CN114292925A - SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection - Google Patents
SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection Download PDFInfo
- Publication number
- CN114292925A CN114292925A CN202111680733.0A CN202111680733A CN114292925A CN 114292925 A CN114292925 A CN 114292925A CN 202111680733 A CN202111680733 A CN 202111680733A CN 114292925 A CN114292925 A CN 114292925A
- Authority
- CN
- China
- Prior art keywords
- pcm
- procambarus
- primer
- air
- growth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of animal molecular marker screening and application. In particular to an SSR molecular marker primer related to the growth traits of procambarus clarkia and application thereof in auxiliary selection. The invention is characterized in that: the method comprises the steps of carrying out PCR amplification on an acquired sample by utilizing SSR markers through genome DNA and growth character phenotype of two full-sibling groups of procambarus clarkia and a natural random group to obtain a target fragment, detecting whether the target fragment is amplified or not through agarose gel electrophoresis, further detecting the genotype of a PCR product through polyacrylamide gel electrophoresis, carrying out correlation analysis on the genotype and the growth character phenotype of the procambarus clarkia, and identifying the QTL site correlated with the growth character. The dominant genotype of the SSR marker is screened to assist in breeding the procambarus clarkia strain with excellent growth traits.
Description
Technical Field
The invention belongs to the technical field of animal molecular marker screening and application. In particular to an SSR molecular marker primer related to the growth traits of procambarus clarkia and application thereof in auxiliary selection.
Background
Procambarus clarkii (Procambarus clakii), commonly known as crayfish, belongs to the phylum Arthropoda, Crustacea, Decapoda, Cambaridae, Procambarus. Procambarus clarkii is native to the southern United states and northern Mexico (Hobbs 1974), and has now spread around the world. The species is reported to gradually spread to various large water systems in China after being introduced from Japan to Nanjing area in China in 1929 (Xie et al 2001). In view of the edibility and economic value of the procambarus clarkii, large-scale artificial breeding of procambarus clarkii is developed in China, Hunan provinces, Jiangsu provinces, Anhui provinces and other provinces.
At present, along with the rapid expansion of the breeding scale of the procambarus clarkia and the lack of excellent varieties, the germ plasm of the procambarus clarkia is declined due to the self-breeding and self-breeding seedling breeding mode of farmers, and the method is specifically represented as follows: small individual, different size and specification, and poor disease resistance. Adult shrimp size is a key economic trait, and growth is a quantitative trait controlled by multiple genes, namely Quantitative Trait Loci (QTLs). Molecular breeding speeds up the breeding process by using genetic markers that allow growth traits to be quantified more quickly, shorten the breeding years, and improve breeding efficiency, as compared to traditional selective breeding, which focuses on selecting individuals with desirable traits. However, the genetic basic research of the procambarus clarkii is relatively lagged, and a molecular breeding system is not established yet. Therefore, the collection and establishment of the resource library of the procambarus clarkii germplasm are urgently needed, the genetic basis of the economic characters of the procambarus clarkii is analyzed, and the basis is laid for the molecular breeding of the procambarus clarkii. Simple repeat sequences markers (SSRs) are widely used in genetic diversity analysis, genetic map construction, QTL mapping, etc. because of their abundance, high polymorphism, widespread distribution throughout the genome, co-dominant inheritance, ease of Polymerase Chain Reaction (PCR) detection, and ease of duplication (Kuleung et al, 2004).
The SSR marker can be used for genetic diversity analysis of procambarus clarkia population, QTL positioning is carried out by utilizing the holomorphic family in combination with growth character phenotype, and gene resources and functional markers are provided for molecular breeding of procambarus clarkia.
A paper about the development of the SSR marker of procambarus clarkia has been reported (see: Sun et al, 2021), but the paper only shows 50 primer sequences, only one primer sequence is overlapped with 11 primer sequences in the application, namely the PCM 806 primer sequence has been reported, and other primer sequences have not been reported. Meanwhile, the related content related to the growth traits is not reported.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, a batch of SSR molecular marker primers related to the growth traits of procambarus clarkia are obtained by screening, and the marker primers are used for auxiliary selection of procambarus clarkia strains. The invention overcomes the difficulties of long period and poor genetic stability of the traditional breeding selection of the procambarus clarkii, and utilizes SSR markers, full sibling populations and natural random populations to identify molecular marker primers related to growth traits by correlation analysis so as to improve the efficiency of auxiliary selection.
The technical scheme of the invention is as follows:
an SSR molecular marker primer related to the growth traits of procambarus clarkia and an application thereof in auxiliary selection, wherein the method comprises the following steps:
(1) two Procambrus clarkii whole sibling populations and a natural random population are constructed, the number of each population is more than 120, and the male-female ratio is about 1: 1. the homomorphic groups are cultured in a single cage in an indoor flowing water culture system, and the natural random groups are cultured in a single cage in a net cage of a pond, as shown in figure 1 in the figure. The culture conditions of individuals in the same group are equal, and the culture conditions comprise growth indexes such as initial body length and weight, the water quality of culture water, culture density, feed supply and the like. Measuring the growth trait phenotypes (body length, body weight, head and chest length, head and chest width and abdomen length) after the shrimp grows to be grown, and collecting the genomic DNA corresponding to each shrimp.
(2) According to the sequencing data of the procambarus clarkia genome, a primer is designed to amplify a target fragment, and agarose electrophoresis is utilized to detect whether the target fragment is amplified. The PCR detection conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 30 s; after 35 cycles, re-extension at 72 ℃ for 7 min; storing at 4 ℃.
(3) Carrying out electrophoresis on the amplified PCR product by using 4% polyacrylamide gel (PAGE gel), dyeing by using 0.2% silver nitrate solution after the electrophoresis is finished, developing, rinsing and airing by using 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution, and carrying out genotype statistical analysis on the population in the step (1);
(4) and (3) carrying out correlation analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individuals in the step (3). Because the procambarus clarkii grows differently between males and females, the association analysis is performed on individuals in the group according to male and female separation. Using one-way anova, molecular markers (P < 0.05) that correlate with the growth trait phenotype and that are reproducibly detectable are identified and the dominant genotype is determined.
(5) Integrating the genotypes obtained in the step (3), dividing the genotypes into two types according to homozygote and heterozygote, and then performing correlation analysis according to the step (4) to identify a molecular marker (P is less than 0.05) which can repeatedly have heterosis among groups.
The invention mainly solves the following technical problems:
with the rapid expansion of the breeding scale of the procambarus clarkii and the lack of excellent varieties, the germ plasm of the procambarus clarkii is declined due to the seedling breeding mode of self-breeding and self-breeding of farmers. The cultivation of a variety with excellent growth characteristics is the key to solve the problem. The traditional selective breeding period is long, and the genetic stability is poor, so that molecular markers related to growth traits are developed, and the molecular markers are utilized to assist in breeding populations with excellent growth traits, so that the breeding efficiency can be accelerated.
The invention has the following advantages:
(1) the molecular marker of the invention is convenient to use, and can quickly screen out procambarus clarkia groups with excellent growth traits.
(2) The molecular marker of the invention has high repeatability in different populations of procambarus clarkia.
(3) The procambarus clarkii genotype identified by the invention corresponds to excellent growth traits and has obvious effect.
Drawings
FIG. 1: a procambarus clarkia breeding system. FIG. 1A is a schematic view of a single-cage indoor procambarus clarkii flow water culture system; fig. B in fig. 1 is a schematic diagram of a single-cage culture of a procambarus clarkii pond cage culture system.
FIG. 2: schematic diagram of SSR site polymorphism of procambarus clarkii.
FIG. 3: the genotype and phenotype of the large individual group and the small individual group in the natural random population of the procambarus clarkia are compared and analyzed. FIG. 3A is a comparison of SSR marker dominant genotypes of Procambrus clarkii; FIG. 3B is a graph of comparative analysis of the body weight and body length of large and small populations of procambarus clarkii; FIG. 3C is a graph of comparative analysis of the predominant genotype ratios of large and small populations of procambarus clarkii.
Detailed Description
Example 1 identification of SSR markers associated with growth traits Using a Whole sibling population
(1) Selecting healthy disease-free procambarus clarkii with complete body types as parents to carry out one-to-one male-female pairing, forming procambarus clarkii whole-sib groups by using fertilized and hatched filial generations, selecting two whole-sib groups to carry out QTL positioning on growth characters, wherein the number of the groups is 214 and 133 respectively, and the male-female sex ratio is about 1: 1.
(2) the whole sibling population is raised in a single cage in the indoor flowing water aquaculture system after hatching is completed, and the number on the cage represents the number of the procambarus clarkii as shown in a diagram A in figure 1. The culture conditions of individuals in the same group are equal, and the culture conditions comprise growth indexes such as initial body length and weight, the water quality of culture water, culture density, feed supply and the like. The growth trait phenotypes (body length, body weight, cephalothorax length, cephalothorax width, abdominal length) were measured starting when the juvenile shrimp grew to 3cm, once every half month until after shrimp formation and the genomic DNA corresponding to each shrimp was collected.
(3) 300 pairs of polymorphic SSR markers (Sun et al, 2021) developed according to sequencing data of procambarus clarkia genomes are selected, primers are designed to amplify target fragments, and the sequences of the primers are shown in Table 1. And detecting whether the target fragment is amplified by agarose electrophoresis. The PCR detection conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 30 s; after 35 cycles, re-extension at 72 ℃ for 7 min; storing at 4 ℃.
(4) Carrying out electrophoresis on the amplified PCR product by using 4% polyacrylamide gel (PAGE gel), dyeing by using 0.2% silver nitrate solution after the electrophoresis is finished, developing, rinsing and airing by using 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution, and carrying out genotype statistical analysis on the population in the step (1);
(5) and (3) carrying out correlation analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individuals in the step (3). Because the procambarus clarkii grows differently between males and females, the association analysis is performed on individuals in the group according to male and female separation. Using one-way anova, molecular markers associated with the growth trait phenotype (P < 0.05) were identified and the dominant genotype was determined.
TABLE 1 molecular marker primer sequences screened according to the invention
(6) Integrating the genotypes obtained in the step (4), dividing the genotypes into two types according to homozygote and heterozygote, and performing correlation analysis according to the method in the step (4) to identify the molecular marker primer combination with heterosis (P is less than 0.05).
Example 2: identification of SSR markers associated with growth traits using natural stochastic populations
(1) Randomly selecting healthy and disease-free procambarus clarkii larvae with complete body types and body lengths of about 4cm in a pond to form a natural random population for carrying out QTL positioning on growth characters, wherein the population number is 138, and the male-female ratio is about 1: 1.
(2) natural random populations are bred in the pond net cages in a single net cage, and as shown in a figure 1B in the legend, the net cages can be numbered to represent the numbers of shrimps. The culture conditions of individuals in the same group are equal, and the culture conditions comprise growth indexes such as initial body length and weight, the water quality of culture water, culture density, feed supply and the like. The growth trait phenotypes (body length, body weight, cephalothorax length, cephalothorax width, abdominal length) were measured after one month of shrimp breeding for young shrimps, and the growth trait phenotypes were measured again after two months of breeding until adult shrimps were grown and genomic DNAs corresponding to each shrimp were collected.
(3) 300 pairs of polymorphic SSR markers (Sun et al, 2021) developed according to sequencing data of procambarus clarkia genomes are selected, primers are designed to amplify target fragments, the sequences of the primers are shown in table 1, and agarose electrophoresis is used for detecting whether the target fragments are amplified. The PCR detection conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 30 s; after 35 cycles, re-extension at 72 ℃ for 7 min; storing at 4 ℃.
(4) And (3) carrying out electrophoresis on the amplified PCR product by using 4% polyacrylamide gel (PAGE gel), dyeing by using 0.2% silver nitrate solution after the electrophoresis is finished, developing, rinsing and airing by using 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution, and carrying out population processing on the population in the step (1).
(5) And (3) carrying out correlation analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individuals in the step (3). Because the procambarus clarkii grows differently between males and females, the association analysis is performed on individuals in the group according to male and female separation. Using one-way anova, molecular markers associated with the growth trait phenotype (P < 0.05) were identified and the dominant genotype was determined.
(6) Integrating the genotypes obtained in the step (4), dividing the genotypes into two types according to homozygote and heterozygote, and then performing association analysis according to the step (4) to identify the molecular marker with heterosis (P is less than 0.05).
Example 3: integration of two full sibling populations and one natural random population with SSR markers related to growth traits and dominant genotypes
Integrating the SSR markers and the dominant genotypes related to the growth traits identified by two full sibling populations and a natural random population, and further confirming the SSR markers and the dominant genotypes with population repeatability.
(1) SSR markers related to growth traits and identified by two full sibling populations and natural random populations and dominant genotypes are integrated, the SSR markers which are not repetitive and only can be repeated among the populations and have consistent dominant genotypes are removed, and the results are shown in table 2.
TABLE 2 Procambarus clarkii SSR sites relevant to growth traits
Table 1 remarks: var, explain the rate of variation.
(2) And (3) screening a Small individual group (Small group) and a large individual group (Big group) accounting for 10% of the population number from the natural random population by weight and length respectively, and performing comparative analysis by combining the SSR markers with population repeatability and the dominant genotypes integrated in the step (1), as shown in a graph A in figure 2. The weight and length of the small and large population are compared as shown in panel B of FIG. 2, and the dominant genotype ratios of the small and large population are shown in panel C of FIG. 2.
(3) The dominant genotype ratio of the large population is much larger than that of the small population, which corresponds to the difference between the body weight and the body length of the small population and the large population.
The main references:
1.Hobbs HH.A checklist of the North and Middle American crayfishes(Decapoda:Astacidae and Cambaridae). Smithsonian Contributions to Zology,1974,166:1-161.
2.Xie Y,Li ZY,Wang S.Review on invasive species in China.In:Protecting the Biodiversity of China(eds Schei P,Xie Y,Wang S).China Environmental Science Press,Beijing(In Chinese),2001,91-96.
3.Kuleung C,Baenziger,PS,Dweikat I.Transferability of SSR markers among wheat,rye,and triticale. Theoretical and Applied Genetics,2004,108:1147-1150.
4.Sun JX,Peng GH,Xiong LJ,Tan C,Li YH,Bai XF.Genome-wide SSR marker development and application in genetic diversity analysis of red swamp crayfish Procambarus clarkii in China.Crustaceana,2021,94(2):189-205。
sequence listing
<110> university of agriculture in Huazhong
SSR molecular marker primer for growth traits of <120> procambarus clarkia and application of SSR molecular marker primer in auxiliary selection
<141> 2021-12-30
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 13
ccctcgctcc ctctcttatc 20
<210> 14
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 15
<210> 16
<211> 23
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(23)
<400> 16
tgaacgtgat agtgatgatg att 23
<210> 17
<211> 22
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 17
tgcttggtgt aaatgacagg ag 22
<210> 18
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 21
<210> 22
<211> 22
<212> DNA
<213> Procambarus clakii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 22
ccaagacata aaaatcccac ca 22
Claims (3)
1. The SSR molecular marker primer for assisting in breeding the excellent growth trait strain of the procambarus clarkii is characterized in that the DNA sequence of the molecular marker primer is as follows:
PCM 2858 forward primer (5 '-3'): CTGCCTTGGGTCCTCACTAA the flow of the air in the air conditioner,
PCM 2858 reverse primer (5 '-3'): CATCTGACCACCACCAGCTA, respectively;
PCM 2799 forward primer (5 '-3'): TCTAGTAGGCCGGGCATAAG the flow of the air in the air conditioner,
PCM 2799 reverse primer (5 '-3'): CCACCACACTTTGGATTCAT, respectively;
PCM 2813 forward primer (5 '-3'): TGGACTTGAGGACCATTCAA the flow of the air in the air conditioner,
PCM 2813 reverse primer (5 '-3'): GAGTTGCTGAAGCAAAATCG, respectively;
PCM 924 Forward primer (5 '-3'): AACCCCTTTTCATCGTTCCT the flow of the air in the air conditioner,
PCM 924 reverse primer (5 '-3'): GGTAAGGAAAGACGGGGAAT, respectively;
PCM 2737 forward primer (5 '-3'): ACGTCTCTTGGTCCCTTGTG the flow of the air in the air conditioner,
PCM 2737 reverse primer (5 '-3'): TGTTTGCATACGGCAAAGTT, respectively;
PCM 2578 forward primer (5 '-3'): CCTCTTCCTGTTTCCCCTCT the flow of the air in the air conditioner,
PCM 2578 reverse primer (5 '-3'): TGACCAATTACGCAGTGAGG, respectively;
PCM 2092 forward primer (5 '-3'): CCCTCGCTCCCTCTCTTATC the flow of the air in the air conditioner,
PCM 2092 reverse primer (5 '-3'): TGGGTAACCCGACCTGTCTA, respectively;
PCM 806 forward primer (5 '-3'): GCTCTCCAATCTTTGCTGGA the flow of the air in the air conditioner,
PCM 806 reverse primer (5 '-3'): TGAACGTGATAGTGATGATGATT, respectively;
PCM 281 Forward primer (5 '-3'): TGCTTGGTGTAAATGACAGGAG the flow of the air in the air conditioner,
PCM 281 reverse primer (5 '-3'): GCCCTCTAGGTCGTGTCAAG, respectively;
PCM 821 Forward primer (5 '-3'): CCGGACATGTACCGTGATCT the flow of the air in the air conditioner,
PCM 821 reverse primer (5 '-3'): CGCACCAGATGATGAGAGTG, respectively;
PCM 2347 forward primer (5 '-3'): GCTGGGAAGAAATCCCAAAT the flow of the air in the air conditioner,
PCM 2347 reverse primer (5 '-3'): CCAAGACATAAAAATCCCACCA are provided.
2. A method for excavating SSR molecular markers for assisting in breeding of excellent growth trait strains of procambarus clarkii is characterized by comprising the following steps:
(1) two Procambrus clarkii full sibling groups and a natural random group are constructed, the number of each group is more than 120, and the male-female ratio is 1: 1; the full sibling groups are cultured in a single cage in an indoor running water culture system, natural random groups are cultured in a single cage in a net cage of a pond, and the culture mode is shown in figure 1; the culturing conditions among individuals in the same group are the same, and the culturing conditions comprise an initial body length index, a weight growth index, the water quality of a culturing water body, culturing density and feed; measuring the growth character phenotype after the adult shrimps grow, wherein the phenotype is body length, body weight, length of the head, the chest and the nails, width of the head, the chest and the nails and abdomen length; collecting the corresponding genomic DNA of the procambarus clarkii;
(2) selecting an SSR marker with polymorphism developed according to procambarus clarkia genome sequencing data, designing a primer to amplify a target fragment, and detecting whether the target fragment is amplified by using agarose electrophoresis;
the PCR detection conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s; annealing at 58 ℃ for 30 s; extension at 72 ℃ for 30 s; after 35 cycles, re-extension at 72 ℃ for 7 min; storing at 4 deg.C;
(3) carrying out electrophoresis on the amplified PCR product by using 4% polyacrylamide gel, dyeing by using 0.2% silver nitrate solution after the electrophoresis is finished, developing, rinsing and airing by using 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution, and carrying out genotype statistical analysis on the population in the step (1);
(4) carrying out correlation analysis on the growth trait phenotype of the individuals in the population in the step (1) in combination with the corresponding marker genotype in the step (3), and separating the individuals in the population according to male and female sex and respectively carrying out correlation analysis; identifying molecular markers which are associated with the growth trait phenotype and can be repeatedly detected by using a one-factor analysis of variance method, and determining the dominant genotype;
(5) integrating the genotypes obtained in the step (3), dividing the genotypes into two types according to homozygote and heterozygote, and then performing correlation analysis according to the method in the step (4) to identify the molecular marker which can be repeated among the groups and has heterosis.
3. The application of the SSR molecular marker primers related to the growth traits of the procambarus clarkia in the assisted breeding of the excellent strains of the procambarus clarkia is characterized in that the method further comprises the following steps:
(1) respectively screening out small individual groups and large individual groups which account for 10 percent of the population number from natural random populations according to the weight and length;
(2) and performing comparative analysis by combining SSR markers with group repeatability and dominant genotypes of the SSR markers, and comparing the dominant genotypes of the small individual group and the large individual group, wherein the dominant genotype proportion of the large individual group is much larger than that of the small individual group, and the dominant genotype proportion corresponds to the difference of the weight and length traits of the small individual group and the large individual group.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111680733.0A CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111680733.0A CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114292925A true CN114292925A (en) | 2022-04-08 |
| CN114292925B CN114292925B (en) | 2023-05-12 |
Family
ID=80975216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111680733.0A Active CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114292925B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114959056A (en) * | 2022-05-13 | 2022-08-30 | 华中农业大学 | SSR marker for identifying female procambarus clarkii and application thereof |
| CN116042843A (en) * | 2022-09-26 | 2023-05-02 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667272A (en) * | 2013-12-04 | 2014-03-26 | 天津市水生动物疫病预防控制中心 | Eriocheir-sinensis-growth-trait-related EST (expressed sequence tag)-SSR (simple sequence repeat) molecular marker and application thereof |
| CN108179200A (en) * | 2018-03-06 | 2018-06-19 | 中国水产科学研究院淡水渔业研究中心 | A kind of microsatellite marker and application with the Procambius clarkii prolificacy linkage of characters |
-
2021
- 2021-12-30 CN CN202111680733.0A patent/CN114292925B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667272A (en) * | 2013-12-04 | 2014-03-26 | 天津市水生动物疫病预防控制中心 | Eriocheir-sinensis-growth-trait-related EST (expressed sequence tag)-SSR (simple sequence repeat) molecular marker and application thereof |
| CN108179200A (en) * | 2018-03-06 | 2018-06-19 | 中国水产科学研究院淡水渔业研究中心 | A kind of microsatellite marker and application with the Procambius clarkii prolificacy linkage of characters |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114959056A (en) * | 2022-05-13 | 2022-08-30 | 华中农业大学 | SSR marker for identifying female procambarus clarkii and application thereof |
| CN114959056B (en) * | 2022-05-13 | 2024-05-17 | 华中农业大学 | SSR (simple sequence repeat) marker for identifying female procambarus clarkia and application thereof |
| CN116042843A (en) * | 2022-09-26 | 2023-05-02 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
| CN116042843B (en) * | 2022-09-26 | 2024-05-24 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114292925B (en) | 2023-05-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nelson et al. | The first gene-based map of Lupinus angustifolius L.-location of domestication genes and conserved synteny with Medicago truncatula | |
| CN107988420B (en) | Molecular marker of maize male nuclear sterility gene ms39 and application thereof | |
| CN114480709B (en) | Molecular marker for detecting wheat leaf rust resistance gene Lr47, detection method and application thereof | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN113637789A (en) | Wheat stripe rust resistant gene YRTD121 linked KASP molecular marker, primer, kit and application | |
| CN114292925A (en) | SSR molecular marker primer related to growth traits of procambarus clarkii and application of SSR molecular marker primer in auxiliary selection | |
| CN109913582B (en) | Molecular marker closely linked with rice blast resistance gene and application thereof | |
| CN108546777B (en) | SNP molecular marker for detecting clubroot resistance of non-heading Chinese cabbages and application thereof | |
| CN112011637B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene Pm68 and application thereof | |
| EP2486155A1 (en) | Methods of quantifying target organisms and creating reniform resistant cotton plants | |
| CN109762928B (en) | Molecular marker related to melon vine length and application of molecular marker in identification of melon vine length characters | |
| CN108085404B (en) | Strong female-like molecular marker of pumpkin indicum and primer pair for identifying strong female-like character of pumpkin indicum | |
| CN111778354B (en) | Molecular marker closely linked with photosensitive male sterility character of cotton PSM4, molecular identification method and application | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN111996275B (en) | Molecular marker RMD16 for assisting in identifying powdery mildew resistance of soybean to be detected | |
| CN109913580B (en) | Application of molecular marker closely linked with rice blast resistance gene | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN117248061B (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
| WO2015066832A1 (en) | Maize rough dwarf disease resistance-related major quantitative trait locus and use thereof | |
| CN108866235B (en) | InDel molecular marker for identifying or assisting in identifying cabbage hybridization affinity and application thereof | |
| CN109913581B (en) | Preparation method of molecular marker closely linked with rice blast resistance gene | |
| CN117230240B (en) | InDel locus related to soybean seed oil content, molecular marker, primer and application thereof | |
| Malik | Molecular genetic characterization of wheat curl mite, Aceria tosichella Keifer (Acari: Eriophyidae), and wheat genes conferring wheat curl mite resistance | |
| CN112011635B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmDGM and application thereof | |
| CN108085407B (en) | SSR marker closely linked with recessive cotton bud yellow gene v1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |