CN114292925B - SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection - Google Patents
SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection Download PDFInfo
- Publication number
- CN114292925B CN114292925B CN202111680733.0A CN202111680733A CN114292925B CN 114292925 B CN114292925 B CN 114292925B CN 202111680733 A CN202111680733 A CN 202111680733A CN 114292925 B CN114292925 B CN 114292925B
- Authority
- CN
- China
- Prior art keywords
- procambarus
- pcm
- primer
- growth
- procambarus clarkia
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of animal molecular marker screening and application. In particular to SSR molecular marker primers related to procambarus clarkia growth traits and application thereof in auxiliary selection. The invention is characterized in that: the method comprises the steps of carrying out PCR amplification on an acquired sample by utilizing SSR markers to obtain a target fragment through two isotactic cell populations and a natural random population genome DNA and a growth character phenotype of procambarus clarkia, detecting whether the target fragment is amplified through agarose gel electrophoresis, detecting the genotype of a PCR product by utilizing polyacrylamide gel electrophoresis, carrying out correlation analysis on the genotype and the growth character phenotype of procambarus clarkia, and identifying a QTL locus correlated with the growth character. The dominant genotype of SSR markers is screened to assist in breeding procambarus clarkia strains with excellent growth traits.
Description
Technical Field
The invention belongs to the technical field of animal molecular marker screening and application. In particular to SSR molecular marker primers related to procambarus clarkia growth traits and application thereof in auxiliary selection.
Background
Procambarus clarkia (Procambarus clakii), commonly known as crayfish, belongs to the phylum Arthropoda (Arthropoda), class Crustaceae (Crustaceae), decapoda (Decapoda), family Cambaridae (Cambaraceae), genus Procambarus (Procambarus). Procambarus clarkia is native to the south of the united states and north mexico (Hobbs 1974) and has spread throughout the world. It is reported that this species gradually spread to large water systems in China after being introduced into Nanjing area in 1929 from Japan (Xie et al 2001). In view of their edibility and economic value, large-scale artificial breeding of procambarus clarkii has been carried out in succession in Hubei, hunan, jiangsu, anhui and a plurality of provinces at present.
At present, with the rapid expansion of the culture scale of procambarus clarkia, the lack of good varieties, the germplasm degeneration of procambarus clarkia caused by a self-propagating and self-breeding germchit breeding mode of a farmer, and is specifically expressed as follows: the individual is smaller, the size and specification are different, and the problems of poor disease resistance and the like are prominent. The size of the adult shrimp is a key economic trait, and growth is a quantitative trait controlled by multiple genes, namely Quantitative Trait Loci (QTLs). Molecular breeding accelerates the breeding process by using genetic markers that allow growth traits to be quantified faster, shortening the breeding years, and improving breeding efficiency, as compared to traditional selective breeding, which focuses on selecting individuals with desirable traits. However, the genetic basic research of procambarus clarkia is relatively lagged, and a molecular breeding system is not established yet. Therefore, the collection and establishment of procambarus clarkia germplasm resource library is urgently needed, and the genetic basis of procambarus clarkia economic characters is analyzed, so that the foundation is laid for procambarus clarkia molecular breeding. Simple repeat markers (simple sequence repeats, SSR) are widely used in genetic diversity analysis, genetic map construction, QTL localization and the like studies because of their abundance, high polymorphism, universal distribution throughout the genome, co-dominant inheritance, ease of Polymerase Chain Reaction (PCR) detection, ease of repetition, etc. (Kuleung et al 2004).
The SSR marker can be used for genetic diversity analysis of procambarus clarkia population, and QTL positioning is carried out by combining an isotactic family with a growth character phenotype, so that gene resources and functional markers are provided for procambarus clarkia molecular breeding.
There have been reports on papers on the development of SSR markers for procambarus clarkia Guan Keshi (see Sun et al, 2021), but only 50 primer sequences are shown in the papers, only one primer sequence overlapping with 11 primer sequences in the application is reported, namely the PCM 806 primer sequence is reported, and no other primer sequences are reported. Meanwhile, the content related to the growth traits is not reported.
Disclosure of Invention
The invention aims to overcome the defects of the prior art, a batch of SSR molecular marker primers related to the growth traits of procambarus clarkia are obtained by screening, and the marker primers are used for carrying out auxiliary selection of procambarus clarkia strains. The invention overcomes the difficulties of long traditional selection breeding period and poor genetic stability of procambarus clarkia, utilizes SSR markers, isotactic population and natural random population, and utilizes correlation analysis to identify molecular marker primers related to growth traits so as to improve the efficiency of auxiliary selection.
The technical scheme of the invention is as follows:
SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection, wherein the method comprises the following steps:
(1) Two procambarus clarkia isotactic cell populations and a natural random population are constructed, wherein the number of each population is more than 120, and the male-female ratio is about 1:1. the isotactic cell population is cultured in a single cage in an indoor running water culture system, and the natural random population is cultured in a single cage in a pond cage, as shown in figure 1 in the legend. The culture conditions among individuals in the same group are identical, and the culture conditions comprise growth indexes such as initial body length, body weight and the like, culture water quality, culture density, feed supply and the like. After growing into shrimps, the growth phenotype (body length, body weight, head and chest nail length, head and chest nail width, abdomen length) is measured, and the genomic DNA corresponding to each shrimp is collected.
(2) According to the procambarus clarkia genome sequencing data, designing a primer to amplify a target fragment, and detecting whether the target fragment is amplified by agarose electrophoresis. PCR detection conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s; annealing at 58 ℃ for 30s; extending at 72 ℃ for 30s; after 35 cycles, the extension was carried out for a further 7min at 72 ℃; preserving at 4 ℃.
(3) Electrophoresis is carried out on the amplified PCR products by using 4% polyacrylamide gel (PAGE gel), after electrophoresis is finished, 0.2% silver nitrate solution is used for dyeing, then 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution is used for developing, rinsing and airing, and genotype statistical analysis is carried out on the population in the step (1);
(4) Performing association analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individual growth trait phenotypes in the step (3). Because of the difference of the male and female growth of the procambarus clarkii, the individuals in the group are respectively subjected to association analysis according to the male and female separation. Molecular markers associated with the growth trait phenotype and which are reproducibly detectable (P < 0.05) were identified using one-way analysis of variance and dominant genotypes were determined.
(5) Integrating the genotypes obtained in the step (3), classifying the genotypes into two types according to homozygotes and heterozygotes, and then carrying out association analysis according to the step (4), thereby identifying the molecular marker (P < 0.05) with the repeatable heterosis among the populations.
The invention mainly solves the following technical problems:
with the rapid expansion of the culture scale of procambarus clarkia, the lack of good varieties, and the germplasm degeneration of procambarus clarkia caused by the self-propagation and self-breeding seedling breeding mode of farmers. Cultivating varieties with good growth traits is critical to solving this problem. The traditional selective breeding has long period and poor genetic stability, so that molecular markers related to growth traits are developed, and the molecular markers are used for assisting in breeding populations with excellent growth traits, so that the breeding efficiency can be accelerated.
The invention has the following advantages:
(1) The molecular marker disclosed by the invention is convenient to use, and procambarus clarkia populations with excellent growth characteristics can be rapidly screened out.
(2) The molecular marker provided by the invention has high repeatability in different populations of procambarus clarkia.
(3) The procambarus clarkia genotype identified by the invention corresponds to excellent growth characters, and has remarkable effect.
Drawings
Fig. 1: a procambarus clarkia culture system. FIG. 1A is a schematic diagram of a single cage culture system for indoor procambarus clarkii; FIG. 1B is a schematic diagram of a single cage culture system for Procambarus clarkii pond cage culture.
Fig. 2: schematic representation of SSR site polymorphism of procambarus clarkia.
Fig. 3: and comparing and analyzing genotypes and phenotypes of large and small individuals in the natural random procambarus clarkii population. Panel A in FIG. 3 is a comparison of dominant genotypes of the SSR markers of procambarus clarkia; panel B of FIG. 3 is a comparative analysis of body weight and body length of a large and small population of procambarus clarkia; panel C of FIG. 3 is a comparative analysis of the dominant genotype fractions of a large and small population of procambarus clarkia.
Detailed Description
Example 1 identification of SSR markers related to growth traits Using isotactic cell populations
(1) Selecting healthy and disease-free procambarus clarkia as a parent to carry out one-to-one male-female matching, forming an isotactic cell population of procambarus clarkia by using filial generation after fertilization and hatching, and selecting two isotactic cell populations to carry out growth trait QTL positioning, wherein the population numbers are 214 and 133 respectively, and the male-female sex ratio is about 1:1.
(2) After the hatching of the isotactic cell population is completed, the isotactic cell population is cultured in a single cage in an indoor running water culture system, as shown in a diagram A in fig. 1, and the number on the cage represents the number of procambarus clarkia. The culture conditions among individuals in the same group are identical, and the culture conditions comprise growth indexes such as initial body length, body weight and the like, culture water quality, culture density, feed supply and the like. The growth trait phenotype (body length, body weight, head and chest nail length, head and chest nail width, abdomen length) was measured starting at the time when the young shrimp body was 3cm long, and the growth trait phenotype was measured every half month until after shrimp formation and the genomic DNA corresponding to each shrimp was collected.
(3) SSR marker 300 pairs (Sun et al, 2021) with polymorphism developed according to procambarus clarkia genome sequencing data are selected, primers are designed to amplify target fragments, and the primer sequences are shown in table 1. And detecting whether the target fragment is amplified by agarose electrophoresis. PCR detection conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s; annealing at 58 ℃ for 30s; extending at 72 ℃ for 30s; after 35 cycles, the extension was carried out for a further 7min at 72 ℃; preserving at 4 ℃. (4) Electrophoresis is carried out on the amplified PCR products by using 4% polyacrylamide gel (PAGE gel), after electrophoresis is finished, 0.2% silver nitrate solution is used for dyeing, then 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution is used for developing, rinsing and airing, and genotype statistical analysis is carried out on the population in the step (1);
(5) Performing association analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individual growth trait phenotypes in the step (3). Because of the difference of the male and female growth of the procambarus clarkii, the individuals in the group are respectively subjected to association analysis according to the male and female separation. Molecular markers (P < 0.05) associated with the growth trait phenotype were identified using a one-way analysis of variance method and dominant genotypes were determined.
TABLE 1 molecular marker primer sequences for screening according to the present invention
(6) Integrating the genotypes obtained in the step (4), dividing the genotypes into two types according to homozygotes and heterozygotes, and performing association analysis according to the method of the step (4) to identify the molecular marker primer combination with heterosis (P is less than 0.05).
Example 2: identification of SSR markers related to growth traits using natural random populations
(1) Randomly selecting natural random populations of healthy and disease-free procambarus clarkia larvae with complete body size and body length of about 4cm from a pond to perform growth trait QTL positioning, wherein the population number is 138, and the male-female ratio is about 1:1.
(2) The natural random population is cultured in a single net cage in a pond net cage, and the net cage can be numbered to represent the number of the shrimp as shown in figure 1B in the legend. The culture conditions among individuals in the same group are identical, and the culture conditions comprise growth indexes such as initial body length, body weight and the like, culture water quality, culture density, feed supply and the like. The growth trait phenotype (body length, body weight, head and chest nail length, head and chest nail width, abdomen length) was measured after one month of young shrimp culture, and the growth trait phenotype was measured again after two months of culture until the shrimp were grown and genomic DNA corresponding to each shrimp was collected.
(3) SSR marker 300 pairs (Sun et al 2021) with polymorphism developed according to procambarus clarkia genome sequencing data are selected, primers are designed to amplify target fragments, the primer sequences are shown in table 1, and agarose electrophoresis is used for detecting whether the target fragments are amplified. PCR detection conditions were: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s; annealing at 58 ℃ for 30s; extending at 72 ℃ for 30s; after 35 cycles, the extension was carried out for a further 7min at 72 ℃; preserving at 4 ℃.
(4) Electrophoresis is carried out on the amplified PCR products by using 4% polyacrylamide gel (PAGE gel), after electrophoresis is finished, the amplified PCR products are dyed by using 0.2% silver nitrate solution, and then developed, rinsed and dried by using 0.5M sodium hydroxide solution containing 0.5% formaldehyde solution, and the colony in the step (1) is carried out.
(5) Performing association analysis on the individual growth trait phenotypes in the population in the step (1) and the marker genotypes corresponding to the individual growth trait phenotypes in the step (3). Because of the difference of the male and female growth of the procambarus clarkii, the individuals in the group are respectively subjected to association analysis according to the male and female separation. Molecular markers (P < 0.05) associated with the growth trait phenotype were identified using a one-way analysis of variance method and dominant genotypes were determined.
(6) Integrating the genotypes obtained in the step (4), classifying the genotypes into two types according to homozygotes and heterozygotes, and performing association analysis according to the step (4) to identify the molecular marker with heterosis (P is less than 0.05).
Example 3: integration of SSR markers and dominant genotypes associated with growth traits in two isotactic populations and one naturally random population
And integrating SSR markers and dominant genotypes related to growth traits identified by two isotactic cell populations and one natural random population, and further confirming the SSR markers and dominant genotypes with population repeatability.
(1) The SSR markers and dominant genotypes associated with growth traits identified by two isotactic and naturally random populations were integrated, and the elimination of the SSR markers without reproducibility left only reproducible and dominant genotype identical between populations, results are shown in table 2.
TABLE 2 SSR sites related to Procambrus clarkii growth traits
Remarks of table 1: var, the variability is explained.
(2) Screening out Small individual groups (Small groups) and large individual groups (Big groups) accounting for 10% of the population number from natural random populations according to the weight and body length sequences respectively, and carrying out comparison analysis by combining the SSR markers with population repeatability and dominant genotypes integrated in the step (1), wherein the comparison analysis is shown as a diagram in figure 3. The body weight and body length of the small and large population are compared as shown in panel B of fig. 3, and the dominant genotype ratio of the small and large population is shown in panel C of fig. 3.
(3) The dominant genotypes of the small and large groups can be compared, and the dominant genotypes of the large group can be found to be larger than that of the small group, and correspond to the weight and length differences of the small and large groups.
Sequence listing
<110> university of agriculture in China
<120> SSR molecular marker primer for procambarus clarkia growth trait and application thereof in auxiliary selection
<141> 2021-12-30
<160> 22
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 1
<210> 2
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 3
<210> 4
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 4
<210> 5
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 5
<210> 6
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 6
<210> 7
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 7
<210> 8
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 8
<210> 9
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 9
<210> 10
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 10
<210> 11
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 11
<210> 12
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 12
<210> 13
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 13
ccctcgctcc ctctcttatc 20
<210> 14
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 14
<210> 15
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 15
<210> 16
<211> 23
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(23)
<400> 16
tgaacgtgat agtgatgatg att 23
<210> 17
<211> 22
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 17
tgcttggtgt aaatgacagg ag 22
<210> 18
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 18
<210> 19
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 19
<210> 20
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 20
<210> 21
<211> 20
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(20)
<400> 21
<210> 22
<211> 22
<212> DNA
<213> Procambarus Clarkii (Procambarus clakii)
<220>
<221> primer_bind
<222> (1)..(22)
<400> 22
ccaagacata aaaatcccac ca 22
Claims (2)
1. SSR molecular marker primer for assisting in screening of body length, body weight, head and chest length, head and chest width and abdomen length characters of procambarus clarkia, wherein the nucleotide sequence of the molecular marker primer is as follows:
PCM 2858 forward primer (5 '-3'): CTGCCTTGGGTCCTCACTAA the number of the individual pieces of the plastic,
PCM 2858 reverse primer (5 '-3'): CATCTGACCACCACCAGCTA;
PCM 2799 forward primer (5 '-3'): TCTAGTAGGCCGGGCATAAG the number of the individual pieces of the plastic,
PCM 2799 reverse primer (5 '-3'): CCACCACACTTTGGATTCAT;
PCM 2813 forward primer (5 '-3'): TGGACTTGAGGACCATTCAA the number of the individual pieces of the plastic,
PCM 2813 reverse primer (5 '-3'): GAGTTGCTGAAGCAAAATCG;
PCM 924 forward primer (5 '-3'): AACCCCTTTTCATCGTTCCT the number of the individual pieces of the plastic,
PCM 924 reverse primer (5 '-3'): GGTAAGGAAAGACGGGGAAT;
PCM 2737 forward primer (5 '-3'): ACGTCTCTTGGTCCCTTGTG the number of the individual pieces of the plastic,
PCM 2737 reverse primer (5 '-3'): TGTTTGCATACGGCAAAGTT;
PCM 2578 forward primer (5 '-3'): CCTCTTCCTGTTTCCCCTCT the number of the individual pieces of the plastic,
PCM 2578 reverse primer (5 '-3'): TGACCAATTACGCAGTGAGG;
PCM 2092 forward primer (5 '-3'): CCCTCGCTCCCTCTCTTATC the number of the individual pieces of the plastic,
PCM 2092 reverse primer (5 '-3'): TGGGTAACCCGACCTGTCTA;
PCM 806 forward primer (5 '-3'): GCTCTCCAATCTTTGCTGGA the number of the individual pieces of the plastic,
PCM 806 reverse primer (5 '-3'): TGAACGTGATAGTGATGATGATT;
PCM 281 forward primer (5 '-3'): TGCTTGGTGTAAATGACAGGAG the number of the individual pieces of the plastic,
PCM 281 reverse primer (5 '-3'): GCCCTCTAGGTCGTGTCAAG;
PCM 821 forward primer (5 '-3'): CCGGACATGTACCGTGATCT the number of the individual pieces of the plastic,
PCM 821 reverse primer (5 '-3'): CGCACCAGATGATGAGAGTG;
PCM 2347 forward primer (5 '-3'): GCTGGGAAGAAATCCCAAAT the number of the individual pieces of the plastic,
PCM 2347 reverse primer (5 '-3'): CCAAGACATAAAAATCCCACCA.
2. The use of the SSR molecular marker primer of claim 1 in the auxiliary screening of procambarus clarkia body length, body weight, head chest length, head chest width and abdomen length traits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111680733.0A CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111680733.0A CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114292925A CN114292925A (en) | 2022-04-08 |
| CN114292925B true CN114292925B (en) | 2023-05-12 |
Family
ID=80975216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111680733.0A Active CN114292925B (en) | 2021-12-30 | 2021-12-30 | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114292925B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114959056B (en) * | 2022-05-13 | 2024-05-17 | 华中农业大学 | SSR (simple sequence repeat) marker for identifying female procambarus clarkia and application thereof |
| CN116042843B (en) * | 2022-09-26 | 2024-05-24 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667272B (en) * | 2013-12-04 | 2015-08-12 | 天津市水生动物疫病预防控制中心 | The EST-SSR molecule marker relevant to mitten crab growth traits and application |
| CN108179200B (en) * | 2018-03-06 | 2021-08-17 | 中国水产科学研究院淡水渔业研究中心 | Microsatellite marker linked with procambarus clarkii high fertility character and application thereof |
-
2021
- 2021-12-30 CN CN202111680733.0A patent/CN114292925B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114292925A (en) | 2022-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114292925B (en) | SSR molecular marker primer related to procambarus clarkia growth traits and application thereof in auxiliary selection | |
| CN113502333B (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| CN107988420B (en) | Molecular marker of maize male nuclear sterility gene ms39 and application thereof | |
| CN113151553B (en) | Molecular marker coseparated with watermelon plant few lateral branch gene Clbl and application | |
| CN107557362A (en) | A kind of authentication method of masson pine cpSSR polymorphism primers and its pine tree sibling species | |
| CN108179200B (en) | Microsatellite marker linked with procambarus clarkii high fertility character and application thereof | |
| CN102140506B (en) | Molecular marker linked with gummy stem blight resistance gene Gsb-2 and application thereof | |
| CN106609298A (en) | Set of reagents used for identification or assistant identification of cucurbita maxima vine length characters, and cucurbita maxima vine length molecular markers | |
| CN109913582B (en) | Molecular marker closely linked with rice blast resistance gene and application thereof | |
| KR101014238B1 (en) | A seed purity checking method for F1 hybrid of Citrullus lanatus | |
| CN105063201A (en) | Molecular marker of corn chromosome 9 ear row number major QTL and application thereof | |
| CN107849566A (en) | For detecting the method and kit of powdery mildew | |
| CN108085404B (en) | Strong female-like molecular marker of pumpkin indicum and primer pair for identifying strong female-like character of pumpkin indicum | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN111778354B (en) | Molecular marker closely linked with photosensitive male sterility character of cotton PSM4, molecular identification method and application | |
| CN114875168A (en) | InDel marker for identifying existence of granuloma on surface of bitter gourd fruit as well as detection primer and application thereof | |
| CN112575101B (en) | Molecular marker related to resistance of Cucurbita pepo PRSV-W virus disease and application thereof | |
| CN109913580B (en) | Application of molecular marker closely linked with rice blast resistance gene | |
| CN103243162A (en) | Method and kit for identifying onion cytoplasm fertility | |
| CN108384886B (en) | Detection primer group and kit for alfalfa bean SSR marker, application of detection primer group and kit and screening method for alfalfa bean self-compatibility genotype | |
| CN113981103A (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method | |
| CN108411026A (en) | A kind of method of chrysanthemum support sweet osmanthus type molecular marker assisted selection | |
| Saini et al. | Validation and cross-species transferability of SSR markers developed from whole genome sequence (WGS) of Mungbean (Vigna radiata L. Wilczek) and their application of population genetics in Vigna species | |
| CN111057786B (en) | SNP marker closely linked with cucumber seed pre-harvest germination resistance character and application thereof | |
| CN108085407B (en) | SSR marker closely linked with recessive cotton bud yellow gene v1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |