2014-12-09 Monsanto Technology Llc Soybean variety A1037490
US8901387B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037469
US8901388B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037481
US8901391B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037503
US8907169B2 (en) 2012-06-01 2014-12-09 Monsanto Technology Llc Soybean variety A1037510
US8901390B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037492
US8946516B2 (en) 2012-06-01 2015-02-03 Monsanto Technology Llc Soybean variety A1037473
US8907167B2 (en) 2012-06-01 2014-12-09 Monsanto Technology Llc Soybean variety A1037474
US8921662B2 (en) 2012-06-01 2014-12-30 Monsanto Technology Llc Soybean variety S110147
US8901386B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037464
US8921661B2 (en) 2012-06-01 2014-12-30 Monsanto Technology Llc Soybean variety A1037518
US8901392B2 (en) 2012-06-01 2014-12-02 Monsanto Technology Llc Soybean variety A1037507
US8975475B2 (en) 2012-06-02 2015-03-10 Monsanto Technology Llc Soybean variety S110157
US8921663B2 (en) 2012-06-02 2014-12-30 Monsanto Technology Llc Soybean variety S110150
US8618369B2 (en) 2012-06-02 2013-12-31 Monsanto Technology Llc Soybean variety S110149
US8754301B2 (en) 2012-06-02 2014-06-17 Monsanto Technology Llc Soybean variety S110154
US8624093B2 (en) 2012-06-02 2014-01-07 Monsanto Technology Llc Soybean variety S110148
US8785741B2 (en) 2012-06-02 2014-07-22 Monsanton Technology Llc Soybean variety S110151
US8921664B2 (en) 2012-06-02 2014-12-30 Monsanto Technology Llc Soybean variety S110155
US8975477B2 (en) 2012-06-03 2015-03-10 Monsanto Technology Llc Soybean variety A1026620
US8987563B2 (en) 2012-06-03 2015-03-24 Monsanto Technology Llc Soybean variety A1035304
US8975476B2 (en) 2012-06-03 2015-03-10 Monsanto Technology Llc Soybean variety A1026329
US9049872B2 (en) 2012-06-03 2015-06-09 Monsanto Technology Llc Soybean variety A1026244
US8981184B2 (en) 2012-06-03 2015-03-17 Monsanto Technology Llc Soybean variety S110158
US8987562B2 (en) 2012-06-03 2015-03-24 Monsanto Technology Llc Soybean variety A1026312
US9000271B2 (en) 2012-06-03 2015-04-07 Monsanto Technology Llc Soybean variety S110159
US8779250B2 (en) 2012-06-04 2014-07-15 Monsanto Technology Llc Soybean variety A1035378
US8907171B2 (en) 2012-06-04 2014-12-09 Monsanto Technology Llc Soybean variety A1035334
US8729351B2 (en) 2012-06-04 2014-05-20 Monsanto Technology Llc Soybean variety A1035428
US8907172B2 (en) 2012-06-04 2014-12-09 Monsanto Technology Llc Soybean variety A1035361
US8766048B2 (en) 2012-06-04 2014-07-01 Monsanto Technology Llc Soybean variety A1035373
US8735679B2 (en) 2012-06-04 2014-05-27 Monsanto Technology Llc Soybean variety A1035368
US8735680B2 (en) 2012-06-04 2014-05-27 Monsanto Technology Llc Soybean variety A1036326
US8735678B2 (en) 2012-06-04 2014-05-27 Monsanto Technology Llc Soybean variety A1035365
US8722977B2 (en) 2012-06-04 2014-05-13 Monsanto Technology Llc Soybean variety A1036320
US8907170B2 (en) 2012-06-04 2014-12-09 Monsanto Technology Llc Soybean variety A1035315
US8907173B2 (en) 2012-06-04 2014-12-09 Monsanto Technology Llc Soybean variety A1035362
US8729352B2 (en) 2012-06-04 2014-05-20 Monsanto Technology Llc Soybean variety A1035431
US8735682B2 (en) 2012-06-05 2014-05-27 Monsanto Technology Llc Soybean variety A1036387
US8729353B2 (en) 2012-06-05 2014-05-20 Monsanto Technology Llc Soybean variety A1036386
US8907177B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1037391
US8907178B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1037405
US8912399B2 (en) 2012-06-05 2014-12-16 Monsanto Technology Llc Soybean variety A1036465
US8735681B2 (en) 2012-06-05 2014-05-27 Monsanto Technology Llc Soybean variety A1036372
US8907179B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1037420
US8722978B2 (en) 2012-06-05 2014-05-13 Monsanto Technology Llc Soybean variety A1036377
US8907175B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1036609
US8907174B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1036466
US8907176B2 (en) 2012-06-05 2014-12-09 Monsanto Technology Llc Soybean variety A1037390
US8766049B2 (en) 2012-06-06 2014-07-01 Monsanto Technology Llc Soybean variety A1036413
US8759628B2 (en) 2012-06-06 2014-06-24 Monsanto Technology Llc Soybean variety A1035398
US8907180B2 (en) 2012-06-06 2014-12-09 Monsanto Technology Llc Soybean variety A1037425
CA2873822C (en) 2012-06-21 2020-09-22 Basf Se An aqueous composition comprising dicamba, and a fatty alcohol alkoxylate as a drift control agent
EP2676536A1 (en) 2012-06-22 2013-12-25 AIT Austrian Institute of Technology GmbH Method for producing plant seed containing endophytic micro-organisms
BR112014032442B8 (en) 2012-06-25 2023-05-16 Dow Agrosciences Llc METHOD FOR DETECTING NUCLEIC ACID SEQUENCES FROM SOYBEAN EVENT PDAB9582.816.15.1
US8461425B1 (en) 2012-06-27 2013-06-11 Monsanto Technology Llc Soybean cultivar 14454401
US8426696B1 (en) 2012-06-27 2013-04-23 Monsanto Technology Llc Soybean cultivar S110133
US8450572B1 (en) * 2012-06-27 2013-05-28 Monsanto Technology Llc Soybean cultivar 14163501
US8450576B1 (en) 2012-06-27 2013-05-28 Monsanto Technology Llc Soybean cultivar 03002101
US8431793B1 (en) 2012-06-27 2013-04-30 Monsanto Technology Llc Soybean cultivar 11133031
US8436233B1 (en) 2012-06-27 2013-05-07 Monsanto Technology Llc Soybean cultivar 05121531
US8450574B1 (en) 2012-06-27 2013-05-28 Monsanto Technology Llc Soybean cultivar 13350612
US8436232B1 (en) 2012-06-27 2013-05-07 Monsanto Technology Llc Soybean cultivar 12133031
US8455730B1 (en) 2012-06-27 2013-06-04 Monsanto Technology Llc Soybean cultivar 14172101
US8431792B1 (en) 2012-06-27 2013-04-30 Monsanto Technology Llc Soybean cultivar 18340601
US8431790B1 (en) * 2012-06-27 2013-04-30 Monsanto Technology Llc Soybean cultivar 19002011
US8431791B1 (en) 2012-06-27 2013-04-30 Monsanto Technology Llc Soybean cultivar 15172101
US8426697B1 (en) * 2012-06-27 2013-04-23 Monsanto Technology Llc Soybean cultivar S110135
US8450573B1 (en) * 2012-06-27 2013-05-28 Monsanto Technology Llc Soybean cultivar S110014
US8450575B1 (en) * 2012-06-27 2013-05-28 Monsanto Technology Llc Soybean cultivar 13182736
US8426699B1 (en) * 2012-06-28 2013-04-23 Monsanto Technology Llc Soybean cultivar S110141
US8431797B1 (en) 2012-06-28 2013-04-30 Monsanto Technology Llc Soybean cultivar 00362508
US8552271B1 (en) 2012-06-28 2013-10-08 Monsanto Technology Llc Soybean cultivar 08194832
US8502032B1 (en) 2012-06-28 2013-08-06 Monsanto Technology Llc Soybean cultivar 14333215
US8507766B1 (en) 2012-06-28 2013-08-13 Monsanto Technology Llc Soybean cultivar S110140
US8431796B1 (en) 2012-06-28 2013-04-30 Monsanto Technology Llc Soybean cultivar S110143
US8431794B1 (en) * 2012-06-28 2013-04-30 Monsanto Technology Llc Soybean cultivar S110008
US8455732B1 (en) 2012-06-28 2013-06-04 Monsanto Technology Llc Soybean cultivar 14070051
US8455731B1 (en) 2012-06-28 2013-06-04 Monsanto Technology Llc Soybean cultivar 02333338
US8450577B1 (en) 2012-06-28 2013-05-28 Monsanto Technology Llc Soybean cultivar S110145
US8581056B1 (en) * 2012-06-28 2013-11-12 Monsanto Technology Llc Soybean cultivar S110134
US8399747B1 (en) 2012-06-28 2013-03-19 Monsanto Technology Llc Soybean cultivar 1446437
US8426698B1 (en) 2012-06-28 2013-04-23 Monsanto Technology Llc Soybean cultivar S110137
US8431795B1 (en) 2012-06-28 2013-04-30 Monsanto Technology Llc Soybean cultivar S110142
US8373033B1 (en) 2012-06-28 2013-02-12 Monsanto Technology Llc Soybean cultivar 05274456
US8395028B1 (en) 2012-06-29 2013-03-12 Monsanto Technology Llc Soybean cultivar 12421671
US8502033B1 (en) 2012-06-29 2013-08-06 Monsanto Technology Llc Soybean cultivar 11374861
US8455733B1 (en) 2012-06-29 2013-06-04 Monsanto Technology Llc Soybean cultivar 12420961
US8471109B1 (en) 2012-06-29 2013-06-25 Monsanto Technology Llc Soybean cultivar 10110882
US8592660B1 (en) 2012-06-29 2013-11-26 Monsanto Technology Llc Soybean cultivar 13430771
US8502034B1 (en) 2012-06-29 2013-08-06 Monsanto Technology Llc Soybean cultivar 18172925
US8431798B1 (en) 2012-06-29 2013-04-30 Monsanto Technology Llc Soybean cultivar S110136
US8604291B1 (en) * 2012-06-29 2013-12-10 Monsanto Technology Llc Soybean cultivar S110139
US8471110B1 (en) 2012-06-29 2013-06-25 Monsanto Technology Llc Soybean cultivar 16480296
US8471111B1 (en) 2012-06-29 2013-06-25 Monsanto Technology Llc Soybean cultivar 17164777
US8436234B1 (en) 2012-06-29 2013-05-07 Monsanto Technology Llc Soybean cultivar 15070051
US8604292B1 (en) 2012-07-01 2013-12-10 Monsanto Technology Llc Soybean cultivar 12302458
US8450578B1 (en) 2012-07-01 2013-05-28 Monsanto Technology Llc Soybean cultivar S110144
MX2015000245A (en) 2012-07-03 2015-08-12 Basf Se Highly concentrated aqueous formulation comprising an anionic pesticide and a base.
EP2869699A1 (en) 2012-07-09 2015-05-13 BASF Corporation Drift control agent comprising polypropylene glycol and a triblock polymer
US8524989B1 (en) 2012-07-27 2013-09-03 Monsanto Technology Llc Soybean cultivar 17140094
US8604293B1 (en) 2012-07-27 2013-12-10 Monsanto Technology Llc Soybean cultivar 12004711
US8541663B1 (en) 2012-07-27 2013-09-24 Monsanto Technology Llc Soybean cultivar S110146
US8450579B1 (en) 2012-07-27 2013-05-28 Monsanto Technology Llc Soybean cultivar 10442723
EP2879493B1 (en) 2012-07-31 2018-09-19 Bayer CropScience AG Pesticidal compositions comprising a terpene mixture and flupyradifurone
US8541664B1 (en) 2012-08-08 2013-09-24 Monsanto Technology Llc Soybean cultivar 15115139
US8552272B1 (en) 2012-08-08 2013-10-08 Monsanto Technology Llc Soybean cultivar 14265229
US8563822B1 (en) 2012-08-08 2013-10-22 Monsanto Technology Llc Soybean cultivar 15211129
US8431800B1 (en) 2012-08-08 2013-04-30 Monsanto Technology Llc Soybean cultivar 13285180
US8609952B1 (en) * 2012-08-08 2013-12-17 Monsanto Technology Llc Soybean cultivar 15120100
US8502035B1 (en) 2012-08-08 2013-08-06 Monsanto Technology Llc Soybean cultivar 16352100
US8431799B1 (en) 2012-08-08 2013-04-30 Monsanto Technology Llc Soybean cultivar 12245180
US8552273B1 (en) 2012-08-08 2013-10-08 Monsanto Technology Llc Soybean cultivar 15332100
US8502036B1 (en) 2012-08-08 2013-08-06 Monsanto Technology Llc Soybean cultivar 13203100
WO2014043435A1 (en) 2012-09-14 2014-03-20 Bayer Cropscience Lp Hppd variants and methods of use
US8569590B1 (en) 2012-09-18 2013-10-29 Monsanto Technology Llc Soybean cultivar 08273775
US8581057B1 (en) 2012-09-18 2013-11-12 Monsanto Technology Llc Soybean cultivar 08351577
US8524990B1 (en) 2012-09-18 2013-09-03 Monsanto Technology Llc Soybean cultivar 07340418
EP2719280A1 (en) 2012-10-11 2014-04-16 Bayer CropScience AG Use of N-phenylethylpyrazole carboxamide derivatives or salts thereof for resistance management of phytopathogenic fungi
CN105357968A (en) 2012-10-19 2016-02-24 拜尔农科股份公司 Active compound combinations comprising carboxamide derivatives
CA2888559C (en) 2012-10-19 2021-03-02 Bayer Cropscience Ag Method for enhancing tolerance to abiotic stress in plants using carboxamide or thiocarboxamide derivatives
ES2665320T3 (en) 2012-10-19 2018-04-25 Bayer Cropscience Ag Method of treating fungicide resistant plants against fungi using carboxamide or thiocarboxamide derivatives
PL2908640T3 (en) 2012-10-19 2020-06-29 Bayer Cropscience Ag Method of plant growth promotion using carboxamide derivatives
EP2735231A1 (en) 2012-11-23 2014-05-28 Bayer CropScience AG Active compound combinations
WO2014083088A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary fungicidal mixtures
EP2925134B1 (en) 2012-11-30 2019-12-25 Bayer CropScience AG Ternary fungicidal mixtures
BR112015012473A2 (en) 2012-11-30 2017-07-11 Bayer Cropscience Ag pesticide and fungicide binary mixtures
EP2925138A1 (en) 2012-11-30 2015-10-07 Bayer CropScience AG Ternary fungicidal and pesticidal mixtures
WO2014083033A1 (en) 2012-11-30 2014-06-05 Bayer Cropsience Ag Binary fungicidal or pesticidal mixture
MX2015006631A (en) 2012-12-03 2015-08-05 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide.
JP2015535532A (en) 2012-12-03 2015-12-14 バイエル・クロップサイエンス・アクチェンゲゼルシャフト Composition comprising biopesticides and fungicides
PT2925142T (en) 2012-12-03 2018-05-18 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
WO2014086759A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
CN105007741A (en) 2012-12-03 2015-10-28 拜耳作物科学股份公司 Composition comprising a biological control agent and a fungicide
WO2014086753A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
EP3318129B1 (en) 2012-12-03 2019-11-06 Bayer CropScience Aktiengesellschaft Method for pest control by applying a combination of paecilomyces lilacinus and fluopyram
EP2925144A2 (en) 2012-12-03 2015-10-07 Bayer CropScience AG Composition comprising a biological control agent and an insecticide
AR093909A1 (en) 2012-12-12 2015-06-24 Bayer Cropscience Ag USE OF ACTIVE INGREDIENTS TO CONTROL NEMATODES IN CULTURES RESISTANT TO NEMATODES
CN105074061B (en) 2012-12-13 2021-03-09 美国陶氏益农公司 DNA detection method for site-specific nuclease activity
US9024116B2 (en) 2012-12-18 2015-05-05 Monsanto Technology Llc Soybean variety A1035957
US9024117B2 (en) 2012-12-18 2015-05-05 Monsanto Technology Llc Soybean variety A1037394
US9040779B2 (en) 2012-12-18 2015-05-26 Monsanto Technology Llc Soybean variety A1035446
AR093996A1 (en) 2012-12-18 2015-07-01 Bayer Cropscience Ag BACTERICIDAL COMBINATIONS AND BINARY FUNGICIDES
US9029644B2 (en) 2012-12-18 2015-05-12 Monsanto Technology Llc Soybean variety A1037403
BR112015014307A2 (en) 2012-12-19 2017-07-11 Bayer Cropscience Ag difluoromethyl nicotinic tetrahydronaphthyl carboxamides
ES2953523T3 (en) * 2012-12-27 2023-11-14 Keygene Nv Method for inducing a directed translocation in a plant
US9192138B1 (en) 2014-05-02 2015-11-24 M.S. Technologies, Llc Soybean cultivar S130057
AU2013377774A1 (en) 2013-02-05 2015-09-17 University Of Saskatchewan Endophytic microbial symbionts in plant prenatal care
MX2015010260A (en) 2013-02-11 2016-04-04 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and a fungicide.
KR20150119031A (en) 2013-02-11 2015-10-23 바이엘 크롭사이언스 엘피 Compositions comprising a streptomyces-based biological control agent and an insecticide
MX2015010259A (en) 2013-02-11 2015-10-29 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and another biological control agent.
RU2723717C2 (en) 2013-03-07 2020-06-17 Атеникс Корп. Toxins genes and methods of using them
CN103409498A (en) * 2013-03-14 2013-11-27 海康生物科技(北京)有限公司 Detection method and a kit of transgenic soybean MON89788 transformation event
BR112015026235A2 (en) 2013-04-19 2017-10-10 Bayer Cropscience Ag method for improving utilization of the potential of transgenic plant production involving the application of a phthaldiamide derivative
US9554573B2 (en) 2013-04-19 2017-01-31 Bayer Cropscience Aktiengesellschaft Binary insecticidal or pesticidal mixture
BR112015026129A2 (en) * 2013-04-19 2017-10-17 Bayer Cropscience Ag method to fight pests
TW201507722A (en) 2013-04-30 2015-03-01 Bayer Cropscience Ag N-(2-halogen-2-phenethyl)carboxamides as nematicides and endoparasiticides
WO2014177514A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag Nematicidal n-substituted phenethylcarboxamides
US8735685B1 (en) 2013-05-15 2014-05-27 Monsanto Technology Llc Soybean cultivar 27311841
US8829290B1 (en) 2013-05-15 2014-09-09 Monsanto Technology Llc Soybean cultivar 23210992
US8766053B1 (en) 2013-05-15 2014-07-01 Monsanto Technology Llc Soybean cultivar S120119
US8847027B1 (en) 2013-05-15 2014-09-30 Monsanto Technology Llc Soybean cultivar S120111
US8766052B1 (en) 2013-05-15 2014-07-01 Monsanto Technology Llc Soybean cultivar S120112
US8772600B1 (en) 2013-05-20 2014-07-08 Monsanto Technology Llc Soybean cultivar 29140711
US8822776B1 (en) 2013-05-20 2014-09-02 Monsanto Technology Llc Soybean cultivar S120107
US8772598B1 (en) 2013-05-20 2014-07-08 Monsanto Technology Llc Soybean cultivar 29124801
US8884121B1 (en) 2013-05-20 2014-11-11 Monsanto Technology Llc Soybean cultivar 23272101
US8829291B1 (en) 2013-05-20 2014-09-09 Monsanto Technology Llc Soybean cultivar 21150231
US8937224B2 (en) 2013-05-20 2015-01-20 Monsanto Technology Llc Soybean cultivar 20453014
US8772599B1 (en) 2013-05-20 2014-07-08 Monsanto Technology Llc Soybean cultivar 01373542
US8816168B1 (en) 2013-05-20 2014-08-26 Monsanto Technology Llc Soybean cultivar S120108
US8772601B1 (en) 2013-05-20 2014-07-08 Monsanto Technology Llc Soybean cultivar 28384013
US8802938B1 (en) 2013-05-20 2014-08-12 Monsanto Technology Llc Soybean cultivar 27113942
US8884123B1 (en) 2013-05-20 2014-11-11 Monsanto Technology Llc Soybean cultivar 14164959
US8884122B1 (en) 2013-05-20 2014-11-11 Monsanto Technology Llc Soybean cultivar 23183371
US8722991B1 (en) 2013-05-21 2014-05-13 Monsanto Technology Llc Soybean cultivar 17110882
US8829292B1 (en) 2013-05-21 2014-09-09 Monsanto Technology Llc Soybean cultivar 27471761
US8884124B1 (en) 2013-05-21 2014-11-11 Monsanto Technology Llc Soybean cultivar 22164261
US8772602B1 (en) 2013-05-21 2014-07-08 Monsanto Technology Llc Soybean cultivar 22290432
US8816169B1 (en) 2013-05-21 2014-08-26 Monsanto Technology Llc Soybean cultivar S120106
US8735686B1 (en) 2013-05-21 2014-05-27 Monsanto Technology Llc Soybean cultivar S120117
US9035138B2 (en) 2013-05-31 2015-05-19 Monsanto Technology Llc Soybean variety 01045772
US9198378B2 (en) 2013-05-31 2015-12-01 Monsanto Technology Llc Soybean variety 01045720
US9198375B2 (en) 2013-05-31 2015-12-01 Monsanto Technology Llc Soybean variety A1036073
US9155266B2 (en) 2013-05-31 2015-10-13 Monsanto Technology Llc Soybean variety 01046882
US9179698B2 (en) 2013-05-31 2015-11-10 Monsanto Technology Llc Soybean variety 01045742
US9198374B2 (en) 2013-05-31 2015-12-01 Monsanto Technology Llc Soybean variety 01046251
US9029651B2 (en) 2013-05-31 2015-05-12 Monsanto Technology Llc Soybean variety 01046192
US9198377B2 (en) 2013-05-31 2015-12-01 Monsanto Technology Llc Soybean variety 01045767
US9155265B2 (en) 2013-05-31 2015-10-13 Monsanto Technology Llc Soybean variety 01046875
US9035139B2 (en) 2013-05-31 2015-05-19 Monsanto Technology Llc Soybean variety 01046169
US9179622B2 (en) 2013-05-31 2015-11-10 Monsanto Technology Llc Soybean variety A1036060
US9155264B2 (en) 2013-05-31 2015-10-13 Monsanto Technology Llc Soybean variety 01045768
US9198376B2 (en) 2013-05-31 2015-12-01 Monsanto Technology Llc Soybean variety A1036086
US9029650B2 (en) 2013-05-31 2015-05-12 Monsanto Technology Llc Soybean variety 01046137
US9029649B2 (en) 2013-05-31 2015-05-12 Monsanto Technology Llc Soybean variety 01045749
US9024133B2 (en) * 2013-06-01 2015-05-05 Monsanto Technology Llc Soybean variety A1036109
US9035140B2 (en) 2013-06-01 2015-05-19 Monsanto Technology Llc Soybean variety A1036101
US9024134B2 (en) 2013-06-01 2015-05-05 Monsanto Technology Llc Soybean variety 01045652
US9024135B2 (en) 2013-06-01 2015-05-05 Monsanto Technology Llc Soybean variety 01045679
US9232707B2 (en) 2013-06-02 2016-01-12 Monsanto Technology Llc Soybean variety A1036212
US9029665B2 (en) 2013-06-02 2015-05-12 Monsanto Technology Llc Soybean variety A1036361
US9035141B2 (en) 2013-06-02 2015-05-19 Monsanto Technology Llc Soybean variety A1036360
US9107370B2 (en) 2013-06-02 2015-08-18 Monsanto Technology Llc Soybean variety A1036375
US9107369B2 (en) 2013-06-02 2015-08-18 Monsanto Technology Llc Soybean variety A1036303
US9232708B2 (en) 2013-06-03 2016-01-12 Monsanto Technology Llc Soybean variety 01045691
US9101104B2 (en) 2013-06-03 2015-08-11 Monsanto Technology Llc Soybean variety A1036103
US9018465B2 (en) 2013-06-03 2015-04-28 Monsanto Technology Llc Soybean variety A1036176
US9101105B2 (en) 2013-06-03 2015-08-11 Monsanto Technology Llc Soybean variety A1036172
US9179623B2 (en) 2013-06-03 2015-11-10 Monsanto Technology Llc Soybean variety 01045719
US9232709B2 (en) 2013-06-03 2016-01-12 Monsanto Technology Llc Soybean variety 01045692
US9232710B2 (en) 2013-06-03 2016-01-12 Monsanto Technology Llc Soybean variety 01045710
US9237695B2 (en) 2013-06-03 2016-01-19 Monsanto Technology Llc Soybean variety A1036208
US9179626B2 (en) 2013-06-03 2015-11-10 Monsanto Technology Llc Soybean variety A1036419
US9179624B2 (en) 2013-06-03 2015-11-10 Monsanto Technology Llc Soybean variety A1036232
US9179625B2 (en) 2013-06-03 2015-11-10 Monsanto Technology Llc Soybean variety A1036312
US9024136B2 (en) 2013-06-03 2015-05-05 Monsanto Technology Llc Soybean variety A1036170
US9018466B2 (en) 2013-06-05 2015-04-28 Monsanto Technology Llc Soybean variety 01046975
US9232713B2 (en) 2013-06-05 2016-01-12 Monsanto Technology Llc Soybean variety A1035917
US9232712B2 (en) 2013-06-05 2016-01-12 Monsanto Technology Llc Soybean variety A1035727
US9155267B2 (en) 2013-06-05 2015-10-13 Monsanto Technology Llc Soybean variety A1035341
US9155269B2 (en) 2013-06-05 2015-10-13 Monsanto Technology Llc Soybean variety A1035300
US9155270B2 (en) 2013-06-05 2015-10-13 Monsanto Technology Llc Soybean variety A1035471
US9018467B2 (en) 2013-06-05 2015-04-28 Monsanto Technology Llc Soybean variety A1035346
US9107371B2 (en) 2013-06-05 2015-08-18 Monsanto Technology Llc Soybean variety 01046959
US9107373B2 (en) 2013-06-05 2015-08-18 Monsanto Technology Llc Soybean variety A1036006
US9232711B2 (en) 2013-06-05 2016-01-12 Monsanto Technology Llc Soybean variety 01046977
US9101107B2 (en) 2013-06-05 2015-08-11 Monsanto Technology Llc Soybean variety 01046967
US9155268B2 (en) 2013-06-05 2015-10-13 Monsanto Technology Llc Soybean variety A1026287
US9226460B2 (en) 2013-06-05 2016-01-05 Monsanto Technology Llc Soybean variety A1035731
US9101106B2 (en) 2013-06-05 2015-08-11 Monsanto Technology Llc Soybean variety 01046941
US9107372B2 (en) 2013-06-05 2015-08-18 Monsanto Technology Llc Soybean variety 01046965
US9179627B2 (en) 2013-06-05 2015-11-10 Monsanto Technology Llc Soybean variety A1035408
US9237696B2 (en) 2013-06-05 2016-01-19 Monsanto Technology Llc Soybean variety A1035594
US9179628B2 (en) 2013-06-06 2015-11-10 Monsanto Technology Llc Soybean variety A1036005
US9232714B2 (en) 2013-06-06 2016-01-12 Monsanto Technology Llc Soybean variety A1036394
US9179629B2 (en) 2013-06-06 2015-11-10 Monsanto Technology Llc Soybean variety A1035330
US9237697B2 (en) 2013-06-06 2016-01-19 Monsanto Technology Llc Soybean variety A1036292
US9107374B2 (en) 2013-06-07 2015-08-18 Monsanto Technology Llc Soybean variety 01046905
US9155271B2 (en) 2013-06-07 2015-10-13 Monsanto Technology Llc Soybean variety 01046887
US9066489B2 (en) 2013-06-09 2015-06-30 Monsanto Technology Llc Soybean variety A1035374
US9029652B2 (en) 2013-06-09 2015-05-12 Monsanto Technology Llc Soybean variety 01046873
US9066490B2 (en) 2013-06-09 2015-06-30 Monsanto Technology Llc Soybean variety A1035302
US9179631B2 (en) 2013-06-09 2015-11-10 Monsanto Technology Llc Soybean variety A1037431
US9179630B2 (en) 2013-06-09 2015-11-10 Monsanto Technology Llc Soybean variety A1037404
US9107375B2 (en) 2013-06-09 2015-08-18 Monsanto Technology Llc Soybean variety A1036601
US9155272B2 (en) 2013-06-09 2015-10-13 Monsanto Technology Llc Soybean variety A1037423
US9198379B2 (en) 2013-06-10 2015-12-01 Monsanto Technology Llc Soybean variety A1036445
US9198381B2 (en) 2013-06-10 2015-12-01 Monsanto Technology Llc Soybean variety A1037432
US9155273B2 (en) 2013-06-10 2015-10-13 Monsanto Technology Llc Soybean variety A1037448
US9198382B2 (en) 2013-06-10 2015-12-01 Monsanto Technology Llc Soybean variety A1037434
US9101108B2 (en) 2013-06-10 2015-08-11 Monsanto Technology Llc Soybean variety A1037452
US9192119B2 (en) 2013-06-10 2015-11-24 Monsanto Technology Llc Soybean variety A1036554
US9107376B2 (en) 2013-06-10 2015-08-18 Monsanto Technology Llc Soybean variety A1037450
US9029653B2 (en) 2013-06-10 2015-05-12 Monsanto Technology Llc Soybean variety A1036421
US9198380B2 (en) 2013-06-10 2015-12-01 Monsanto Technology Llc Soybean variety A1036446
US9101110B2 (en) 2013-06-10 2015-08-11 Monsanto Technology Llc Soybean variety A1035791
US9029654B2 (en) 2013-06-10 2015-05-12 Monsanto Technology Llc Soybean variety A1036442
US9101109B2 (en) 2013-06-10 2015-08-11 Monsanto Technology Llc Soybean variety A1037476
US10059999B2 (en) 2013-06-10 2018-08-28 Monsanto Technology Llc Molecular markers associated with soybean tolerance to low iron growth conditions
US9018468B1 (en) 2013-06-14 2015-04-28 Monsanto Technology Llc Soybean cultivar 29254233
US8889960B1 (en) 2013-06-14 2014-11-18 Monsanto Technology Llc Soybean cultivar S120120
US8829293B1 (en) 2013-06-14 2014-09-09 Monsanto Technology Llc Soybean cultivar 22170671
US8829295B1 (en) 2013-06-14 2014-09-09 Monsanto Technology Llc Soybean cultivar 28241823
US8759631B1 (en) 2013-06-14 2014-06-24 Monsanto Technology Llc Soybean cultivar 25261523
US8889961B1 (en) 2013-06-14 2014-11-18 Monsanto Technology Llc Soybean cultivar 27120191
US9006534B1 (en) 2013-06-14 2015-04-14 Monsanto Technology Llc Soybean cultivar S120115
US8829294B1 (en) 2013-06-14 2014-09-09 Monsanto Technology Llc Soybean cultivar 23170671
US8772603B1 (en) 2013-06-14 2014-07-08 Monsanto Technology Llc Soybean cultivar S120116
US10136646B2 (en) 2013-06-26 2018-11-27 Indigo Ag, Inc. Agricultural endophyte-plant compositions, and methods of use
MX372594B (en) 2013-06-26 2020-04-20 Indigo Ag Inc SEED-DERIVED ENDOPHYTIC POPULATIONS, COMPOSITIONS AND METHODS OF USE.
US9770022B2 (en) 2013-06-26 2017-09-26 Bayer Cropscience Ag N-cycloalkyl-N-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives
WO2015007287A1 (en) * 2013-07-17 2015-01-22 Cheminova A/S Controlling charcoal rot with flutriafol
US9271462B1 (en) 2013-08-29 2016-03-01 Monsanto Technology Llc Soybean variety XB49AE13
US9332713B1 (en) 2013-08-29 2016-05-10 Monsanto Technology Llc Soybean variety XB44K13
CA2861213A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb21z13
CA2861223A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb23ab13
CA2861217C (en) 2013-08-29 2022-07-19 Monsanto Technology Llc Soybean variety xb007g13
US9485930B1 (en) 2013-08-29 2016-11-08 Monsanto Technology Llc Soybean variety XB35W13
US9408359B1 (en) 2013-08-29 2016-08-09 Monsanto Technology Llc Soybean variety XB36G13
US9332710B2 (en) 2013-08-29 2016-05-10 Monsanto Technology Llc Soybean variety XB22A13
US9485931B1 (en) 2013-08-29 2016-11-08 Monsanto Technology Llc Soybean variety XB39C13
US9320233B1 (en) 2013-08-29 2016-04-26 Monsanto Technology Llc Soybean variety XB55B13
US9480226B1 (en) 2013-08-29 2016-11-01 Monsanto Technology Llc Soybean variety XB34Z13
US9271464B1 (en) 2013-08-29 2016-03-01 Monsanto Technology Llc Soybean variety XB35Y13
CA2861184A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb33z13
CA2861263A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb28t13
US9271463B1 (en) 2013-08-29 2016-03-01 Monsanto Technology Llc Soybean variety XB56V13
US9485932B1 (en) 2013-08-29 2016-11-08 Monsanto Technology Llc Soybean variety XB40U13
CA2861225A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb04f13
US9408358B1 (en) 2013-08-29 2016-08-09 Monsanto Technology Llc Soybean variety XB34Y13
US9408357B1 (en) 2013-08-29 2016-08-09 Monsanto Technology Llc Soybean variety XB35X13
US9445567B1 (en) 2013-08-29 2016-09-20 Monsanto Technology Llc Soybean variety XB39D13
CA2861228A1 (en) 2013-08-29 2015-02-28 Monsanto Technology Llc Soybean variety xb09ae13
HUE048666T2 (en) 2013-09-04 2020-08-28 Indigo Ag Inc Agricultural endophyte-plant compositions, and methods of use
WO2015069938A1 (en) 2013-11-06 2015-05-14 The Texas A & M University System Fungal endophytes for improved crop yields and protection from pests
US10071967B2 (en) 2013-12-05 2018-09-11 Bayer Cropscience Aktiengesellschaft N-cycloalkyl-N-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
CN105793243A (en) 2013-12-05 2016-07-20 拜耳作物科学股份公司 N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
US9497914B2 (en) 2013-12-12 2016-11-22 Monsanto Technology Llc Soybean variety 01045730
US9554529B2 (en) 2013-12-13 2017-01-31 Monsanto Technology Llc Soybean variety 01046035
US9357731B2 (en) 2013-12-13 2016-06-07 Monsanto Technology Llc Soybean variety 01046948
US9554528B2 (en) * 2013-12-13 2017-01-31 Monsanto Technology Llc Soybean variety 01045954
US9370155B2 (en) 2013-12-16 2016-06-21 Monsanto Technology Llc Soybean variety 01046182
US9445568B1 (en) 2013-12-17 2016-09-20 Monsanto Technology Llc Soybean variety 01046626
CA2875106A1 (en) 2013-12-17 2015-06-17 Monsanto Technology Llc Soybean variety 01046426
US9345217B2 (en) 2013-12-17 2016-05-24 Monsanto Technology Llc Soybean variety 01046814
US9386754B2 (en) 2013-12-17 2016-07-12 Monsanto Technology, Llc Soybean variety 01046551
US9370157B2 (en) 2013-12-17 2016-06-21 Monsanto Technology Llc Soybean variety 01046703
CN103725777B (en) * 2013-12-18 2015-07-15 南京佳邦食品有限公司 Real-time fluorescence PCR (Polymerase Chain Reaction) method for rapidly detecting transgenic soybean MON89788
US9220221B2 (en) 2013-12-18 2015-12-29 Monsanto Technology Llc Soybean variety 01050487
US9363967B2 (en) 2013-12-18 2016-06-14 Monsanto Technology Llc Soybean variety 01046942
US9232716B2 (en) 2013-12-18 2016-01-12 Monsanto Technology Llc Soybean variety 01050485
US9370156B2 (en) 2013-12-18 2016-06-21 Monsanto Technology Llc Soybean variety 01046863
US9155277B2 (en) 2013-12-18 2015-10-13 Monsanto Technology Llc Soybean variety 01045636
US9155276B2 (en) 2013-12-18 2015-10-13 Monsanto Technology Llc Soybean variety 01050478
US9357732B2 (en) 2013-12-18 2016-06-07 Monsanto Technology Llc Soybean variety 01046898
US9220222B2 (en) 2013-12-18 2015-12-29 Monsanto Technology Llc Soybean variety 01046250
EP2885970A1 (en) 2013-12-21 2015-06-24 Bayer CropScience AG Fungicide compositions comprising compound I, at least one succinate dehydrogenase (SDH) inhibitor and at least one triazole fungicide
US9364005B2 (en) 2014-06-26 2016-06-14 Ait Austrian Institute Of Technology Gmbh Plant-endophyte combinations and uses therefor
WO2015100432A2 (en) 2013-12-24 2015-07-02 Symbiota, Inc. Method for propagating microorganisms within plant bioreactors and stably storing microorganisms within agricultural seeds
EP3086646A4 (en) 2013-12-24 2017-08-09 Indigo AG, Inc. Plants containing beneficial endophytes
US20150184193A1 (en) * 2013-12-30 2015-07-02 Dow Agrosciences Llc Trait stacking strategy for corn introgression
US20150181822A1 (en) * 2013-12-31 2015-07-02 Dow Agrosciences Llc Selection based on optimal haploid value to create elite lines
MX2016011745A (en) 2014-03-11 2017-09-01 Bayer Cropscience Lp Hppd variants and methods of use.
WO2015160618A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a biological control agent
WO2015160619A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a fungicide
WO2015160620A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and an insecticide
US9320227B2 (en) 2014-04-30 2016-04-26 Mertec, Llc Soybean cultivar 26253445
US9024137B1 (en) 2014-04-30 2015-05-05 Monsanto Technology Llc Soybean cultivar S130088
US9060481B1 (en) 2014-04-30 2015-06-23 Monsanto Technology Llc Soybean cultivar S130089
US9210896B2 (en) 2014-04-30 2015-12-15 Monsanto Technology Llc Soybean cultivar 39162602
US9320228B2 (en) 2014-04-30 2016-04-26 Mertec, Llc Soybean cultivar 16333091
US9055725B1 (en) * 2014-04-30 2015-06-16 Monsanto Technology Llc Soybean cultivar 37173872
US9060480B1 (en) 2014-04-30 2015-06-23 Monsanto Technology Llc Soybean cultivar 36133391
US9125371B1 (en) 2014-05-01 2015-09-08 Monsanto Technology Llc Soybean cultivar 39382828
US8969663B1 (en) 2014-05-01 2015-03-03 Monsanto Technology Llc Soybean cultivar 34362728
US9237718B2 (en) 2014-05-01 2016-01-19 M.S. Technologies Llc Soybean cultivar S130050
US9210899B2 (en) 2014-05-01 2015-12-15 Monsanto Technology Llc Soybean cultivar 37273791
US9307730B2 (en) 2014-05-01 2016-04-12 M.S. Technologies Llc Soybean cultivar S120082
US9433170B2 (en) 2014-05-01 2016-09-06 M.S. Technologies Llc Soybean cultivar S120070
US9237716B2 (en) 2014-05-01 2016-01-19 M.S. Technologies Llc Soybean cultivar S120077
US9307729B2 (en) 2014-05-01 2016-04-12 M.S. Technologies Llc Soybean cultivar S120081
US9192137B1 (en) 2014-05-01 2015-11-24 M.S. Technologies, Llc Soybean cultivar S110192
US9232739B2 (en) 2014-05-01 2016-01-12 M.S. Technologies Llc Soybean cultivar S120085
US9185869B1 (en) 2014-05-01 2015-11-17 M.S. Technologies, Llc Soybean cultivar S120099
US9210898B2 (en) 2014-05-01 2015-12-15 Monsanto Technology Llc Soybean cultivar 35424318
US9451755B2 (en) 2014-05-01 2016-09-27 M.S. Technologies Llc Soybean cultivar S120063
US8975485B1 (en) 2014-05-01 2015-03-10 Monsanto Technology Llc Soybean cultivar 38050801
US9237717B2 (en) 2014-05-01 2016-01-19 M.S. Technologies Llc Soybean cultivar S120091
US9313982B2 (en) 2014-05-02 2016-04-19 M.S. Technologies Llc Soybean cultivar S130054
US9326477B2 (en) 2014-05-02 2016-05-03 M.S. Technologies, Llc Soybean cultivar S130056
US9198393B2 (en) 2014-05-02 2015-12-01 M.S. Technologies, Llc Soybean cultivar S130060
US9237724B2 (en) 2014-05-02 2016-01-19 M.S. Technologies Llc Soybean cultivar S130053
US9237723B2 (en) 2014-05-02 2016-01-19 M.S. Technologies Llc Soybean cultivar S130049
US9232742B2 (en) 2014-05-02 2016-01-12 M.S. Technologies Llc Soybean cultivar S130055
US9265214B2 (en) 2014-05-02 2016-02-23 M.S. Technologies, Llc Soybean cultivar S120104
US9307731B2 (en) 2014-05-02 2016-04-12 M.S. Technologies Llc Soybean cultivar S120074
US9185870B1 (en) 2014-05-02 2015-11-17 M.S. Technologies, Llc Soybean cultivar S130058
US9320229B2 (en) 2014-05-02 2016-04-26 M.S. Technologies, Llc Soybean cultivar S130052
US9313985B2 (en) 2014-05-02 2016-04-19 M.S. Technologies Llc Soybean cultivar S130047
US9237722B2 (en) 2014-05-02 2016-01-19 M.S. Technologies Llc Soybean cultivar S130059
US9313984B2 (en) 2014-05-02 2016-04-19 M.S. Technologies Llc Soybean cultivar S120094
US9313983B2 (en) 2014-05-02 2016-04-19 M.S. Technologies Llc Soybean cultivar S130061
US9320208B2 (en) 2014-05-02 2016-04-26 M.S. Technologies, Llc Soybean cultivar S130051
US8969664B1 (en) 2014-05-05 2015-03-03 Monsanto Technology Llc Soybean cultivar S130093
US9018470B1 (en) 2014-05-05 2015-04-28 Monsanto Technology Llc Soybean cultivar 32390021
US9018471B1 (en) 2014-05-05 2015-04-28 Monsanto Technology Llc Soybean cultivar S130090
US9018469B1 (en) 2014-05-05 2015-04-28 Monsanto Technology Llc Soybean cultivar 21264635
US9060483B1 (en) 2014-05-05 2015-06-23 Monsanto Technology Llc Soybean cultivar 36074412
US9210905B2 (en) * 2014-05-05 2015-12-15 Monsanto Technology Llc Soybean cultivar 37083371
US9055726B1 (en) 2014-05-05 2015-06-16 Monsanto Technology Llc Soybean cultivar 32292803
US8981187B1 (en) 2014-05-05 2015-03-17 Monsanto Technology Llc Soybean cultivar 27153891
US9060482B1 (en) 2014-05-05 2015-06-23 Monsanto Technology Llc Soybean cultivar 20364935
US9060484B1 (en) 2014-05-05 2015-06-23 MonsantoTechnology LLC Soybean cultivar S130087
US9055728B1 (en) 2014-05-06 2015-06-16 Monsanto Technology Llc Soybean cultivar 38401184
US9018472B1 (en) 2014-05-06 2015-04-28 Monsanto Technology Llc Soybean cultivar 34251723
US9055727B1 (en) 2014-05-06 2015-06-16 Monsanto Technology Llc Soybean cultivar 37144482
US9060485B1 (en) 2014-05-06 2015-06-23 Monsanto Technology Llc Soybean cultivar 38053212
US8969665B1 (en) 2014-05-06 2015-03-03 Monsanto Technology Llc Soybean cultivar S130091
US9060487B1 (en) 2014-05-06 2015-06-23 Monsanto Technology Llc Soybean cultivar 33193068
US9024138B1 (en) 2014-05-06 2015-05-05 Monsanto Technology Llc Soybean cultivar 38141102
US9060486B1 (en) 2014-05-06 2015-06-23 Monsanto Technology Llc Soybean cultivar 35460534
US9210908B2 (en) 2014-05-06 2015-12-15 Monsanto Technology Llc Soybean cultivar S130092
US8975486B1 (en) 2014-05-06 2015-03-10 Monsanto Technology Llc Soybean cultivar S130097
US9060488B1 (en) 2014-05-08 2015-06-23 Monsanto Technology Llc Soybean cultivar 33351113
US9345224B2 (en) 2014-05-08 2016-05-24 Monsanto Technology Llc Soybean variety 01051076
US9363974B2 (en) 2014-05-08 2016-06-14 Monsanto Technology Llc Soybean variety 01051545
US9060492B1 (en) 2014-05-08 2015-06-23 Monsanto Technology Llc Soybean cultivar 32143113
US9510544B2 (en) 2014-05-08 2016-12-06 Monsanto Technology Llc Soybean variety 01050893
US9060489B1 (en) 2014-05-08 2015-06-23 Monsanto Technology Llc Soybean cultivar 30451113
US9018473B1 (en) 2014-05-08 2015-04-28 Monsanto Technology Llc Soybean cultivar 36120411
US9060491B1 (en) 2014-05-08 2015-06-23 Monsanto Technology Llc Soybean cultivar 39242052
US9510545B2 (en) 2014-05-08 2016-12-06 Monsanto Technology Llc Soybean variety 01050923
CA2890604A1 (en) 2014-05-08 2015-11-08 Monsanto Technology Llc Soybean variety 01050938
US8969666B1 (en) 2014-05-08 2015-03-03 Monsanto Technology Llc Soybean cultivar S130098
US9433172B2 (en) 2014-05-08 2016-09-06 Monsanto Technology Llc Soybean cultivar 36162553
US9131657B1 (en) 2014-05-08 2015-09-15 Monsanto Technology Llc Soybean cultivar S130095
US9060490B1 (en) 2014-05-08 2015-06-23 Monsanto Technology Llc Soybean cultivar S130096
US9521816B2 (en) 2014-05-08 2016-12-20 Monsanto Technology Llc Soybean variety 01051547
US9307732B2 (en) 2014-05-08 2016-04-12 Monsanto Technology Llc Soybean cultivar 31462553
US9055729B1 (en) 2014-05-08 2015-06-16 Monsanto Technology Llc Soybean cultivar 36391644
US9363973B2 (en) 2014-05-08 2016-06-14 Monsanto Technology Llc Soybean variety 01051540
US9345225B2 (en) 2014-05-09 2016-05-24 Monsanto Technology Llc Soybean variety 01051559
US9655320B2 (en) 2014-05-09 2017-05-23 Monsanto Technology Llc Soybean variety 01051581
US9655322B2 (en) 2014-05-09 2017-05-23 Monsanto Technology Llc Soybean variety 01051603
US9655321B2 (en) 2014-05-09 2017-05-23 Monsanto Technology Llc Soybean variety 01051585
US9338963B2 (en) 2014-05-13 2016-05-17 Monsanto Technology Llc Soybean variety 01045684
US9232750B2 (en) 2014-05-13 2016-01-12 Monsanto Technology Llc Soybean variety 01045654
US9232749B2 (en) 2014-05-13 2016-01-12 Monsanto Technology Llc Soybean variety 01045635
US9338962B2 (en) 2014-05-13 2016-05-17 Monsanto Technology Llc Soybean variety 01045681
US9338964B2 (en) 2014-05-13 2016-05-17 Monsanto Technology Llc Soybean variety 01045693
US9167794B1 (en) 2014-05-13 2015-10-27 Monsanto Technology Llc Soybean variety 01045663
US9277712B2 (en) 2014-05-13 2016-03-08 Monsanto Technology Llc Soybean variety 01045709
US9173369B1 (en) 2014-05-13 2015-11-03 Monsanto Technology Llc Soybean variety D400401
US9277711B2 (en) 2014-05-13 2016-03-08 Monsanto Technology Llc Soybean variety 01045703
US9451756B2 (en) 2014-05-13 2016-09-27 Monsanto Technology Llc Soybean variety 01045700
US9232751B2 (en) 2014-05-13 2016-01-12 Monsanto Technology Llc Soybean variety 01045662
US9232752B2 (en) 2014-05-14 2016-01-12 Monsanto Technology Llc Soybean variety D401201
US9237732B2 (en) 2014-05-14 2016-01-19 Monsanto Technology Llc Soybean variety 01045734
US9232753B2 (en) 2014-05-14 2016-01-12 Monsanto Technology Llc Soybean variety 01045746
US9277714B2 (en) 2014-05-15 2016-03-08 Monsanto Technology Llc Soybean variety 01045914
US9277715B2 (en) 2014-05-15 2016-03-08 Monsanto Technology Llc Soybean variety 01045961
US9237733B2 (en) 2014-05-15 2016-01-19 Monsanto Technology Llc Soybean variety 01045798
US9338965B2 (en) 2014-05-15 2016-05-17 Monsanto Technology Llc Soybean variety 01045747
US9510526B2 (en) 2014-05-15 2016-12-06 Monsanto Technology Llc Soybean variety 01045783
US9345209B2 (en) 2014-05-15 2016-05-24 Monsanto Technology Llc Soybean variety 01045782
US9237734B2 (en) 2014-05-15 2016-01-19 Monsanto Technology Llc Soybean variety 01045930
US9282707B2 (en) 2014-05-15 2016-03-15 Monsanto Technology Llc Soybean variety 01045962
US9241466B2 (en) 2014-05-15 2016-01-26 Monsanto Technology Llc Soybean variety A1035765
US9277713B2 (en) 2014-05-15 2016-03-08 Monsanto Technology Llc Soybean variety 01045751
US9521817B2 (en) 2014-05-15 2016-12-20 Monsanto Technology Llc Soybean variety 01045769
US9338971B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety D202801
US9277716B2 (en) 2014-05-16 2016-03-08 Monsanto Technology Llc Soybean variety 01045983
US9338972B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety 01046264
US9277718B2 (en) 2014-05-16 2016-03-08 Monsanto Technology Llc Soybean variety 01046046
US9338966B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety 01045982
US9241467B2 (en) 2014-05-16 2016-01-26 Monsanto Technology Llc Soybean variety 01045970
US9338967B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety 01046051
US9237735B2 (en) 2014-05-16 2016-01-19 Monsanto Technology Llc Soybean variety 01046211
US9232756B2 (en) 2014-05-16 2016-01-12 Monsanto Technology Llc Soybean variety 01046203
US9345211B2 (en) 2014-05-16 2016-05-24 Monsanto Technology Llc Soybean variety 01046139
US9480223B2 (en) 2014-05-16 2016-11-01 Monsanto Technology Llc Soybean variety 01046252
US9232757B2 (en) 2014-05-16 2016-01-12 Monsanto Technology Llc Soybean variety 01046242
US9232754B2 (en) 2014-05-16 2016-01-12 Monsanto Technology Llc Soybean variety D402501
US9345210B2 (en) 2014-05-16 2016-05-24 Monsanto Technology Llc Soybean variety 01045963
US9338969B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety 01046074
US9338970B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety D402201
US9237736B2 (en) 2014-05-16 2016-01-19 Monsanto Technology Llc Soybean variety 01046238
US9161508B1 (en) 2014-05-16 2015-10-20 Monsanto Technology Llc Soybean variety 01046317
US9232755B2 (en) 2014-05-16 2016-01-12 Monsanto Technology Llc Soybean variety 01046197
US9277717B2 (en) 2014-05-16 2016-03-08 Monsanto Technology Llc Soybean variety 01046009
US9338968B2 (en) 2014-05-16 2016-05-17 Monsanto Technology Llc Soybean variety 01046072
US9277722B2 (en) 2014-05-20 2016-03-08 Monsanto Technology Llc Soybean variety 01046792
US9339002B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046442
US9338975B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046439
US9338981B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046642
US9338978B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046540
US9192140B1 (en) 2014-05-20 2015-11-24 Monsanto Technology Llc Soybean variety 01046348
US9338982B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046798
US9192139B1 (en) 2014-05-20 2015-11-24 Monsanto Technology Llc Soybean variety 01046343
US9237737B2 (en) 2014-05-20 2016-01-19 Monsanto Technology Llc Soybean variety 01046386
US9282709B2 (en) 2014-05-20 2016-03-15 Monsanto Technology Llc Soybean variety 01046794
US9338974B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety D403301
US9282708B2 (en) 2014-05-20 2016-03-15 Monsanto Technology Llc Soybean variety 01046529
US9338979B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046581
US9277721B2 (en) 2014-05-20 2016-03-08 Monsanto Technology Llc Soybean variety 01046750
US9338983B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety D404401
US9338977B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046500
US9338976B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046447
US9241468B2 (en) 2014-05-20 2016-01-26 Monsanto Technology Llc Soybean variety 01046531
US9338980B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046583
US9338973B2 (en) 2014-05-20 2016-05-17 Monsanto Technology Llc Soybean variety 01046401
US9277719B2 (en) 2014-05-20 2016-03-08 Monsanto Technology Llc Soybean variety 01046394
US9277720B2 (en) 2014-05-20 2016-03-08 Monsanto Technology Llc Soybean variety 01046743
US9345212B2 (en) 2014-05-21 2016-05-24 Monsanto Technology Llc Soybean variety 01051528
US9232758B2 (en) 2014-05-21 2016-01-12 Monsanto Technology Llc Soybean variety 01046904
US9480225B2 (en) 2014-05-21 2016-11-01 Monsanto Technology Llc Soybean variety 01052135
US9232760B2 (en) 2014-05-21 2016-01-12 Monsanto Technology Llc Soybean variety 01051987
US9363965B2 (en) 2014-05-21 2016-06-14 Monsanto Technology Llc Soybean variety 01051014
US9338986B2 (en) 2014-05-21 2016-05-17 Monsanto Technology Llc Soybean variety 01052058
US9282710B2 (en) 2014-05-21 2016-03-15 Monsanto Technology Llc Soybean variety 01051522
US9232762B2 (en) 2014-05-21 2016-01-12 Monsanto Technology Llc Soybean variety 01046953
US9363966B2 (en) 2014-05-21 2016-06-14 Monsanto Technology Llc Soybean variety 01051039
US9480224B2 (en) 2014-05-21 2016-11-01 Monsanto Technology Llc Soybean variety 01052125
US9232759B2 (en) 2014-05-21 2016-01-12 Monsanto Technology Llc Soybean variety 01046909
US9232761B2 (en) 2014-05-21 2016-01-12 Monsanto Technology Llc Soybean variety 01051996
US9277723B2 (en) 2014-05-21 2016-03-08 Monsanto Technology Llc Soybean variety 01046883
US9338987B2 (en) 2014-05-21 2016-05-17 Monsanto Technology Llc Soybean variety 01052118
US9351461B2 (en) 2014-05-21 2016-05-31 Monsanto Technology Llc Soybean variety 01050896
US9338984B2 (en) 2014-05-21 2016-05-17 Monsanto Technology Llc Soybean variety 01046870
US9338988B2 (en) 2014-05-21 2016-05-17 Monsanto Technology Llc Soybean variety 01046980
US9338985B2 (en) 2014-05-21 2016-05-17 Monsanto Technology Llc Soybean variety 01052002
US9282711B2 (en) 2014-05-22 2016-03-15 Monsanto Technology Llc Soybean variety 01046852
US9277724B2 (en) 2014-05-22 2016-03-08 Monsanto Technology Llc Soybean variety 01046644
US9193976B1 (en) 2014-06-09 2015-11-24 M.S. Technologies, Llc Soybean cultivar S120071
BR112016029884B1 (en) 2014-06-20 2022-09-27 The Flinders University Of South Australia METHOD TO INCREASE AT LEAST ONE GROWTH PARAMETER OF A LEGUMINOUS PLANT FROM A LEGUMINOUS SEED
WO2015200902A2 (en) 2014-06-26 2015-12-30 Symbiota, LLC Endophytes, associated compositions, and methods of use thereof
EA201790048A1 (en) 2014-06-26 2017-05-31 Басф Агрокемикэл Продактс Б.В. TREATMENT OF SEEDS WITH ACETOLOLACTATSINTAZY INHIBITORS (ALS)
US9185873B1 (en) 2014-06-27 2015-11-17 Mertec, Llc Soybean cultivar 28353445
US9185872B1 (en) 2014-06-27 2015-11-17 Mertec, Llc Soybean cultivar 27353445
CN107072165B (en) 2014-09-26 2021-05-28 先锋国际良种公司 Wheat Ms1 polynucleotides, polypeptides and methods of use
US9585347B2 (en) 2014-09-29 2017-03-07 Monsanto Technology Llc Soybean variety 01046668
US10219515B2 (en) 2014-11-07 2019-03-05 Basf Se Agrochemical adjuvant containing 2-oxo-1,3-dioxolan-4 carboxylates
CA2883600C (en) 2014-11-19 2017-08-29 Monsanto Technology Llc Soybean variety xr30ar14rx
US9320243B1 (en) 2014-11-19 2016-04-26 Monsanto Technology Llc Soybean variety XR45Z14RX
US9320240B1 (en) 2014-11-19 2016-04-26 Monsanto Technology Llc Soybean variety XR35AS14RX
US9402362B1 (en) 2014-11-19 2016-08-02 Monsanto Technology Llc Soybean variety XR47AB14RX
US9648819B1 (en) 2014-11-19 2017-05-16 Monsanto Technology Llc Soybean variety XR57F14RX
US9332717B1 (en) 2014-11-19 2016-05-10 Monsanto Technology Llc Soybean variety XR68D14RX
US9675026B1 (en) 2014-11-19 2017-06-13 Monsanto Technology Llc Soybean variety XR35AP14RX
US9320241B1 (en) 2014-11-19 2016-04-26 Monsanto Technology Llc Soybean variety XR37Z14RX
CA2883685C (en) 2014-11-19 2017-08-29 Monsanto Technology Llc Soybean variety xr30at14rx
US9320239B1 (en) 2014-11-19 2016-04-26 Monsanto Technology Llc Soybean variety XR35AR14RX
US9585321B1 (en) 2014-11-19 2017-03-07 Monsanto Technology Llc Soybean variety XR34AT14RX
US9554538B2 (en) 2014-11-19 2017-01-31 Monsanto Technology Llc Soybean variety XR27AK14RX
US9320242B1 (en) 2014-11-19 2016-04-26 Monsanto Technology Llc Soybean variety XR43A14RX
US9332716B1 (en) 2014-11-24 2016-05-10 Monsanto Technology LC Soybean variety XB42A14R2
US9271470B1 (en) 2014-11-24 2016-03-01 Monsanto Technology Llc Soybean variety XB69F14R2
US9504222B2 (en) 2014-11-24 2016-11-29 Monsanto Technology Llc Soybean variety XB15R14R2
CA2883610C (en) 2014-11-24 2017-09-05 Monsanto Technology Llc Soybean variety xb07a14r2
US9320238B1 (en) 2014-11-24 2016-04-26 Monsanto Technology Llc Soybean variety XB20AA14R2
US9648818B1 (en) 2014-11-24 2017-05-16 Monsanto Technology Llc Soybean variety XB37X14R2
US9635819B1 (en) 2014-11-24 2017-05-02 Monsanto Technology Llc Soybean variety XB57E14R2
US9433180B1 (en) 2014-11-24 2016-09-06 Monsanto Technology Llc Soybean variety XB35AL14R2
US9414562B1 (en) 2014-11-24 2016-08-16 Monsanto Technology Llc Soybean variety XB47AA14R2
US9554530B2 (en) * 2014-12-17 2017-01-31 Monsanto Technology Llc Soybean variety 01057523
US9363968B1 (en) 2014-12-17 2016-06-14 Monsanto Technology Llc Soybean variety 01050493
US9554531B2 (en) * 2014-12-17 2017-01-31 Monsanto Technology Llc Soybean variety 01051034
CN108271339A (en) 2014-12-30 2018-07-10 靛蓝农业公司 Seed endophyte, compositions related and its application method between cultivar and species
US9560818B2 (en) 2015-02-26 2017-02-07 M.S. Technologies Llc Soybean cultivar S140141
US9532525B2 (en) 2015-02-26 2017-01-03 M.S. Technologies Llc Soybean cultivar S130066
US9456571B2 (en) 2015-02-26 2016-10-04 M.S. Technologies Llc Soybean cultivar S140147
US9578830B2 (en) 2015-02-26 2017-02-28 M.S. Technologies Llc Soybean cultivar S110170
US9351465B1 (en) 2015-02-26 2016-05-31 M.S. Technologies, Llc Soybean cultivar S140151
US9241469B1 (en) 2015-02-26 2016-01-26 M.S. Technologies Llc Soybean cultivar S130063
US9265224B1 (en) 2015-02-26 2016-02-23 M.S. Technologies, Llc Soybean cultivar S130065
US9560816B2 (en) 2015-02-26 2017-02-07 M.S. Technologies Llc Soybean cultivar S130079
US9497917B2 (en) 2015-02-26 2016-11-22 M.S. Technologies Llc Soybean cultivar S130075
US9554535B2 (en) 2015-02-26 2017-01-31 M.S. Technologies Llc Soybean cultivar S130074
US9554536B2 (en) 2015-02-26 2017-01-31 M.S. Technologies Llc Soybean cultivar S140140
US9241470B1 (en) 2015-02-26 2016-01-26 M.S. Technologies Llc Soybean cultivar S130070
US9456572B2 (en) 2015-02-26 2016-10-04 M.S. Technologies Llc Soybean cultivar S140143
US9351466B1 (en) 2015-02-26 2016-05-31 M.S. Technologies, Llc Soybean cultivar S140156
US9345221B1 (en) 2015-02-26 2016-05-24 M.S. Technologies, Llc Soybean cultivar S140154
US9357736B1 (en) 2015-02-26 2016-06-07 M.S. Technologies, Llc Soybean cultivar S140158
US9560819B2 (en) 2015-02-26 2017-02-07 M.S. Technologies Llc Soybean cultivar S140150
US9456573B2 (en) 2015-02-26 2016-10-04 M.S. Technologies Llc Soybean cultivar S140155
US9560817B2 (en) 2015-02-26 2017-02-07 M.S. Technologies Llc Soybean cultivar S140144
US9271469B1 (en) 2015-02-26 2016-03-01 M.S. Technologies, Llc Soybean cultivar S140157
US9565820B2 (en) 2015-02-26 2017-02-14 M.S. Technologies Llc Soybean cultivar S130084
US9532524B2 (en) 2015-02-26 2017-01-03 M.S. Technologies Llc Soybean cultivar S140183
US9247705B1 (en) 2015-02-26 2016-02-02 M.S. Technologies Llc Soybean cultivar S140165
US9351467B1 (en) 2015-03-02 2016-05-31 Monsanto Technology Llc Soybean variety XB32AQ13R2
US9439381B1 (en) 2015-03-04 2016-09-13 Monsato Technology Llc Soybean cultivar 29082991
US9301488B1 (en) 2015-03-04 2016-04-05 Monsanto Technology Llc Soybean cultivar 44022461
US9301487B1 (en) 2015-03-04 2016-04-05 Monsanto Technology Llc Soybean cultivar 48381241
US9532526B2 (en) 2015-03-04 2017-01-03 Monsanto Technology Llc Soybean cultivar 44364071
US9433181B1 (en) 2015-03-04 2016-09-06 Monsanto Technology Llc Soybean cultivar S140178
US9320244B1 (en) 2015-03-04 2016-04-26 Monsanto Technology Llc Soybean cultivar S140176
US9301486B1 (en) 2015-03-04 2016-04-05 Monsanto Technology Llc Soybean cultivar 34221541
US9320245B1 (en) 2015-03-04 2016-04-26 Monsanto Technology Llc Soybean cultivar 46312031
US9462770B2 (en) 2015-03-04 2016-10-11 Monsanto Technology Llc Soybean cultivar 43096025
CN104726582A (en) * 2015-03-17 2015-06-24 苏州华麦生物科技有限公司 Probe method based constant temperature detection primer group, detection kit and detection method of genetically modified soybeans MON89788
US9655317B2 (en) 2015-04-09 2017-05-23 M.S. Technologies, Llc Soybean cultivar S140152
US9681624B2 (en) 2015-04-09 2017-06-20 Mertec, Llc Soybean cultivar 36211415
EP3283476B1 (en) 2015-04-13 2019-08-14 Bayer Cropscience AG N-cycloalkyl-n-(biheterocyclyethylene)-(thio)carboxamide derivatives
US9351469B1 (en) 2015-04-27 2016-05-31 Monsanto Technology Llc Soybean cultivar 36314231
US9681625B2 (en) 2015-04-27 2017-06-20 M.S. Technologies Llc Soybean cultivar 38292104
US9301489B1 (en) 2015-04-29 2016-04-05 Monsanto Technology Llc Soybean cultivar 48043017
US9320246B1 (en) 2015-04-29 2016-04-26 Monsanto Technology Llc Soybean cultivar 41243017
US9301490B1 (en) 2015-04-29 2016-04-05 Monsanto Technology Llc Soybean cultivar 48364117
EP3288361B1 (en) 2015-05-01 2022-03-23 Indigo Ag, Inc. Isolated complex endophyte compositions and methods for improved plant traits
BR112017023551A2 (en) 2015-05-01 2018-07-24 Indigo Agriculture Inc Complex endophyte compositions designed and methods for improving plant characteristics.
US9357738B1 (en) 2015-05-05 2016-06-07 Monsanto Technology Llc Soybean cultivar 32150325
US9585332B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01059874
US9585333B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01059967
US9585335B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01050939
US9585336B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01059528
US9609826B2 (en) 2015-05-20 2017-04-04 Monsanto Technology Llc Soybean variety 01050982
US9615525B2 (en) 2015-05-20 2017-04-11 Monsanto Technology Llc Soybean variety 01051642
US9585331B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01059966
US9585334B2 (en) 2015-05-20 2017-03-07 Monsanto Technology Llc Soybean variety 01059962
US9788503B2 (en) 2015-05-21 2017-10-17 Monsanto Technology Llc Soybean variety 01051964
US9609827B2 (en) 2015-05-21 2017-04-04 Monsanto Technology Llc Soybean variety 01050829
US9474238B1 (en) 2015-05-21 2016-10-25 Monsanto Technology Llc Soybean variety 01050800
US9439383B1 (en) 2015-05-21 2016-09-13 Monsanto Technology Llc Soybean variety 01051693
US9491920B1 (en) 2015-05-21 2016-11-15 Monsanto Technology Llc Soybean variety 01050862
US9609828B2 (en) 2015-05-21 2017-04-04 Monsanto Technology Llc Soybean variety 01051807
US9439382B1 (en) 2015-05-21 2016-09-13 Monsanto Technology Llc Soybean variety 01050895
US9439384B1 (en) 2015-05-21 2016-09-13 Monsanto Technology Llc Soybean variety 01051734
US9781891B2 (en) 2015-05-21 2017-10-10 Monsanto Technology Llc Soybean variety 01051941
US9456577B1 (en) 2015-05-21 2016-10-04 Monsanto Technology Llc Soybean variety 01051789
US9462778B1 (en) 2015-05-22 2016-10-11 Monsanto Technology Llc Soybean variety 01050913
US9585338B2 (en) 2015-05-22 2017-03-07 Monsanto Technology Llc Soybean variety 01051129
US9468180B1 (en) 2015-05-22 2016-10-18 Monsanto Technology Llc Soybean variety 01051028
US9622442B2 (en) 2015-05-22 2017-04-18 Monsanto Technology Llc Soybean variety 01050576
US9585337B2 (en) 2015-05-22 2017-03-07 Monsanto Technology Llc Soybean variety 01051092
US9655324B2 (en) 2015-05-22 2017-05-23 Monsanto Technology Llc Soybean variety 01051871
US9693514B2 (en) 2015-05-22 2017-07-04 Monsanto Technology Llc Soybean variety 01051868
US9468179B1 (en) 2015-05-22 2016-10-18 Monsanto Technology Llc Soybean variety 01050806
US9655323B2 (en) 2015-05-22 2017-05-23 Monsanto Technology Llc Soybean variety 01050561
US9497922B1 (en) 2015-05-22 2016-11-22 Monsanto Technology Llc Soybean variety 01051809
US9497920B1 (en) 2015-05-22 2016-11-22 Monsanto Technology Llc Soybean variety 01051652
US9510547B1 (en) 2015-05-22 2016-12-06 Monsanto Technology Llc Soybean variety 01051813
US9510546B1 (en) 2015-05-22 2016-12-06 Monsanto Technology Llc Soybean variety 01050728
US9497921B1 (en) 2015-05-22 2016-11-22 Monsanto Technology Llc Soybean variety 01051779
US9510548B1 (en) 2015-05-28 2016-12-06 Monsanto Technology Llc Soybean variety 01052178
US9655325B2 (en) 2015-05-28 2017-05-23 Monsanto Technology Llc Soybean variety 01050591
US9578842B2 (en) 2015-05-28 2017-02-28 Monsanto Technology Llc Soybean variety 01052083
US9648825B2 (en) 2015-05-28 2017-05-16 Monsanto Technology Llc Soybean variety 01052098
US9585339B2 (en) 2015-05-28 2017-03-07 Monsanto Technology Llc Soybean variety 01050639
US9675028B2 (en) 2015-05-28 2017-06-13 Monsanto Technology Llc Soybean variety 01051998
US9474239B1 (en) 2015-05-28 2016-10-25 Monsanto Technology Llc Soybean variety 01051127
US9585341B2 (en) 2015-05-28 2017-03-07 Monsanto Technology Llc Soybean variety 01052100
US9655327B2 (en) 2015-05-28 2017-05-23 Monsanto Technology Llc Soybean variety 01051842
US9655328B2 (en) 2015-05-28 2017-05-23 Monsanto Technology Llc Soybean variety 01052052
US9521821B1 (en) 2015-05-28 2016-12-20 Monsanto Technology Llc Soybean variety 01051938
US9585340B2 (en) 2015-05-28 2017-03-07 Monsanto Technology Llc Soybean variety 01052124
US9521823B1 (en) 2015-05-28 2016-12-20 Monsanto Technology Llc Soybean variety 01051901
US9521822B1 (en) 2015-05-28 2016-12-20 Monsanto Technology Llc Soybean variety 01051937
US9655326B2 (en) 2015-05-28 2017-05-23 Monsanto Technology Llc Soybean variety 01051843
EP3097782A1 (en) 2015-05-29 2016-11-30 Bayer CropScience Aktiengesellschaft Methods for controlling phytopathogenic nematodes by combination of fluopyram and biological control agents
US9510550B1 (en) 2015-06-03 2016-12-06 Monsanto Technology Llc Soybean variety 01050509
US9675029B2 (en) 2015-06-03 2017-06-13 Monsanto Technology Llc Soybean variety 01050834
US9532543B2 (en) 2015-06-03 2017-01-03 Monsanto Technology Llc Soybean variety 01050742
US9609829B2 (en) 2015-06-03 2017-04-04 Monsanto Technology Llc Soybean variety 01050652
US9510549B1 (en) 2015-06-03 2016-12-06 Monsanto Technology Llc Soybean variety 01050689
US9585342B2 (en) 2015-06-03 2017-03-07 Monsanto Technology Llc Soybean variety 01050585
US9510551B1 (en) 2015-06-03 2016-12-06 Monsanto Technology Llc Soybean variety 01050909
US9521824B1 (en) 2015-06-03 2016-12-20 Monsanto Technology Llc Soybean variety 01050628
US9532544B2 (en) 2015-06-03 2017-01-03 Monsanto Technology Llc Soybean variety 01050668
US9675030B2 (en) 2015-06-03 2017-06-13 Monsanto Technology Llc Soybean variety 01050762
US9585343B2 (en) 2015-06-03 2017-03-07 Monsanto Technology Llc Soybean variety 01050761
AU2016274683B2 (en) 2015-06-08 2021-06-24 Indigo Ag, Inc. Streptomyces endophyte compositions and methods for improved agronomic traits in plants
US9743630B2 (en) 2015-06-25 2017-08-29 Monsanto Technology Llc Soybean variety 01058664
US10076093B2 (en) 2015-06-25 2018-09-18 Monsanto Technology Llc Soybean variety 01058524
US9775320B2 (en) 2015-06-25 2017-10-03 Monsanto Technology Llc Soybean variety 01058744
US9826701B2 (en) 2015-06-25 2017-11-28 Monsanto Technology Llc Soybean variety 01050769
US9832964B2 (en) 2015-06-25 2017-12-05 Monsanto Technology Llc Soybean variety 01051705
US9807962B2 (en) 2015-06-25 2017-11-07 Monsanto Technology Llc Soybean variety 01058613
US9807961B2 (en) 2015-06-25 2017-11-07 Monsanto Technology Llc Soybean variety 01058472
US10104848B2 (en) 2015-06-25 2018-10-23 Monsanto Technology Llc Soybean variety 01051773
US9781898B2 (en) 2015-06-25 2017-10-10 Monsanto Technology Llc Soybean variety 01058771
US9788516B2 (en) 2015-06-25 2017-10-17 Monsanto Technology Llc Soybean variety 01058627
US9894860B2 (en) 2015-06-25 2018-02-20 Monsanto Technology Llc Soybean variety 01058780
US9986704B2 (en) 2015-06-25 2018-06-05 Monsanto Technology Llc Soybean variety 01057162
US9781897B2 (en) 2015-06-25 2017-10-10 Monsanto Technology Llc Soybean variety 01058741
US9814205B2 (en) 2015-06-25 2017-11-14 Monsanto Technology Llc Soybean variety 01058730
US9832963B2 (en) 2015-06-25 2017-12-05 Monsanto Technology Llc Soybean variety 01058403
US9907262B2 (en) 2015-06-25 2018-03-06 Monsanto Technology Llc Soybean variety 01051117
US9974268B2 (en) 2015-06-25 2018-05-22 Monsanto Technology Llc Soybean variety 01051074
US9743631B2 (en) 2015-06-25 2017-08-29 Monsanto Technology Llc Soybean variety 01058733
US9814206B2 (en) 2015-06-25 2017-11-14 Monsanto Technology Llc Soybean variety 01051877
US9974269B2 (en) 2015-06-28 2018-05-22 Monsanto Technology Llc Soybean variety 01058766
US10051807B2 (en) 2015-06-28 2018-08-21 Monsanto Technology Llc Soybean variety 01058772
US9807963B2 (en) 2015-06-28 2017-11-07 Monsanto Technology Llc Soybean variety 01052094
US9844200B2 (en) 2015-06-28 2017-12-19 Monsanto Technology Llc Soybean variety 01058749
US9820458B2 (en) 2015-06-28 2017-11-21 Monsanto Technology Llc Soybean variety 01052110
US9907266B2 (en) 2015-06-28 2018-03-06 Monsanto Technology Llc Soybean variety 01057255
US9844199B2 (en) 2015-06-28 2017-12-19 Monsanto Technology Llc Soybean variety 01058475
US9924676B2 (en) 2015-06-28 2018-03-27 Monsanto Technology Llc Soybean variety 01057057
US9924677B2 (en) 2015-06-28 2018-03-27 Monsanto Technology Llc Soybean variety 01052136
US9848569B2 (en) 2015-06-28 2017-12-26 Monsanto Technology Llc Soybean variety 01057209
US9907265B2 (en) 2015-06-28 2018-03-06 Monsanto Technology Llc Soybean variety 01058380
US9826703B2 (en) 2015-06-28 2017-11-28 Monsanto Technology Llc Soybean variety 01058683
US10034445B2 (en) 2015-06-29 2018-07-31 Monsanto Technology Llc Soybean variety 01050611
US9901056B2 (en) 2015-06-29 2018-02-27 Monsanto Technology Llc Soybean variety 01057377
US9907267B2 (en) 2015-06-29 2018-03-06 Monsanto Technology Llc Soybean variety 01057383
US9907271B2 (en) 2015-06-29 2018-03-06 Monsanto Technology Llc Soybean variety 01056960
US9924679B2 (en) 2015-06-29 2018-03-27 Monsanto Technology Llc Soybean variety 01057010
US9907269B2 (en) 2015-06-29 2018-03-06 Monsanto Technology Llc Soybean variety 01050536
US9907268B2 (en) 2015-06-29 2018-03-06 Monsanto Technology Llc Soybean variety 01057333
US9844201B2 (en) 2015-06-29 2017-12-19 Monsanto Technology Llc Soybean variety 01050745
US9968057B2 (en) 2015-06-29 2018-05-15 Monsanto Technology Llc Soybean variety 01058336
US9901057B2 (en) 2015-06-29 2018-02-27 Monsanto Technology Llc Soybean variety 01050566
US9924678B2 (en) 2015-06-29 2018-03-27 Monsanto Technology Llc Soybean variety 01057325
US9907270B2 (en) 2015-06-29 2018-03-06 Monsanto Technology Llc Soybean variety 01057497
US9907263B2 (en) 2015-06-30 2018-03-06 Monsanto Technology Llc Soybean variety 01050612
US9832965B2 (en) 2015-06-30 2017-12-05 Monsanto Technology Llc Soybean variety 01051604
US10034444B2 (en) 2015-06-30 2018-07-31 Monsanto Technology Llc Soybean variety 01050609
US9820459B2 (en) 2015-06-30 2017-11-21 Monsanto Technology Llc Soybean variety 01058808
US10004197B2 (en) 2015-06-30 2018-06-26 Monsanto Technology Llc Soybean variety 01050595
US9826702B2 (en) 2015-06-30 2017-11-28 Monsanto Technology Llc Soybean variety 01051835
US9907264B2 (en) 2015-06-30 2018-03-06 Monsanto Technology Llc Soybean variety 01052085
US9901055B2 (en) 2015-06-30 2018-02-27 Monsanto Technology Llc Soybean variety 01050596
US9814207B2 (en) 2015-06-30 2017-11-14 Monsanto Technology Llc Soybean variety 01058565
US10070606B2 (en) 2015-06-30 2018-09-11 Monsanto Technology Llc Soybean variety 01058789
US9351471B1 (en) 2015-08-05 2016-05-31 Monsanto Technology Llc Soybean cultivar 46434117
US9258973B1 (en) 2015-08-05 2016-02-16 Monsanto Technology Llc Soybean cultivar 46092117
US9497925B1 (en) 2015-08-05 2016-11-22 Monsanto Technology Llc Soybean cultivar 43341876
US9351470B1 (en) 2015-08-05 2016-05-31 Monsanto Technology Llc Soybean cultivar 46043017
US9357739B1 (en) 2015-08-05 2016-06-07 Monsanto Technology Llc Soybean cultivar 41421431
US9485951B1 (en) 2015-08-05 2016-11-08 Monsanto Technology Llc Soybean cultivar 44302246
EA201890696A1 (en) 2015-09-11 2018-09-28 Байер Кропсайенс Акциенгезельшафт GRFD VARIANTS AND APPLICATIONS
US9901061B2 (en) 2015-09-24 2018-02-27 Monsanto Technology Llc Soybean variety 01052008
US9907273B2 (en) 2015-09-24 2018-03-06 Monsanto Technology Llc Soybean variety 01051571
US9907274B2 (en) 2015-09-24 2018-03-06 Monsanto Technology Llc Soybean variety 01052030
US9901059B2 (en) 2015-09-24 2018-02-27 Monsanto Technology Llc Soybean variety 01051956
US9901060B2 (en) 2015-09-24 2018-02-27 Monsanto Technology Llc Soybean variety 01051946
US9894862B2 (en) 2015-09-24 2018-02-20 Monsanto Technology Llc Soybean variety 01058666
US9901062B2 (en) 2015-09-24 2018-02-27 Monsanto Technology Llc Soybean variety 01052029
CN105219768B (en) * 2015-10-09 2018-02-13 上海交通大学 Transformation of soybean event SHZD32 01 and its detection method
CN105219767B (en) * 2015-10-09 2018-02-13 上海交通大学 Transformation of soybean event SHZD32 01 and its application process
US9629325B1 (en) 2015-12-01 2017-04-25 Monsanto Technology Llc Soybean variety 01057518
BR112018012839A2 (en) 2015-12-21 2018-12-04 Indigo Ag Inc endophytic compositions and methods for plant trait improvement in plants of agronomic importance
CN108431223A (en) * 2016-01-08 2018-08-21 生物辐射实验室股份有限公司 Multiple pearls under per drop resolution
US9686939B1 (en) 2016-01-25 2017-06-27 Mertec, Llc Soybean cultivar 41372926
US9675034B1 (en) 2016-01-25 2017-06-13 Mertec, Llc Soybean cultivar 43383687
US9775311B2 (en) 2016-01-25 2017-10-03 Mertec, Llc Soybean cultivar 43393886
US9686938B1 (en) 2016-01-25 2017-06-27 Mertec, Llc Soybean cultivar 43284597
US9655332B1 (en) 2016-01-25 2017-05-23 Mertec, Llc Soybean cultivar 43433651
US9655333B1 (en) 2016-01-25 2017-05-23 Mertec, Llc Soybean cultivar 45343736
US9648832B1 (en) 2016-01-25 2017-05-16 Mertec Llc Soybean cultivar 48160931
US9675033B1 (en) 2016-01-25 2017-06-13 Mertec, Llc Soybean cultivar 42062766
US9693521B1 (en) 2016-01-27 2017-07-04 Monsanto Technology Llc Soybean cultivar 58211811
US9585351B1 (en) 2016-01-27 2017-03-07 Monsanto Technology Llc Soybean cultivar 52032434
WO2017139898A1 (en) 2016-02-19 2017-08-24 Nutrasource Diagnostics Inc. Methods for detecting genetically modified organisms (gmo)
US9560827B1 (en) 2016-03-21 2017-02-07 Monsanto Technology Llc Soybean variety XR45C15X
US9763411B1 (en) 2016-03-21 2017-09-19 Monsanto Technology Llc Soybean variety XR09AL15X
US9565822B1 (en) 2016-03-21 2017-02-14 Monsanto Technology Llc Soybean variety XR37AE15X
US9565821B1 (en) 2016-03-21 2017-02-14 Monsanto Technology Llc Soybean variety XR47AF15X
US9763413B1 (en) 2016-03-21 2017-09-19 Monsanto Technology Llc Soybean variety XR23AQ15X
US9861053B1 (en) 2016-03-21 2018-01-09 Monsanto Technology Llc Soybean variety XR36AC15X
US10010040B1 (en) 2016-03-21 2018-07-03 Monsanto Technology Llc Soybean variety XR50E15X
US9560829B1 (en) 2016-03-21 2017-02-07 Monsanto Technology Llc Soybean variety XR47AG15X
US9730415B1 (en) 2016-03-21 2017-08-15 Monsanto Technology Llc Soybean variety XR08A15X
US9560828B1 (en) 2016-03-21 2017-02-07 Monsanto Technology Llc Soybean variety XR46Z15X
US9861055B1 (en) 2016-03-21 2018-01-09 Monsanto Technology Llc Soybean variety XR39U15X
US9596819B1 (en) 2016-03-21 2017-03-21 Monsanto Technology Llc Soybean variety XR33AU15X
US9763414B1 (en) 2016-03-21 2017-09-19 Monsanto Technology Llc Soybean variety XR25AL15X
US9861056B1 (en) 2016-03-21 2018-01-09 Monsanto Technology Llc Soybean variety XR56J15X
US9603331B1 (en) 2016-03-21 2017-03-28 Monsanto Technology Llc Soybean variety XR39V15X
US9700000B1 (en) 2016-03-21 2017-07-11 Monsanto Technology Llc Soybean variety XR38W15X
US9585355B1 (en) 2016-03-21 2017-03-07 Monsanto Technology Llc Soybean variety XR40AA15X
US9585354B1 (en) 2016-03-21 2017-03-07 Monsanto Technology Llc Soybean variety XR48C15X
US9699999B1 (en) 2016-03-21 2017-07-11 Monsanto Technology Llc Soybean variety XR22K15X
US9788508B1 (en) 2016-03-21 2017-10-17 Monsanto Technology Llc Soybean variety XR20AH15X
US9763412B1 (en) 2016-03-21 2017-09-19 Monsanto Technology Llc Soybean variety XR09AP15X
US9596818B1 (en) 2016-03-21 2017-03-21 Monsanto Technology Llc Soybean variety XR30AX15X
US9861054B1 (en) 2016-03-21 2018-01-09 Monsanto Technology Llc Soybean variety XR36Z15X
US9648835B1 (en) 2016-03-22 2017-05-16 Monsanto Technology Llc Soybean cultivar 53030521
US9585357B1 (en) 2016-03-22 2017-03-07 Monsanto Technology Llc Soybean cultivar 53146341
US9770000B1 (en) 2016-03-22 2017-09-26 Monsanto Technology Llc Soybean cultivar 56042428
US9648834B1 (en) 2016-03-22 2017-05-16 Monsanto Technology Llc Soybean cultivar 51201110
US9648836B1 (en) * 2016-03-22 2017-05-16 Monsanto Technology Llc Soybean cultivar 50262411
US9585356B1 (en) 2016-03-22 2017-03-07 Monsanto Technology Llc Soybean cultivar 52232331
US9578849B1 (en) 2016-03-22 2017-02-28 Monsanto Technology Llc Soybean cultivar 55021012
US9591827B1 (en) 2016-03-22 2017-03-14 Monsanto Technology Llc Soybean cultivar 57160653
US9609832B1 (en) 2016-03-22 2017-04-04 Monsanto Technology Llc Soybean cultivar 53032202
US9609834B1 (en) 2016-03-22 2017-04-04 Monsanto Technology Llc Soybean cultivar 55030014
US9609833B1 (en) 2016-03-22 2017-04-04 Monsanto Technology Llc Soybean cultivar 58111502
US9655336B1 (en) 2016-03-22 2017-05-23 Monsanto Technology Llc Soybean cultivar 58150703
US9706729B1 (en) 2016-03-22 2017-07-18 Monsanto Technology Llc Soybean cultivar 51240902
US9609831B1 (en) 2016-03-22 2017-04-04 Monsanto Technology Llc Soybean cultivar 56052100
US9867351B2 (en) 2016-05-31 2018-01-16 Monsanto Technology Llc Soybean variety 01057076
US9743623B1 (en) 2016-05-31 2017-08-29 Monsanto Technology Llc Soybean variety 01056977
US9888646B2 (en) 2016-05-31 2018-02-13 Monsanto Technology Llc Soybean variety 01057021
US9924672B2 (en) 2016-05-31 2018-03-27 Monsanto Technology Llc Soybean variety 01056984
US9872469B2 (en) 2016-05-31 2018-01-23 Monsanto Technology Llc Soybean variety 01056991
US9743624B1 (en) 2016-05-31 2017-08-29 Monsanto Technology Llc Soybean variety 01056994
US9901052B2 (en) 2016-05-31 2018-02-27 Monsanto Technology Llc Soybean variety 01057176
US10051806B2 (en) 2016-05-31 2018-08-21 Monsanto Technology Llc Soybean variety 01057079
US9888648B2 (en) 2016-05-31 2018-02-13 Monsanto Technology Llc Soybean variety 01057115
US9907245B2 (en) 2016-05-31 2018-03-06 Monsanto Technology Llc Soybean variety 01056902
US9901051B2 (en) 2016-05-31 2018-02-27 Monsanto Technology Llc Soybean variety 01057075
US9888647B2 (en) 2016-05-31 2018-02-13 Monsanto Technology Llc Soybean variety 01057072
US9907246B2 (en) 2016-05-31 2018-03-06 Monsanto Technology Llc Soybean variety 01056904
US9750218B1 (en) 2016-05-31 2017-09-05 Monsanto Technology Llc Soybean variety 01056968
US9877450B2 (en) 2016-05-31 2018-01-30 Monsanto Technology Llc Soybean variety 01056979
US10226001B2 (en) 2016-05-31 2019-03-12 Monsanto Technology Llc Soybean variety 01056938
US9867352B2 (en) 2016-05-31 2018-01-16 Monsanto Technology Llc Soybean variety 01057081
US9907247B2 (en) 2016-05-31 2018-03-06 Monsanto Technology Llc Soybean variety 01056929
US9713311B1 (en) 2016-05-31 2017-07-25 Monsanto Technology Llc Soybean variety 01057181
US9756823B1 (en) 2016-05-31 2017-09-12 Monsanto Technology Llc Soybean variety 01056961
US9788514B1 (en) 2016-06-01 2017-10-17 Monsanto Technology Llc Soybean variety 01057345
US9974264B2 (en) 2016-06-01 2018-05-22 Monsanto Technology Llc Soybean variety 01057212
US9706739B1 (en) 2016-06-01 2017-07-18 Monsanto Technology Llc Soybean variety 01057290
US9907250B2 (en) 2016-06-01 2018-03-06 Monsanto Technology Llc Soybean variety 01057493
US9832953B1 (en) 2016-06-01 2017-12-05 Monsanto Technology Llc Soybean variety 01057348
US9907252B2 (en) 2016-06-01 2018-03-06 Monsanto Technology Llc Soybean variety 01058320
US9907249B2 (en) 2016-06-01 2018-03-06 Monsanto Technology Llc Soybean variety 01057459
US9661823B1 (en) 2016-06-01 2017-05-30 Monsanto Technology Llc Soybean variety 01057424
US9848562B1 (en) 2016-06-01 2017-12-26 Monsanto Technology Llc Soybean variety 01058349
US9968054B2 (en) 2016-06-01 2018-05-15 Monsanto Technology Llc Soybean variety 01057207
US9907248B2 (en) 2016-06-01 2018-03-06 Monsanto Technology Llc Soybean variety 01057390
US9788515B1 (en) 2016-06-01 2017-10-17 Monsanto Technology Llc Soybean variety 01057347
US10104847B2 (en) 2016-06-01 2018-10-23 Monsanto Technology Llc Soybean variety 01057454
US10231398B2 (en) 2016-06-01 2019-03-19 Monsanto Technology Llc Soybean variety 01057400
US9706738B1 (en) 2016-06-01 2017-07-18 Monsanto Technology Llc Soybean variety 01057282
US9907251B2 (en) 2016-06-01 2018-03-06 Monsanto Technology Llc Soybean variety 01058313
US10226002B2 (en) 2016-06-01 2019-03-12 Monsanto Technology Llc Soybean variety 01057408
US9854772B2 (en) 2016-06-01 2018-01-02 Monsanto Technology Llc Soybean variety 01058360
US9700008B1 (en) 2016-06-01 2017-07-11 Monsanto Technology Llc Soybean variety 01057341
US9848563B1 (en) 2016-06-01 2017-12-26 Monsanto Technology Llc Soybean variety 01058353
US9901053B2 (en) 2016-06-02 2018-02-27 Monsanto Technology Llc Soybean variety 01058606
US9832957B1 (en) 2016-06-02 2017-12-05 Monsanto Technology Llc Soybean variety 01058863
US9700009B1 (en) 2016-06-02 2017-07-11 Monsanto Technology Llc Soybean variety 01058861
US9867354B2 (en) 2016-06-02 2018-01-16 Monsanto Technology Llc Soybean variety 01058529
US9807960B1 (en) 2016-06-02 2017-11-07 Monsanto Technology Llc Soybean variety 01063888
US9693529B1 (en) 2016-06-02 2017-07-04 Monsanto Technology Llc Soybean variety 01063878
US9832954B1 (en) 2016-06-02 2017-12-05 Monsanto Technology Llc Soybean variety 01058711
US9854773B2 (en) 2016-06-02 2018-01-02 Monsanto Technology Llc Soybean variety 01058444
US9832955B1 (en) 2016-06-02 2017-12-05 Monsanto Technology Llc Soybean variety 01058718
US9867353B2 (en) 2016-06-02 2018-01-16 Monsanto Technology Llc Soybean variety 01058528
US9848564B1 (en) 2016-06-02 2017-12-26 Monsanto Technology Llc Soybean variety 01058864
US9832956B1 (en) 2016-06-02 2017-12-05 Monsanto Technology Llc Soybean variety 01063886
US9693530B1 (en) 2016-06-02 2017-07-04 Monsanto Technology Llc Soybean variety 01063884
US9907254B2 (en) 2016-06-02 2018-03-06 Monsanto Technology Llc Soybean variety 01058698
US9907256B2 (en) 2016-06-02 2018-03-06 Monsanto Technology Llc Soybean variety 01058822
US9907255B2 (en) 2016-06-02 2018-03-06 Monsanto Technology Llc Soybean variety 01058767
US9872470B2 (en) 2016-06-02 2018-01-23 Monsanto Technology Llc Soybean variety 01058469
US9700010B1 (en) 2016-06-02 2017-07-11 Monsanto Technology Llc Soybean variety 01063871
US9907253B2 (en) 2016-06-02 2018-03-06 Monsanto Technology Llc Soybean variety 01058513
US9955645B2 (en) 2016-06-03 2018-05-01 Monsanto Technology Llc Soybean variety 01063902
US10219462B2 (en) 2016-06-03 2019-03-05 Monsanto Technology Llc Soybean variety 01063907
US9750221B1 (en) 2016-06-03 2017-09-05 Monsanto Technology Llc Soybean variety 01063935
US9743625B1 (en) 2016-06-03 2017-08-29 Monsanto Technology Llc Soybean variety 01063903
US9848565B1 (en) 2016-06-03 2017-12-26 Monsanto Technology Llc Soybean variety 01063939
US9717212B1 (en) 2016-06-03 2017-08-01 Monsanto Technology Llc Soybean variety 01064113
US9730418B1 (en) 2016-06-03 2017-08-15 Monsanto Technology Llc Soybean variety 01063920
US9907259B2 (en) 2016-06-03 2018-03-06 Monsanto Technology Llc Soybean variety 01063916
US9907257B2 (en) 2016-06-03 2018-03-06 Monsanto Technology Llc Soybean variety 01063892
US9901054B2 (en) 2016-06-03 2018-02-27 Monsanto Technology Llc Soybean variety 01063900
US9907258B2 (en) 2016-06-03 2018-03-06 Monsanto Technology Llc Soybean variety 01063898
US9907260B2 (en) 2016-06-03 2018-03-06 Monsanto Technology Llc Soybean variety 01063906
US9907261B2 (en) 2016-06-03 2018-03-06 Monsanto Technology Llc Soybean variety 01063928
US9717213B1 (en) 2016-06-03 2017-08-01 Monsanto Technology Llc Soybean variety 01064120
US9730419B1 (en) 2016-06-03 2017-08-15 Monsanto Technology Llc Soybean variety 01064108
US9717211B1 (en) 2016-06-03 2017-08-01 Monsanto Technology Llc Soybean variety 01063940
US10058047B2 (en) 2016-06-03 2018-08-28 Monsanto Technology Llc Soybean variety 01063918
US9737037B1 (en) 2016-06-03 2017-08-22 Monsanto Technology Llc Soybean variety 01063921
US9832958B1 (en) 2016-06-03 2017-12-05 Monsanto Technology Llc Soybean variety 01064122
US9848567B1 (en) 2016-06-06 2017-12-26 Monsanto Technology Llc Soybean variety 01064142
US9795106B1 (en) 2016-06-06 2017-10-24 Monsanto Technology Llc Soybean variety 01064150
US9867356B2 (en) 2016-06-06 2018-01-16 Monsanto Technology Llc Soybean variety 01064143
US9839187B1 (en) 2016-06-06 2017-12-12 Monsanto Technology Llc Soybean variety 01064165
US9844197B1 (en) 2016-06-06 2017-12-19 Monsanto Technology Llc Soybean variety 01064151
US9832960B1 (en) 2016-06-06 2017-12-05 Monsanto Technology Llc Soybean variety 01064152
US10064356B2 (en) 2016-06-06 2018-09-04 Monsanto Technology Llc Soybean variety 01064137
US9832961B1 (en) 2016-06-06 2017-12-05 Monsanto Technology Llc Soybean variety 01064167
US9743626B1 (en) 2016-06-06 2017-08-29 Monsanto Technology Llc Soybean variety 01064148
US9832962B1 (en) 2016-06-06 2017-12-05 Monsanto Technology Llc Soybean variety 01064172
US9867355B2 (en) 2016-06-06 2018-01-16 Monsanto Technology Llc Soybean variety 01064176
US9730420B1 (en) 2016-06-06 2017-08-15 Monsanto Technology Llc Soybean variety 01064123
US9872471B2 (en) 2016-06-06 2018-01-23 Monsanto Technology Llc Soybean variety 01064177
US9743627B1 (en) 2016-06-06 2017-08-29 Monsanto Technology Llc Soybean variety 01064182
US9924673B2 (en) 2016-06-06 2018-03-27 Monsanto Technology Llc Soybean variety 01064169
US9848566B1 (en) 2016-06-06 2017-12-26 Monsanto Technology Llc Soybean variety 01064124
US9832959B1 (en) 2016-06-06 2017-12-05 Monsanto Technology Llc Soybean variety 01064131
US9848568B1 (en) 2016-06-07 2017-12-26 Monsanto Technology Llc Soybean variety 01064130
US9756824B1 (en) 2016-06-07 2017-09-12 Monsanto Technology Llc Soybean variety 01062058
US9968055B2 (en) 2016-06-07 2018-05-15 Monsanto Technology Llc Soybean variety 01062064
US9743629B1 (en) 2016-06-07 2017-08-29 Monsanto Technology Llc Soybean variety 01058714
US9974266B2 (en) 2016-06-07 2018-05-22 Monsanto Technology Llc Soybean variety 01059566
US9743628B1 (en) 2016-06-07 2017-08-29 Monsanto Technology Llc Soybean variety 01062055
US9974267B2 (en) 2016-06-07 2018-05-22 Monsanto Technology Llc Soybean variety 01057526
US10194609B2 (en) 2016-06-07 2019-02-05 Monsanto Technology Llc Soybean variety 01062049
US10064378B2 (en) 2016-06-07 2018-09-04 Monsanto Technology Llc Soybean variety 01062066
US9999186B2 (en) 2016-06-07 2018-06-19 Monsanto Technology Llc Soybean variety 01059533
US9968056B2 (en) 2016-06-07 2018-05-15 Monsanto Technology Llc Soybean variety 01051641
US9974265B2 (en) 2016-06-07 2018-05-22 Monsanto Technology Llc Soybean variety 01057517
US9844198B1 (en) 2016-06-07 2017-12-19 Monsanto Technology Llc Soybean variety 01063894
US9992945B2 (en) 2016-06-07 2018-06-12 Monsanto Technology Llc Soybean variety 01062057
US10212899B2 (en) 2016-06-07 2019-02-26 Monsanto Technology Llc Soybean variety 01062052
US9924674B2 (en) 2016-06-07 2018-03-27 Monsanto Technology Llc Soybean variety 01057531
US10206348B2 (en) 2016-06-07 2019-02-19 Monsanto Technology Llc Soybean variety 01062053
US10194610B2 (en) 2016-06-07 2019-02-05 Monsanto Technology Llc Soybean variety 01062050
US10327400B2 (en) 2016-06-08 2019-06-25 Monsanto Technology Llc Methods for identifying crosses for use in plant breeding
CN106086011B (en) * 2016-06-18 2019-10-18 北京大北农科技集团股份有限公司 Nucleic acid sequence for detection of herbicide-tolerant soybean plant DBN9004 and detection method thereof
BR112019001764A2 (en) 2016-07-29 2019-05-07 Bayer Cropscience Ag combinations of active compounds and methods for plant propagation material protection
BR112019010476A2 (en) 2016-11-23 2019-09-10 BASF Agricultural Solutions Seed US LLC recombinant nucleic acid molecule, vector, host cell, transgenic plant, transgenic seed, recombinant polypeptide, composition, method for controlling a pest population, for killing pests, for producing a polypeptide, plant or plant cell, method for protecting a plant against a pest, to increase yield on a plant, use and primary product
WO2018102733A1 (en) 2016-12-01 2018-06-07 Indigo Ag, Inc. Modulated nutritional quality traits in seeds
BR112019011293A2 (en) 2016-12-19 2019-10-08 Basf Se compounds of formula I, intermediates, agrochemical composition, use and method for combating phytopathogenic harmful fungi
KR20190095409A (en) 2016-12-22 2019-08-14 바스프 아그리컬쳐럴 솔루션즈 시드 유에스 엘엘씨 Elite Event EE-GM4, and Methods and Kits for Identifying Such Events in Biological Samples
US11555202B2 (en) 2016-12-22 2023-01-17 BASF Agricultural Solutions Seed US LLC Elite event EE-GM5 and methods and kits for identifying such event in biological samples
RS61635B1 (en) 2016-12-22 2021-04-29 Syngenta Participations Ag Polymorphs
GB201622007D0 (en) 2016-12-22 2017-02-08 And See Cambridge Display Tech Ltd Syngenta Participations Ag Polymorphs
KR20190095411A (en) 2016-12-22 2019-08-14 바스프 아그리컬쳐럴 솔루션즈 시드 유에스 엘엘씨 Use of CR14 for the control of nematode pests
WO2018119419A1 (en) 2016-12-23 2018-06-28 The Texas A&M University System Fungal endophytes for improved crop yields and protection from pests
US10703782B2 (en) * 2017-01-12 2020-07-07 Monsanto Technology Llc Pesticidal toxin proteins active against lepidopteran insects
CN110431234B (en) 2017-01-18 2024-04-16 巴斯夫农业种子解决方案美国有限责任公司 BP005 toxin gene and method of use thereof
US11286498B2 (en) 2017-01-18 2022-03-29 BASF Agricultural Solutions Seed US LLC Use of BP005 for the control of plant pathogens
US11425910B2 (en) 2017-02-21 2022-08-30 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
RU2019129891A (en) 2017-03-01 2021-04-01 Индиго Аг, Инк. ENDOPHYTIC COMPOSITIONS AND METHODS FOR IMPROVING PLANT SIGNS
MX2019010349A (en) 2017-03-01 2019-11-21 Indigo Ag Inc Endophyte compositions and methods for improvement of plant traits.
UY37623A (en) 2017-03-03 2018-09-28 Syngenta Participations Ag DERIVATIVES OF OXADIAZOL THIOPHEN FUNGICIDES
BR112019018056A2 (en) 2017-03-07 2020-08-11 BASF Agricultural Solutions Seed US LLC recombinant nucleic acid molecule, expression cassette, host cell, plants, transgenic seeds, recombinant polypeptide, methods for checking tolerance and for controlling weeds, utility product and use of the nucleotide sequence
US9888659B1 (en) 2017-03-29 2018-02-13 Monsanto Technology Llc Soybean cultivar 61040705
US9913449B1 (en) 2017-03-29 2018-03-13 Monsanto Technology Llc Soybean cultivar 67272133
US9907280B1 (en) 2017-03-29 2018-03-06 Monsanto Technology Llc Soybean cultivar 64492916
US9894871B1 (en) 2017-03-29 2018-02-20 Monsanto Technology Llc Soybean cultivar 64480739
US9894869B1 (en) 2017-03-29 2018-02-20 Monsanto Technology Llc Soybean cultivar 64091728
US9999193B1 (en) 2017-03-29 2018-06-19 Monsanto Technology Llc Soybean cultivar 65090203
US9930856B1 (en) 2017-03-29 2018-04-03 Monsanto Technology Llc Soybean cultivar 62030513
US9930858B1 (en) 2017-03-29 2018-04-03 Monsanto Technology Llc Soybean cultivar 62232543
US9894870B1 (en) 2017-03-29 2018-02-20 Monsanto Technology Llc Soybean cultivar 65012333
US9907281B1 (en) 2017-03-29 2018-03-06 Monsanto Technology Llc Soybean cultivar 64291310
US10039249B1 (en) 2017-03-29 2018-08-07 Monsanto Technology Llc Soybean cultivar 61162227
US9930857B1 (en) 2017-03-29 2018-04-03 Monsato Technology Llc Soybean cultivar 61311131
US9907282B1 (en) 2017-03-29 2018-03-06 Monsanto Technology Llc Soybean cultivar 60371632
US9961868B1 (en) 2017-03-29 2018-05-08 Monsanto Technology Llc Soybean cultivar 60111034
US9901063B1 (en) 2017-03-29 2018-02-27 Monsanto Technology Llc Soybean cultivar 69250600
US9907279B1 (en) 2017-03-29 2018-03-06 Monsanto Technology Llc Soybean cultivar 63282422
US9907283B1 (en) 2017-03-29 2018-03-06 Monsanto Technology Llc Soybean cultivar 62103227
US9913448B1 (en) 2017-03-29 2018-03-13 Monsanto Technology Llc Soybean cultivar 63281310
US9913450B1 (en) 2017-03-29 2018-03-13 Monsanto Technology Llc Soybean cultivar 68071303
CN113979962A (en) 2017-03-31 2022-01-28 先正达参股股份有限公司 Fungicidal compositions
WO2018177880A1 (en) 2017-03-31 2018-10-04 Syngenta Participations Ag Fungicidal compositions
EP3606913B1 (en) 2017-04-03 2022-04-27 Syngenta Participations AG Microbiocidal oxadiazole derivatives
WO2018184987A1 (en) 2017-04-05 2018-10-11 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
BR112019020739B1 (en) 2017-04-05 2023-12-19 Syngenta Participations Ag COMPOUNDS DERIVED FROM OXADIAZOLE MICROBIOCIDES AND THEIR USE, AGROCHEMICAL COMPOSITION, METHOD TO CONTROL OR PREVENT INFESTATION OF USEFUL PLANTS BY PHYTOPATHOGENIC MICROORGANISMS
WO2018184986A1 (en) 2017-04-05 2018-10-11 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
BR112019020735B1 (en) 2017-04-05 2023-12-05 Syngenta Participations Ag COMPOUNDS DERIVED FROM OXADIAZOLE MICROBIOCIDES AND THEIR USE, AGROCHEMICAL COMPOSITION AND METHOD TO CONTROL OR PREVENT INFESTATION OF USEFUL PLANTS BY PHYTOPATHOGENIC MICROORGANISMS
BR112019020756B1 (en) 2017-04-05 2023-11-28 Syngenta Participations Ag COMPOUNDS DERIVED FROM OXADIAZOLE MICROBICIDES, AGROCHEMICAL COMPOSITION COMPRISING THE SAME, METHOD FOR CONTROLLING OR PREVENTING INFESTATION OF USEFUL PLANTS BY PHYTOPATHOGENIC MICROORGANISMS AND USE OF THESE COMPOUNDS
WO2018184988A1 (en) 2017-04-05 2018-10-11 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
WO2018185211A1 (en) 2017-04-06 2018-10-11 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
AU2018247768A1 (en) 2017-04-07 2019-10-03 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
WO2018188962A1 (en) 2017-04-11 2018-10-18 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
EP3612029A1 (en) 2017-04-21 2020-02-26 Bayer CropScience LP Method of improving crop safety
US11109591B2 (en) 2017-04-24 2021-09-07 Taminco Bvba Single phase liquids of alkanolamine salts of dicamba
US11882838B2 (en) 2017-04-27 2024-01-30 The Flinders University Of South Australia Bacterial inoculants
JP7160487B2 (en) 2017-05-04 2022-10-25 ビーエーエスエフ ソシエタス・ヨーロピア Substituted 5-(haloalkyl)-5-hydroxy-isoxazoles for combating plant pathogens
WO2018202491A1 (en) 2017-05-04 2018-11-08 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
CN108866222B (en) * 2017-05-10 2021-09-03 中国农业科学院作物科学研究所 Method for identifying corn kernel characters and special kit thereof
WO2018219825A1 (en) 2017-06-02 2018-12-06 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
WO2018219773A1 (en) 2017-06-02 2018-12-06 Syngenta Participations Ag Fungicidal compositions
WO2018219797A1 (en) 2017-06-02 2018-12-06 Basf Se Substituted oxadiazoles for combating phytopathogenic fungi
US11154058B2 (en) 2017-06-14 2021-10-26 Syngenta Participations Ag Fungicidal compositions
WO2018234139A1 (en) 2017-06-19 2018-12-27 Basf Se 2 - [[5- (TRIFLUOROMETHYL) -1,2,4-OXADIAZOL-3-YL] ARYLOXY] (THIO) ACETAMIDES FOR THE CONTROL OF PHYTOPATHOGENIC FUNGI
US10314274B2 (en) 2017-06-26 2019-06-11 Monsanto Technology Llc Soybean variety 01068109
US10383304B2 (en) 2017-06-26 2019-08-20 Monsanto Technology Llc Soybean variety 01063944
US10342197B2 (en) 2017-06-26 2019-07-09 Monsanto Technology Llc Soybean variety 01064349
US10034447B1 (en) 2017-06-26 2018-07-31 Monsanto Technology Llc Soybean variety 01064421
US10039254B1 (en) 2017-06-26 2018-08-07 Monsanto Technology Llc Soybean variety 01064117
US10342199B2 (en) 2017-06-26 2019-07-09 Monsanto Technology Llc Soybean variety 01068883
US10034448B1 (en) 2017-06-26 2018-07-31 Monsanto Technology Llc Soybean variety 01064516
US10342198B2 (en) 2017-06-26 2019-07-09 Monsanto Technology Llc Soybean variety 01064381
US10039255B1 (en) 2017-06-26 2018-08-07 Monsanto Technology Llc Soybean variety 01064252
US10314273B2 (en) 2017-06-26 2019-06-11 Monsanto Technology Llc Soybean variety 01068110
US10010046B1 (en) 2017-06-26 2018-07-03 Monsanto Technology Llc Soybean variety 01064401
US10405511B2 (en) 2017-06-26 2019-09-10 Monsanto Technology Llc Soybean variety 01064350
US10455788B2 (en) 2017-06-26 2019-10-29 Monsanto Technology Llc Soybean variety 01068888
US10368518B2 (en) 2017-06-26 2019-08-06 Monsanto Technology Llc Soybean variety 01068117
US10011845B1 (en) 2017-06-28 2018-07-03 Monsanto Technology Llc Soybean variety 01068893
US10182539B1 (en) 2017-06-28 2019-01-22 Monsanto Technology Llc Soybean variety 5PDZB74
US10201138B2 (en) 2017-06-28 2019-02-12 Monsanto Technology Llc Soybean variety 01064519
US10178838B1 (en) 2017-06-28 2019-01-15 Monsanto Technology Llc Soybean variety 5PQNG18
US10178837B1 (en) 2017-06-28 2019-01-15 Monsanto Technology Llc Soybean variety 5PHQP31
US10194613B2 (en) 2017-06-28 2019-02-05 Monsanto Technology Llc Soybean variety 01064363
US10196646B2 (en) 2017-06-28 2019-02-05 Monsanto Technology Llc Soybean variety 01064344
US10349598B2 (en) 2017-06-28 2019-07-16 Monsanto Technology Llc Soybean variety 01068088
US10036027B1 (en) 2017-06-28 2018-07-31 Monsanto Technology Llc Soybean variety 01064536
US10368512B2 (en) 2017-06-28 2019-08-06 Monsanto Technology Llc Soybean variety 01068083
US10368511B2 (en) 2017-06-28 2019-08-06 Monsanto Technology Llc Soybean variety 01068085
US10244705B2 (en) 2017-06-28 2019-04-02 Monsanto Technology Llc Soybean variety 01064265
US10206350B1 (en) 2017-06-28 2019-02-19 Monsanto Technology Llc Soybean variety 5PDSD70
US10292358B2 (en) 2017-06-28 2019-05-21 Monsanto Technology Llc Soybean variety 01064327
US10244704B2 (en) 2017-06-28 2019-04-02 Monsanto Technologies Llc Soybean variety 01068084
US10206349B1 (en) 2017-06-28 2019-02-19 Monsanto Technology Llc Soybean variety 5PPHU37
US10172310B1 (en) 2017-06-28 2019-01-08 Monsanto Technology Llc Soybean variety 5PYFS21
US10053699B1 (en) 2017-06-28 2018-08-21 Monsanto Technology Llc Soybean variety 01068892
US10271493B2 (en) 2017-06-28 2019-04-30 Monsanto Technology Llc Soybean variety 01064280
US10194612B2 (en) 2017-06-28 2019-02-05 Monsanto Technology Llc Soybean variety 01068093
US10053700B1 (en) 2017-06-28 2018-08-21 Monsanto Technology Llc Soybean variety 01064288
US10188059B1 (en) 2017-06-28 2019-01-29 Monsanto Technology Llc Soybean variety 5PUWT62
EP3644743B1 (en) 2017-06-28 2022-10-26 Syngenta Participations AG Fungicidal compositions
US10098305B1 (en) 2017-07-06 2018-10-16 Monsanto Technology Llc Soybean variety 01064403
US10058058B1 (en) 2017-07-06 2018-08-28 Monsanto Technology Llc Soybean variety 01063616
US10201139B2 (en) 2017-07-06 2019-02-12 Monsanto Technology Llc Soybean variety 01068144
US10070616B1 (en) 2017-07-06 2018-09-11 Monsanto Technology Llc Soybean variety 01067507
US10194616B2 (en) 2017-07-06 2019-02-05 Monsanto Technology Llc Soybean variety 01064568
US10064379B1 (en) 2017-07-06 2018-09-04 Monsanto Technology Llc Soybean variety 01064450
US10194615B2 (en) 2017-07-06 2019-02-05 Monsanto Technology Llc Soybean variety 01063576
US10064382B1 (en) 2017-07-06 2018-09-04 Monsanto Technology Llc Soybean variety 01064035
US10064380B1 (en) 2017-07-06 2018-09-04 Monsanto Technology Llc Soybean variety 01063585
US10231403B2 (en) 2017-07-06 2019-03-19 Monsanto Technology Llc Soybean variety 01068141
US10194614B2 (en) 2017-07-06 2019-02-05 Monsanto Technology Llc Soybean variety 01064567
US10244706B2 (en) 2017-07-06 2019-04-02 Monsanto Technology Llc Soybean variety 01064571
US10238057B2 (en) 2017-07-06 2019-03-26 Monsanto Technology Llc Soybean variety 01064461
US10070617B1 (en) 2017-07-06 2018-09-11 Monsanto Technology Llc Soybean variety 01063975
US10064381B1 (en) 2017-07-06 2018-09-04 Monsanto Technology Llc Soybean variety 01067510
US10064367B1 (en) 2017-07-06 2018-09-04 Monsanto Technology Llc Soybean variety 01067515
WO2019011923A1 (en) 2017-07-11 2019-01-17 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
WO2019011928A1 (en) 2017-07-11 2019-01-17 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
BR112020000456A2 (en) 2017-07-11 2020-07-21 Syngenta Participations Ag microbiocidal oxadiazole derivatives
WO2019011926A1 (en) 2017-07-11 2019-01-17 Syngenta Participations Ag Microbiocidal oxadiazole derivatives
BR112020000414A2 (en) 2017-07-12 2020-07-21 Syngenta Participations Ag microbicidal oxadiazole derivatives
BR112020000371A2 (en) 2017-07-12 2020-07-14 Syngenta Participations Ag microbiocidal oxadiazole derivatives
BR112020000463A2 (en) 2017-07-13 2020-07-21 Syngenta Participations Ag microbiocidal oxadiazole derivatives
US10058059B1 (en) 2017-07-14 2018-08-28 Monsanto Technology Llc Soybean variety 01067522
US10136602B1 (en) 2017-07-19 2018-11-27 Monsanto Technology Llc Soybean variety 01068087
US10231405B2 (en) 2017-07-19 2019-03-19 Monsanto Technology Llc Soybean variety 01068135
US10194617B1 (en) 2017-07-19 2019-02-05 Monsanto Technology Llc Soybean variety 01068066
US10098306B1 (en) 2017-07-19 2018-10-16 Monsanto Technology Llc Soybean variety 01068070
US10212901B2 (en) 2017-07-19 2019-02-26 Monsanto Technology Llc Soybean variety 01068895
US10238076B2 (en) 2017-07-19 2019-03-26 Monsanto Technology, Llc Soybean variety 01068130
US10064368B1 (en) 2017-07-19 2018-09-04 Monsanto Technology Llc Soybean variety 01068133
US10231422B2 (en) 2017-07-19 2019-03-19 Monsanto Technology Llc Soybean variety 01068134
US10058060B1 (en) 2017-07-19 2018-08-28 Monsanto Technology Llc Soybean variety 01068082
US10058061B1 (en) 2017-07-19 2018-08-28 Monsanto Technology Llc Soybean variety 01068112
US10398105B2 (en) 2017-07-19 2019-09-03 Monsanto Technology Llc Soybean variety 01064198
US10219466B2 (en) 2017-07-19 2019-03-05 Monsanto Technology Llc Soybean variety 01064243
US10356997B2 (en) 2017-07-19 2019-07-23 Monsanto Technology Llc Soybean variety 01068891
US10206352B2 (en) 2017-07-19 2019-02-19 Monsanto Technology Llc Soybean variety 01068065
US10314275B2 (en) 2017-07-19 2019-06-11 Monsanto Technology Llc Soybean variety 01064238
US10206351B2 (en) 2017-07-19 2019-02-19 Monsanto Technology Llc Soybean variety 01068060
US10426116B2 (en) 2017-07-19 2019-10-01 Monsanto Technology Llc Soybean variety 01068124
US10440908B2 (en) 2017-07-19 2019-10-15 Monsanto Technology Llc Soybean variety 01064245
US10064369B1 (en) 2017-07-19 2018-09-04 Monsanto Technology Llc Soybean variety 01068131
US10231421B2 (en) 2017-07-19 2019-03-19 Monsanto Technology Llc Soybean variety 01064231
US10231404B2 (en) 2017-07-19 2019-03-19 Monsanto Technology Llc Soybean variety 01064187
US10098307B1 (en) 2017-07-20 2018-10-16 Monsanto Technology Llc Soybean variety 01064838
US10206353B2 (en) 2017-07-20 2019-02-19 Monsanto Technology Llc Soybean variety 01064485
US10117400B1 (en) 2017-07-20 2018-11-06 Monsanto Technology Llc Soybean variety 01064185
US10285367B2 (en) 2017-07-20 2019-05-14 Monsanto Technology Llc Soybean variety 01064508
US10098308B1 (en) 2017-07-20 2018-10-16 Monsanto Technology Llc Soybean variety 01068054
US10117401B1 (en) 2017-07-20 2018-11-06 Monsanto Technology Llc Soybean variety 01064488
US10051823B1 (en) 2017-07-20 2018-08-21 Monsanto Technology Llc Soybean variety 01064868
US10143167B1 (en) 2017-07-20 2018-12-04 Monsanto Technology Llc Soybean variety 01064871
US10244723B2 (en) 2017-07-20 2019-04-02 Monsanto Technology Llc Soybean variety 01068058
US10064370B1 (en) 2017-07-20 2018-09-04 Monsanto Technology Llc Soybean variety 01064806
US10231406B2 (en) 2017-07-20 2019-03-19 Monsanto Technology Llc Soybean variety 01068831
US10058062B1 (en) 2017-07-20 2018-08-28 Monsanto Technology Llc Soybean variety 01064840
US10368513B2 (en) 2017-07-31 2019-08-06 Monsanto Technology Llc Soybean variety 01064206
US10117402B1 (en) 2017-07-31 2018-11-06 Monsanto Technology Llc Soybean variety 01068884
WO2019025250A1 (en) 2017-08-04 2019-02-07 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
US11263707B2 (en) 2017-08-08 2022-03-01 Indigo Ag, Inc. Machine learning in agricultural planting, growing, and harvesting contexts
WO2019038042A1 (en) 2017-08-21 2019-02-28 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
US10231407B1 (en) 2017-08-23 2019-03-19 Monsanto Technology Llc Soybean variety 01063959
US10251354B2 (en) 2017-08-23 2019-04-09 Monsanto Technology Llc Soybean variety 01064596
US10117404B1 (en) 2017-08-23 2018-11-06 Monsanto Technology Llc Soybean variety 01064613
US10231408B1 (en) 2017-08-23 2019-03-19 Monsanto Technology Llc Soybean variety 01064013
US10264748B2 (en) 2017-08-23 2019-04-23 Monsanto Technology Llc Soybean variety 01064212
US10285368B2 (en) 2017-08-23 2019-05-14 Monsanto Technology Llc Soybean variety 01064056
US10244708B2 (en) 2017-08-23 2019-04-02 Monsanto Technology Llc Soybean variety 01064594
US10257994B2 (en) 2017-08-23 2019-04-16 Monsanto Technology Llc Soybean variety 01068143
US10238059B2 (en) 2017-08-23 2019-03-26 Monsanto Technology Llc Soybean variety 01064460
US10271494B2 (en) 2017-08-23 2019-04-30 Monsanto Technology Llc Soybean variety 01068122
US10117403B1 (en) 2017-08-23 2018-11-06 Monsanto Technology Llc Soybean variety 01064099
US10051824B1 (en) 2017-08-24 2018-08-21 Monsanto Technology Llc Soybean variety 01064393
US10039256B1 (en) 2017-08-24 2018-08-07 Monsanto Technology Llc Soybean variety 01064446
US10231423B1 (en) 2017-08-24 2019-03-19 Monsanto Technology Llc Soybean variety 01064404
US10314276B2 (en) 2017-08-24 2019-06-11 Monsanto Technology Llc Soybean variety 01064370
US10045507B1 (en) 2017-08-24 2018-08-14 Monsanto Technology Llc Soybean variety 01064406
US10130060B1 (en) 2017-08-24 2018-11-20 Monsanto Technology Llc Soybean variety 01068804
US10342200B2 (en) 2017-08-24 2019-07-09 Monsanto Technology Llc Soybean variety 01067525
US10123501B1 (en) 2017-08-24 2018-11-13 Monsanto Technology Llc Soybean variety 01064722
US10051825B1 (en) 2017-08-24 2018-08-21 Monsanto Technology Llc Soybean variety 01064400
US10045506B1 (en) 2017-08-24 2018-08-14 Monsanto Technology Llc Soybean variety 01064415
US10136603B1 (en) 2017-08-24 2018-11-27 Monsanto Technology Llc Soybean variety 01067535
US10130059B1 (en) 2017-08-24 2018-11-20 Monsanto Technology Llc Soybean variety 01068801
US10130058B1 (en) 2017-08-24 2018-11-20 Monsanto Technology Llc Soybean variety 01064723
US10271496B2 (en) 2017-08-29 2019-04-30 Monsanto Technology Llc Soybean variety 01064102
US10271497B2 (en) 2017-08-29 2019-04-30 Monsanto Technology Llc Soybean variety 01064054
US10342201B2 (en) 2017-08-29 2019-07-09 Monsanto Technology Llc Soybean variety 01067531
US10231409B1 (en) 2017-08-29 2019-03-19 Monsanto Technology Llc Soybean variety 01064026
US10314265B2 (en) 2017-08-29 2019-06-11 Monsanto Technology Llc Soybean variety 01064669
US10159206B1 (en) 2017-08-29 2018-12-25 Monsanto Technology Llc Soybean variety 01067519
US10244724B2 (en) 2017-08-29 2019-04-02 Monsanto Technology Llc Soybean variety 01064667
US10257995B2 (en) 2017-08-29 2019-04-16 Monsanto Technology Llc Soybean variety 01064083
US10433504B2 (en) 2017-08-29 2019-10-08 Monsanto Technology Llc Soybean variety 01064105
US10485197B2 (en) 2017-08-29 2019-11-26 Monsanto Technology Llc Soybean variety 01064625
US10271495B2 (en) 2017-08-29 2019-04-30 Monsanto Technology Llc Soybean variety 01064036
US10159205B1 (en) 2017-08-29 2018-12-25 Monsanto Technology Llc Soybean variety 01064633
US10238077B2 (en) 2017-08-29 2019-03-26 Monsanto Technology Llc Soybean variety 01064104
US10314277B2 (en) 2017-08-29 2019-06-11 Monsanto Technology Llc Soybean variety 01064636
US10188072B1 (en) 2017-08-30 2019-01-29 Monsanto Technology Llc Soybean variety 01064694
US10231424B1 (en) 2017-08-30 2019-03-19 Monsanto Technology Llc Soybean variety 01067526
US10194618B1 (en) 2017-08-30 2019-02-05 Monsanto Technology Llc Soybean variety 01064184
US10212902B1 (en) 2017-08-30 2019-02-26 Monsanto Technology Llc Soybean variety 01067523
US10342202B2 (en) 2017-08-30 2019-07-09 Monsanto Technology Llc Soybean variety 01064775
US10278350B2 (en) 2017-08-30 2019-05-07 Monsanto Technology Llc Soybean variety 01064672
US10117406B1 (en) 2017-08-30 2018-11-06 Monsanto Technology Llc Soybean variety 01064166
US10117405B1 (en) 2017-08-30 2018-11-06 Monsanto Technology Llc Soybean variety 01064511
US10117409B1 (en) 2017-08-30 2018-11-06 Monsanto Technology Llc Soybean variety 01064756
US10271498B2 (en) 2017-08-30 2019-04-30 Monsanto Technology Llc Soybean variety 01064676
US10231425B1 (en) 2017-08-30 2019-03-19 Monsanto Technology Llc Soybean variety 01067534
US10188061B1 (en) 2017-08-30 2019-01-29 Monsanto Technology Llc Soybean variety 01064486
US10051827B1 (en) 2017-08-30 2018-08-21 Monsanto Technology Llc Soybean variety 01064164
US10231426B1 (en) 2017-08-30 2019-03-19 Monsanto Technology Llc Soybean variety 01064748
US10357007B2 (en) 2017-08-30 2019-07-23 Monsanto Technology Llc Soybean variety 01064743
US10314278B2 (en) 2017-08-30 2019-06-11 Monsanto Technology Llc Soybean variety 01064635
US10219467B1 (en) 2017-08-30 2019-03-05 Monsanto Technology Llc Soybean variety 01064677
US10219484B1 (en) 2017-08-30 2019-03-05 Monsanto Technology Llc Soybean variety 01064735
US10117408B1 (en) 2017-08-30 2018-11-06 Monsanto Technology Llc Soybean variety 01064491
US10219485B1 (en) 2017-08-30 2019-03-05 Monsanto Technology Llc Soybean variety 01069661
US10051826B1 (en) 2017-08-30 2018-08-21 Monsanto Technology Llc Soybean variety 01064189
US10064371B1 (en) 2017-08-30 2018-09-04 Monsanto Technology Llc Soybean variety 01064809
US10117407B1 (en) 2017-08-30 2018-11-06 Monsanto Technology Llc Soybean variety 01064490
US12075786B2 (en) 2017-09-18 2024-09-03 Indigo Ag, Inc. Markers of plant health
BR112020004441B1 (en) 2017-09-18 2024-01-16 Basf Se COMPOUNDS OF FORMULA I, AGROCHEMICAL COMPOSITION, COATED SEED, USE OF COMPOUNDS AND NON-THERAPEUTIC METHOD OF FIGHTING FUNGUS
US11589579B2 (en) 2017-09-22 2023-02-28 Biotenzz Gesellschaft Für Biotechnologie Mbh Polymeric particles containing microorganisms
UY37913A (en) 2017-10-05 2019-05-31 Syngenta Participations Ag PICOLINAMIDE DERIVATIVES FUNGICIDES THAT CARRY A QUATERNARY TERMINAL GROUP
UY37912A (en) 2017-10-05 2019-05-31 Syngenta Participations Ag PICOLINAMIDE DERIVATIVES FUNGICIDES THAT CONTAIN HETEROARILO OR HETEROARILOXI TERMINAL GROUPS
WO2019068811A1 (en) 2017-10-06 2019-04-11 Bayer Aktiengesellschaft Compositions comprising fluopyram and tioxazafen
WO2019083810A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenase (hppd) inhibitors by down-regulation of hppd expression in soybean
US20210032651A1 (en) 2017-10-24 2021-02-04 Basf Se Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean
CN111344279B (en) 2017-11-15 2023-07-07 先正达参股股份有限公司 Microbicidal pyridinamide derivatives
US11147275B2 (en) 2017-11-23 2021-10-19 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
CA3084443A1 (en) * 2017-12-10 2019-06-13 Monsanto Technology Llc Methods and systems for identifying hybrids for use in plant breeding
US11728010B2 (en) 2017-12-10 2023-08-15 Monsanto Technology Llc Methods and systems for identifying progenies for use in plant breeding
WO2019121143A1 (en) 2017-12-20 2019-06-27 Basf Se Substituted cyclopropyl derivatives
WO2019137995A1 (en) 2018-01-11 2019-07-18 Basf Se Novel pyridazine compounds for controlling invertebrate pests
WO2019145221A1 (en) 2018-01-29 2019-08-01 BASF Agro B.V. New agrochemical formulations
WO2019154665A1 (en) 2018-02-07 2019-08-15 Basf Se New pyridine carboxamides
US20200354321A1 (en) 2018-02-07 2020-11-12 Basf Se New pyridine carboxamides
US11917995B2 (en) 2018-03-01 2024-03-05 BASF Agro B.V. Fungicidal compositions of mefentrifluconazole
CN112020503A (en) 2018-04-26 2020-12-01 先正达参股股份有限公司 Microbicidal oxadiazole derivatives
WO2019219464A1 (en) 2018-05-15 2019-11-21 Basf Se Substituted trifluoromethyloxadiazoles for combating phytopathogenic fungi
WO2019224092A1 (en) 2018-05-22 2019-11-28 Basf Se Pesticidally active c15-derivatives of ginkgolides
US10420313B1 (en) 2018-05-24 2019-09-24 Monsanto Technology Llc Soybean variety 5PKVF24
US10368520B1 (en) 2018-05-24 2019-08-06 Monsanto Technology Llc Soybean variety 5PCDJ10
US10412921B1 (en) 2018-05-24 2019-09-17 Monsanto Technology Llc Soybean variety 5PYUP46
US10368519B1 (en) 2018-05-24 2019-08-06 Monsanto Technology Llc Soybean variety 5PYGS18
US10420312B1 (en) 2018-05-24 2019-09-24 Monsanto Technology Llc Soybean variety 5PKGL32
US10480005B1 (en) 2018-05-24 2019-11-19 Monsanto Technology Llc Soybean variety 5PEKB42
US10477818B1 (en) 2018-05-24 2019-11-19 Monsanto Technology Llc Soybean variety 5PTJB40
EP3802521A1 (en) 2018-06-04 2021-04-14 Bayer Aktiengesellschaft Herbicidally active bicyclic benzoylpyrazoles
CN112351981A (en) 2018-06-29 2021-02-09 先正达农作物保护股份公司 Microbicidal oxadiazole derivatives
CN112714764A (en) 2018-07-02 2021-04-27 先正达农作物保护股份公司 3- (2-thienyl) -5- (trifluoromethyl) -1,2, 4-oxadiazole derivatives as agrochemical fungicides
EP3823966A1 (en) 2018-07-16 2021-05-26 Syngenta Crop Protection AG Microbiocidal oxadiazole derivatives
CN108570442B (en) * 2018-07-24 2021-05-28 湖北省农业科学院经济作物研究所 Method for rapidly inducing spore production of anthrax
US10258014B1 (en) 2018-08-06 2019-04-16 Monsanto Technology Llc Soybean cultivar 76051047
US10258013B1 (en) 2018-08-06 2019-04-16 Monsanto Technology Llc Soybean cultivar 64442216
US10349607B1 (en) 2018-08-06 2019-07-16 Monsanto Technology Llc Soybean cultivar 78091047
US10251358B1 (en) 2018-08-06 2019-04-09 Monsanto Technology Llc Soybean cultivar 67421739
US10321654B1 (en) 2018-08-06 2019-06-18 Monsanto Technology Llc Soybean cultivar 76222418
US10238080B1 (en) 2018-08-06 2019-03-26 Monsanto Technology Llc Soybean cultivar 79072143
US10342207B1 (en) 2018-08-06 2019-07-09 Monsanto Technology Llc Soybean cultivar 68381333
US10349608B1 (en) 2018-08-06 2019-07-16 Monsanto Technology Llc Soybean cultivar 70520427
US10357010B1 (en) 2018-08-06 2019-07-23 Monsanto Technology Llc Soybean cultivar 68352516
US10342205B1 (en) 2018-08-06 2019-07-09 Monsanto Technology Llc Soybean cultivar 66050405
US10342206B1 (en) 2018-08-06 2019-07-09 Monsanto Technology Llc Soybean cultivar 60390131
US10238079B1 (en) 2018-08-06 2019-03-26 Monsanto Technology Llc Soybean cultivar 77301427
US10342204B1 (en) 2018-08-06 2019-07-09 Monsanto Technology Llc Soybean cultivar 65382631
US10517255B1 (en) 2018-08-06 2019-12-31 Monsanto Technology Llc Soybean cultivar 62391708
US10398122B1 (en) 2018-08-06 2019-09-03 Monsanto Technology Llc Soybean cultivar 77252418
US10368521B1 (en) 2018-08-06 2019-08-06 Monsanto Technology Llc Soybean cultivar 70490447
US10362758B1 (en) 2018-08-06 2019-07-30 Monsanto Technology Llc Soybean cultivar 64272401
US10238078B1 (en) 2018-08-06 2019-03-26 Monsanto Technology Llc Soybean cultivar 65352211
US10238066B1 (en) 2018-08-06 2019-03-26 Monsanto Technology Llc Soybean cultivar 73301323
US10264760B1 (en) 2018-08-06 2019-04-23 Monsanto Technology Llc Soybean cultivar 79380729
US10555483B1 (en) 2018-08-22 2020-02-11 Monsanto Technology Llc Soybean variety 01067598
US10624302B2 (en) 2018-08-22 2020-04-21 Monsanto Technology Llc Soybean variety 01072280
US11013197B2 (en) 2018-08-22 2021-05-25 Monsanto Technology Llc Soybean variety 01072368
US10905081B2 (en) 2018-08-22 2021-02-02 Monsanto Technology Llc Soybean variety 01072329
US10897868B2 (en) 2018-08-22 2021-01-26 Monsanto Technology Llc Soybean variety 01072327
US10973199B2 (en) 2018-08-22 2021-04-13 Monsanto Technology Llc Soybean variety 01072341
US10575490B1 (en) 2018-08-22 2020-03-03 Monsanto Technology Llc Soybean variety 01067547
US10918065B2 (en) 2018-08-22 2021-02-16 Monsanto Technology Llc Soybean variety 01072343
US11026389B2 (en) 2018-08-22 2021-06-08 Monsanto Technology Llc Soybean variety 01072367
US10973198B2 (en) 2018-08-22 2021-04-13 Monsanto Technology Llc Soybean variety 01072340
US10561098B1 (en) 2018-08-22 2020-02-18 Monsanto Technology Llc Soybean variety 01067649
US11109553B2 (en) 2018-08-22 2021-09-07 Monsanto Technology Llc Soybean variety 01072328
US11109552B2 (en) 2018-08-22 2021-09-07 Monsanto Technology Llc Soybean variety 01072332
US10973201B2 (en) 2018-08-22 2021-04-13 Monsanto Technology Llc Soybean variety 01072339
US10602689B2 (en) 2018-08-22 2020-03-31 Monsanto Technology Llc Soybean variety 01068908
US10617089B2 (en) 2018-08-22 2020-04-14 Monsanto Technology Llc Soybean variety 01067827
US10582686B1 (en) 2018-08-22 2020-03-10 Monsanto Technology Llc Soybean variety 01064580
US11096363B2 (en) 2018-08-22 2021-08-24 Monsanto Technology Llc Soybean variety 01072331
US10973200B2 (en) 2018-08-22 2021-04-13 Monsanto Technology Llc Soybean variety 01072342
US10624285B2 (en) 2018-08-22 2020-04-21 Monsanto Technology Llc Soybean variety 01068376
US10624303B2 (en) 2018-08-22 2020-04-21 Monsanto Technology Llc Soybean variety 01072279
US10555481B1 (en) 2018-08-22 2020-02-11 Monsanto Technology Llc Soybean variety 01068364
US10993404B2 (en) 2018-08-22 2021-05-04 Monsanto Technology Llc Soybean variety 01072356
US10575489B1 (en) 2018-08-22 2020-03-03 Monsanto Technology Llc Soybean variety 01067545
US10897869B2 (en) 2018-08-22 2021-01-26 Monsanto Technology Llc Soybean variety 01072333
US10999998B2 (en) 2018-08-22 2021-05-11 Monsanto Technology Llc Soybean variety 01072346
US11206791B2 (en) 2018-08-22 2021-12-28 Monsanto Technology Llc Soybean variety 01072337
US10561099B1 (en) 2018-08-22 2020-02-18 Monsanto Technology Llc Soybean variety 01068352
US10555482B1 (en) 2018-08-22 2020-02-11 Monsanto Technology Llc Soybean variety 01068427
US11044876B2 (en) 2018-08-22 2021-06-29 Monsanto Technology Llc Soybean variety 01072345
US10555484B1 (en) 2018-08-22 2020-02-11 Monsanto Technology Llc Soybean variety 01068903
US10602704B2 (en) 2018-08-22 2020-03-31 Monsanto Technology Llc Soybean variety 01068313
EP3613736A1 (en) 2018-08-22 2020-02-26 Basf Se Substituted glutarimide derivatives
US10939652B2 (en) 2018-08-22 2021-03-09 Monsanto Technology Llc Soybean variety 01072350
US10905080B2 (en) 2018-08-22 2021-02-02 Monsanto Technology Llc Soybean variety 01072355
US10555480B1 (en) 2018-08-22 2020-02-11 Monsanto Technology Llc Soybean variety 01068350
US10897870B2 (en) 2018-08-22 2021-01-26 Monsanto Technology Llc Soybean variety 01072322
US10463000B1 (en) 2018-08-23 2019-11-05 Monsanto Technology Llc Soybean variety 01072224
US10624286B2 (en) 2018-08-23 2020-04-21 Monsanto Technology Llc Soybean variety 01072276
US10631499B2 (en) 2018-08-23 2020-04-28 Monsanto Technology Llc Soybean variety 01072291
US10555486B1 (en) 2018-08-23 2020-02-11 Monsanto Technology Llc Soybean variety 01068910
US10638707B2 (en) 2018-08-23 2020-05-05 Monsanto Technology Llc Soybean variety 01067639
US10499601B1 (en) 2018-08-23 2019-12-10 Monsanto Technology Llc Soybean variety 01068356
US10624287B2 (en) 2018-08-23 2020-04-21 Monsanto Technology Llc Soybean variety 01072275
US10555485B1 (en) 2018-08-23 2020-02-11 Monsanto Technology Llc Soybean variety 01073532
US10548284B1 (en) 2018-08-23 2020-02-04 Monsanto Technology Llc Soybean variety 01072294
US10524446B1 (en) 2018-08-23 2020-01-07 Monsanto Technology Llc Soybean variety 01072245
US10506786B1 (en) 2018-08-23 2019-12-17 Monsanto Technology Llc Soybean variety 01067789
US10492450B1 (en) 2018-08-23 2019-12-03 Monsanto Technology Llc Soybean variety 01064752
US10609888B2 (en) 2018-08-23 2020-04-07 Monsanto Technology Llc Soybean variety 01068346
US10687501B2 (en) 2018-08-23 2020-06-23 Monsanto Technology Llc Soybean variety 01068438
US10631486B2 (en) 2018-08-23 2020-04-28 Monsanto Technology Llc Soybean variety 01068187
US10448608B1 (en) 2018-08-23 2019-10-22 Monsanto Technology Llc Soybean variety 01067812
US10512239B1 (en) 2018-08-23 2019-12-24 Monsanto Technology Llc Soybean variety 01072273
US10448609B1 (en) 2018-08-23 2019-10-22 Monsanto Technology Llc Soybean variety 01072293
US10638708B2 (en) 2018-08-23 2020-05-05 Monsanto Technology Llc Soybean variety 01068325
US10687502B2 (en) 2018-08-23 2020-06-23 Monsanto Technology Llc Soybean variety 01068433
US10575491B1 (en) 2018-08-24 2020-03-03 Monsanto Technology Llc Soybean variety 01072289
US10624304B2 (en) 2018-08-24 2020-04-21 Monsanto Technology Llc Soybean variety 01068381
US10617090B2 (en) 2018-08-24 2020-04-14 Monsanto Technology Llc Soybean variety 01068163
US10477821B1 (en) 2018-08-24 2019-11-19 Monsanto Technology Llc Soybean variety 01067769
US10555488B1 (en) 2018-08-24 2020-02-11 Monsanto Technology Llc Soybean variety 01067714
US10561101B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01068184
US10638710B2 (en) 2018-08-24 2020-05-05 Monsanto Technology Llc Soybean variety 01068195
US10561102B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01068182
US10631500B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01067788
US10631504B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01072295
US10561103B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01073501
US10492451B1 (en) 2018-08-24 2019-12-03 Monsanto Technology Llc Soybean variety 0107226
US10485213B1 (en) 2018-08-24 2019-11-26 Monsanto Technology Llc Soybean variety 01068968
US10548285B1 (en) 2018-08-24 2020-02-04 Monsanto Technology Llc Soybean variety 01067703
US10561105B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01072235
US10470395B1 (en) 2018-08-24 2019-11-12 Monsanto Technology Llc Soybean variety 01067663
US10531629B1 (en) 2018-08-24 2020-01-14 Monsanto Technology Llc Soybean variety 01072223
US10645898B2 (en) 2018-08-24 2020-05-12 Monsanto Technology Llc Soybean variety 01068192
US10582689B1 (en) 2018-08-24 2020-03-10 Monsanto Technology Llc Soybean variety 01067573
US10512240B1 (en) 2018-08-24 2019-12-24 Monsanto Technology Llc Soybean variety 01072228
US10631503B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01067814
US10631507B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01068485
US10506787B1 (en) 2018-08-24 2019-12-17 Monsanto Technology Llc Soybean variety 01072220
US10638709B2 (en) 2018-08-24 2020-05-05 Monsanto Technology Llc Soybean variety 01068191
US10555487B1 (en) 2018-08-24 2020-02-11 Monsanto Technology Llc Soybean variety 01067694
US10631502B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01067840
US10582690B1 (en) 2018-08-24 2020-03-10 Monsanto Technology Llc Soybean variety 01067790
US10631505B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01069676
US10602705B2 (en) 2018-08-24 2020-03-31 Monsanto Technology Llc Soybean variety 01068821
US10631501B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01067793
US10631506B2 (en) 2018-08-24 2020-04-28 Monsanto Technology Llc Soybean variety 01068838
US10660292B2 (en) 2018-08-24 2020-05-26 Monsanto Technology Llc Soybean variety 01068157
US10542721B1 (en) 2018-08-24 2020-01-28 Monsanto Technology Llc Soybean variety 01072231
US10470425B1 (en) 2018-08-24 2019-11-12 Monsanto Technology Llc Soybean variety 01067783
US10561104B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01072234
US10561100B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01067742
US10463010B1 (en) 2018-08-24 2019-11-05 Monsanto Technology Llc Soybean variety 01068189
US10512241B1 (en) 2018-08-24 2019-12-24 Monsanto Technology Llc Soybean variety 01072232
US10582688B1 (en) 2018-08-24 2020-03-10 Monsanto Technology Llc Soybean variety 01067543
US10561106B1 (en) 2018-08-24 2020-02-18 Monsanto Technology Llc Soybean variety 01068466
US10582687B1 (en) 2018-08-24 2020-03-10 Monsanto Technology Llc Soybean variety 01068359
US10517259B1 (en) 2018-08-24 2019-12-31 Monsanto Technology Llc Soybean variety 01068824
US10448610B1 (en) 2018-08-24 2019-10-22 Monsanto Technology Llc Soybean variety 01067781
US10575493B1 (en) 2018-08-27 2020-03-03 Monsanto Technology Llc Soybean variety 01067819
US10506788B1 (en) 2018-08-27 2019-12-17 Monsanto Technology Llc Soybean variety 01072292
US10631509B2 (en) 2018-08-27 2020-04-28 Monsanto Technology Llc Soybean variety 01067807
US10463013B1 (en) 2018-08-27 2019-11-05 Monsanto Technology Llc Soybean variety 01069709
US10575492B1 (en) 2018-08-27 2020-03-03 Monsanto Technology Llc Soybean variety 01068915
US10631508B2 (en) 2018-08-27 2020-04-28 Monsanto Technology Llc Soybean variety 01068228
US10492454B1 (en) 2018-08-27 2019-12-03 Monsanto Technology Llc Soybean variety 01072256
US10660293B2 (en) 2018-08-27 2020-05-26 Monsanto Technology Llc Soybean variety 01077434
US10687503B2 (en) 2018-08-27 2020-06-23 Monsanto Technology Llc Soybean variety 01068213
US10499603B1 (en) 2018-08-27 2019-12-10 Monsanto Technology Llc Soybean variety 01068207
US10602706B2 (en) 2018-08-27 2020-03-31 Monsanto Technology Llc Soybean variety 01077437
US10743492B2 (en) 2018-08-27 2020-08-18 Monsanto Technology Llc Soybean variety 01077433
US10568290B1 (en) 2018-08-27 2020-02-25 Monsanto Technology Llc Soybean variety 01068219
US10660294B2 (en) 2018-08-27 2020-05-26 Monsanto Technology Llc Soybean variety 01077435
US10477823B1 (en) 2018-08-27 2019-11-19 Monsanto Technology Llc Soybean variety 01069720
US10492453B1 (en) 2018-08-27 2019-12-03 Monsanto Technology Llc Soybean variety 01072254
US10743491B2 (en) 2018-08-27 2020-08-18 Monsanto Technology Llc Soybean variety 01077432
US10463011B1 (en) 2018-08-27 2019-11-05 Monsanto Technology Llc Soybean variety 01068162
US10602692B2 (en) 2018-08-27 2020-03-31 Monsanto Technology Llc Soybean variety 01072252
US10582678B1 (en) 2018-08-27 2020-03-10 Monsanto Technology Llc Soybean variety 01072239
US10582679B1 (en) 2018-08-27 2020-03-10 Monsanto Technology Llc Soybean variety 01072243
US10477822B1 (en) 2018-08-27 2019-11-19 Monsanto Technology Llc Soybean variety 01069686
US10602690B2 (en) 2018-08-27 2020-03-31 Monsanto Technology Llc Soybean variety 01068227
US10463012B1 (en) 2018-08-27 2019-11-05 Monsanto Technology Llc Soybean variety 01069688
US10568291B1 (en) 2018-08-27 2020-02-25 Monsanto Technology Llc Soybean variety 01067741
US10548286B1 (en) 2018-08-27 2020-02-04 Monsanto Technology Llc Soybean variety 01068171
US10499602B1 (en) 2018-08-27 2019-12-10 Monsanto Technology Llc Soybean variety 01067553
US10602691B2 (en) 2018-08-27 2020-03-31 Monsanto Technology Llc Soybean variety 01072253
US10512242B1 (en) 2018-08-27 2019-12-24 Monsanto Technology Llc Soybean variety 01077436
US10492452B1 (en) 2018-08-27 2019-12-03 Monsanto Technology Llc Soybean variety 01067646
US10555489B1 (en) 2018-08-27 2020-02-11 Monsanto Technology Llc Soybean variety 01068972
US10743493B2 (en) 2018-08-27 2020-08-18 Monsanto Technology Llc Soybean variety 01077438
US10561107B1 (en) 2018-08-27 2020-02-18 Monsanto Technology Llc Soybean variety 01068807
EP3628158A1 (en) 2018-09-28 2020-04-01 Basf Se Pesticidal mixture comprising a mesoionic compound and a biopesticide
BR112021007156A2 (en) 2018-10-17 2021-07-20 Syngenta Crop Protection Ag microbiocidal oxadiazole derivatives
AR116628A1 (en) 2018-10-18 2021-05-26 Syngenta Crop Protection Ag MICROBIOCIDAL COMPOUNDS
WO2020083662A1 (en) 2018-10-23 2020-04-30 Basf Se Tricyclic pesticidal compounds
EP3643705A1 (en) 2018-10-24 2020-04-29 Basf Se Pesticidal compounds
US10506789B1 (en) 2018-12-04 2019-12-17 Monsanto Technology Llc Soybean cultivar 61381330
EP3670501A1 (en) 2018-12-17 2020-06-24 Basf Se Substituted [1,2,4]triazole compounds as fungicides
CA3122208A1 (en) 2019-01-11 2020-07-16 Basf Se Crystalline forms of 1-(1,2-dimethylpropyl)-n-ethyl-5-methyl-n-pyridazin-4-yl-pyrazole-4-carboxamide
EP3696177A1 (en) 2019-02-12 2020-08-19 Basf Se Heterocyclic compounds for the control of invertebrate pests
WO2020165403A1 (en) 2019-02-15 2020-08-20 Syngenta Crop Protection Ag Phenyl substituted thiazole derivatives as microbiocidal compounds
EP3927166A1 (en) 2019-02-20 2021-12-29 Syngenta Crop Protection AG Use of spiropidion
GB201903942D0 (en) 2019-03-22 2019-05-08 Syngenta Crop Protection Ag Microbiocidal compounds
WO2020208095A1 (en) 2019-04-10 2020-10-15 Syngenta Crop Protection Ag Microbiocidal picolinamide derivatives
KR20210150468A (en) 2019-04-10 2021-12-10 신젠타 크롭 프로텍션 아게 fungicidal composition
CN109913580B (en) * 2019-04-30 2022-05-20 三明市农业科学研究院 Application of molecular marker closely linked with rice blast resistance gene
CN109913581B (en) * 2019-04-30 2022-05-20 三明市农业科学研究院 Preparation method of molecular marker closely linked with rice blast resistance gene
CN109913582B (en) * 2019-04-30 2021-12-17 三明市农业科学研究院 Molecular marker closely linked with rice blast resistance gene and application thereof
WO2020231751A1 (en) 2019-05-10 2020-11-19 Bayer Cropscience Lp Active compound combinations
CN113923987B (en) 2019-05-29 2024-10-01 巴斯夫欧洲公司 Mesoionic imidazolium compounds and derivatives for controlling animal pests
EP3769623A1 (en) 2019-07-22 2021-01-27 Basf Se Mesoionic imidazolium compounds and derivatives for combating animal pests
US10624305B1 (en) 2019-06-04 2020-04-21 Monsanto Technology Llc Soybean cultivar 85161422
US10667484B1 (en) 2019-06-04 2020-06-02 Monsanto Technology Llc Soybean cultivar 82322805
US10602693B1 (en) 2019-06-04 2020-03-31 Monsanto Technology Llc Soybean cultivar 81302732
US10631512B1 (en) 2019-06-04 2020-04-28 Monsanto Technology Llc Soybean cultivar 85322536
US10631513B1 (en) 2019-06-04 2020-04-28 Monsanto Technology Llc Soybean cultivar 87181312
US10617080B1 (en) 2019-06-04 2020-04-14 Monsanto Technology Llc Soybean cultivar 87352527
US10617091B1 (en) 2019-06-04 2020-04-14 Monsanto Technology Llc Soybean cultivar 86331141
US10609883B1 (en) 2019-06-05 2020-04-07 Monsanto Technology Llc Soybean cultivar 82340103
US10548287B1 (en) 2019-06-05 2020-02-04 Monsanto Technology Llc Soybean cultivar 86411138
US10602707B1 (en) 2019-06-05 2020-03-31 Monsanto Technology Llc Soybean cultivar 85442619
US10602708B1 (en) 2019-06-05 2020-03-31 Monsanto Technology Llc Soybean cultivar 82370721
US10638686B1 (en) 2019-06-05 2020-05-05 Monsanto Technology Llc Soybean cultivar 84161023
US10624288B1 (en) 2019-06-05 2020-04-21 Monsanto Technology Llc Soybean cultivar 85061635
US10602709B1 (en) 2019-06-05 2020-03-31 Monsanto Technology Llc Soybean cultivar 86360847
US10631514B1 (en) 2019-06-05 2020-04-28 Monsanto Technology Llc Soybean cultivar 80131402
US10638713B1 (en) 2019-06-05 2020-05-05 Monsanto Technology Llc Soybean cultivar 85220103
US10660295B1 (en) 2019-06-05 2020-05-26 Monsanto Technology Llc Soybean cultivar 86072029
AU2020286573A1 (en) 2019-06-06 2021-12-23 Basf Se Fungicidal n-(pyrid-3-yl)carboxamides
US10785950B1 (en) 2019-06-06 2020-09-29 Stine Seed Farm, Inc. Soybean cultivar 86190345
US10548289B1 (en) 2019-06-06 2020-02-04 Monsanto Technology Llc Soybean cultivar 82290447
US10561108B1 (en) 2019-06-06 2020-02-18 Monsanto Technology Llc Soybean cultivar 80431932
US10609889B1 (en) 2019-06-06 2020-04-07 Monsanto Technology Llc Soybean cultivar 89001711
US10617092B1 (en) 2019-06-06 2020-04-14 Monsanto Technology Llc Soybean cultivar 80411617
US10561109B1 (en) 2019-06-06 2020-02-18 Monsanto Technology Llc Soybean cultivar 82042815
US10631487B1 (en) 2019-06-06 2020-04-28 Monsanto Technology Llc Soybean cultivar 83240828
US10813335B1 (en) * 2019-06-06 2020-10-27 Monsanto Technology Llc Soybean cultivar 80261309
US10568284B1 (en) 2019-06-06 2020-02-25 Monsanto Technology Llc Soybean cultivar 87161804
US10548273B1 (en) 2019-06-06 2020-02-04 Monsanto Technology Llc Soybean cultivar 87120510
US10638687B1 (en) 2019-06-06 2020-05-05 Monsanto Technology Llc Soybean cultivar 88103087
WO2020244969A1 (en) 2019-06-06 2020-12-10 Basf Se Pyridine derivatives and their use as fungicides
US10568292B1 (en) 2019-06-06 2020-02-25 Monsanto Technology Llc Soybean cultivar 80181322
WO2020244970A1 (en) 2019-06-06 2020-12-10 Basf Se New carbocyclic pyridine carboxamides
US10548288B1 (en) 2019-06-06 2020-02-04 Mansanto Technology Llc Soybean cultivar 80372800
US10638714B1 (en) 2019-06-06 2020-05-05 Monsanto Technology Llc Soybean cultivar 84062517
US10568294B1 (en) 2019-06-07 2020-02-25 Monsanto Technology Llc Soybean cultivar 82440038
US10555490B1 (en) 2019-06-07 2020-02-11 Monsanto Technology Llc Soybean cultivar 85370909
US10548274B1 (en) 2019-06-07 2020-02-04 Monsanto Technology Llc Soybean cultivar 83262718
US10568293B1 (en) 2019-06-07 2020-02-25 Monsanto Technology Llc Soybean cultivar AR 86112649
US10561089B1 (en) 2019-06-07 2020-02-18 Monsanto Technology Llc Soybean cultivar 84060345
US10555491B1 (en) 2019-06-07 2020-02-11 Monsanto Technology Llc Soybean cultivar 83072718
US10602710B1 (en) 2019-06-07 2020-03-31 Monsanto Technology Llc Soybean cultivar 89282206
US10660296B1 (en) 2019-06-07 2020-05-26 Monsanto Technology Llc Soybean cultivar 84241941
US10548290B1 (en) 2019-06-07 2020-02-04 Monsanto Technology Llc Soybean cultivar 89031941
US10561090B1 (en) 2019-06-07 2020-02-18 Monsanto Technology Llc Soybean cultivar 86370345
US10555492B1 (en) 2019-06-07 2020-02-11 Monsanto Technology Llc Soybean cultivar 81430038
EP3994124A1 (en) 2019-07-05 2022-05-11 Syngenta Crop Protection AG Microbiocidal picolinamide derivatives
GB201910037D0 (en) 2019-07-12 2019-08-28 Syngenta Crop Protection Ag Microbiocidal compounds
EP3766879A1 (en) 2019-07-19 2021-01-20 Basf Se Pesticidal pyrazole derivatives
MX2022000950A (en) 2019-07-22 2022-02-14 Bayer Ag 5-amino substituted pyrazoles and triazoles as pest control agents.
BR112022000942A2 (en) 2019-07-23 2022-05-17 Bayer Ag Heteroaryl-triazole compounds as pesticides
CN118561817A (en) 2019-07-23 2024-08-30 拜耳公司 New heteroaryl-triazole compounds as pesticides
US10863709B1 (en) 2019-07-29 2020-12-15 Monsanto Technology Llc Soybean variety 01072789
US10932428B2 (en) 2019-07-29 2021-03-02 Monsanto Technology Llc Soybean variety 01072749
US10849300B1 (en) 2019-07-29 2020-12-01 Monsanto Technology Llc Soybean variety 01073359
US10925237B1 (en) 2019-07-29 2021-02-23 Monsanto Technology Llc Soybean variety 01073288
US10925236B1 (en) 2019-07-29 2021-02-23 Monsanto Technology Llc Soybean variety 01072823
US10863708B1 (en) 2019-07-29 2020-12-15 Monsanto Technology Llc Soybean variety 01073439
US10918050B1 (en) 2019-07-29 2021-02-16 Monsanto Technology Llc Soybean variety 01072791
US10918053B1 (en) 2019-07-29 2021-02-16 Monsanto Technology Llc Soybean variety 01073354
US11096357B2 (en) 2019-07-29 2021-08-24 Monsanto Technology Llc Soybean variety 01073351
US10932429B2 (en) 2019-07-29 2021-03-02 Monsanto Technology Llc Soybean variety 01073265
US10925235B1 (en) 2019-07-29 2021-02-23 Monsanto Technology Llc Soybean variety 01072810
US10912270B1 (en) 2019-07-29 2021-02-09 Monsanto Technology Llc Soybean variety 01072737
US10925238B1 (en) 2019-07-29 2021-02-23 Monsanto Technology Llc Soybean variety 01073320
US10918054B1 (en) 2019-07-29 2021-02-16 Monsanto Technology Llc Soybean variety 01073353
US10905071B1 (en) 2019-07-29 2021-02-02 Monsanto Technology Llc Soybean variety 01072744
US10905072B1 (en) 2019-07-29 2021-02-02 Monsanto Technology Llc Soybean variety 01073330
US10993401B2 (en) 2019-07-29 2021-05-04 Monsanto Technology Llc Soybean variety 01073256
US10939643B2 (en) 2019-07-29 2021-03-09 Monsanto Technology Llc Soybean variety 01072768
US10918051B1 (en) 2019-07-29 2021-02-16 Monsanto Technology Llc Soybean variety 01072804
US10869452B1 (en) 2019-07-29 2020-12-22 Monsanto Technology Llc Soybean variety 01072767
US10918052B1 (en) 2019-07-29 2021-02-16 Monsanto Technology Llc Soybean variety 01073365
US11266100B2 (en) 2019-07-30 2022-03-08 Monsanto Technology Llc Soybean variety 01073441
US10939645B2 (en) 2019-07-30 2021-03-09 Monsanto Technology Llc Soybean variety 01073480
US10881074B1 (en) 2019-07-30 2021-01-05 Monsanto Technology Llc Soybean variety 01072802
US10849301B1 (en) 2019-07-30 2020-12-01 Monsanto Technology Llc Soybean variety 01072784
US10939646B2 (en) 2019-07-30 2021-03-09 Monsanto Technology Llc Soybean variety 01073479
US10939644B2 (en) 2019-07-30 2021-03-09 Monsanto Technology Llc Soybean variety 01073461
US10925240B1 (en) 2019-07-30 2021-02-23 Monsanto Technology Llc Soybean variety 01073455
US10888063B1 (en) 2019-07-30 2021-01-12 Monsanto Technology Llc Soybean variety 01072800
US10881073B1 (en) 2019-07-30 2021-01-05 Monsanto Technology Llc Soybean variety 01072782
US10856508B1 (en) 2019-07-30 2020-12-08 Monsanto Technology Llc Soybean variety 01073445
US10856507B1 (en) 2019-07-30 2020-12-08 Monsanto Technology Llc Soybean variety 01073444
US10827714B1 (en) 2019-07-30 2020-11-10 Monsanto Technology Llc Soybean variety 01073443
US10897864B1 (en) 2019-07-30 2021-01-26 Monsanto Technology Llc Soybean variety 01073453
US10925239B1 (en) 2019-07-30 2021-02-23 Monsanto Technology Llc Soybean variety 01073452
US10918055B1 (en) 2019-07-30 2021-02-16 Monsanto Technology Llc Soybean variety 01073472
US10973194B2 (en) 2019-07-31 2021-04-13 Monsanto Technology Llc Soybean variety 01072867
US10939648B2 (en) 2019-07-31 2021-03-09 Monsanto Technology Llc Soybean variety 01072899
US10973193B2 (en) 2019-07-31 2021-04-13 Monsanto Technology Llc Soybean variety 01072864
US10842117B1 (en) 2019-07-31 2020-11-24 Monsanto Technology Llc Soybean variety 01072842
US10939647B2 (en) 2019-07-31 2021-03-09 Monsanto Technology Llc Soybean variety 01072860
US10945397B2 (en) 2019-07-31 2021-03-16 Monsanto Technology Llc Soybean variety 01073506
US10912271B1 (en) 2019-07-31 2021-02-09 Monsanto Technology Llc Soybean variety 01072822
US10869453B1 (en) 2019-07-31 2020-12-22 Monsanto Technology Llc Soybean variety 01072813
US10959389B2 (en) 2019-07-31 2021-03-30 Monsanto Technology Llc Soybean variety 01073503
US10827715B1 (en) 2019-07-31 2020-11-10 Monsanto Technology Llc Soybean variety 01077799
US10874078B1 (en) 2019-07-31 2020-12-29 Monsanto Technology Llc Soybean variety 01072817
US10863710B1 (en) 2019-07-31 2020-12-15 Monsanto Technology Llc Soybean variety 01072819
US10842116B1 (en) 2019-07-31 2020-11-24 Monsanto Technology Llc Soybean variety 01072832
US10918056B1 (en) 2019-07-31 2021-02-16 Monsanto Technology Llc Soybean variety 01077815
US11122759B2 (en) 2019-07-31 2021-09-21 Monsanto Technology Llc Soybean variety 01072870
US11026387B2 (en) 2019-08-01 2021-06-08 Monsanto Technology Llc Soybean variety 01073016
US11019787B2 (en) 2019-08-01 2021-06-01 Monsanto Technology Llc Soybean variety 01072951
US10905074B1 (en) 2019-08-01 2021-02-02 Monsanto Technology Llc Soybean variety 01072906
US11026388B2 (en) 2019-08-01 2021-06-08 Monsanto Technology Llc Soybean variety 01073060
US10905075B1 (en) 2019-08-01 2021-02-02 Monsanto Technology Llc Soybean variety 01073059
US10925241B1 (en) 2019-08-01 2021-02-23 Monsanto Technology Llc Soybean variety 01072974
US10905073B1 (en) 2019-08-01 2021-02-02 Monsanto Technology Llc Soybean variety 01072883
US11019789B2 (en) 2019-08-01 2021-06-01 Monsanto Technology Llc Soybean variety 01073534
US11006602B2 (en) 2019-08-01 2021-05-18 Monsanto Technology Llc Soybean variety 01072946
US11019788B2 (en) 2019-08-01 2021-06-01 Monsanto Technology Llc Soybean variety 01072980
US11129346B2 (en) 2019-08-01 2021-09-28 Monsanto Technology Llc Soybean variety 01073533
CA3149206A1 (en) 2019-08-01 2021-02-04 Bayer Cropscience Lp Method of improving cold stress tolerance and crop safety
US11076552B2 (en) 2019-08-07 2021-08-03 Monsanto Technology Llc Soybean variety 01073356
US10980203B2 (en) 2019-08-07 2021-04-20 Monsanto Technology Llc Soybean variety 01073305
US11096359B2 (en) 2019-08-07 2021-08-24 Monsanto Technology Llc Soybean variety 01077377
US11019790B2 (en) 2019-08-07 2021-06-01 Monsanto Technology Llc Soybean variety 01073304
US10912273B1 (en) 2019-08-07 2021-02-09 Monsanto Technology Llc Soybean variety 01073355
US10973195B2 (en) 2019-08-07 2021-04-13 Monsanto Technology Llc Soybean variety 01073325
EP3701796A1 (en) 2019-08-08 2020-09-02 Bayer AG Active compound combinations
US11044866B2 (en) 2019-08-15 2021-06-29 Monsanto Technology Llc Soybean variety 01073114
US11013196B2 (en) 2019-08-15 2021-05-25 Monsanto Technology Llc Soybean variety 01073094
US10959390B2 (en) 2019-08-15 2021-03-30 Monsanto Technology Llc Soybean variety 01073069
US11096360B2 (en) 2019-08-15 2021-08-24 Monsanto Technology Llc Soybean variety 01067560
US10952393B2 (en) 2019-08-15 2021-03-23 Monsanto Technology Llc Soybean variety 01073169
US10945398B2 (en) 2019-08-15 2021-03-16 Monsanto Technology Llc Soybean variety 01073160
US11044865B2 (en) 2019-08-15 2021-06-29 Monsanto Technology Llc Soybean variety 01073029
US10952392B2 (en) 2019-08-15 2021-03-23 Monsanto Technology Llc Soybean variety 01073151
US11044867B2 (en) 2019-08-15 2021-06-29 Monsanto Technology Llc Soybean variety 01073133
US11096361B2 (en) 2019-08-15 2021-08-24 Monsanto Technology Llc Soybean variety 01073072
US11109550B2 (en) 2019-08-15 2021-09-07 Monsanto Technology Llc Soybean variety 01073116
US11071271B2 (en) 2019-08-15 2021-07-27 Monsanto Technology Llc Soybean variety 01073065
US10952391B2 (en) 2019-08-15 2021-03-23 Monsanto Technology Llc Soybean variety 01073150
US11039590B2 (en) 2019-08-16 2021-06-22 Monsanto Technology Llc Soybean variety 01073272
US11129348B2 (en) 2019-08-16 2021-09-28 Monsanto Technology Llc Soybean variety 01073219
US10863711B1 (en) 2019-08-16 2020-12-15 Monsanto Technology Llc Soybean variety 01073279
US10856509B1 (en) 2019-08-16 2020-12-08 Monsanto Technology Llc Soybean variety 01073199
US11129347B2 (en) 2019-08-16 2021-09-28 Monsanto Technology Llc Soybean variety 01073210
US11160237B2 (en) 2019-08-16 2021-11-02 Monsanto Technology Llc Soybean variety 01073183
US11006603B2 (en) 2019-08-16 2021-05-18 Monsanto Technology Llc Soybean variety 01072287
US11044869B2 (en) 2019-08-16 2021-06-29 Monsanto Technology Llc Soybean variety 01073270
US11096362B2 (en) 2019-08-16 2021-08-24 Monsanto Technology Llc Soybean variety 01073204
US11109551B2 (en) 2019-08-16 2021-09-07 Monsanto Technology Llc Soybean variety 01073253
US10932430B1 (en) 2019-08-16 2021-03-02 Monsanto Technology Llc Soybean variety 01073203
US11044868B2 (en) 2019-08-16 2021-06-29 Monsanto Technology Llc Soybean variety 01073261
US10973196B2 (en) 2019-08-16 2021-04-13 Monsanto Technology Llc Soybean variety 01073237
US11039591B2 (en) 2019-08-16 2021-06-22 Monsanto Technology Llc Soybean variety 01073340
US10905079B1 (en) 2019-08-16 2021-02-02 Monsanto Technology Llc Soybean variety 01073335
US11129349B2 (en) 2019-08-16 2021-09-28 Monsanto Technology Llc Soybean variety 01073350
US10863712B1 (en) 2019-08-16 2020-12-15 Monsanto Technology Llc Soybean variety 01073281
US10869454B1 (en) 2019-08-16 2020-12-22 Monsanto Technology Llc Soybean variety 01073329
US11071272B2 (en) 2019-08-16 2021-07-27 Monsanto Technology Llc Soybean variety 01073195
BR112022002280A2 (en) 2019-09-03 2022-04-26 Basf Se Composition for controlling spray drift, aqueous composition, method for reducing spray drift, use of aqueous composition, and kit of parts
CN110512023B (en) * 2019-09-04 2022-10-11 中国农业科学院油料作物研究所 Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence
US11229182B2 (en) 2019-09-16 2022-01-25 Monsanto Technology Llc Soybean variety 01077387
US11178841B2 (en) 2019-09-16 2021-11-23 Monsanto Technology Llc Soybean variety 01077386
US11266107B2 (en) 2019-09-16 2022-03-08 Monsanto Technology Llc Soybean variety 01081408
US11185044B2 (en) 2019-09-16 2021-11-30 Monsanto Technology Llc Soybean variety 01077343
US11284587B2 (en) 2019-09-16 2022-03-29 Monsanto Technology Llc Soybean variety 01077381
US11266106B2 (en) 2019-09-16 2022-03-08 Monsanto Technology Llc Soybean variety 01081407
US11266110B2 (en) 2019-09-16 2022-03-08 Monsanto Technology Llc Soybean variety 01077337
US11259494B2 (en) 2019-09-16 2022-03-01 Monsanto Technology Llc Soybean variety 01077345
US11337400B2 (en) 2019-09-16 2022-05-24 Monsanto Technology, Llc Soybean variety 01077373
US11259493B2 (en) 2019-09-16 2022-03-01 Monsanto Technology Llc Soybean variety 01077341
US11266109B2 (en) 2019-09-16 2022-03-08 Monsanto Technology Llc Soybean variety 01077385
US11350595B2 (en) 2019-09-16 2022-06-07 Monsanto Technology, Llc Soybean variety 01077372
US11185043B2 (en) 2019-09-16 2021-11-30 Monsanto Technology Llc Soybean variety 01077334
US11266105B2 (en) 2019-09-16 2022-03-08 Monsanto Technology Llc Soybean variety 01077338
US11266111B2 (en) 2019-09-17 2022-03-08 Monsanto Technology Llc Soybean variety 01077383
US11266108B2 (en) 2019-09-17 2022-03-08 Monsanto Technology Llc Soybean variety 01081409
US11297792B2 (en) 2019-09-17 2022-04-12 Monsanto Technology Llc Soybean variety 01077344
US11576341B2 (en) 2019-09-17 2023-02-14 Monsanto Technology, Llc Soybean variety 01072361
US11576340B2 (en) 2019-09-17 2023-02-14 Monsanto Technology, Llc Soybean variety 01081414
WO2021058659A1 (en) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Rnai-mediated pest control
CA3156302A1 (en) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
WO2021063736A1 (en) 2019-10-02 2021-04-08 Basf Se Bicyclic pyridine derivatives
WO2021063735A1 (en) 2019-10-02 2021-04-08 Basf Se New bicyclic pyridine derivatives
UY38911A (en) 2019-10-09 2021-05-31 Bayer Ag HETEROARYL-TRIAZOLE COMPOUNDS AS PESTICIDES, FORMULATIONS, USES AND METHODS OF USE OF THEM
AR120176A1 (en) 2019-10-09 2022-02-02 Bayer Ag HETEROARYL-TRIAZOLE COMPOUNDS AS PESTICIDES
EP4461128A3 (en) 2019-10-14 2025-03-26 BASF Agricultural Solutions US LLC Novel insect resistant genes and methods of use
US12241075B2 (en) 2019-10-14 2025-03-04 Basf Agricultural Solutions Us Llc Insect resistant genes and methods of use
US11252922B2 (en) 2019-10-18 2022-02-22 Monsanto Technology Llc Soybean variety 01077391
US11330777B2 (en) 2019-10-18 2022-05-17 Monsanto Technology, Llc Soybean variety 01077390
US11324181B2 (en) 2019-10-18 2022-05-10 Monsanto Technology Llc Soybean variety 01077335
US11330783B2 (en) 2019-10-18 2022-05-17 Monsanto Technology, Llc Soybean variety 01077336
US11252921B2 (en) 2019-10-18 2022-02-22 Monsanto Technology Llc Soybean variety 01077393
US11272679B2 (en) 2019-10-18 2022-03-15 Monsanto Technology Llc Soybean variety 01077330
US20220380318A1 (en) 2019-11-07 2022-12-01 Bayer Aktiengesellschaft Substituted sulfonyl amides for controlling animal pests
WO2021097162A1 (en) 2019-11-13 2021-05-20 Bayer Cropscience Lp Beneficial combinations with paenibacillus
MX2022005893A (en) 2019-11-15 2022-06-14 Basf Corp Methods of using a composition comprising an anionic pesticide and a buffer.
TW202134226A (en) 2019-11-18 2021-09-16 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
WO2021099271A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
TW202136248A (en) 2019-11-25 2021-10-01 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
WO2021155084A1 (en) 2020-01-31 2021-08-05 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
PY2112437A (en) 2020-02-18 2022-08-16 Bayer Ag NEW HETEROARYL-TRIAZOLE COMPOUNDS AS PESTICIDES
EP3708565A1 (en) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphenylamidines and the use thereof as fungicides
UY39115A (en) 2020-03-05 2021-10-29 Syngenta Crop Protection Ag FUNGICIDE MIXTURES OF ARYL METHOXYACRYLATE DERIVATIVES
EP4114184A1 (en) 2020-03-05 2023-01-11 Syngenta Crop Protection AG Fungicidal compositions
CN111172158B (en) * 2020-03-06 2021-11-09 科稷达隆(北京)生物技术有限公司 Glyphosate-resistant cotton transformation event KJC017 and application thereof
WO2021211926A1 (en) 2020-04-16 2021-10-21 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
WO2021209490A1 (en) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephenylaminoquinolines as fungicides
US20230212163A1 (en) 2020-04-21 2023-07-06 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocyclic derivatives as pest control agents
EP3903581A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors i
EP3903583A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iii
EP3903582A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ii
EP3903584A1 (en) 2020-04-28 2021-11-03 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors iv
GB202006399D0 (en) 2020-04-30 2020-06-17 Syngenta Crop Protection Ag Microbiocidal compounds
GB202006480D0 (en) 2020-05-01 2020-06-17 Syngenta Crop Protection Ag Microbiocidal compounds
GB202006606D0 (en) 2020-05-05 2020-06-17 Syngenta Crop Protection Ag Microbiocidal compounds
EP4146628A1 (en) 2020-05-06 2023-03-15 Bayer Aktiengesellschaft Pyridine (thio)amides as fungicidal compounds
TWI891782B (en) 2020-05-06 2025-08-01 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
WO2021228734A1 (en) 2020-05-12 2021-11-18 Bayer Aktiengesellschaft Triazine and pyrimidine (thio)amides as fungicidal compounds
EP3909950A1 (en) 2020-05-13 2021-11-17 Basf Se Heterocyclic compounds for the control of invertebrate pests
EP4153566A1 (en) 2020-05-19 2023-03-29 Bayer CropScience Aktiengesellschaft Azabicyclic(thio)amides as fungicidal compounds
CN111657226B (en) * 2020-05-29 2021-12-07 湖北省农业科学院畜牧兽医研究所 Purification breeding method of black-bone goats
MX2022015107A (en) 2020-06-02 2023-03-01 Pairwise Plants Services Inc METHODS TO CONTROL THE SIZE OF THE MERISTEM TO IMPROVE CROPS.
US12565489B2 (en) 2020-06-04 2026-03-03 Bayer Aktiengesellschaft Heterocyclyl pyrimidines and triazines as novel fungicides
EP3945089A1 (en) 2020-07-31 2022-02-02 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors v
CA3186659A1 (en) 2020-06-10 2021-12-16 Bayer Aktiengesellschaft Azabicyclyl-substituted heterocycles as fungicides
WO2021249800A1 (en) 2020-06-10 2021-12-16 Basf Se Substituted [1,2,4]triazole compounds as fungicides
US20230232821A1 (en) 2020-06-15 2023-07-27 Basf Se A stable, solvent-free, self-emulsifiable concentrate
WO2021257775A1 (en) 2020-06-17 2021-12-23 Pairwise Plants Services, Inc. Methods for controlling meristem size for crop improvement
US20230292747A1 (en) 2020-06-18 2023-09-21 Bayer Aktiengesellschaft Composition for use in agriculture
CN116157017A (en) 2020-06-18 2023-05-23 拜耳公司 3-(Pyridazin-4-yl)-5,6-dihydro-4H-1,2,4-oxadiazine derivatives as fungicides for crop protection
WO2021255091A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazoles and their derivatives as fungicides
UY39276A (en) 2020-06-19 2022-01-31 Bayer Ag USE OF 1,3,4-OXADIAZOL-2-ILPYRIMIDINE COMPOUNDS TO CONTROL PHYTOPATHOGENIC MICROORGANISMS, METHODS OF USE AND COMPOSITIONS.
WO2021255089A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides
UY39275A (en) 2020-06-19 2022-01-31 Bayer Ag 1,3,4-OXADIAZOLE PYRIMIDINES AS FUNGICIDES, PROCESSES AND INTERMEDIARIES FOR THEIR PREPARATION, METHODS OF USE AND USES OF THE SAME
EP3929189A1 (en) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Novel heteroaryl-substituted pyrazine derivatives as pesticides
KR20230039665A (en) 2020-07-02 2023-03-21 바이엘 악티엔게젤샤프트 Heterocycle derivatives as pest control agents
EP3960727A1 (en) 2020-08-28 2022-03-02 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors vi
EP3939961A1 (en) 2020-07-16 2022-01-19 Basf Se Strobilurin type compounds and their use for combating phytopathogenic fungi
WO2022017836A1 (en) 2020-07-20 2022-01-27 BASF Agro B.V. Fungicidal compositions comprising (r)-2-[4-(4-chlorophenoxy)-2-(trifluoromethyl)phenyl]-1- (1,2,4-triazol-1-yl)propan-2-ol
US20240011043A1 (en) 2020-07-31 2024-01-11 Inari Agriculture Technology, Inc. Generation of plants with improved transgenic loci by genome editing
US11326177B2 (en) 2020-07-31 2022-05-10 Inari Agriculture Technology, Inc. INIR12 transgenic maize
CA3188283A1 (en) * 2020-07-31 2022-02-03 Inari Agriculture Technology, Inc. Genome editing of transgenic crop plants with modified transgenic loci
US11369073B2 (en) 2020-07-31 2022-06-28 Inari Agriculture Technology, Inc. INIR12 transgenic maize
BR112023001798A2 (en) * 2020-07-31 2023-02-23 Inari Agriculture Tech Inc TRANSGENIC MAIZE PLANT CELL, TRANSGENIC MAIZE PLANT PART, TRANSGENIC MAIZE PLANT, METHOD FOR OBTAINING A BULK POPULATION OF INDOGAMIC SEEDS, METHOD FOR OBTAINING HYBRID MAIZE SEED, DNA MOLECULE, PROCESSED TRANSGENIC MAIZE PLANT PRODUCT , BIOLOGICAL SAMPLE, NUCLEIC ACID MOLECULE ADAPTED FOR DETECTION OF GENOMIC DNA, METHOD OF DETECTION OF A CORN PLANT CELL, METHOD OF EXCISION OF THE INIR12 TRANSGENIC LOCIE OF THE CORN PLANT CELL GENOME, METHOD OF MODIFICATION OF A PLANT CELL OF TRANSGENIC CORN, METHOD OF PRODUCTION OF CELLS OF TRANSGENIC CORN PLANT COMPRISING AN INIR12 TRANSGENIC LOCIUS, CALLUS OF TRANSGENIC CORN PLANT, SEED OF TRANSGENIC CORN PLANT, METHOD OF USE OF CORN PLANT CELL, METHOD OF COLLECTION OF DATA FROM NUCLEIC ACID ANALYSIS, PLANT REPRODUCTION METHOD
US11214811B1 (en) 2020-07-31 2022-01-04 Inari Agriculture Technology, Inc. INIR6 transgenic maize
EP3970494A1 (en) 2020-09-21 2022-03-23 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors viii
WO2022033991A1 (en) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft 5-amino substituted triazoles as pest control agents
US20240026372A1 (en) 2020-08-31 2024-01-25 Basf Se Plant yield improvement
WO2022053453A1 (en) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide as pest control agents
US11252923B1 (en) 2020-09-09 2022-02-22 Monsanto Technology Llc Soybean cultivar 99003018
US11206797B1 (en) 2020-09-09 2021-12-28 Monsanto Technology Llc Soybean cultivar 97320218
US11259495B1 (en) 2020-09-09 2022-03-01 Monsanto Technology Llc Soybean cultivar 90381408
US11234406B1 (en) 2020-09-09 2022-02-01 Monsanto Technology Llc Soybean cultivar 98010818
US11234405B1 (en) 2020-09-09 2022-02-01 Monsanto Technology Llc Soybean cultivar 90110208
US20220079070A1 (en) 2020-09-11 2022-03-17 Monsanto Technology Llc Soybean cultivar 94112440
US11350596B2 (en) 2020-09-11 2022-06-07 Monsanto Technology, Llc Soybean cultivar 96050600
US11284592B1 (en) 2020-09-11 2022-03-29 Monsanto Technology Llc Soybean cultivar 91030603
US11439111B2 (en) 2020-09-11 2022-09-13 Monsanto Technology Llc Soybean cultivar 99354100
US11277996B1 (en) 2020-09-11 2022-03-22 Monsanto Technology Llc Soybean cultivar 97051600
US11310988B2 (en) 2020-09-11 2022-04-26 Monsanto Technology Llc Soybean cultivar 92340030
US11229183B1 (en) 2020-09-11 2022-01-25 Monsanto Technology Llc Soybean cultivar 93070703
US11317587B2 (en) 2020-09-11 2022-05-03 Stine Seed Farm, Inc. Soybean cultivar 96030600
US11317588B2 (en) 2020-09-11 2022-05-03 Stine Seed Farm, Inc. Soybean cultivar 97080600
US11330784B2 (en) 2020-09-11 2022-05-17 Monsanto Technology, Llc Soybean cultivar 95322700
US11357200B2 (en) 2020-09-11 2022-06-14 Monsanto Technology, Llc Soybean cultivar 92131600
US11744211B2 (en) 2020-09-15 2023-09-05 Monsanto Technology, Llc Soybean cultivar 92310017
US11406080B2 (en) 2020-09-15 2022-08-09 Stine Seed Farm, Inc. Soybean cultivar 92420140
US11412692B2 (en) 2020-09-15 2022-08-16 Monsanto Technology Llc Soybean cultivar 90290600
US11419299B2 (en) 2020-09-15 2022-08-23 Monsanto Technology Llc Soybean cultivar 91361201
US11324184B2 (en) 2020-09-15 2022-05-10 Stine Seed Farm, Inc. Soybean cultivar 97061850
US11363778B2 (en) 2020-09-15 2022-06-21 Monsanto Technology Llc Soybean cultivar 90221620
US11363780B2 (en) 2020-09-15 2022-06-21 Monsanto Technology Llc Soybean cultivar 93272026
US11337401B2 (en) 2020-09-15 2022-05-24 Monsanto Technology, Llc Soybean cultivar 90370640
US11363779B2 (en) 2020-09-15 2022-06-21 Monsanto Technology Llc Soybean cultivar 90301201
US11324183B2 (en) 2020-09-15 2022-05-10 Stine Seed Farm, Inc. Soybean cultivar 90250820
US11357201B2 (en) 2020-09-15 2022-06-14 Monsanto Technology, Llc Soybean cultivar 94411660
US11317589B2 (en) 2020-09-15 2022-05-03 Monsanto Technology Llc Soybean cultivar 95430820
US11399497B2 (en) 2020-09-15 2022-08-02 Monsanto Technology, Llc Soybean cultivar 93333110
US11606926B2 (en) 2020-09-15 2023-03-21 Monsanto Technology Llc Soybean cultivar 94030201
US11310989B2 (en) 2020-09-15 2022-04-26 Monsanto Technology Llc Soybean cultivar 94071660
US11343989B2 (en) 2020-09-15 2022-05-31 Monsanto Technology, Llc Soybean cultivar 92350300
US11324182B2 (en) 2020-09-15 2022-05-10 Stine Seed Farm, Inc. Soybean cultivar 95060020
US11369074B2 (en) 2020-09-15 2022-06-28 Monsanto Technology Llc Soybean cultivar 99122620
US11343988B2 (en) 2020-09-15 2022-05-31 Stine Seed Farm, Inc. Soybean cultivar 91041800
US11350597B2 (en) 2020-09-15 2022-06-07 Monsanto Technology, Llc Soybean cultivar 94111580
US11399496B2 (en) 2020-09-15 2022-08-02 Monsanto Technology, Llc Soybean cultivar 90116100
US11425879B2 (en) 2020-09-15 2022-08-30 Monsanto Technology, Llc Soybean cultivar 93054930
WO2022058327A1 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Substituted ureas and derivatives as new antifungal agents
US11343987B2 (en) 2020-09-15 2022-05-31 Stine Seed Farm, Inc. Soybean cultivar 90401320
GB202014840D0 (en) 2020-09-21 2020-11-04 Syngenta Crop Protection Ag Microbiocidal compounds
EP3974414A1 (en) 2020-09-25 2022-03-30 Bayer AG 5-amino substituted pyrazoles and triazoles as pesticides
WO2022089969A1 (en) 2020-10-27 2022-05-05 BASF Agro B.V. Compositions comprising mefentrifluconazole
US11612128B2 (en) 2020-11-02 2023-03-28 Monsanto Technology Llc Soybean variety 01083666
WO2022090069A1 (en) 2020-11-02 2022-05-05 Basf Se Compositions comprising mefenpyr-diethyl
US11596122B2 (en) 2020-11-02 2023-03-07 Monsanto Technology Llc Soybean variety 01077891
WO2022090071A1 (en) 2020-11-02 2022-05-05 Basf Se Use of mefenpyr-diethyl for controlling phytopathogenic fungi
US11477960B2 (en) 2020-11-02 2022-10-25 Monsanto Technology Llc Soybean variety 01077912
US11547075B2 (en) 2020-11-02 2023-01-10 Monsanto Technology Llc Soybean variety 01078822
US11653613B2 (en) 2020-11-02 2023-05-23 Monsanto Technology Llc Soybean variety 01077829
US11510382B2 (en) 2020-11-02 2022-11-29 Monsanto Technology Llc Soybean variety 01078845
US11653612B2 (en) 2020-11-02 2023-05-23 Monsanto Technology Llc Soybean variety 01077826
US11445688B2 (en) 2020-11-05 2022-09-20 Monsanto Technology, Llc Soybean variety 01077870
US11350600B2 (en) 2020-11-05 2022-06-07 Monsanto Technology, Llc Soybean variety 01083699
US11412694B2 (en) 2020-11-05 2022-08-16 Monsanto Technology Llc Soybean variety 01077905
US11277997B1 (en) 2020-11-05 2022-03-22 Monsanto Technology Llc Soybean variety 01077853
US11343990B2 (en) 2020-11-05 2022-05-31 Monsanto Technology, Llc Soybean variety 01083439
US11533883B2 (en) 2020-11-05 2022-12-27 Monsanto Technology, Llc Soybean variety 01077890
US11357205B2 (en) 2020-11-05 2022-06-14 Monsanto Technology Llc Soybean variety 01083631
US11457591B2 (en) 2020-11-05 2022-10-04 Monsanto Technology, Llc Soybean variety 01077893
US11445689B2 (en) 2020-11-05 2022-09-20 Monsanto Technology, Llc Soybean variety 01078100
US11284593B1 (en) 2020-11-05 2022-03-29 Monsanto Technology Llc Soybean variety 01083687
US11284594B1 (en) 2020-11-05 2022-03-29 Monsanto Technology Llc Soybean variety 01077848
US11343993B2 (en) 2020-11-05 2022-05-31 Monsanto Technology, Llc Soybean variety 01083650
US11343992B2 (en) 2020-11-05 2022-05-31 Monsanto Technology, Llc Soybean variety 01078550
US11343991B2 (en) 2020-11-05 2022-05-31 Monsanto Technology, Llc Soybean variety 01078115
US11464195B2 (en) 2020-11-06 2022-10-11 Monsanto Technology Llc Soybean variety 01083654
US11547076B2 (en) 2020-11-06 2023-01-10 Monsanto Technology, Llc Soybean variety 01077931
US11484000B2 (en) 2020-11-06 2022-11-01 Monsanto Technology, Llc Soybean variety 01083661
US11533884B2 (en) 2020-11-06 2022-12-27 Monsanto Technology, Llc Soybean variety 01083660
US11547077B2 (en) 2020-11-06 2023-01-10 Monsanto Technology, Llc Soybean variety 01083688
US11350601B2 (en) 2020-11-06 2022-06-07 Monsanto Technology, Llc Soybean variety 01077876
US11343995B1 (en) 2020-11-06 2022-05-31 Monsanto Technology, Llc Soybean variety 01083647
US11357206B2 (en) 2020-11-06 2022-06-14 Monsanto Technology Llc Soybean variety 01077974
US11477961B2 (en) 2020-11-06 2022-10-25 Monsanto Technology, Llc Soybean variety 01077940
US11445690B2 (en) 2020-11-06 2022-09-20 Monsanto Technology Llc Soybean variety 01083639
US11528879B2 (en) 2020-11-06 2022-12-20 Monsanto Technology, Llc Soybean variety 01083659
US11343996B1 (en) 2020-11-06 2022-05-31 Monsanto Technology, Llc Soybean variety 01077875
US11439114B2 (en) 2020-11-06 2022-09-13 Monsanto Technology, Llc Soybean variety 01078032
US11432518B2 (en) 2020-11-06 2022-09-06 Monsanto Technology, Llc Soybean variety 01078759
US11330785B1 (en) 2020-11-06 2022-05-17 Monsanto Technology, Llc Soybean variety 01077941
US11457600B2 (en) 2020-11-06 2022-10-04 Monsanto Technology, Llc Soybean variety 01083646
US11510384B2 (en) 2020-11-06 2022-11-29 Monsanto Technology, Llc Soybean variety 01078675
US11343994B1 (en) 2020-11-06 2022-05-31 Monsanto Technology, Llc Soybean variety 01083655
US11457601B2 (en) 2020-11-06 2022-10-04 Monsanto Technology Llc Soybean variety 01083638
US11553671B2 (en) 2020-11-06 2023-01-17 Monsanto Technology, Llc Soybean variety 01083653
US11382301B2 (en) 2020-11-06 2022-07-12 Monsanto Technology, Llc Soybean variety 01077881
US11369076B2 (en) 2020-11-06 2022-06-28 Monsanto Technology, Llc Soybean variety 01078749
WO2022106304A1 (en) 2020-11-23 2022-05-27 BASF Agro B.V. Compositions comprising mefentrifluconazole
TW202231187A (en) 2020-11-27 2022-08-16 瑞士商先正達農作物保護公司 Pesticidal compositions
PY21103556A (en) 2020-12-02 2023-05-03 Syngenta Crop Protection Ag FUNGICIDAL COMPOSITIONS
WO2022117650A1 (en) 2020-12-02 2022-06-09 Syngenta Crop Protection Ag Fungicidal compositions
WO2022128524A1 (en) 2020-12-14 2022-06-23 Basf Se Sulfoximine pesticides
EP3915971A1 (en) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phenyl-s(o)n-phenylamidines and the use thereof as fungicides
WO2022129190A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides
JP2023554063A (en) 2020-12-18 2023-12-26 バイエル・アクチエンゲゼルシヤフト Use of DHODH inhibitors to control resistant phytopathogenic fungi in crops
WO2022129188A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines as fungicides
WO2022129196A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Heterobicycle substituted 1,2,4-oxadiazoles as fungicides
EP4036083A1 (en) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft 5-oxy substituted heterocycles as pesticides
US11653614B2 (en) 2021-02-11 2023-05-23 Eagle Research LLC Soybean cultivar P-17
EP4291641A1 (en) 2021-02-11 2023-12-20 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin oxidase levels in plants
EP4043444A1 (en) 2021-02-11 2022-08-17 Basf Se Substituted isoxazoline derivatives
US12365910B2 (en) 2021-02-25 2025-07-22 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture in plants
AR125089A1 (en) 2021-03-19 2023-06-07 Syngenta Crop Protection Ag PESTICIDE COMPOSITIONS
BR112023019400A2 (en) 2021-03-30 2023-12-05 Bayer Ag 3-(HETERO)ARYL-5-CHLORODIFLOROMETHYL-1,2,4-OXADIAZOLE AS A FUNGICIDE
WO2022207496A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
EP4333616A1 (en) 2021-05-03 2024-03-13 Basf Se Additives for enhancing the pesticidal effectiveness of pesticidal microorganisms
MX2023013014A (en) 2021-05-04 2023-11-15 Syngenta Crop Protection Ag Use of clethodim for insect control.
WO2022233777A1 (en) 2021-05-06 2022-11-10 Bayer Aktiengesellschaft Alkylamide substituted, annulated imidazoles and use thereof as insecticides
EP4337661A1 (en) 2021-05-12 2024-03-20 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocycle derivatives as pest control agents
EP4091451A1 (en) 2021-05-17 2022-11-23 BASF Agro B.V. Compositions comprising mefentrifluconazole
EP4341258B1 (en) 2021-05-18 2025-12-03 Basf Se New substituted pyridines as fungicides
CN117355518A (en) 2021-05-18 2024-01-05 巴斯夫欧洲公司 New substituted pyridines for use as fungicides
BR112023023989A2 (en) 2021-05-18 2024-01-30 Basf Se COMPOUNDS, COMPOSITION, METHOD TO COMBAT PHYTOPATHOGENIC AND SEED FUNGI
CA3221617A1 (en) 2021-06-14 2022-12-22 Basf Se Yield improvement by gene combinations
US20220411813A1 (en) 2021-06-17 2022-12-29 Pairwise Plants Services, Inc. Modification of growth regulating factor family transcription factors in soybean
UY39827A (en) 2021-06-24 2023-01-31 Pairwise Plants Services Inc MODIFICATION OF UBIQUITIN LIGASE E3 HECT GENES TO IMPROVE PERFORMANCE TRAITS
US12529063B2 (en) 2021-07-01 2026-01-20 Pairwise Plants Services, Inc. Methods and compositions for enhancing root system development
MX2024000074A (en) 2021-07-02 2024-02-23 Syngenta Crop Protection Ag Use of fluazifop-p-butyl for insect control.
EP4119547A1 (en) 2021-07-12 2023-01-18 Basf Se Triazole compounds for the control of invertebrate pests
US20240351995A1 (en) 2021-08-02 2024-10-24 Basf Se (3-pirydyl)-quinazoline
EP4380926A1 (en) 2021-08-02 2024-06-12 Basf Se (3-quinolyl)-quinazoline
US12365911B2 (en) 2021-08-12 2025-07-22 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
JP2024529148A (en) 2021-08-13 2024-08-01 バイエル、アクチエンゲゼルシャフト Active compound combinations and antifungal compositions containing them - Patents.com
PY2270221A (en) 2021-08-17 2023-03-20 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING HISTIDINE KINASE CYTOKININ RECEPTOR GENES IN PLANTS
EP4140986A1 (en) 2021-08-23 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
US11647720B2 (en) 2021-08-24 2023-05-16 Monsanto Technology Llc Soybean cultivar 01130157
US11666031B2 (en) 2021-08-24 2023-06-06 Monsanto Technology Llc Soybean cultivar 05140102
US11647723B2 (en) 2021-08-24 2023-05-16 Monsanto Technology Llc Soybean cultivar 07060434
US11678636B2 (en) 2021-08-24 2023-06-20 Monsanto Technology, Llc Soybean cultivar 04070428
US11647722B2 (en) 2021-08-24 2023-05-16 Monsanto Technology Llc Soybean cultivar 02140434
US11696556B2 (en) 2021-08-24 2023-07-11 Monsanto Technology, Llc Soybean cultivar 07080746
US11647724B2 (en) 2021-08-24 2023-05-16 Monsanto Technology Llc Soybean cultivar 03230124
US11641837B2 (en) 2021-08-24 2023-05-09 Monsanto Technology Llc Soybean cultivar 02340134
US11678635B2 (en) 2021-08-24 2023-06-20 Stine Seed Farm, Inc. Soybean cultivar 01160922
US11647721B2 (en) 2021-08-24 2023-05-16 Monsanto Technology Llc Soybean cultivar 02330517
US11641838B2 (en) 2021-08-24 2023-05-09 Monsanto Technology Llc Soybean cultivar 04130514
MX2024002386A (en) 2021-08-25 2024-03-14 Bayer Ag Novel pyrazinyl-triazole compounds as pesticides.
EP4140995A1 (en) 2021-08-27 2023-03-01 Basf Se Pyrazine compounds for the control of invertebrate pests
EP4395531A1 (en) 2021-08-30 2024-07-10 Pairwise Plants Services, Inc. Modification of ubiquitin binding peptidase genes in plants for yield trait improvement
US12029189B2 (en) 2021-08-30 2024-07-09 Monsanto Technology Llc Soybean cultivar 02170813
US11696557B2 (en) 2021-08-31 2023-07-11 Monsanto Technology, Llc Soybean cultivar 04060955
US11672229B2 (en) 2021-08-31 2023-06-13 Monsanto Technology, Llc Soybean cultivar 08180710
US11672230B2 (en) 2021-08-31 2023-06-13 Monsanto Technology, Llc Soybean cultivar 03260108
US11700826B2 (en) 2021-08-31 2023-07-18 Monsanto Technology, Llc Soybean cultivar 02410315
US11800847B2 (en) 2021-08-31 2023-10-31 Monsanto Technology, Llc Soybean cultivar 05050112
US11700825B2 (en) 2021-08-31 2023-07-18 Monsanto Technology, Llc Soybean cultivar 06170324
US11696558B2 (en) 2021-08-31 2023-07-11 Monsanto Technology, Llc Soybean cultivar 02021411
US11647725B2 (en) 2021-08-31 2023-05-16 Monsanto Technology Llc Soybean cultivar 07160416
US11716947B2 (en) 2021-08-31 2023-08-08 Monsanto Technology, Llc Soybean cultivar 07030013
US11647727B2 (en) 2021-08-31 2023-05-16 Monsanto Technology Llc Soybean cultivar 04120446
US11700827B2 (en) 2021-08-31 2023-07-18 Monsanto Technology, Llc Soybean cultivar 07220837
US11856914B2 (en) 2021-08-31 2024-01-02 Monsanto Technology, Llc Soybean cultivar 01140108
US11647726B2 (en) 2021-08-31 2023-05-16 Monsanto Technology Llc Soybean cultivar 04070902
EP4144739A1 (en) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Anellated pyrazoles as parasiticides
AR126938A1 (en) 2021-09-02 2023-11-29 Pairwise Plants Services Inc METHODS AND COMPOSITIONS TO IMPROVE PLANT ARCHITECTURE AND PERFORMANCE TRAITS
EP4151631A1 (en) 2021-09-20 2023-03-22 Basf Se Heterocyclic compounds for the control of invertebrate pests
CA3232804A1 (en) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Methods and compositions for reducing pod shatter in canola
US11819003B2 (en) 2021-09-28 2023-11-21 Monsanto Technology, Llc Soybean variety 01083835
US11825804B2 (en) 2021-09-28 2023-11-28 Monsanto Technology, Llc Soybean variety 01083877
US11856918B2 (en) 2021-09-28 2024-01-02 Monsanto Technology, Llc Soybean variety 01084034
US11744215B2 (en) 2021-09-28 2023-09-05 Monsanto Technology, Llc Soybean variety 01084068
US11825805B2 (en) 2021-09-28 2023-11-28 Monsanto Technology, Llc Soybean variety 01083845
US11825806B2 (en) 2021-09-28 2023-11-28 Monsanto Technology, Llc Soybean variety 01083849
US11917968B2 (en) 2021-09-28 2024-03-05 Monsanto Technology Llc Soybean variety 01083684
US11903357B2 (en) 2021-09-28 2024-02-20 Monsanto Technology Llc Soybean variety 01083737
US11707044B2 (en) 2021-09-28 2023-07-25 Monsanto Technology, Llc Soybean variety 01083999
US11997978B2 (en) 2021-09-28 2024-06-04 Monsanto Technology Llc Soybean variety 01083711
US11730132B2 (en) 2021-09-28 2023-08-22 Monsanto Technology, Llc Soybean variety 01083701
US11917969B2 (en) 2021-09-28 2024-03-05 Monsanto Technology Llc Soybean variety 01083899
US11985949B2 (en) 2021-09-28 2024-05-21 Monsanto Technology Llc Soybean variety 01091555
US11917971B2 (en) 2021-09-29 2024-03-05 Monsanto Technology Llc Soybean variety 01091703
US11839192B2 (en) 2021-09-29 2023-12-12 Monsanto Technology, Llc Soybean variety 01091705
US11744217B2 (en) 2021-09-29 2023-09-05 Monsanto Technology, Llc Soybean variety 01091711
US11744216B2 (en) 2021-09-29 2023-09-05 Monsanto Technology, Llc Soybean variety 01091693
US11930768B2 (en) 2021-09-29 2024-03-19 Monsanto Technology Llc Soybean variety 01091702
US11917970B2 (en) 2021-09-29 2024-03-05 Monsanto Technology Llc Soybean variety 01091697
US11716958B2 (en) 2021-09-29 2023-08-08 Monsanto Technology, Llc Soybean variety 01091691
US11716957B2 (en) 2021-09-29 2023-08-08 Monsanto Technology, Llc Soybean variety 01091574
US11925161B2 (en) 2021-09-29 2024-03-12 Monsanto Technology Llc Soybean variety 01091628
US11758869B2 (en) 2021-09-29 2023-09-19 M.S. Technologies, L.L.C. Soybean variety 01091607
US12089555B2 (en) 2021-09-30 2024-09-17 Monsanto Technology Llc Soybean variety 01091725
US11744218B2 (en) 2021-09-30 2023-09-05 Monsanto Technology, Llc Soybean variety 01091749
US12004475B2 (en) 2021-09-30 2024-06-11 Monsanto Technology Llc Soybean variety 01091767
US11930769B2 (en) 2021-09-30 2024-03-19 Monsanto Technology Llc Soybean variety 01091763
US11751529B2 (en) 2021-09-30 2023-09-12 M.S. Technologies, L.L.C. Soybean variety 01091734
US12004474B2 (en) 2021-09-30 2024-06-11 Monsanto Technology Llc Soybean variety 01091721
US11917973B2 (en) 2021-10-01 2024-03-05 Monsanto Technology Llc Soybean variety 01091785
US11930770B2 (en) 2021-10-01 2024-03-19 Monsanto Technology Llc Soybean variety 01091765
US11917972B2 (en) 2021-10-01 2024-03-05 Monsanto Technology Llc Soybean variety 01091777
US11963509B2 (en) 2021-10-01 2024-04-23 Monsanto Technology Llc Soybean variety 01091775
US20230108968A1 (en) 2021-10-04 2023-04-06 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
US11832578B2 (en) 2021-10-04 2023-12-05 Monsanto Technology, Llc Soybean variety 01091795
US11917974B2 (en) 2021-10-04 2024-03-05 Monsanto Technology, Llc Soybean variety 01091792
US11903358B2 (en) 2021-10-04 2024-02-20 Monsanto Technology Llc Soybean variety 01091805
US11839193B2 (en) 2021-10-04 2023-12-12 Monsanto Technology, Llc Soybean variety 01091798
US12082547B2 (en) 2021-10-04 2024-09-10 Monsanto Technology Llc Soybean variety 01091811
AR127300A1 (en) 2021-10-07 2024-01-10 Pairwise Plants Services Inc METHODS TO IMPROVE FLOWER FERTILITY AND SEED YIELD
WO2023072670A1 (en) 2021-10-28 2023-05-04 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors x
WO2023072671A1 (en) 2021-10-28 2023-05-04 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors ix
CN118541353A (en) 2021-11-03 2024-08-23 拜耳公司 Bis (hetero) aryl thioether (thio) amides as fungicidal compounds
WO2023099445A1 (en) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hetero)aryl thioether oxadiazines as fungicidal compounds
US12193386B2 (en) 2021-11-30 2025-01-14 Monsanto Technology Llc Soybean variety 01091764
EP4194453A1 (en) 2021-12-08 2023-06-14 Basf Se Pyrazine compounds for the control of invertebrate pests
AR127904A1 (en) 2021-12-09 2024-03-06 Pairwise Plants Services Inc METHODS TO IMPROVE FLOWER FERTILITY AND SEED YIELD
EP4198033A1 (en) 2021-12-14 2023-06-21 Basf Se Heterocyclic compounds for the control of invertebrate pests
EP4198023A1 (en) 2021-12-16 2023-06-21 Basf Se Pesticidally active thiosemicarbazone compounds
US12004476B2 (en) 2022-01-26 2024-06-11 Monsanto Technology Llc. Cotton variety 20R750B3XF
UY40132A (en) 2022-01-31 2023-08-31 Pairwise Plants Services Inc SUPPRESSION OF THE SHADE AVOIDANCE RESPONSE IN PLANTS
CN119012913A (en) 2022-02-01 2024-11-22 环球化学股份有限公司 Methods and compositions for controlling pests
CN119156135A (en) 2022-02-01 2024-12-17 环球化学股份有限公司 Methods and compositions for controlling pests on soybeans
US20250197358A1 (en) 2022-02-17 2025-06-19 Basf Se Pesticidally active thiosemicarbazone compounds
EP4479540A1 (en) 2022-02-18 2024-12-25 Basf Se Coumarin synthesis and uses thereof
CN114787389A (en) 2022-02-21 2022-07-22 北京大北农生物技术有限公司 Nucleic acid sequence for detecting soybean plant DBN8205 and detection method thereof
PY2314419A (en) 2022-03-02 2023-09-25 Pairwise Plants Services Inc MODIFICATION OF BRASSINOSTEROID RECEPTOR GENES TO IMPROVE PERFORMANCE TRAITS
EP4238971A1 (en) 2022-03-02 2023-09-06 Basf Se Substituted isoxazoline derivatives
WO2023192838A1 (en) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Early flowering rosaceae plants with improved characteristics
AU2023251095A1 (en) 2022-04-07 2024-10-17 Monsanto Technology Llc Methods and compositions for improving resistance to fusarium head blight
EP4511387A1 (en) 2022-04-21 2025-02-26 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
AU2023259351A1 (en) * 2022-04-27 2024-10-10 Monsanto Technology Llc Transgenic soybean event gm_csm63714 and methods for detection and uses thereof
UY40250A (en) 2022-05-02 2023-11-15 Pairwise Plants Services Inc METHODS AND COMPOSITIONS TO IMPROVE PERFORMANCE AND DISEASE RESISTANCE
CN119522219A (en) 2022-05-03 2025-02-25 拜耳公司 Crystalline form of (5S)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4H-1,2,4-oxadiazine
JP2025516324A (en) 2022-05-03 2025-05-27 バイエル、アクチエンゲゼルシャフト Use of (5S)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4H-1,2,4-oxadiazine for controlling undesirable microorganisms
UY40255A (en) 2022-05-05 2023-11-15 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING ROOT ARCHITECTURE AND/OR IMPROVING PERFORMANCE RANGES
UY40326A (en) 2022-06-27 2023-12-29 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING SHADE ESCAPE IN PLANTS
CN119487055A (en) 2022-06-29 2025-02-18 成对植物服务股份有限公司 Methods and compositions for controlling meristem size for crop improvement
US20240002873A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024018016A1 (en) 2022-07-21 2024-01-25 Syngenta Crop Protection Ag Crystalline forms of 1,2,4-oxadiazole fungicides
CA3263381A1 (en) 2022-08-02 2024-02-08 Basf Se Pyrazolo pesticidal compounds
WO2024030984A1 (en) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
CA3264244A1 (en) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024033374A1 (en) 2022-08-11 2024-02-15 Syngenta Crop Protection Ag Novel arylcarboxamide or arylthioamide compounds
EP4584282A1 (en) 2022-09-08 2025-07-16 Pairwise Plants Services, Inc. Methods and compositions for improving yield characteristics in plants
EP4342885A1 (en) 2022-09-20 2024-03-27 Basf Se N-(3-(aminomethyl)-phenyl)-5-(4-phenyl)-5-(trifluoromethyl)-4,5-dihydroisoxazol-3-amine derivatives and similar compounds as pesticides
US12284966B2 (en) 2022-09-21 2025-04-29 Monsanto Technology Llc Soybean cultivar 19241023
US12268166B2 (en) 2022-09-21 2025-04-08 Monsanto Technology Llc Soybean cultivar 14030941
US12274225B2 (en) 2022-09-21 2025-04-15 Monsanto Technology Llc Soybean cultivar 12340924
US12295332B2 (en) 2022-09-21 2025-05-13 Monsanto Technology Llc Soybean cultivar 19221717
US12207614B2 (en) 2022-09-21 2025-01-28 Monsanto Technology Llc Soybean cultivar 15280717
US12396426B2 (en) 2022-09-21 2025-08-26 Monsanto Technology Llc Soybean cultivar 18071201
US12207612B2 (en) 2022-09-21 2025-01-28 Monsanto Technology Llc Soybean cultivar 18181400
US12336490B2 (en) 2022-09-21 2025-06-24 Monsanto Technology Llc Soybean cultivar 11251200
US12207613B2 (en) 2022-09-21 2025-01-28 Monsanto Technology Llc Soybean cultivar 17101336
US12268167B2 (en) 2022-09-21 2025-04-08 Monsanto Technology Llc Soybean cultivar 15040915
US12284965B2 (en) 2022-09-21 2025-04-29 Monsanto Technology Llc Soybean cultivar 12350011
US12239087B2 (en) 2022-09-21 2025-03-04 Monsanto Technology Llc Soybean cultivar 17111743
US12414529B2 (en) 2022-09-21 2025-09-16 Monsanto Technology Llc Soybean cultivar 11232411
US12207615B2 (en) 2022-09-21 2025-01-28 Monsanto Technology Llc Soybean cultivar 15301811
US12284967B2 (en) 2022-09-21 2025-04-29 Monsanto Technology Llc Soybean cultivar 13323023
US12268168B2 (en) 2022-09-21 2025-04-08 Monsanto Technology Llc Soybean cultivar 17041010
US12284968B2 (en) 2022-09-21 2025-04-29 Monsanto Technology Llc Soybean cultivar 16150010
US12402594B2 (en) 2022-09-21 2025-09-02 Monsanto Technology Llc Soybean cultivar 15202010
GB202214202D0 (en) 2022-09-28 2022-11-09 Syngenta Crop Protection Ag Agricultural methods
US12274226B2 (en) 2022-09-28 2025-04-15 Monsanto Technology Llc Soybean cultivar 10411540
US12284971B2 (en) 2022-09-28 2025-04-29 Monsanto Technology Llc Soybean cultivar 13380227
US12274228B2 (en) 2022-09-28 2025-04-15 Mansanto Technology Llc Soybean cultivar 14102235
US12225871B2 (en) 2022-09-28 2025-02-18 Monsanto Technology Llc Soybean cultivar 15341968
US12219915B2 (en) 2022-09-28 2025-02-11 Monsanto Technology Llc Soybean cultivar 15161227
US12274227B2 (en) 2022-09-28 2025-04-15 Monsanto Technology Llc Soybean cultivar 11021540
WO2024068518A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
EP4295688A1 (en) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Active compound combination
US12453327B2 (en) 2022-09-28 2025-10-28 Monsanto Technology Llc Soybean cultivar 17060354
US12302845B2 (en) 2022-09-28 2025-05-20 Monsanto Technology Llc Soybean cultivar 15091010
US12207616B2 (en) 2022-09-28 2025-01-28 Monsanto Technology Llc Soybean cultivar 17370111
US12268172B2 (en) 2022-09-28 2025-04-08 Monsanto Technology Llc Soybean cultivar 13011855
GB202214203D0 (en) 2022-09-28 2022-11-09 Syngenta Crop Protection Ag Fungicidal compositions
WO2024068519A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068517A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
US12284970B2 (en) 2022-09-28 2025-04-29 Monsanto Technology Llc Soybean cultivar 12070855
US12268173B2 (en) 2022-09-28 2025-04-08 Monsanto Technology Llc Soybean cultivar 17050534
US12213442B2 (en) 2022-09-28 2025-02-04 Monsanto Technology Llc Soybean cultivar 10220111
WO2024068520A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
US12268174B2 (en) 2022-09-28 2025-04-08 Monsanto Technology Llc Soybean cultivar 15410048
US12490704B2 (en) 2022-09-28 2025-12-09 Monsanto Technology Llc Soybean cultivar 15231737
EP4361126A1 (en) 2022-10-24 2024-05-01 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors xv
US12302848B2 (en) 2022-11-01 2025-05-20 Monsanto Technology Llc Soybean variety 01091599
US12389862B2 (en) 2022-11-02 2025-08-19 Monsanto Technology Llc Soybean variety 01091626
US12514213B2 (en) 2022-11-02 2026-01-06 Monsanto Technology Llc Soybean variety 01094692
US12295333B2 (en) 2022-11-02 2025-05-13 Monsanto Technology Llc Soybean variety 01094697
US12284973B2 (en) 2022-11-02 2025-04-29 Monsanto Technology Llc Soybean variety 01094700
US12295334B2 (en) 2022-11-02 2025-05-13 Monsanto Technology Llc Soybean variety 01093524
US12514214B2 (en) 2022-11-02 2026-01-06 Monsanto Technology Llc Soybean variety 01093014
US12396427B2 (en) 2022-11-02 2025-08-26 Monsanto Technoloy LLC Soybean variety 01091614
US12593792B2 (en) 2022-11-02 2026-04-07 Monsanto Technhology LLC Soybean variety 01094695
US12284974B2 (en) 2022-11-03 2025-04-29 Monsanto Technology Llc Soybean variety 01094189
US12295335B2 (en) 2022-11-03 2025-05-13 Monsanto Technology Llc Soybean variety 01094667
US12329115B2 (en) 2022-11-04 2025-06-17 Monsanto Technology Llc Soybean variety 01094676
US12324397B2 (en) 2022-11-07 2025-06-10 Monsanto Technology Llc Soybean variety 01094715
WO2024100069A1 (en) 2022-11-08 2024-05-16 Syngenta Crop Protection Ag Microbiocidal pyridine derivatives
US12295336B2 (en) 2022-11-10 2025-05-13 Monsanto Technology Llc Soybean variety 01094682
US12356946B2 (en) 2022-11-15 2025-07-15 Monsanto Technology Llc Soybean variety 01094720
US12317850B2 (en) 2022-11-15 2025-06-03 Monsanto Technology Llc Soybean variety 01094668
US12310318B2 (en) 2022-11-15 2025-05-27 Monsanto Technology Llc Soybean variety 01094669
US12219916B2 (en) 2022-11-15 2025-02-11 Monsanto Technology Llc Soybean variety 01094718
EP4619399A1 (en) 2022-11-16 2025-09-24 Basf Se New substituted tetrahydrobenzoxazepine
WO2024104815A1 (en) 2022-11-16 2024-05-23 Basf Se Substituted benzodiazepines as fungicides
US12295337B2 (en) 2022-11-16 2025-05-13 Monsanto Technology Llc Soybean variety 01094726
CN120202196A (en) 2022-11-16 2025-06-24 巴斯夫欧洲公司 Substituted benzodiazepines as fungicides
CN120202194A (en) 2022-11-16 2025-06-24 巴斯夫欧洲公司 Substituted tetrahydrobenzodiazepines as fungicides
US12310320B2 (en) 2022-11-17 2025-05-27 Monsanto Technology Llc Soybean variety 01094766
US12225872B2 (en) 2022-11-17 2025-02-18 Monsanto Technology Llc Soybean variety 01094758
US12356947B2 (en) 2022-11-17 2025-07-15 Monsanto Technology Llc Soybean variety 01094755
US12369554B2 (en) 2022-11-17 2025-07-29 Monsanto Technology Llc Soybean variety 01094759
US12295338B2 (en) 2022-11-17 2025-05-13 Monsanto Technology Llc Soybean variety 01094762
US12310319B2 (en) 2022-11-17 2025-05-27 Monsanto Technology Llc Soybean variety 01094752
US12245566B2 (en) 2022-11-20 2025-03-11 Monsanto Technology Llc Soybean variety 01094772
US12356948B2 (en) 2022-11-20 2025-07-15 Monsanto Technology Llc Soybean variety 01094790
US12389863B2 (en) 2022-11-20 2025-08-19 Monsanto Technology Llc Soybean variety 01094793
US12593793B2 (en) 2022-11-20 2026-04-07 Monsanto Technology Llc Soybean variety 01094778
US12376549B2 (en) 2022-11-20 2025-08-05 Monsanto Technology Llc Soybean variety 01094788
US12310321B2 (en) 2022-11-20 2025-05-27 Monsanto Technology Llc Soybean variety 01094775
US12310322B2 (en) 2022-11-20 2025-05-27 Monsanto Technology Llc Soybean variety 01094785
US12310323B2 (en) 2022-11-21 2025-05-27 Monsanto Technology Llc Soybean variety 01094797
US12329116B2 (en) 2022-11-21 2025-06-17 Monsanto Technology Llc Soybean variety 01094813
US12402595B2 (en) 2022-11-21 2025-09-02 Monsanto Technology Llc Soybean variety 01094810
US12302849B2 (en) 2022-11-21 2025-05-20 Monsanto Technology Llc Soybean variety 01094817
US12295339B2 (en) 2022-11-21 2025-05-13 Monsanto Technology Llc Soybean variety 01094816
US12490705B2 (en) 2022-11-22 2025-12-09 Monsanto Technology Llc Soybean variety 01098117
US12342786B2 (en) 2022-11-22 2025-07-01 Monsanto Technology Llc Soybean variety 01094835
US12484539B2 (en) 2022-11-22 2025-12-02 Monsanto Technology Llc Soybean variety 01094826
US12295340B2 (en) 2022-11-22 2025-05-13 Monsanto Technology Llc Soybean variety 01094839
US12396428B2 (en) 2022-11-22 2025-08-26 Monsanto Technology Llc Soybean variety 01094840
US12317852B2 (en) 2022-11-22 2025-06-03 Monsanto Technology Llc Soybean variety 01098165
US12396429B2 (en) 2022-11-22 2025-08-26 Monsanto Technology Llc Soybean variety 01098164
US12382914B2 (en) 2022-11-22 2025-08-12 Monsanto Technology Llc Soybean variety 01098202
US12364241B2 (en) 2022-11-23 2025-07-22 Monsanto Technology Llc Soybean variety 01098236
US12389864B2 (en) 2022-11-24 2025-08-19 Monsanto Technology Llc Soybean variety 01098296
US12302850B2 (en) 2022-11-24 2025-05-20 Monsanto Technology Llc Soybean variety 01098267
US12376550B2 (en) 2022-11-24 2025-08-05 Monsanto Technology Llc Soybean variety 01098249
US12376551B2 (en) 2022-11-24 2025-08-05 Monsanto Technology Llc Soybean variety 01098301
US12382915B2 (en) 2022-11-24 2025-08-12 Monsanto Technology Llc Soybean variety 01098300
US12369555B2 (en) 2022-11-26 2025-07-29 Monsanto Technology Llc Soybean variety 01098305
US12484540B2 (en) 2022-11-26 2025-12-02 Monsanto Technology Llc Soybean variety 01098338
US12295342B2 (en) 2022-11-26 2025-05-13 Monsanto Technology Llc Soybean variety 01098302
US12382916B2 (en) 2022-11-26 2025-08-12 Monsanto Technology Llc Soybean variety 01098337
US12295343B2 (en) 2022-11-26 2025-05-13 Monsanto Technology Llc Soybean variety 01098326
EP4385326A1 (en) 2022-12-15 2024-06-19 Kimitec Biogorup Biopesticide composition and method for controlling and treating broad spectrum of pests and diseases in plants
AU2023408197A1 (en) 2022-12-19 2025-06-26 Basf Agricultural Solutions Us Llc Insect toxin genes and methods for their use
EP4389210A1 (en) 2022-12-21 2024-06-26 Basf Se Heteroaryl compounds for the control of invertebrate pests
EP4662210A1 (en) 2023-02-08 2025-12-17 Basf Se New substituted quinoline compounds for combatitng phytopathogenic fungi
EP4665747A1 (en) 2023-02-16 2025-12-24 Pairwise Plants Services, Inc. Methods and compositions for modifying shade avoidance in plants
UY40661A (en) 2023-03-02 2024-10-15 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING SHADE AVOIDANCE IN PLANTS
UY40664A (en) 2023-03-09 2024-10-15 Pairwise Plants Services Inc MODIFICATION OF BRASSINOSTEROID SIGNALING PATHWAY GENES TO IMPROVE PERFORMANCE TRAITS
KR20250156732A (en) 2023-03-17 2025-11-03 바스프 에스이 Substituted pyridyl/pyrazidyl dihydrobenzothiazepine compounds for combating phytopathogenic fungi
EP4455137A1 (en) 2023-04-24 2024-10-30 Basf Se Pyrimidine compounds for the control of invertebrate pests
AU2023445097A1 (en) 2023-04-26 2025-11-06 Basf Se Use of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors xvi
UY40746A (en) 2023-05-18 2024-12-13 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR IMPROVING PLANT PERFORMANCE CHARACTERISTICS
EP4467535A1 (en) 2023-05-25 2024-11-27 Basf Se Lactam pesticidal compounds
US11917976B1 (en) 2023-06-20 2024-03-05 Kg Agri Products, Inc. Soybean cultivar GL2876
WO2025008446A1 (en) 2023-07-05 2025-01-09 Bayer Aktiengesellschaft Composition for use in agriculture
CN121464139A (en) 2023-07-05 2026-02-03 巴斯夫欧洲公司 Substituted quinolines for combating phytopathogenic fungi base/quinoxalinyl dihydro pyrrolotriazine compounds
WO2025008227A1 (en) 2023-07-05 2025-01-09 Basf Se Substituted pyridyl/pyrazinyl dihydropyrrolotriazine compounds for combatting phytopath-ogenic fungi
WO2025008447A1 (en) 2023-07-05 2025-01-09 Bayer Aktiengesellschaft Composition for use in agriculture
EP4488273A1 (en) 2023-07-06 2025-01-08 Basf Se Triazole compounds for the control of invertebrate pests
EP4488269A1 (en) 2023-07-06 2025-01-08 Basf Se Triazole compounds for the control of invertebrate pests
EP4488270A1 (en) 2023-07-06 2025-01-08 Basf Se Triazole compounds for the control of invertebrate pests
AU2024386241A1 (en) 2023-07-07 2026-01-08 Basf Agricultural Solutions Us Llc Use of cry genes for the control of nematode pests
PY2455894A (en) 2023-07-18 2025-03-28 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING ROOT ARCHITECTURE IN PLANTS
AR133310A1 (en) 2023-07-27 2025-09-17 Pairwise Plants Services Inc METHODS AND COMPOSITIONS FOR MODIFYING PLANT PERFORMANCE TRAITS
WO2025026738A1 (en) 2023-07-31 2025-02-06 Bayer Aktiengesellschaft 6-[5-(ethylsulfonyl)-1-methyl-1h-imidazol-4-yl]-7-methyl-3-(pentafluoroethyl)-7h-imidazo[4,5-c]pyridazine derivatives as pesticides
KR20260042262A (en) 2023-08-01 2026-03-30 글로바켐 엔브이 insecticide mixture
EP4501112A1 (en) 2023-08-01 2025-02-05 Globachem NV Plant defense elicitors
WO2025031989A1 (en) 2023-08-04 2025-02-13 Syngenta Crop Protection Ag Methods of controlling or preventing infestation of plants by the phytopathogenic microorganism corynespora cassiicola
CN121568607A (en) 2023-08-04 2026-02-24 先正达农作物保护股份公司 Method for controlling or preventing infestation of plants by the phytopathogenic microorganism corynespora polymorpha
WO2025031990A1 (en) 2023-08-04 2025-02-13 Syngenta Crop Protection Ag Methods of controlling or preventing infestation of soybean plants by the phytopathogenic microorganism corynespora cassiicola
CN121693501A (en) 2023-08-09 2026-03-17 拜耳公司 Pyridazin-4-yl oxadiazines as novel bactericides
CN121646591A (en) 2023-08-09 2026-03-10 巴斯夫欧洲公司 Novel use for combating phytopathogenic fungi substituted benzoxazines pyridine carbonitrile compounds
WO2025031842A1 (en) 2023-08-09 2025-02-13 Basf Se New substituted benzoxazepine picolinonitrile compounds for combatting phytopathogenic fungi
WO2025031668A1 (en) 2023-08-09 2025-02-13 Bayer Aktiengesellschaft Azaheterobiaryl-substituted 4,5-dihydro-1h-2,4,5-oxadiazines as novel fungicides
WO2025064734A1 (en) 2023-09-21 2025-03-27 Pairwise Plants Services, Inc. Early flowering black raspberry plants with improved characteristics
WO2025068226A2 (en) 2023-09-29 2025-04-03 Basf Se Methods for protecting plants using mixtures comprising sulfur and selected terpenes
AU2024358203A1 (en) 2023-10-09 2026-04-16 Basf Se Fungicidal mixture comprising substituted pyridines
AU2024358155A1 (en) 2023-10-09 2026-04-16 Basf Se Fungicidal mixture comprising substituted quinazolyl quinolines
WO2025080600A1 (en) 2023-10-11 2025-04-17 Pairwise Plants Services, Inc. Methods and compositions for improving crop yield traits
WO2025078128A1 (en) 2023-10-11 2025-04-17 Bayer Aktiengesellschaft Pyridazin-3-one-4-yloxadiazines as novel fungicides
WO2025090606A1 (en) 2023-10-27 2025-05-01 Basf Agricultural Solutions Us Llc Use of novel genes for the control of nematode pests
CN117144056B (en) * 2023-10-31 2024-03-22 中国热带农业科学院三亚研究院 Application of haplotype molecular marker related to papaya fruit fructose accumulation
WO2025098874A1 (en) 2023-11-10 2025-05-15 Bayer Aktiengesellschaft Active compound combinations having fungicidal/insecticidal/acaricidal properties
WO2025098875A1 (en) 2023-11-10 2025-05-15 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
WO2025098876A1 (en) 2023-11-10 2025-05-15 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
US12575530B2 (en) 2023-11-16 2026-03-17 Monsanto Technology Llc Soybean variety 01106186
US12604846B2 (en) 2023-11-16 2026-04-21 Monsanto Technology Llc Soybean variety 01098371
US12610918B2 (en) 2023-11-17 2026-04-28 Monsanto Technology Llc Soybean variety 01098318
US12604847B2 (en) 2023-11-17 2026-04-21 Monsanto Technology Llc Soybean variety 01098373
US12593804B2 (en) 2023-11-25 2026-04-07 Monsanto Technology Llc Soybean variety 01098218
US12604848B2 (en) 2023-11-25 2026-04-21 Monsanto Technology Llc Soybean variety 01106137
US12543687B2 (en) 2023-11-25 2026-02-10 Monsanto Technology Llc Soybean variety 01106525
US12543689B2 (en) 2023-11-26 2026-02-10 Monsanto Technology Llc Soybean variety 01106455
US12604850B2 (en) 2023-11-26 2026-04-21 Monsanto Technology Llc Soybean variety 01098228
US12604849B2 (en) 2023-11-26 2026-04-21 Monsanto Technology Llc Soybean variety 01106402
US12582077B2 (en) 2023-11-26 2026-03-24 Monsanto Technology Llc Soybean variety 01098266
US12543691B2 (en) 2023-11-26 2026-02-10 Monsanto Technology Llc Soybean variety 01106526
US12604852B2 (en) 2023-11-26 2026-04-21 Monsanto Technology Llc Soybean variety 01106260
US12543688B2 (en) 2023-11-26 2026-02-10 Monsanto Technology Llc Soybean variety 01106153
US12550856B2 (en) 2023-11-26 2026-02-17 Monsanto Technology Llc Soybean variety 01098245
US12604851B2 (en) 2023-11-26 2026-04-21 Monsanto Technology Llc Soybean variety 01098257
US12543690B2 (en) 2023-11-26 2026-02-10 Monsanto Technology Llc Soybean variety 01106154
US12582076B2 (en) 2023-11-26 2026-03-24 Monsanto Technology Llc Soybean variety 01106187
US12457988B2 (en) 2023-11-26 2025-11-04 Monsanto Technology Llc Soybean variety 01106460
US12593805B2 (en) 2023-11-27 2026-04-07 Monsanto Technology Llc Soybean variety 01106379
US12465009B2 (en) 2023-11-27 2025-11-11 Monsanto Technology Llc Soybean variety 01098216
US12588640B2 (en) 2023-11-28 2026-03-31 Monsanto Technology Llc Soybean variety 01098144
US12593806B2 (en) 2023-11-28 2026-04-07 Monsanto Technology Llc Soybean variety 01098361
US12599094B2 (en) 2023-11-28 2026-04-14 Monsanto Technology Llc Soybean variety 01106520
US12484544B2 (en) 2023-11-28 2025-12-02 Monsanto Technology Llc Soybean variety 01098181
PY24108853A (en) 2023-12-08 2025-10-06 Syngenta Crop Protection Ag POLYMORPHS
WO2025125639A1 (en) 2023-12-13 2025-06-19 Syngenta Crop Protection Ag Method of pathogen control in soybean
TW202542314A (en) * 2023-12-13 2025-11-01 美商孟山都科技有限責任公司 Transgenic soybean event gm_csm63717 and compositions and methods for detection and uses thereof
WO2025131902A1 (en) 2023-12-21 2025-06-26 Basf Se Methods for protecting plants using mixtures comprising sulfur, selected terpenes and phosphites.
WO2025132562A1 (en) 2023-12-22 2025-06-26 Basf Agricultural Solutions Us Llc Increased resistance by expression of a defense signal multiplier protein
EP4574819A1 (en) 2023-12-22 2025-06-25 Basf Se Diazinone compounds for the control of invertebrate pests
US12588634B2 (en) 2024-01-16 2026-03-31 Monsanto Technology Llc Soybean cultivar 21161335
US12593801B2 (en) 2024-01-16 2026-04-07 Monsanto Technology Llc Soybean cultivar 21031508
US12604844B2 (en) 2024-01-16 2026-04-21 Monsanto Technology Llc Soybean cultivar 20261107
US12593800B2 (en) 2024-01-16 2026-04-07 Monsanto Technology Llc Soybean cultivar 21380017
US12588635B2 (en) 2024-01-16 2026-03-31 Monsanto Technology Llc Soybean cultivar 29350415
US12588636B2 (en) 2024-01-16 2026-03-31 Monsanto Technology Llc Soybean cultivar 26111036
US12593799B2 (en) 2024-01-16 2026-04-07 Monsanto Technology Llc Soybean cultivar 20160221
US12599091B2 (en) 2024-01-16 2026-04-14 Monsanto Technology Llc Soybean cultivar 23151928
US12593797B2 (en) 2024-01-16 2026-04-07 Monsanto Technology Llc Soybean cultivar 29020100
US12593798B2 (en) 2024-01-16 2026-04-07 Monsanto Technology Llc Soybean cultivar 25091511
US12599092B2 (en) 2024-01-16 2026-04-14 Monsanto Technology Llc Soybean cultivar 25140606
WO2025162985A1 (en) 2024-01-30 2025-08-07 Basf Plant Science Company Gmbh Increased plant disease resistance by expression of a glycine-rich protein
WO2025165829A1 (en) * 2024-01-31 2025-08-07 Pioneer Hi-Bred International, Inc. Soybean event cor-23134-4 and methods for detection thereof
WO2025168620A1 (en) 2024-02-07 2025-08-14 Bayer Aktiengesellschaft Heteroaryl-substituted 4,5-dihydro-1h-2,4,5-oxadiazines as novel fungicides
US12588637B2 (en) 2024-02-08 2026-03-31 Monsanto Technology Llc Soybean cultivar 20430823
US12604845B2 (en) 2024-02-08 2026-04-21 Monsanto Technology Llc Soybean cultivar 24450465
US12593802B2 (en) 2024-02-08 2026-04-07 Monsanto Technology Llc Soybean cultivar 21120033
US12610916B2 (en) 2024-02-08 2026-04-28 Monsanto Technology Llc Soybean cultivar 29440802
US12610917B2 (en) 2024-02-08 2026-04-28 Monsanto Technology Llc Soybean cultivar 28491649
US12593803B2 (en) 2024-02-08 2026-04-07 Monsanto Technology Llc Soybean cultivar 23450022
US12610915B2 (en) 2024-02-08 2026-04-28 Monsanto Technology Llc Soybean cultivar 27280428
US12599093B2 (en) 2024-02-08 2026-04-14 Monsanto Technology Llc Soybean cultivar 20372402
WO2025178902A1 (en) 2024-02-22 2025-08-28 Pairwise Plants Services, Inc. Methods and compositions for improving yield characteristics in plants
WO2025180964A1 (en) 2024-03-01 2025-09-04 Basf Se New substituted benzoxazepine compounds for combatting phytopathogenic fungi
WO2025186065A1 (en) 2024-03-05 2025-09-12 Bayer Aktiengesellschaft Heteroaryl-substituted (aza)quinoxaline derivatives as pesticides
WO2025190927A1 (en) 2024-03-14 2025-09-18 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
WO2025202482A1 (en) 2024-03-28 2025-10-02 Syngenta Crop Protection Ag Fungicidal compositions
WO2025202499A1 (en) 2024-03-28 2025-10-02 Syngenta Crop Protection Ag Fungicidal compositions
WO2025211272A1 (en) 2024-04-04 2025-10-09 Nihon Nohyaku Co., Ltd. Pesticidal mixtures comprising an ethylsulfone compound
EP4640052A1 (en) 2024-04-24 2025-10-29 Basf Se Mixtures of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors with at least one further pesticide i
WO2025223904A1 (en) 2024-04-24 2025-10-30 Basf Se Mixtures of strobilurin type compounds for combating phytopathogenic fungi containing an amino acid substitution f129l in the mitochondrial cytochrome b protein conferring resistance to qo inhibitors with at least one further pesticide i
EP4652843A1 (en) 2024-05-21 2025-11-26 Kimitec Biogroup S.L Biopesticide composition, procedure of obtain thereof, and method for controlling and treating broad spectrum of pests in plants
EP4652842A1 (en) 2024-05-21 2025-11-26 Kimitec Biogroup S.L Biopesticide composition, procedure of obtain thereof, and method for controlling and treating broad spectrum of pests, diseases and weeds in plants
WO2025257121A1 (en) 2024-06-12 2025-12-18 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
WO2025257122A1 (en) 2024-06-12 2025-12-18 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
WO2026002763A1 (en) 2024-06-26 2026-01-02 Basf Se Pesticidal mixtures and applications of beauveria bassiana and dimpropyridaz
WO2026006779A1 (en) 2024-06-27 2026-01-02 The Regents Of The University Of California Transgenic plants expressing fern rapid non-photochemical quenching (npq) proteins
WO2026010930A1 (en) 2024-07-05 2026-01-08 BASF Agricultural Solutions Seed US LLC Use of axmi277 for the control of rotylenchulus reniformis nematode pests
WO2026012814A1 (en) 2024-07-10 2026-01-15 Basf Se Compositions and methods to enhance crop yield and plant health
WO2026021911A1 (en) 2024-07-23 2026-01-29 Basf Se New substituted benzothiazine pyridine compounds for combatting phytopathogenic fungi
WO2026021909A1 (en) 2024-07-23 2026-01-29 Basf Se New substituted benzothiazine pyridine compounds for combatting phytopathogenic fungi
WO2026021910A1 (en) 2024-07-23 2026-01-29 Basf Se New substituted benzothiazine pyridine compounds for combatting phytopathogenic fungi
WO2026021912A1 (en) 2024-07-23 2026-01-29 Basf Se New substituted benzothiazine pyridine compounds for combatting phytopathogenic fungi
WO2026027375A1 (en) 2024-07-29 2026-02-05 Bayer Aktiengesellschaft Hydroxy-dihydropyridinone carboxamides as pesticides
WO2026027723A1 (en) 2024-08-01 2026-02-05 Syngenta Crop Protection Ag Herbicide resistant plants
WO2026037853A1 (en) 2024-08-14 2026-02-19 Basf Se Benzoxazole derivatives as pesticidal compounds
WO2026041702A1 (en) 2024-08-21 2026-02-26 Basf Se Benzoxazole derivatives as pesticidal compounds
EP4710766A1 (en) 2024-09-11 2026-03-18 Basf Se Mixtures of ambruticin with at least one further pesticide
WO2026057375A1 (en) 2024-09-11 2026-03-19 Basf Se Mixtures of ambruticin with at least one further pesticide
EP4721566A1 (en) 2024-10-07 2026-04-08 Kimitec Biogroup S.L Microbial composition based on bacillus infantis strain for agricultural use
WO2026082481A1 (en) 2024-10-17 2026-04-23 Bayer Aktiengesellschaft Active compound combinations having insecticidal/acaricidal properties
WO2026082514A1 (en) 2024-10-18 2026-04-23 Basf Se Pesticidal mixtures and applications of dimpropyridaz

Citations (34)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US5094945A (en) * 1983-01-05 1992-03-10 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use
US5110805A (en) * 1990-09-28 1992-05-05 The Board Of Supervisors Of Louisiana State University Method for protecting plants against soil-borne fungi using glyphosate and imazaquin compositions
US5310667A (en) * 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5312910A (en) * 1987-05-26 1994-05-17 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5437697A (en) * 1992-07-07 1995-08-01 E. I. Du Pont De Nemours And Company Method to identify genetic markers that are linked to agronomically important genes
US5463175A (en) * 1990-06-25 1995-10-31 Monsanto Company Glyphosate tolerant plants
US5554798A (en) * 1990-01-22 1996-09-10 Dekalb Genetics Corporation Fertile glyphosate-resistant transgenic corn plants
US5627061A (en) * 1990-08-31 1997-05-06 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5659114A (en) * 1996-05-10 1997-08-19 Asgrow Seed Company Soybean cultivar 88154622393
US6040497A (en) * 1997-04-03 2000-03-21 Dekalb Genetics Corporation Glyphosate resistant maize lines
US20020133852A1 (en) * 2000-01-07 2002-09-19 Hauge Brian M. Soybean SSRs and methods of genotyping
US6462258B1 (en) * 1999-12-16 2002-10-08 Monsanto Technology Llc Plant expression constructs
US20030083480A1 (en) * 2000-10-30 2003-05-01 Maxygen, Inc. Novel glyphosate N-acetyl transferase (GAT) genes
US6573425B1 (en) * 1997-11-18 2003-06-03 Pioneer Hi-Bred International, Inc. Compositions and methods to reduce the complexity of transgene integration in the genome of a plant
US20030114308A1 (en) * 2000-12-22 2003-06-19 Monsanto Technology, L.L.C. Method of improving yield and vigor of plants
US6610910B1 (en) * 2000-12-22 2003-08-26 Pioneer Hi-Bred International, Inc. Soybean variety 93B86
US6689880B2 (en) * 2000-09-29 2004-02-10 Monsanto Technology Llc DNA molecule for detecting glyphosate tolerant wheat plant 33391 and progeny thereof
US6733974B1 (en) * 2000-12-01 2004-05-11 Monsanto Technology, Llc Methods and compositions for detection of specific genetic constructs in plant transformation events
US6740488B2 (en) * 2000-10-25 2004-05-25 Monsanto Technology Llc Cotton event PV-GHGT07(1445) compositions and methods for detection thereof
US6818807B2 (en) * 2001-08-06 2004-11-16 Bayer Bioscience N.V. Herbicide tolerant cotton plants having event EE-GH1
US6825400B2 (en) * 2000-06-22 2004-11-30 Monsanto Technology Llc Corn plants comprising event PV-ZMGT32(nk603)
US6893826B1 (en) * 2000-11-17 2005-05-17 Monsanto Technology Llc Cotton event PV-GHBK04 (757) and compositions and methods for detection thereof
US6900014B1 (en) * 1999-10-29 2005-05-31 Bayer Bioscience N.V Methods for determining the presence or absence of elite event MS-B2 in Brassica plant material
US20050223425A1 (en) * 2004-03-30 2005-10-06 Clinton William P Methods for controlling plant pathogens using N-phosphonomethylglycine
US20060021094A1 (en) * 2003-03-10 2006-01-26 Athenix Corporation GDC-2 genes conferring herbicide resistance
US20060021093A1 (en) * 2003-03-10 2006-01-26 Athenix Corporation GDC-1 genes conferring herbicide resistance
US20060111239A1 (en) * 2002-11-12 2006-05-25 Peter Oakley Method for yield improvement in glyphosate-resistent legumes
US20060223707A1 (en) * 2003-10-28 2006-10-05 Baley George J Suppression of foliar and soilborne pathogens
US20060282915A1 (en) * 2005-05-27 2006-12-14 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US20070197474A1 (en) * 2004-03-30 2007-08-23 Clinton William P Methods for controlling plants pathogens using N-phosphonomethylglycine
US7306909B2 (en) * 2000-10-30 2007-12-11 Monsanto Technology Llc Canola event pv-bngt04(rt73) and compositions and methods for detection thereof
US7405074B2 (en) * 2004-04-29 2008-07-29 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GAT) genes
US7405347B2 (en) * 2002-12-18 2008-07-29 Athenix Corporation Genes conferring herbicide resistance

Family Cites Families (37)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2627469A (en) * 1952-01-29 1953-02-03 Best Foods Inc Soya bean oil compositions
IT1065709B (en) * 1975-09-08 1985-03-04 Dravo Corp PROCESS FOR PREPARING A PROTEIN CONCENTRATE AND PRODUCED IN THIS WAY
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
US4683195A (en) 1986-01-30 1987-07-28 Cetus Corporation Process for amplifying, detecting, and/or-cloning nucleic acid sequences
CA1313830C (en) * 1985-08-07 1993-02-23 Dilip Maganlal Shah Glyphosate-resistant plants
US5416011A (en) * 1988-07-22 1995-05-16 Monsanto Company Method for soybean transformation and regeneration
US5602311A (en) * 1990-01-05 1997-02-11 Iowa State University Research Foundation, Inc. Soybeans and soybeans products having high palmitic acid content
DE69120419T3 (en) 1990-08-31 2007-02-15 Monsanto Technology Llc GLYPHOSATE TOLERANT 5-ENOLPYRUVYL-3-PHOSPHOSHIKIMATE SYNTHASES
AU712463B2 (en) 1996-03-29 1999-11-04 Monsanto Europe S.A. New use of N-(phosphonomethyl)glycine and derivatives thereof
JP2001503280A (en) * 1997-10-31 2001-03-13 ノバルティス アクチエンゲゼルシャフト Glyphosate resistant transgenic plants
US6984774B1 (en) 1997-12-10 2006-01-10 Iowa State University Research Foundation, Inc. Method and materials to induce recombination in plants
AU1927699A (en) 1997-12-19 1999-07-12 Pioneer Hi-Bred International, Inc. Nucleotide polymorphisms in soybean
US5914451A (en) 1998-04-06 1999-06-22 Monsanto Company Efficiency soybean transformation protocol
US6080916A (en) 1998-09-14 2000-06-27 Monsanto Corporation Soybean cultivar 943168607010
US6572830B1 (en) 1998-10-09 2003-06-03 Motorola, Inc. Integrated multilayered microfludic devices and methods for making the same
WO2000042207A2 (en) 1999-01-14 2000-07-20 Monsanto Technology Llc Soybean transformation method
US20070277267A1 (en) * 1999-10-15 2007-11-29 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
AU2591501A (en) * 1999-12-30 2001-07-16 Pioneer Hi-Bred International, Inc. Mqm mapping using haplotyped putative qtl-alleles: a simple approach for mappingqtl's in plant breeding populations
US20070083945A1 (en) * 2000-03-10 2007-04-12 Byrum Joseph R Nucleic acid molecules and other molecules associated with plants
US20030046724A1 (en) 2000-07-18 2003-03-06 Ranch Jerome P. Methods of transforming plants and identifying parental origin of a chromosome in those plants
DE10040379A1 (en) 2000-08-18 2002-02-28 Max Planck Gesellschaft Plants with changed growth properties
EP1337669A2 (en) 2000-11-30 2003-08-27 Ses Europe N.V./S.A. Glyphosate resistant transgenic sugar beet characterised by a specific transgene insertion (t227-1), methods and primers for the detection of said insertion
DE10059609A1 (en) * 2000-12-01 2002-06-06 Bayer Ag Fungicidal composition comprises neem tree seed extracts and glyphosate
WO2002092856A1 (en) 2001-05-15 2002-11-21 Monsanto Technology Llc A method of selecting dna constructs for herbicide tolerance in plants
US7164056B2 (en) 2002-05-03 2007-01-16 Pioneer Hi-Bred International, Inc. Gene targeting using replicating DNA molecules
US20040060082A1 (en) * 2002-07-11 2004-03-25 Monsanto Technology, L.L.C. High yielding soybean plants with increased seed protein plus oil
BR122015019398B1 (en) * 2003-01-31 2019-10-01 Monsanto Technology Llc METHODS FOR PRODUCING GLYPHOSATE TOLERANT ALFAFA PLANT HAVING J-163 TRANSGENIC EVENT AND FOR PRODUCING ALPHAFA HAY
WO2004072235A2 (en) * 2003-02-12 2004-08-26 Monsanto Technology Llc Cotton event mon 88913 and compositions and methods for detection thereof
EP1597373B1 (en) 2003-02-20 2012-07-18 KWS Saat AG Glyphosate-tolerant sugar beet
ATE488604T1 (en) 2003-05-20 2010-12-15 Investigen Inc POLYNUCLEOTIDE DETECTION SYSTEM
WO2006024023A2 (en) 2004-08-24 2006-03-02 Nanomix, Inc. Nanotube sensor devices for dna detection
US20060068398A1 (en) 2004-09-24 2006-03-30 Cepheid Universal and target specific reagent beads for nucleic acid amplification
EA201270781A1 (en) 2005-06-09 2013-09-30 Байер Кропсайенс Аг COMBINATION OF BIOLOGICALLY ACTIVE SUBSTANCES
WO2007054835A2 (en) 2005-06-21 2007-05-18 Cheminova Agro A/S Synergistic combination of a glyphosate herbicide and a triazole fungicide
BRPI0614651A2 (en) 2005-08-09 2011-04-12 Syngenta Participations Ag method for controlling phytopathogenic organisms
US8461077B2 (en) 2007-03-23 2013-06-11 Basf Se Combinations of active substances
US20100093715A1 (en) 2007-04-23 2010-04-15 Basf Se Plant productivity enhancement by combining chemical agents with transgenic modifications

Patent Citations (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5094945A (en) * 1983-01-05 1992-03-10 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthase, production and use
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US5312910A (en) * 1987-05-26 1994-05-17 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5310667A (en) * 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5554798A (en) * 1990-01-22 1996-09-10 Dekalb Genetics Corporation Fertile glyphosate-resistant transgenic corn plants
US5463175A (en) * 1990-06-25 1995-10-31 Monsanto Company Glyphosate tolerant plants
US5627061A (en) * 1990-08-31 1997-05-06 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5633435A (en) * 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5804425A (en) * 1990-08-31 1998-09-08 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US6248876B1 (en) * 1990-08-31 2001-06-19 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5110805A (en) * 1990-09-28 1992-05-05 The Board Of Supervisors Of Louisiana State University Method for protecting plants against soil-borne fungi using glyphosate and imazaquin compositions
US5437697A (en) * 1992-07-07 1995-08-01 E. I. Du Pont De Nemours And Company Method to identify genetic markers that are linked to agronomically important genes
US5659114A (en) * 1996-05-10 1997-08-19 Asgrow Seed Company Soybean cultivar 88154622393
US6040497A (en) * 1997-04-03 2000-03-21 Dekalb Genetics Corporation Glyphosate resistant maize lines
US6573425B1 (en) * 1997-11-18 2003-06-03 Pioneer Hi-Bred International, Inc. Compositions and methods to reduce the complexity of transgene integration in the genome of a plant
US6900014B1 (en) * 1999-10-29 2005-05-31 Bayer Bioscience N.V Methods for determining the presence or absence of elite event MS-B2 in Brassica plant material
US6660911B2 (en) * 1999-12-16 2003-12-09 Monsanto Technology Llc Plant expression constructs
US6919495B2 (en) * 1999-12-16 2005-07-19 Monsanto Technology Llc Chimeric cauliflower mosaic virus 35S-arabidopsis actin 8 promoters and methods of using them
US6462258B1 (en) * 1999-12-16 2002-10-08 Monsanto Technology Llc Plant expression constructs
US20020133852A1 (en) * 2000-01-07 2002-09-19 Hauge Brian M. Soybean SSRs and methods of genotyping
US6825400B2 (en) * 2000-06-22 2004-11-30 Monsanto Technology Llc Corn plants comprising event PV-ZMGT32(nk603)
US6689880B2 (en) * 2000-09-29 2004-02-10 Monsanto Technology Llc DNA molecule for detecting glyphosate tolerant wheat plant 33391 and progeny thereof
US6740488B2 (en) * 2000-10-25 2004-05-25 Monsanto Technology Llc Cotton event PV-GHGT07(1445) compositions and methods for detection thereof
US20030083480A1 (en) * 2000-10-30 2003-05-01 Maxygen, Inc. Novel glyphosate N-acetyl transferase (GAT) genes
US7306909B2 (en) * 2000-10-30 2007-12-11 Monsanto Technology Llc Canola event pv-bngt04(rt73) and compositions and methods for detection thereof
US6893826B1 (en) * 2000-11-17 2005-05-17 Monsanto Technology Llc Cotton event PV-GHBK04 (757) and compositions and methods for detection thereof
US6733974B1 (en) * 2000-12-01 2004-05-11 Monsanto Technology, Llc Methods and compositions for detection of specific genetic constructs in plant transformation events
US20030114308A1 (en) * 2000-12-22 2003-06-19 Monsanto Technology, L.L.C. Method of improving yield and vigor of plants
US6610910B1 (en) * 2000-12-22 2003-08-26 Pioneer Hi-Bred International, Inc. Soybean variety 93B86
US20050233905A1 (en) * 2000-12-22 2005-10-20 Monsanto Technology, L.L.C. Method of improving yield and vigor of plants
US7098170B2 (en) * 2000-12-22 2006-08-29 Monsanto Technology Llc Method of improving yield and vigor of plants by treatment with triazole and strobilurin-type fungicides
US6818807B2 (en) * 2001-08-06 2004-11-16 Bayer Bioscience N.V. Herbicide tolerant cotton plants having event EE-GH1
US20060111239A1 (en) * 2002-11-12 2006-05-25 Peter Oakley Method for yield improvement in glyphosate-resistent legumes
US7405347B2 (en) * 2002-12-18 2008-07-29 Athenix Corporation Genes conferring herbicide resistance
US20060021094A1 (en) * 2003-03-10 2006-01-26 Athenix Corporation GDC-2 genes conferring herbicide resistance
US20060021093A1 (en) * 2003-03-10 2006-01-26 Athenix Corporation GDC-1 genes conferring herbicide resistance
US20060223707A1 (en) * 2003-10-28 2006-10-05 Baley George J Suppression of foliar and soilborne pathogens
US20070197474A1 (en) * 2004-03-30 2007-08-23 Clinton William P Methods for controlling plants pathogens using N-phosphonomethylglycine
US20050223425A1 (en) * 2004-03-30 2005-10-06 Clinton William P Methods for controlling plant pathogens using N-phosphonomethylglycine
US7405074B2 (en) * 2004-04-29 2008-07-29 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GAT) genes
US20060288447A1 (en) * 2005-05-27 2006-12-21 Monsanto Technology, L.L.C Method for disease control in MON89788 soybean
US20060282915A1 (en) * 2005-05-27 2006-12-14 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof

Cited By (71)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110030107A1 (en) * 1997-11-18 2011-02-03 Pioneer Hi-Bred International, Inc. Compositions and methods for genetic modification of plants
US9222098B2 (en) 1997-11-18 2015-12-29 Christopher L. Baszczynski Compositions for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US20080209595A1 (en) * 1997-11-18 2008-08-28 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US8735158B2 (en) 1997-11-18 2014-05-27 Pioneer Hi-Bred International, Inc. Compositions and methods for the targeted insertion of a nucleotide sequence of interest into the genome of a plant
US8143504B2 (en) 1997-11-18 2012-03-27 Pioneer Hi-Bred International, Inc. Compositions and methods for genetic modification of plants
US20040083500A1 (en) * 1997-11-18 2004-04-29 Pioneer Hi-Bred International, Inc. Compositions and methods to stack multiple nucleotide sequences of interest in the genome of a plant
US20070197474A1 (en) * 2004-03-30 2007-08-23 Clinton William P Methods for controlling plants pathogens using N-phosphonomethylglycine
US20100099859A1 (en) * 2005-05-27 2010-04-22 Marianne Malven Soybean event mon89788 and methods for detection thereof
US10273498B2 (en) 2005-05-27 2019-04-30 Monsanto Technology Llc Methods and compositions to enhance plant breeding
US12018268B2 (en) 2005-05-27 2024-06-25 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US9605272B2 (en) 2005-05-27 2017-03-28 Monsanto Technology Llc Methods and compositions to enhance plant breeding
US9944945B2 (en) 2005-05-27 2018-04-17 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US20060282915A1 (en) * 2005-05-27 2006-12-14 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US11390881B2 (en) 2005-05-27 2022-07-19 Monsanto Technology, Llc Soybean event MON89788 and methods for detection thereof
US7632985B2 (en) 2005-05-27 2009-12-15 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US7608761B2 (en) 2005-05-27 2009-10-27 Monsanto Technology Llc Method for disease control in MON89788 soybean
US10738320B2 (en) 2005-05-27 2020-08-11 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US9017947B2 (en) 2005-05-27 2015-04-28 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US8053184B2 (en) 2005-05-27 2011-11-08 Monsanto Technology Llc Soybean event MON89788 and methods for detection thereof
US8900869B2 (en) 2005-07-18 2014-12-02 Pioneer Hi-Bred International, Inc. FRT recombination sites and methods of use
US9777284B2 (en) 2005-07-18 2017-10-03 Pioneer Hi-Bred International, Inc. Modified FRT recombination site libraries and methods of use
US8318493B2 (en) 2005-07-18 2012-11-27 Pioneer Hi-Bred International, Inc. FRT recombination sites and methods of use
US20100173801A1 (en) * 2005-07-18 2010-07-08 Pioneer Hi-Bred International, Inc. Modified FRT Recombination Site Libraries and Methods of Use
US8586361B2 (en) 2005-07-18 2013-11-19 Pioneer Hi-Bred International, Inc. FRT recombination sites and methods of use
US20100192263A1 (en) * 2005-07-18 2010-07-29 Pioneer Hi-Bred International, Inc. Novel FRT Recombination Sites and Methods of Use
US9234194B2 (en) 2005-07-18 2016-01-12 Pioneer Hi-Bred International, Inc. Modified FRT recombination site libraries and methods of use
US20100275286A1 (en) * 2007-05-31 2010-10-28 Monsanto Technology Llc Soybean Polymorphisms And Methods Of Genotyping
US9271455B2 (en) 2007-05-31 2016-03-01 Monsanto Technology Llc Soybean polymorphisms and methods of genotyping
EP2511381A1 (en) 2007-06-08 2012-10-17 Monsanto Technology LLC Methods for sequence-directed molecular breeding
US10550424B2 (en) 2007-06-08 2020-02-04 Monsanto Technology Llc Methods for sequence-directed molecular breeding
US10544471B2 (en) 2007-06-08 2020-01-28 Monsanto Technology Llc Methods for sequence-directed molecular breeding
US10544448B2 (en) 2007-06-08 2020-01-28 Monsanto Technology Llc Methods for sequence-directed molecular breeding
US20090031438A1 (en) * 2007-06-22 2009-01-29 Monsanto Technology, Llc Methods & Compositions for Selection of Loci for Trait Performance & Expression
US8912392B2 (en) 2007-06-29 2014-12-16 Pioneer Hi-Bred International, Inc. Methods for altering the genome of a monocot plant cell
US20090133152A1 (en) * 2007-06-29 2009-05-21 Pioneer Hi-Bred International, Inc. Methods for altering the genome of a monocot plant cell
US10760095B2 (en) 2007-08-29 2020-09-01 Monsanto Technology Llc Methods and compositions for gray leaf spot resistance in corn
US9828610B2 (en) 2007-08-29 2017-11-28 Monsanto Technology Llc Methods and compositions for Goss' Wilt resistance in corn
US9862966B2 (en) * 2007-08-29 2018-01-09 Monsanto Technology Llc Methods and compositions for gray leaf spot resistance in corn
US20160024519A1 (en) * 2007-08-29 2016-01-28 Monsanto Technology Llc Methods and compositions for gray leaf spot resistance in corn
US10301644B2 (en) 2007-08-29 2019-05-28 Monsanto Technology Llc Methods and compositions for Goss' Wilt resistance in corn
US10323255B2 (en) 2007-08-29 2019-06-18 Monsanto Technology Llc Methods and compositions for gray leaf spot resistance in corn
US10844399B2 (en) 2007-08-29 2020-11-24 Monsanto Technology Llc Methods and compositions for Goss' Wilt resistance in corn
US20110015084A1 (en) * 2007-10-25 2011-01-20 Monsanto Technology Llc Methods for Identifying Genetic Linkage
US8338157B2 (en) 2008-03-11 2012-12-25 Precision Biosciences, Inc. Rationally-designed meganuclease variants of lig-34 and I-crei for maize genome engineering
US20110113509A1 (en) * 2008-03-11 2011-05-12 Precision Biosciences, Inc. Rationally-designed meganucleases for maize genome engineering
US20110123509A1 (en) * 2008-04-28 2011-05-26 Derek Jantz Fusion molecules of rationally-designed dna-binding proteins and effector domains
US20100167403A1 (en) * 2008-12-30 2010-07-01 Pioneer Hi-Bred International, Inc. Identification and selection of commercial-quality transgenic plant events
US12378571B2 (en) 2009-05-18 2025-08-05 Monsanto Technology Llc Use of glyphosate for disease suppression and yield enhancement in soybean
US11479787B2 (en) 2009-05-18 2022-10-25 Monsanto Technology, Llc Use of glyphosate for disease suppression and yield enhancement in soybean
US10555527B2 (en) 2009-05-18 2020-02-11 Monsanto Technology Llc Use of glyphosate for disease suppression and yield enhancement in soybean
US11130961B2 (en) 2009-09-17 2021-09-28 Monsanto Technology Llc Soybean transgenic event MON 87708 and methods of use thereof
US12305182B2 (en) 2009-09-17 2025-05-20 Monsanto Technology Llc Soybean transgenic event MON 87708 and methods of use thereof
US20240124884A1 (en) * 2010-01-21 2024-04-18 Monsanto Technology Llc Methods and compositions for use of directed recombination in plant breeding
US20170107527A1 (en) * 2010-01-21 2017-04-20 Monsanto Technology Llc Methods and compositions for use of directed recombination in plant breeding
US20110203012A1 (en) * 2010-01-21 2011-08-18 Dotson Stanton B Methods and compositions for use of directed recombination in plant breeding
US12110496B2 (en) 2010-06-04 2024-10-08 Monsanto Technology Llc Method of determining the zygosity of event MON 88302
US11193137B2 (en) 2010-06-04 2021-12-07 Monsanto Technology Llc Late season application of glyphosate for weed control in Brassica
US10544425B2 (en) * 2010-12-28 2020-01-28 Incorporated Administrative Agency National Agriculture Agriculture and Food Research Organization Plant having increased resistance or susceptibility to 4-HPPD inhibitor
US20150047066A1 (en) * 2010-12-28 2015-02-12 Toyama Prefecture Plant having increased resistance or susceptibility to 4-hppd inhibitor
US12338444B2 (en) 2011-03-23 2025-06-24 Pioneer Hi-Bred International, Inc. Methods for producing a complex transgenic trait locus
US10822610B2 (en) 2011-03-23 2020-11-03 E. I. Du Pont De Nemours And Company Methods for producing a complex transgenic trait locus
US9951346B2 (en) * 2011-08-03 2018-04-24 Pioneer Hi-Bred International, Inc. Methods and compositions for targeted integration in a plant
US20140338070A1 (en) * 2011-08-03 2014-11-13 Pioneer Hi-Bred International Methods and compositions for targeted integration in a plant
US10435699B2 (en) 2012-01-27 2019-10-08 E I Du Pont De Nemours And Company Methods and compositions for generating complex trait loci
US10961540B2 (en) * 2012-09-07 2021-03-30 Dow Agrosciences Llc FAD3 performance loci and corresponding target site specific binding proteins capable of inducing targeted breaks
EP3971283A1 (en) 2014-02-27 2022-03-23 Monsanto Technology LLC Compositions and methods for site directed genomic modification
US12173294B2 (en) 2014-09-12 2024-12-24 Corteva Agriscience Llc Generation of site specific integration sites for complex trait loci in corn and soybean, and methods of use
US11560568B2 (en) 2014-09-12 2023-01-24 E. I. Du Pont De Nemours And Company Generation of site-specific-integration sites for complex trait loci in corn and soybean, and methods of use
US12564191B2 (en) 2020-04-28 2026-03-03 Basf Se Pesticidal compounds
US11788096B2 (en) 2020-07-31 2023-10-17 Inari Agriculture Technology, Inc. Excisable INHT31 transgenic soybean glyphosate tolerance locus
US12467056B2 (en) 2021-04-30 2025-11-11 Monsanto Technology Llc Plant regulatory elements and uses thereof

Also Published As

Publication number Publication date
AU2006252680A1 (en) 2006-12-07
AP2007004272A0 (en) 2007-12-31
US11390881B2 (en) 2022-07-19
ZA200710175B (en) 2008-10-29
AR053496A1 (en) 2007-05-09
WO2006130436A3 (en) 2007-03-29
US9944945B2 (en) 2018-04-17
US20150113686A1 (en) 2015-04-23
AU2006252801B2 (en) 2011-05-12
US9017947B2 (en) 2015-04-28
ZA200710177B (en) 2008-10-29
MX2007014970A (en) 2008-02-15
AP2693A (en) 2013-07-16
MX2007014972A (en) 2008-02-15
AU2006252680A2 (en) 2008-07-31
CN101252831B (en) 2016-01-27
HK1153232A1 (en) 2012-03-23
US8053184B2 (en) 2011-11-08
JP2015006192A (en) 2015-01-15
US20170156276A1 (en) 2017-06-08
BRPI0610051A2 (en) 2010-05-25
SG138646A1 (en) 2008-02-29
UY29570A1 (en) 2006-12-29
US20120070839A1 (en) 2012-03-22
HK1220721A1 (en) 2017-05-12
US9605272B2 (en) 2017-03-28
US20140259221A1 (en) 2014-09-11
EP2975129A1 (en) 2016-01-20
JP6167075B2 (en) 2017-07-19
US20220389441A1 (en) 2022-12-08
CA2609777A1 (en) 2006-12-07
WO2006128095A3 (en) 2007-12-06
ES2603857T3 (en) 2017-03-01
US20190185875A1 (en) 2019-06-20
CN104328085A (en) 2015-02-04
EP2275561A1 (en) 2011-01-19
US7632985B2 (en) 2009-12-15
EP1883303B1 (en) 2014-01-15
MX2007014971A (en) 2008-02-12
AR085663A2 (en) 2013-10-16
AU2006252801C1 (en) 2013-09-05
NZ563718A (en) 2010-07-30
RU2007149328A (en) 2009-07-10
WO2006130436A2 (en) 2006-12-07
US20100100980A1 (en) 2010-04-22
CA2609854A1 (en) 2006-11-30
CN101252831A (en) 2008-08-27
EP1885176B1 (en) 2016-08-24
US20230159947A1 (en) 2023-05-25
BRPI0610654B1 (en) 2017-03-28
PH12007502677B1 (en) 2014-08-13
CN101316513A (en) 2008-12-03
KR101076095B1 (en) 2011-10-21
US20060282915A1 (en) 2006-12-14
EP1883303A2 (en) 2008-02-06
CL2013002676A1 (en) 2014-03-07
CL2013002680A1 (en) 2014-03-07
JP5631544B2 (en) 2014-11-26
BRPI0610088A2 (en) 2008-12-09
US20190185876A1 (en) 2019-06-20
US20250092414A1 (en) 2025-03-20
US10738320B2 (en) 2020-08-11
SG179442A1 (en) 2012-04-27
US8754289B2 (en) 2014-06-17
WO2006130494A2 (en) 2006-12-07
US20100099859A1 (en) 2010-04-22
UA94582C2 (en) 2011-05-25
CA2609418A1 (en) 2006-12-07
US20060288447A1 (en) 2006-12-21
JP2008545413A (en) 2008-12-18
KR20080050548A (en) 2008-06-09
BRPI0610654A2 (en) 2010-07-13
AR054052A1 (en) 2007-05-30
IN2007DE09378A (en) 2008-06-27
US10273498B2 (en) 2019-04-30
CA2609418C (en) 2013-09-03
AU2011201461A1 (en) 2011-04-21
AU2006252801A1 (en) 2006-12-07
PT1885176T (en) 2016-11-28
EP1885861A2 (en) 2008-02-13
AU2011201461B2 (en) 2011-09-15
CN101253268A (en) 2008-08-27
RU2411720C2 (en) 2011-02-20
US20210017535A1 (en) 2021-01-21
WO2006130436A8 (en) 2007-12-27
CL2013002678A1 (en) 2014-03-07
CA2609854C (en) 2012-04-24
WO2006128095A2 (en) 2006-11-30
EP1885176A2 (en) 2008-02-13
AR053497A1 (en) 2007-05-09
WO2006130494A3 (en) 2007-06-07
US7608761B2 (en) 2009-10-27
US20200017874A1 (en) 2020-01-16
US12018268B2 (en) 2024-06-25

Similar Documents

Publication Publication Date Title
US10273498B2 (en) Methods and compositions to enhance plant breeding
US11819022B2 (en) Stacked herbicide tolerance event 8264.44.06.1, related transgenic soybean lines, and detection thereof
CN101563462B (en) Produce the method for hybrid corn seed and the composition of method production thus
CN104427861B (en) Corn event mon 87411
CN106191101B (en) Corn event 5307
JP5762400B2 (en) Rice genetic recombination event 17053 and methods of use thereof
JP2015154776A (en) Genetically modified rice event 17314 and method of use thereof
EP2726493A1 (en) Methods and compositions for selective regulation of protein expression
CN104830845B (en) Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878
USH2258H1 (en) Development of novel germplasm using segregates from transgenic crosses
CN110881367A (en) Corn event Ttrans-4 and methods of use thereof
CN104830846A (en) Nucleic acid sequence used for detecting herbicide-tolerant corn plant DBN9898 and detection method thereof
CN118222619A (en) Nucleic acid molecules, detection methods and applications of insect-resistant and herbicide-tolerant maize transformation event LD05
CN116200529A (en) Nucleic acid sequence of corn transformation event LG11 and detection method thereof
CN104878090A (en) Nucleic acid sequence for detecting herbicide-tolerant corn plant DBN9877 and detecting method thereof
BR122019014603B1 (en) POLYNUCLEOTIDES RELATED TO THE STACKED HERBICIDE TOLERANCE EVENT 8264.44.06.1
BR112012010778B1 (en) POLYNUCLEOTIDES, EXPRESSION CASSETTE, PROBE, TRANSGENIC INSERT, AS WELL AS METHODS FOR WEED CONTROL, SEQUENCE IDENTIFICATION IN A SAMPLE, DETERMINATION OF EVENT ZYGOSITY OF A SOYBEAN PLANT, PRODUCTION OF A TRANSGENIC SOYBEAN PLANT AND PRODUCTION OF A PROTEIN IN A PLANT CELL

Legal Events

Date Code Title Description
AS Assignment

Owner name: MONSANTO TECHNOLOGY, L.L.C., MISSOURI

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:BULL, JASON;BUTRUILLE, DAVID;EATHINGTON, SAM;AND OTHERS;REEL/FRAME:018101/0620;SIGNING DATES FROM 20060731 TO 20060811

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION