CN109913581B - Preparation method of molecular marker closely linked with rice blast resistance gene - Google Patents
Preparation method of molecular marker closely linked with rice blast resistance gene Download PDFInfo
- Publication number
- CN109913581B CN109913581B CN201910362960.5A CN201910362960A CN109913581B CN 109913581 B CN109913581 B CN 109913581B CN 201910362960 A CN201910362960 A CN 201910362960A CN 109913581 B CN109913581 B CN 109913581B
- Authority
- CN
- China
- Prior art keywords
- rice
- rice blast
- blast resistance
- indel
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A preparation method of molecular markers closely linked with rice blast resistance genes comprises the steps of constructing an F2 segregation population for positioning the rice blast resistance genes by taking rice varieties with rice blast resistance characteristics as male parents and susceptible varieties as female parents; selecting at least 10 extreme disease-resistant single plants and at least 10 extreme disease-sensitive single plants from the plants to respectively construct a disease-resistant gene pool and a disease-sensitive gene pool; respectively extracting genome DNA of amphiphilic seedlings and amphiphilic filial generation seedlings by adopting an improved CTAB method; screening polymorphisms between two parents and two gene pools to obtain molecular markers linked with the rice blast resistance genes, thereby carrying out preliminary positioning on the rice blast resistance genes; comparing the genome sequence polymorphism of japonica rice and indica rice, and finely positioning the genes related to the rice blast resistance, thereby obtaining the InDel locus closely linked with the rice blast resistance gene and converting the InDel locus into a related specific InDel molecular marker.
Description
Technical Field
The invention relates to the field of rice genetic breeding and molecular biology, in particular to a preparation method of a molecular marker closely linked with a rice blast resistance gene.
Background
Rice is one of the most important food crops in the world, and breeds more than half of the world population. With the improvement of conventional rice breeding strategies and the continuous improvement of molecular breeding technologies, the yield level of rice is gradually improved, but the continuous occurrence of rice diseases and insect pests prevents the rice from breedingThe above further development, wherein the disease causes a loss of rice yield of more than about 30%, and is particularly severe as expressed by rice blast. From fungiMagnaporthe oryzaeThe caused rice blast is one of the most devastating diseases of rice, occurs in all rice areas nationwide or even all over the world, and causes serious influence on the planting and production of the rice.
Currently, the general strategy for controlling rice blast is chemical control and breeding resistant varieties. Although chemical prevention and control can play a certain role, the grain planting cost of farmers is often increased, the pesticide effect is greatly reduced after repeated use, and meanwhile, environmental pollution and potential harm are caused to human beings. The breeding and planting of resistant varieties are the most economic, effective and safe measures for preventing and treating rice blast, and also meet the requirements of human beings on green foods, but simultaneously, because physiological microspecies of rice blast germs have frequent variation and different rice varieties have strong specificity to different physiological microspecies, a plurality of single disease-resistant varieties gradually lose the disease-resistant characteristics after being planted for 3 to 5 years, and the mining and utilization of broad-spectrum resistance genes become the most economic and effective method for breeding the rice varieties with lasting rice blast resistance. Meanwhile, the method also has important significance in the aspects of ecological safety and environmental protection. At least 80 major genes for resisting rice blast are reported to be separated from different rice varieties, wherein more than 20 genes are successfully cloned, but few genes with broad-spectrum resistance are obtained.
On the other hand, the traditional rice blast resistance breeding has the defects of time and labor waste, poor accuracy and easy influence of environmental factors. At present, with the development of molecular biology, molecular marker assisted breeding based on a molecular marker assisted selection technology utilizes the characteristic that a molecular marker is tightly linked with a target gene for resisting rice blast, the existence and the state of the target gene can be judged by directly detecting the linked molecular marker in a laboratory, the purpose of selecting target characters is achieved, and the target gene can be detected in the seedling stage of rice, so that the method has the advantages of early detection period, high detection speed, accurate result and no interference of environmental conditions. Therefore, the discovery of new excellent genes with broad-spectrum rice blast resistance and the development of molecular markers closely linked with the genes become the key for further development of rice blast resistance breeding.
Disclosure of Invention
The invention provides a preparation method of a molecular marker closely linked with a rice blast resistance gene, and mainly aims to develop a preparation method of the molecular marker, so that the prepared molecular marker can overcome the defects of long period, low efficiency, inaccuracy and easiness in influence of environmental factors in a conventional rice blast resistance breeding method.
In order to solve the technical problems, the invention adopts the following technical scheme:
a preparation method of a molecular marker closely linked with a rice blast resistance gene comprises the following steps:
constructing an F2 segregation population for locating rice blast resistance genes by taking a rice variety with rice blast resistance as a male parent and a susceptible variety as a female parent;
(II) randomly selecting at least 10 extreme disease-resistant single plants and at least 10 extreme susceptible single plants from the F2 segregation population to respectively construct a disease-resistant gene pool and an susceptible gene pool;
(III) respectively extracting the genome DNA of the amphiphilic seedling and the amphiphilic filial generation seedling by adopting an improved CTAB method;
(IV) obtaining molecular markers linked with the rice blast resistance genes by screening polymorphism between two parents and two gene pools according to SSR molecular markers published in a rice bioinformatics database, so as to preliminarily position the rice blast resistance genes;
and (V) comparing the genome sequence polymorphism of the japonica rice and indica rice two subspecies which have completed whole genome sequencing in the chromosome region which is preliminarily positioned in the step (IV), finely positioning genes related to rice blast resistance so as to obtain an insertion deletion InDel locus which is closely linked with the rice blast resistance gene, and designing and converting the insertion deletion InDel locus into a related specific insertion deletion InDel molecular marker by using Primer Premier 5.0 software.
Further, in the step (one), a rice variety Kangfeng B with rice blast resistance is taken as a male parent, and a susceptible variety Lijiang Xinjiang Heiguan is taken as a female parent.
Further, in the step (two), 15 extreme disease resistant individuals and 15 extreme infection individuals are randomly selected from the F2 segregation population.
Further, in the step (five), japonica rice and indica rice which have completed whole genome sequencing are Nipponbare and 9311 respectively.
Further, in the third step (iii), the improved CTAB method comprises the following specific steps:
1) weighing 0.1g of rice leaves, putting the rice leaves in liquid nitrogen, grinding the rice leaves into powder, and transferring the powder into a 2.0ml centrifuge tube;
2) adding 800 μ L CTAB extract into the 2.0ml centrifuge tube, gently shaking to mix well, placing in water bath kettle, and warm-bathing at 65 deg.C for 30 min;
3) taking the product obtained in the step 2) out of the water bath, cooling to room temperature, adding chloroform: the isoamyl alcohol is 600 mu L of mixed solution with the ratio of 24:1, and the mixed solution is obtained by shaking up and down and mixing the mixed solution fully and evenly;
4) centrifuging the mixed solution at 12000rpm for 10min, and transferring the supernatant of the mixed solution into a 1.5mL centrifuge tube;
5) adding pre-cooled isopropanol with the volume 2 times that of the supernatant into the 1.5mL centrifuge tube, and gently shaking and uniformly mixing until the visible DNA flocculent precipitate is generated;
6) placing the 1.5mL centrifuge tube into a centrifuge, centrifuging for 3min at 5000rpm, and discarding the supernatant;
7) adding 500 mu L of 75% ethanol into the 1.5mL centrifuge tube, cleaning, centrifuging at 5000rpm for 3min, and removing the supernatant;
8) repeating the step 7) to obtain washed DNA;
9) the washed DNA is placed on a superclean bench to be dried and dissolved in 200 mu L of high-pressure ddH2And O, storing in a refrigerator at 4 ℃ for later use.
Compared with the prior art, the invention has the beneficial effects that:
the molecular marker developed and obtained by the invention is used for detecting the rice blast resistance gene, has strong resistance to rice blast, stable resistance and wide resistance spectrum, and lays a foundation for further cloning and molecular mechanism research of the rice blast resistance gene in the later period through development of the closely linked molecular marker and fine positioning of the gene.
Drawings
FIG. 1 is a schematic diagram of the genetic linkage map and genetic distance between the SSR molecular marker and the InDel marker and the rice blast resistance gene Pi-kf2 (t).
FIG. 2 is a diagram showing the actual physical positions of the linked molecular markers and the rice blast resistance gene Pi-kf2 (t) on the chromosome, and the numbers in brackets below the markers indicate the number of crossover individuals of the corresponding linked markers in the genotype detection process of 220F 2 susceptible groups.
FIG. 3 is the genotype test and linkage analysis of 45F 2 susceptible individuals by the InDel marker InDel-19; in the figure, 1: disease-resistant parent Kangfeng B (KFB); 2: susceptible parent Lijiang Xinjiang black grain (LTH); 3: a pool of disease resistance genes (RP); 4: a susceptible gene pool (SP); s: 45F 2 susceptible individuals.
FIG. 4 is the genotype test and linkage analysis of 45F 2 susceptible individuals by the InDel marker InDel-25; in the figure, 1: disease-resistant parent Kangfeng B (KFB); 2: a pool of disease resistance genes (RP); 3: the susceptible parent Lijiang Xinjiang black grain (LTH); 4: a pool of susceptibility genes (SP); s: 45F 2 susceptible individuals.
FIG. 5 shows genotype detection and linkage analysis of 45F 2 susceptible individuals by the InDel marker InDel-27 1: disease-resistant parent Kangfeng B (KFB); 2: a pool of disease resistance genes (RP); 3: susceptible parent Lijiang Xinjiang black grain (LTH); 4: a pool of susceptibility genes (SP); s: 45F 2 susceptible individuals.
FIG. 6 is the verification of insertion deletion marker InDel-19 on 5 disease-resistant and 5 susceptible individuals of the offspring isolated from Kangfeng B/Nipponbare cross F2; in the figure, 1: disease-resistant parent Kangfeng B (KFB); 2: susceptible parent Nipponbare; r: f2 separating progeny disease-resistant single plants; s: f2 progeny susceptible individuals were isolated.
FIG. 7 is the verification of the InDel marker InDel-25 on 5 disease-resistant and 5 susceptible individuals of the offspring isolated from the Congfeng B/Nipponbare cross F2; in the figure, 1: disease-resistant parent Kangfeng B (KFB); 2: susceptible parent Nipponbare; r: f2 separating progeny disease-resistant single plants; s: f2 progeny susceptible individuals were isolated.
FIG. 8 is the verification of the InDel marker InDel-27 on 5 disease-resistant and 5 susceptible individuals of the offspring isolated from the Congfeng B/Nipponbare cross F2; in the figure, 1: disease-resistant parent Kangfeng B (KFB); 2: susceptible parent Nipponbare; r: f2 separating progeny disease-resistant single plants; s: f2 progeny susceptible individuals were isolated.
Detailed Description
The following describes embodiments of the present invention with reference to the drawings.
Example one
A molecular marker closely linked with rice blast resistance genes is developed and transformed from insertion deletion InDel sites closely linked with the rice blast resistance genes. The molecular marker primer comprises a forward primer pair and a reverse primer pair, and the nucleotide sequences are respectively as follows:
InDel-19 forward: 5 'AAGGAGATCTGGTATGTGTGCG 3';
InDel-19 reverses: 5 'AGTTTGGGGTAGTGAAATGCGA 3';
InDel-25 forward: 5 'CCTGGTCTAAAGCGCACCTA 3';
InDel-25 reverse: 5 'CGCCATGGATTCGTTCGACT 3';
InDel-27 forward: 5 'TCGGTGCTTTAGATATGTTTTGCT 3';
InDel-27 reverse: 5 'ACAACTCAAACCAAGCTTCTCA 3'.
The rice blast resistance gene contained in the rice blast resistance gene has strong resistance to rice blast, and has stable resistance and wide resistance spectrum.
Specifically, the molecular marker is positioned on the No. 6 rice chromosome, is positioned in a Pi2/Pi9 multiple allele cluster region, and is in allelic or close linkage with a Pi2/Pi9 multiple allele cluster region, so that the molecular marker developed by the invention can be simultaneously used as a close linkage marker of the multiple allele disease-resistant genes, and can be used for molecular marker assisted selection of the Pi2/Pi9 gene or polymerization breeding of a plurality of resistance genes in rice resistance breeding.
Reference is made to fig. 1, 2, 3, 4 and 5. A preparation method of a molecular marker closely linked with a rice blast resistance gene comprises the following steps:
constructing an F2 segregation population for locating rice blast resistance genes by taking a rice variety with rice blast resistance as a male parent and a susceptible variety as a female parent;
in the embodiment, a three-line sterile maintainer line rice blast resistant rice variety Kangfeng B (KFB) with a special nuclear genetic background, which is autonomously bred by agriculture science research institute in Sanming city, is taken as a male parent, a susceptible variety Lijiang New Yong black grain (LTH) is taken as a female parent for hybridization to obtain F1, and F2 segregation population is obtained after F1 selfing. Carrying out artificial injection inoculation on rice blast germs at the 3-4 leaf stage of the F2 segregation population seedlings, placing the inoculated seedlings into a constant-temperature incubator at 24-26 ℃ for dark culture for 24h with the relative humidity of 95-100%, then transferring the inoculated seedlings into a greenhouse at 25 ℃ for culture for 8-10 days, observing and counting the morbidity of the inoculated seedlings, and identifying 220 susceptible individuals from the progeny of the population for analyzing the linkage relationship.
(II) randomly selecting at least 10 extreme disease-resistant individuals and at least 10 extreme disease-susceptible individuals from the F2 segregation population to respectively construct a disease-resistant gene pool (RP) and a disease-susceptible gene pool (SP);
in this example, 15 extreme disease resistant individuals and 15 extreme susceptible individuals are randomly selected from the F2 segregating population, the leaf genome DNAs thereof are respectively extracted by an improved CTAB method, the concentrations thereof are measured by DU800 spectrophotometry, and are uniformly diluted to 50ng/μ L, and the diluted 15 disease resistant individuals DNAs and 15 susceptible individuals DNAs are respectively mixed in equal amounts to form a disease resistant gene pool and a susceptible gene pool for linkage analysis.
(III) respectively extracting the genome DNA of the amphiphilic seedling and the amphiphilic filial generation seedling by adopting an improved CTAB method; the method comprises the following steps of extracting genome DNA of single leaf plants of Kangfeng B (KFB), Lijiang Xinjiang Heiguan (LTH), F1 and F2, and specifically comprises the following steps:
1) weighing 0.1g of rice leaves, putting the rice leaves in liquid nitrogen, grinding the rice leaves into powder, and transferring the powder into a 2.0ml centrifuge tube;
2) adding 800 μ L CTAB extract into the 2.0ml centrifuge tube, gently shaking to mix well, placing in a water bath kettle, and warm-bathing at 65 deg.C for 30 min;
3) taking the product obtained in the step 2) out of the water bath, cooling to room temperature, adding chloroform: the isoamyl alcohol is 600 mu L of mixed solution with the ratio of 24:1, and the mixed solution is obtained by shaking up and down and mixing the mixed solution fully and evenly;
4) centrifuging the mixed solution at 12000rpm for 10min, and transferring the supernatant of the mixed solution into a 1.5mL centrifuge tube;
5) adding pre-cooled isopropanol with the volume 2 times that of the supernatant into the 1.5mL centrifuge tube, and gently shaking and uniformly mixing until the visible DNA flocculent precipitate is generated;
6) placing the 1.5mL centrifuge tube into a centrifuge, centrifuging for 3min at 5000rpm, and discarding the supernatant;
7) adding 500 mu L of 75% ethanol into the 1.5mL centrifuge tube, cleaning, centrifuging at 5000rpm for 3min, and removing the supernatant;
8) repeating the step 7) to obtain washed DNA;
9) the washed DNA is placed on a super clean bench for drying and dissolved in 200 mu L high-pressure ddH2And O, storing in a refrigerator at 4 ℃ for later use.
(IV) obtaining molecular markers linked with the rice blast resistance genes by screening polymorphism between two parents and two gene pools according to SSR molecular markers published in a rice bioinformatics database (http:// archive. gram. org/markers/microsat), thereby carrying out primary positioning on the rice blast resistance genes;
specifically, the genotype identification and linkage analysis are further carried out on the F2 susceptible population in the step (I) by combining with linkage analysis software Mapmaker/EXP 3.0, the recombination rate is converted into relative genetic distance by a Kosambi arithmetic function, molecular markers Rm19776, Rm19781, Rm527, Rm7213, Rm5850 and Rm7311 which are linked with the target gene are obtained, the rice blast resistance gene is preliminarily positioned between Rm527 and Rm7213, and the markers have 45 crossover recombinant individuals in the detection process of 220F 2 susceptible populations and have certain genetic distance with the target gene;
and (V) comparing the genome sequence polymorphism of the japonica rice and indica rice two subspecies which have completed whole genome sequencing in the chromosome region which is preliminarily positioned in the step (IV), finely positioning genes related to rice blast resistance so as to obtain an insertion deletion InDel locus which is closely linked with the rice blast resistance gene, and designing and converting the insertion deletion InDel locus into a related specific insertion deletion InDel molecular marker by using Primer Premier 5.0 software.
In this example, in order to develop related molecular markers, the target genes were further finely located, genomic sequence polymorphisms in the chromosomal region preliminarily located in step (four) of two subtypes japonica rice, nippon and indica rice 9311 were compared, insertion deletion InDel sites closely linked with the rice blast resistant genes were obtained, Primer Premier 5.0 software was used to design and convert them into corresponding specific InDel molecular markers, markers InDel-19, InDel-22, InDel-25 and InDel-27 closely linked with the target rice blast resistant genes were obtained, and when genotype analysis was performed on F2 susceptible population, it was found that no crossover recombinant single plants appeared in all of the three markers other than InDel-22 marker, and there was a close linkage relationship with the target genes.
The applicant separates and identifies a broad-spectrum rice blast resistance gene from a three-line sterile maintainer line variety Kangfeng B (KFB) of rice with a special nuclear genetic background by a separation population analysis method and a recessive population analysis method and by utilizing a molecular marker technology, and finely positions the broad-spectrum rice blast resistance gene on a No. 6 rice chromosome in a Pi2/Pi9 allele cluster region by developing a closely linked molecular marker. Through allele-specific molecular marker identification and a series of genome amplification sequencing and sequence alignment analysis, the rice blast resistance gene in Confeng B is different from other reported Pi2/Pi9 alleles, and is presumed to be a novel rice blast resistance gene with broad-spectrum resistance. The invention lays a foundation for further cloning and molecular mechanism research of the rice blast resistance gene in the later period through the development of the closely linked molecular marker and the fine positioning of the gene.
Reference is made to fig. 1, 2, 3, 4 and 5. The application of molecular marker closely linked with rice blast resistance gene is used in the identification of rice blast resistance gene and the auxiliary selective breeding of rice disease resisting variety.
Wherein, the method for identifying the rice blast resistance gene comprises the following steps:
a) taking DNA of a single rice plant material to be identified as a template;
b) carrying out PCR amplification on the DNA in the step a) by using a molecular marker to obtain an amplification product; the specific application in the embodiment is that the molecular markers InDel-19, InDel-25 and InDel-27 are used for PCR amplification; the reaction system for PCR amplification in the step 1 comprises the following components in a total volume of 10 mu L: 5.0. mu.L of PCR MasterMix, 0.5. mu.L of forward primer, 0.5. mu.L of reverse primer, 0.8. mu.L of DNA, 3.2. mu.L of ddH2O; the reaction conditions for PCR amplification are as follows: pre-denaturation at 94.0 deg.C for 5 min; denaturation at 94.0 deg.C for 30S, renaturation at 55 deg.C for 30S, extension at 72 deg.C for 1min, 35 cycles; extending for 7min at 72 ℃, and storing at 4 ℃;
c) carrying out gel electrophoresis separation analysis on the amplification product in the step b) by using 8% non-denatured polyacrylamide gel, and observing through nucleic acid dye staining to obtain band patterns with different molecular weights; in the step, the preparation method of the 8% non-denatured polyacrylamide gel comprises the following steps: the composition comprises the following components in a total volume of 30 mu L: 23.4mL ddH2O, 6mL of 40% acrylamide, 0.3mL of 50 × CTAB, 0.3mL of APS, 24.9 μ L of TEMED;
d) if a specific band corresponding to the molecular marker exists in the band type, the single rice plant to be identified is a plant containing a rice blast resistance gene, and particularly applied to the embodiment, the single rice plant which can respectively amplify specific bands of 241bp (InDel-19), 250bp (InDel-25) and 243bp (InDel-27) is a plant containing a target resistance gene.
The invention obtains a new rice blast resistance gene with broad spectrum resistance from a rice three-line sterile maintainer line rice variety Kangfeng B (KFB) with special nuclear genetic background by a map-based cloning method, and locates the rice blast resistance gene on the No. 6 chromosome of rice in the Pi2/Pi9 allelic gene region. 3 insertional deletion InDel molecular markers which are tightly linked with target resistance genes are developed by utilizing a method of genome sequence comparison between indica-japonica subspecies, in the later-stage rice blast resistance breeding, the auxiliary selection can be carried out through the tightly linked molecular markers, the defects of long period, low efficiency, inaccuracy, easy influence of environmental factors and the like in the conventional breeding method can be overcome, meanwhile, the identification of the disease-resistant genes in a laboratory can be carried out in a targeted manner, and the polymerization of a plurality of disease-resistant genes can be carried out in a targeted manner, so that a new rice variety with broad-spectrum resistance and lasting and stable resistance can be cultured. Meanwhile, the development of the closely linked molecular markers and the fine positioning of the genes have important significance on the further cloning and the molecular mechanism research of the resistance genes.
Example two
Refer to fig. 6, 7, and 8. In order to further prove the application of the molecular marker which is developed by the invention and is closely linked with the rice blast resistance gene in rice resistance auxiliary selective breeding, the applicant configures a new hybridization combination by taking the disease-resistant variety Kangfeng B (KFB) as a male parent and the susceptible variety Nipponbare as a female parent, obtains a new F2 segregation population, and inoculates the new F2 segregation population by the method of the step (one) in the embodiment to obtain a certain number of F2 disease-resistant single strains and susceptible single strains. Meanwhile, referring to the method for identifying rice blast resistance genes in the embodiment I, polymorphism analysis is respectively carried out on two parents by using the three InDel markers, polymorphism of the two parents at the three InDel sites is found, the two parents are shown as amplification band types with different molecular weights, further, F2 partial disease-resistant single plants and partial disease-susceptible single plants are detected, the band types of the disease-resistant single plants are found to be consistent with disease-resistant parent Congfeng B (KFB), the band types of the disease-susceptible single plants are found to be consistent with disease-susceptible parent Nippon clear, and FIGS. 6, 7 and 8 are respectively used for detecting F2 group partial disease-resistant single plants and partial disease-susceptible single plants hybridized with Nippon clear/Congfeng B (KFB) by using molecular markers InDel-19, InDel-25 and InDel-27. The insertion deletion InDel marker which is developed by the invention and is closely linked with the rice blast resistance gene can accurately distinguish disease-resistant and susceptible single plants, so that the insertion deletion InDel marker can be well applied to the auxiliary selective breeding of the rice blast resistance molecular marker in the later stage. The markers can be used for PCR amplification of rice seedling stage genome to accurately judge the existence and state of rice blast resistance genes, so that the rice resistance breeding selection efficiency can be obviously improved, the workload of later stage field screening and identification is reduced, and the breeding process is accelerated.
The above description is only an embodiment of the present invention, but the design concept of the present invention is not limited thereto, and any insubstantial modifications made by using the design concept should fall within the scope of infringing the present invention.
Sequence listing
<110> sanming city institute of agricultural science
<120> a molecular marker closely linked with rice blast resistance gene and application thereof
<140> 2019103629728
<141> 2019-04-30
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 1
<210> 2
<211> 22
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 2
agtttggggt agtgaaatgc ga 22
<210> 3
<211> 20
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 3
cctggtctaa agcgcaccta 20
<210> 4
<211> 20
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 4
cgccatggat tcgttcgact 20
<210> 5
<211> 24
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 5
tcggtgcttt agatatgttt tgct 24
<210> 6
<211> 22
<212> DNA
<213> 2 Ambystoma laterale x Ambystoma jeffersonianum
<400> 6
acaactcaaa ccaagcttct ca 22
Claims (4)
1. A method for preparing a molecular marker closely linked with a rice blast resistance gene, which is characterized in that the molecular marker is obtained by amplifying the following nucleotide sequences:
InDel-19 forward: 5 'AAGGAGATCTGGTATGTGTGCG 3's;
InDel-19 reverses: 5 'AGTTTGGGGTAGTGAAATGCGA 3';
InDel-25 forward: 5 'CCTGGTCTAAAGCGCACCTA 3';
InDel-25 reverse: 5 'CGCCATGGATTCGTTCGACT 3';
InDel-27 forward: 5 'TCGGTGCTTTAGATATGTTTTGCT 3';
InDel-27 reverse: 5 'ACAACTCAAACCAAGCTTCTCA 3';
the preparation method comprises the following steps:
constructing an F2 segregation population for positioning rice blast resistance genes by taking a rice variety Kangfeng B with rice blast resistance as a male parent and a susceptible variety Lijiang Xinjiang Heiguan as a female parent;
(II) randomly selecting at least 10 extreme disease-resistant single plants and at least 10 extreme susceptible single plants from the F2 segregation population to respectively construct a disease-resistant gene pool and an susceptible gene pool;
(III) respectively extracting the genome DNA of the two parent seedlings and the two parent hybrid progeny seedlings by adopting an improved CTAB method;
(IV) obtaining molecular markers linked with the rice blast resistance genes by screening polymorphism between two parents and two gene pools according to SSR molecular markers published in a rice bioinformatics database, so as to preliminarily position the rice blast resistance genes;
and (V) comparing the genome sequence polymorphism of the japonica rice and indica rice two subspecies which have completed whole genome sequencing in the chromosome region which is preliminarily positioned in the step (IV), finely positioning genes related to rice blast resistance so as to obtain an insertion deletion InDel locus which is closely linked with the rice blast resistance gene, and designing and converting the insertion deletion InDel locus into a related specific insertion deletion InDel molecular marker by using Primer Premier 5.0 software.
2. The method for producing a molecular marker which is closely linked to a rice blast resistance gene according to claim 1, wherein: in the step (II), 15 extreme disease resistant individuals and 15 extreme susceptible individuals are randomly selected from the F2 segregation population.
3. The method for producing a molecular marker which is closely linked to a rice blast resistance gene according to claim 1, wherein: in the step (five), japonica rice which has completed whole genome sequencing is Nipponbare and indica rice is 9311.
4. The method for producing a molecular marker which is closely linked to a rice blast resistance gene according to claim 1, wherein: in the step (III), the improved CTAB method comprises the following specific steps:
1) weighing 0.1g of rice leaves, putting the rice leaves in liquid nitrogen, grinding the rice leaves into powder, and transferring the powder into a 2.0ml centrifuge tube;
2) adding 800 μ L CTAB extract into the 2.0ml centrifuge tube, gently shaking to mix well, placing in water bath kettle, and warm-bathing at 65 deg.C for 30 min;
3) taking the product prepared in the step 2) out of the water bath, cooling to room temperature, adding chloroform: the isoamyl alcohol is 600 mu L of mixed solution with the ratio of 24:1, and the mixed solution is obtained by shaking up and down and mixing the mixed solution fully and evenly;
4) centrifuging the mixed solution at 12000rpm for 10min, and transferring the supernatant of the mixed solution into a 1.5mL centrifuge tube;
5) adding pre-cooled isopropanol with the volume 2 times that of the supernatant into the 1.5mL centrifuge tube, and gently shaking and uniformly mixing until a DNA flocculent precipitate is generated;
6) placing the 1.5mL centrifuge tube into a centrifuge, centrifuging for 3min at 5000rpm, and discarding the supernatant;
7) adding 500 mu L of 75% ethanol into the 1.5mL centrifuge tube, cleaning, centrifuging at 5000rpm for 3min, and removing the supernatant;
8) repeating the step 7) to obtain washed DNA;
9) the washed DNA is placed on a super clean bench for drying and dissolved in 200 mu L high-pressure ddH2And O, storing in a refrigerator at 4 ℃ for later use.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362960.5A CN109913581B (en) | 2019-04-30 | 2019-04-30 | Preparation method of molecular marker closely linked with rice blast resistance gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910362960.5A CN109913581B (en) | 2019-04-30 | 2019-04-30 | Preparation method of molecular marker closely linked with rice blast resistance gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109913581A CN109913581A (en) | 2019-06-21 |
| CN109913581B true CN109913581B (en) | 2022-05-20 |
Family
ID=66978853
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910362960.5A Active CN109913581B (en) | 2019-04-30 | 2019-04-30 | Preparation method of molecular marker closely linked with rice blast resistance gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109913581B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146695A (en) * | 2013-03-01 | 2013-06-12 | 福建省农业科学院生物技术研究所 | Functional molecular marker for rice anti-blast gene Pi9 and application thereof |
| CN106498089A (en) * | 2017-01-03 | 2017-03-15 | 湖南农业大学 | The molecule labelling method of resistance gene of rice blast Pi2 1 and application |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PT1885176T (en) * | 2005-05-27 | 2016-11-28 | Monsanto Technology Llc | Soybean event mon89788 and methods for detection thereof |
-
2019
- 2019-04-30 CN CN201910362960.5A patent/CN109913581B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103146695A (en) * | 2013-03-01 | 2013-06-12 | 福建省农业科学院生物技术研究所 | Functional molecular marker for rice anti-blast gene Pi9 and application thereof |
| CN106498089A (en) * | 2017-01-03 | 2017-03-15 | 湖南农业大学 | The molecule labelling method of resistance gene of rice blast Pi2 1 and application |
Non-Patent Citations (4)
| Title |
|---|
| Fine mapping and identification of the rice blast-resistance locus Pi-kf2(t) as a new member of the Pi2/Pi9 multigene family;Xinyu Wei等;《Mol Breeding》;20190710;第39卷(第7期);第1-15页 * |
| Resistance genes and selection DNA markers for blast disease in rice (Oryza sativa L.);Yohei Koide等;《Japan Agricultural Research Quarterly》;20091231;第43卷(第4期);第255-280页 * |
| 分子标记辅助培育水稻万金 B 抗稻瘟病近等基因系与基因聚合系;徐未未;《中国优秀博硕士学位论文全文数据库(硕士)农业科技辑》;20130915(第09期);第12页倒数第2段至第17页最后一段 * |
| 水稻不育系康丰 A 稻瘟病抗性的遗传分析和基因定位;陈鑫;《中国优秀博硕士学位论文全文数据库(硕士)农业科技辑》;20160815(第08期);第1页摘要、第24页第1段至第31页第1段、图5 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109913581A (en) | 2019-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109913582B (en) | Molecular marker closely linked with rice blast resistance gene and application thereof | |
| CN112430606B (en) | Wheat stripe rust resistant gene yrZ-1949 and molecular marker and application thereof | |
| CN113637789A (en) | Wheat stripe rust resistant gene YRTD121 linked KASP molecular marker, primer, kit and application | |
| CN106434944B (en) | Application of SNP molecular marker closely linked with peach aphid-resistant gene | |
| CN111778352A (en) | KASP primer group related to wheat grain weight and application thereof | |
| CN113273489B (en) | Molecular marker-assisted breeding method for high-yield wheat with resistance to gibberellic disease | |
| CN103014153B (en) | Anti-ustilaginoidea virens major gene and molecular marker thereof | |
| CN108456740B (en) | Rice blast resistance site 'Pi-jx', Indel marker primer and breeding application thereof | |
| CN112889664B (en) | Method for cultivating broad-spectrum and durable resistant rice breeding material by polymerizing complementary rice blast resistant genes | |
| CN112760402B (en) | KASP primer group for detecting wheat spike number and biomass density and application thereof | |
| CN114292925A (en) | SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection | |
| CN115852022A (en) | Tobacco core SNP marker developed based on whole genome re-sequencing and KASP technology and application thereof | |
| CN109913580B (en) | Application of molecular marker closely linked with rice blast resistance gene | |
| CN114032235A (en) | SSR marker, primer pair and application thereof, and screening method of SSR marker sites related to upland cotton precocity molecular breeding | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN109913581B (en) | Preparation method of molecular marker closely linked with rice blast resistance gene | |
| CN110468229A (en) | Rice wide spectrum high resistance to hoja blanca gene Xa45's (t) isolates molecular labeling Hxjy-1 | |
| CN115786567A (en) | Semi-dominant maize dwarfing related molecular marker and application thereof | |
| CN112080580B (en) | SNP marker for identifying broccoli variety Zhe Qing 60 | |
| CN111118192B (en) | KASP molecular marker of wheat ear base small ear fruition main effect QTL and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN110257553A (en) | A kind of KASP molecule labelling method for identifying resistance gene of rice blast Pigm | |
| CN110923356B (en) | Molecular marker primer of rice gall midge-resistant major gene Gm5, and marking method and application thereof | |
| CN109468400B (en) | Rice blast resistance gene Pi36 codominant molecular marker and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |