CN113981103A - Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method - Google Patents
Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method Download PDFInfo
- Publication number
- CN113981103A CN113981103A CN202111110152.3A CN202111110152A CN113981103A CN 113981103 A CN113981103 A CN 113981103A CN 202111110152 A CN202111110152 A CN 202111110152A CN 113981103 A CN113981103 A CN 113981103A
- Authority
- CN
- China
- Prior art keywords
- microsatellite
- identification
- parents
- macrobrachium rosenbergii
- taking
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a microsatellite primer for identifying macrobrachium rosenbergii microsatellite parents, a detection kit and an identification method; the 5' end of the forward primer of the microsatellite primer pair is modified by a fluorescent group, and the method firstly extracts DNA from different individuals to be identified respectively; carrying out PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product; detecting the fluorescent marked amplification product on an ABI3730XL genetic typing instrument, taking GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and filial generations by using CERVUS 3.0 software, determining the parents and the parents of each filial generation, and comparing with the known actual genetic relationship to judge the paternity identification success rate. The microsatellite locus of the invention has high polymorphism, and can obtain better identification effect in the parent-child identification of the macrobrachium rosenbergii by utilizing a few loci.
Description
Technical Field
The invention relates to the field of animal molecular genetics, in particular to a microsatellite primer for identifying macrobrachium rosenbergii microsatellite parents, a detection kit and an identification method.
Background
Macrobrachium rosenbergii (Macrobrachium rosenbergii), also known as Macrobrachium malabaricum, Macrobrachium nipponensis, is classified as Arthropoda, Crustacea, Decapoda, Natanisia, Panlaemonidae, Macrobrachium, is a species of the river-tracing organism, native to southeast Asia, widely distributed in the tropical and subtropical regions. Macrobrachium rosenbergii is introduced into China for the first time in 1976, and is widely cultivated in more than ten provinces and cities such as Guangdong, Zhejiang and Jiangsu due to the advantages of large individual, wide eating habits, quick growth, high nutritional value and the like. At present, the culture yield of China accounts for more than half of the world, and the China has become the world with the highest culture yield of macrobrachium rosenbergii. However, under the artificial breeding model, the germplasm resources are more and more seriously degraded due to long-term inbreeding and small-population inbreeding, and the method mainly shows that the growth speed is slowed down, individuals tend to be miniaturized, the sexual maturity is advanced, the reproduction rate is reduced and the diseases are increased. Therefore, in order to promote the sustainable development of the macrobrachium rosenbergii breeding industry, the development of the fine breed breeding work is one of the urgent works.
In the process of breeding aquatic animals, clear pedigree information is important for the research of genetic parameters and the breeding of families. The macrobrachium rosenbergii has a special and complex natural mating and breeding mode, and the processes of sexual encounter and identification, male shrimp occupation, female shrimp shelling, mating, female shrimp spawning, spawning and hatching and the like can be carried out in the period, so that the establishment of the macrobrachium rosenbergii holomorphic family is different from other aquatic animals capable of carrying out artificial breeding and only depends on paternity test or single hermaphrodite pairing with low efficiency. In addition, in the traditional macrobrachium rosenbergii breeding work, in order to distinguish the offspring of different families, the aim of distinguishing after polyculture is generally achieved by injecting physical markers such as visible embedded fluorescent markers and the like at the tail part before polyculture, but the method can be implemented only when the macrobrachium rosenbergii grows to a larva stage, physical damage can be caused to the larva in the implementation process, and the phenomenon of individual death often occurs after the markers are used. Crustaceans also undergo multiple molting during their growth, resulting in the disappearance of the physical markers of individual individuals with molting. Research shows that genealogical errors caused by individual label falling, fluorescent label drifting, human errors and the like occur in animal and plant populations, the probability is about 10%, and the genetic parameter prediction based on family breeding has errors due to the errors. Based on the above problems, how to maintain accurate pedigree information in the breeding process becomes one of the main difficulties faced by the macrobrachium rosenbergii breeding work.
Paternity testing (component Identification), or genetic relationship testing, is a technique that uses molecular markers to determine whether a progeny is related to a parent before the progeny and the parent based on molecular genetics theory. Can provide complete and accurate pedigree information for modern animal pedigree breeding and comprehensive breeding. Meanwhile, the establishment of the technology can allow aquatic animals to realize mixed culture of families in the early hatching period, so that the influence of environmental factors caused by independent culture is reduced, and the evaluation of the growth performance, the hybridization advantages and the genetic parameters of the families is more accurate. At present, the paternity test of aquatic animals mainly adopts a microsatellite (SSR) molecular marker, and the microsatellite marker is widely applied to paternity test and population genetic diversity analysis of aquatic animals such as megalobrama amblycephala, grass carp, yellow perch, grouper and the like due to the advantages of wide distribution, co-dominance, high polymorphism, low requirement on the quality of DNA samples and the like. At present, the research of applying microsatellite markers to parent-child identification of macrobrachium rosenbergii is only found in the reconstruction of family genetic relationship by utilizing two-base repeated microsatellite loci carried out by Karaket and the like, but after the amplification effect detection is carried out on primer pairs in the research, serious shadow bands exist, the existence of the shadow bands can cause errors to the typing result to a certain extent, and in addition, different microsatellite primer pairs are combined in different groups to have different identification effects due to population differentiation. Therefore, the construction of a paternity test system consisting of microsatellite loci with three or more bases which are stable in amplification and highly polymorphic has important significance for genetic breeding of the macrobrachium rosenbergii.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a microsatellite primer for identifying macrobrachium rosenbergii microsatellite parents, a detection kit and an identification method. The invention utilizes the fluorescence labeling primer of the highly polymorphic microsatellite locus and capillary electrophoresis typing to identify families, establishes an effective paternity test system for the molecular marker-assisted breeding of the macrobrachium rosenbergii, and thus provides a meaningful molecular technology for the fine breed breeding work of the macrobrachium rosenbergii.
In order to achieve the purpose, the invention designs a microsatellite primer group for parent-child identification of macrobrachium rosenbergii microsatellites, wherein the 5' end of a forward primer of a microsatellite primer pair is modified by a fluorescent group, and the microsatellite primer pair comprises the following components:
| MRO1 | F: | cgaaaaagttgaagcaccgt | R: | Actgcaacacgctacatggt |
| MRO4 | F: | ctgcaaagctgtatgtgcgt | R: | tgaccaggaacgacattttg |
| MRO5 | F: | agcggaggtccctaggaata | R: | gccattcttttcaataagacctgt |
| MRO7 | F: | gtgaggtgcactgacggc | R: | gacaaggaggacggtgacag |
| MRO9 | F: | gaagaaggtacgaacgcat | R: | gtgagccgccttattccttt |
| MRO12 | F: | ccacgaatgccatagttcct | R: | tcgcgacctagacctatgct |
| MRO16 | F: | actgttctccccgatgagc | R: | tccagggctattttgactgg |
| MRO17 | F: | cgtccaagcctatgggacta | R: | gatgctggtgatgatgatgc |
| Mr-70 | F: | catcagcatttggcagtc | R: | cattggagcccttgaact |
| 51708 | F: | gtgagatctccacgcccaaa | R: | tcagcgcattcagtcggttt |
further, the fluorescent group is selected from FAM (blue), HEX (green), TAMRA (black), ROX (red).
The invention also provides a detection kit for parent-child microsatellite identification of macrobrachium rosenbergii, which comprises the microsatellite primer pair in claim 1.
Further, the detection kit also comprises cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2 x Premix Taq, ddH2O; wherein the 2 × Premix Taq mainly comprises 0.05U/. mu.L Taq DNA polymerase and 3mM Mg2+And 0.4mM dNTPs
Still further, the cell lysate comprises the following components: Tris-HCL 100mM, pH8.0; EDTA 50mM, pH 8.0; SDS 1%, pH 8.0; NaCl 125 mM.
The invention also provides a method for identifying macrobrachium rosenbergii microsatellite paternity by using the kit, which comprises the following steps:
1) respectively extracting DNA from different individuals to be identified;
2) carrying out PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product;
3) detecting the fluorescence-labeled amplification product on an ABI3730XL genetic typing instrument, taking a primer GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and filial generations by using CERVUS 3.0 software, determining the parents and the parents of each filial generation, and comparing the parents and the parents with the known actual genetic relationship to judge the paternity and paternity test success rate.
The method for extracting DNA as a preferred embodiment is as follows:
1) taking 100mg of sample, sucking dry ethanol by using filter paper, placing the sample in a 2mL centrifuge tube, adding 600mL of cell lysate, shearing the tissue by using scissors, adding 6 mu L of proteinase K (20mg/L) into each tube, uniformly mixing, placing the tube in a 65 ℃ water bath for 2-4h, and turning the centrifuge tube upside down every 30min until the tissue is completely cracked;
2) taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, fully shaking up, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernatant into a new 1.5mL centrifuge tube, then centrifuging at 12000rpm at 4 ℃ for 10min again, taking 500 mu L of supernatant into a new 1.5mL centrifuge tube, adding equivalent (500mL) of isopropanol, shaking up and mixing uniformly, placing on ice for 1-2min, centrifuging at 12000rpm for 10min at 4 ℃, and discarding the supernatant;
3) adding 1mL of 70% ethanol, cleaning, centrifuging at 12000rpm at 4 ℃ for 10min, removing the supernatant, and cleaning again;
4) adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm at 4 ℃ for 5min, discarding the supernatant, reversing the centrifuge tube on filter paper, drying for 15-20min, and adding proper double distilled water for dissolving; after the concentration and the quality are detected, the solution is diluted to 100 ng/. mu.L and stored at the temperature of minus 20 ℃ for later use.
Preferably, in the step 2), the PCR reaction system is: total volume 12.5 μ L: 2 XPremix Taq 6.25. mu.L, forward and reverse primers 0.5. mu.L each, DNA template 0.5. mu.L, ddH2O 4.75μL。
Preferably, in step 2), the PCR reaction procedure is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at a suitable annealing temperature for 30s, extension at 72 ℃ for 30s, and 35 cycles; finally, extension is carried out for 7min at 72 ℃ and temporary storage is carried out at 4 ℃.
The invention has the beneficial effects that:
1) the microsatellite loci developed and screened by the invention have high polymorphism, and a good identification effect can be obtained in the parent-child identification of the macrobrachium rosenbergii by utilizing a few loci.
2) The invention utilizes different fluorescent group modified primers, can mix different fluorescent modified sites and then carry out the detection on the machine, thereby greatly reducing the detection cost.
3) The invention allows mixed culture of different families in early stage, reduces the cost of single culture of families and the environmental influence caused by single culture, and ensures that the breeding result is more accurate and reliable.
Drawings
FIG. 1 is a diagram of the polypropylene gel electrophoresis of the partial sites in example 1, each site was amplified by PCR using the whole genome DNA of 8 individuals as a template.
FIG. 2 genotyping Panel of part of the loci in example 3, the progeny having two alleles from the male and female parent, respectively, according to Mendelian's law of segregation.
Detailed Description
The invention is described in further detail below with reference to the figures and specific embodiments for the understanding of those skilled in the art.
Example 1 polymorphic microsatellite site selection
Selecting microsatellite locus synthesis primers with more than 150 repeated bases based on transcriptome data and published articles, amplifying in 8 wild individuals, selecting clear bands through agarose gel electrophoresis, using the primers with stable amplification for subsequent polymorphism detection, then selecting primers with the band number more than 3 as shown in figure 1 through polypropylene gel electrophoresis to synthesize fluorescent primers, wherein the 5' end of the forward primer of each primer is modified by FAM, HEX, TAMRA and ROX respectively, and common primers and fluorescent primers are synthesized by Wuhan Pongk biotechnology Limited.
The synthesized fluorescent primers are amplified in 32 individuals, the amplified products are detected on an ABI3730XL genetic typing instrument, the typing data after calibration are arranged in an excel table, then the observed heterozygosity, expected heterozygosity, polymorphism, average exclusion rate and accumulated exclusion rate (table 1) of each site are analyzed by Cervus software, finally 10 pairs of primers which are ranked in the top ten of the polymorphism are selected as paternity identification primers by comprehensively considering the accumulated exclusion rate and the identification cost, and the primer information is shown in table 2.
The PCR reaction system was 12.5. mu.L, and included 6.25. mu.L of Premix Taq (Takara Bio Inc, Dalian, China), 0.5. mu.L of forward and reverse primers (10. mu.m/L), and 0.5. mu.L of DNA template (100 ng. mu.L)-1) 4.75 μ L of double distilled water. The PCR reaction program is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, Ta annealing for 30s, and extension at 72 ℃ for 30s, and performing 35 cycles; after 72 ℃ extension for 7min, finally 4 ℃ storage.
TABLE 121 genetic information of candidate Macrobrachium rosenbergii microsatellite loci in 32 individuals
Note: ND means no test, NS means no significant deviation (P >0.05), x means significant deviation (P <0.01), and x means very significant deviation (P < 0.001).
TABLE 2 microsatellite primer information for paternity testing of Macrobrachium rosenbergii
Note: f is a forward primer, R is a reverse primer
Example 2
The kit comprises a microsatellite primer pair, cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2 x Premix Taq and ddH2O。
Wherein, the components of the cell lysate are as follows: Tris-HCl 100mM, pH 8.0; EDTA 50mM, pH 8.0; SDS 1%, pH 8.0; NaCl 125 mM.
The microsatellite primer pairs are as follows:
example 3
The method for identifying the microsatellite paternity of the macrobrachium rosenbergii by using the kit comprises the following steps:
1. establishment of macrobrachium rosenbergii whole-sib family
Selecting larger, healthy and disease-free male and female individuals with intact appendages, and selecting male and female individuals with a ratio of 1: 3, mating and developing each group of shrimps in a separate net cage to establish 30 families, and simultaneously cutting the appendages of each parent and storing the appendages in absolute ethyl alcohol for extracting DNA. And (3) breeding the offspring of the 30 families in a single barrel, selecting 30 larvae from each family when the daphnia larvae develop to the X stage, and storing the 30 larvae in absolute ethyl alcohol to be used as a paternity test sample.
2. Extraction of parental and progeny DNA
Taking 100mg of appendages of each parent and collected larvae of each parent, sucking dry ethanol by using filter paper, putting the parents and the collected larvae of each parent into a centrifuge tube of 2mL, adding 600mL of cell lysate (Tris-HCL 100mM, pH 8.0; EDTA 50mM, pH 8.0; SDS 1%, pH 8.0; NaCl 125mM), shearing tissues by using scissors, adding 6 mu L of proteinase K (20mg/L) into each tube, uniformly mixing, putting the tubes into a water bath kettle of 65 ℃ for water bath for 2-4h, and turning the centrifuge tube up and down every 30min until the tissues are completely lysed. Taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, fully shaking uniformly, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernate into a new 1.5mL centrifuge tube, then centrifuging at 12000rpm for 10min at 4 ℃, taking 500 mu L of supernate into a new 1.5mL centrifuge tube, adding equivalent (500mL) of isopropanol, shaking gently, mixing uniformly, placing on ice for 1-2min, centrifuging at 12000rpm for 10min at 4 ℃, and discarding the supernate. 1mL of 70% ethanol was added, washing was performed, centrifugation was performed at 12000rpm at 4 ℃ for 10min, and the supernatant was discarded, and the procedure was repeated. Adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm at 4 ℃ for 5min, discarding the supernatant, reversing the centrifuge tube on filter paper, drying for 15-20min, adding proper double-distilled water for dissolving, detecting the concentration and the quality, diluting to 100 ng/mu L, and storing at-20 ℃ for later use.
3. Microsatellite locus genotyping and paternity testing analysis
The selected 10 primers were PCR amplified in all samples, and the amplification products were detected on an ABI3730XL genotyping instrument using GS-500LIZ as an internal molecular weight standard and the fragment length at each site was read using GeneMapper 4.0 software. The allele frequency, expected heterozygosity, observed heterozygosity, polymorphic information content, mean exclusion probability, Hardy-Winberg equilibrium and null allele probability for each microsatellite locus were calculated using Cervus software (Table 3). Then, simulation analysis and genetic relationship analysis are sequentially carried out, and the parent pair of each filial generation is identified according to the LOD value.
4. Paternity test results
In the simulation analysis, 10000 offspring were generated by simulating 50 pairs of parents, and the probability of successful identification of the parents in the range of 80% and 95% confidence intervals can reach 100%. Of the 852 individuals of the 30 pedigrees actually identified, 827 individuals found parents that were consistent with the pedigree record and the genotypes of each locus in the parents and offspring followed mendelian segregation law, exemplified by loci MRO1, MRO4, MRO5, with the two alleles of the offspring being from the male and female parents, respectively (fig. 2). In addition, 12 cases did not find true male parent, 16 cases did not find true female parent, and 3 cases all had mismatches between the male parent and the female parent. Therefore, the probability of finding the true parents from the candidate parents is respectively 98.6 percent and 98.1 percent, the overall identification success rate is 97.1 percent, and the requirement of rebuilding the genetic breeding pedigree relationship can be met.
Table 310 microsatellite locus genetic diversity statistics and exclusion rates
Note: indicates a significant deviation of the poles (P <0.001)
Other parts not described in detail are prior art. Although the present invention has been described in detail with reference to the above embodiments, it is only a part of the embodiments of the present invention, not all of the embodiments, and other embodiments can be obtained without inventive step according to the embodiments, and the embodiments are within the scope of the present invention.
Sequence listing
<110> university of agriculture in Huazhong
<120> microsatellite primer for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 1
cgaaaaagtt gaagcaccgt 20
<210> 2
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 2
actgcaacac gctacatggt 20
<210> 3
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 3
ctgcaaagct gtatgtgcgt 20
<210> 4
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 4
tgaccaggaa cgacattttg 20
<210> 5
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 5
agcggaggtc cctaggaata 20
<210> 6
<211> 24
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 6
gccattcttt tcaataagac ctgt 24
<210> 7
<211> 18
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 7
gtgaggtgca ctgacggc 18
<210> 8
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 8
gacaaggagg acggtgacag 20
<210> 9
<211> 19
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 9
gaagaaggta cgaacgcat 19
<210> 10
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 10
gtgagccgcc ttattccttt 20
<210> 11
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 11
ccacgaatgc catagttcct 20
<210> 12
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 12
tcgcgaccta gacctatgct 20
<210> 13
<211> 19
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 13
actgttctcc ccgatgagc 19
<210> 14
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 14
tccagggcta ttttgactgg 20
<210> 15
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 15
cgtccaagcc tatgggacta 20
<210> 16
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 16
gatgctggtg atgatgatgc 20
<210> 17
<211> 18
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 17
catcagcatt tggcagtc 18
<210> 18
<211> 18
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 18
cattggagcc cttgaact 18
<210> 19
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 19
gtgagatctc cacgcccaaa 20
<210> 20
<211> 20
<212> DNA
<213> Synthetic sequence (Synthetic sequence)
<400> 20
tcagcgcatt cagtcggttt 20
Claims (9)
1. A microsatellite primer group for parent-child identification of macrobrachium rosenbergii microsatellites is characterized in that: the 5' end of the forward primer of the microsatellite primer pair is modified by a fluorescent group, and the microsatellite primer pair comprises the following components:
2. the microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites according to claim 1, which is characterized in that: the fluorescent group is selected from FAM, HEX, TAMRA and ROX.
3. A detection kit for microsatellite paternity test of macrobrachium rosenbergii is characterized in that: the detection kit comprises the microsatellite primer pair of claim 1.
4. The detection kit according to claim 3, characterized in that: the detection kit also comprises cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2 x Premix Taq and ddH2O, wherein the 2 XPremix Taq mainly comprises 0.05U/. mu.L Taq DNA polymerase and 3mM Mg2+、0.4mM dNTPs。
5. The detection kit according to claim 4, characterized in that: the components of the cell lysate are as follows: Tris-HCl 100mM, pH 8.0; EDTA 50mM, pH 8.0; SDS 1%, pH 8.0; NaCl 125 mM.
6. A method for identifying macrobrachium rosenbergii microsatellite paternity test by using the kit of claim 3, which is characterized by comprising the following steps: the method comprises the following steps:
1) respectively extracting DNA from different individuals to be identified;
2) carrying out PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product;
3) detecting the fluorescent marked amplification product on an ABI3730XL genetic typing instrument, taking GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and filial generations by using CERVUS 3.0 software, determining the parents and the parents of each filial generation, and comparing with the known actual genetic relationship to judge the paternity identification success rate.
7. The identification method according to claim 6, wherein: the method for extracting DNA comprises the following steps:
1) taking 100mg of sample, sucking dry ethanol by using filter paper, placing the sample in a 2mL centrifuge tube, adding 600mL of cell lysate, shearing the tissue by using scissors, adding 6 mu L of proteinase K into each tube, uniformly mixing, placing the tube in a 65 ℃ water bath for 2-4h, and turning the centrifuge tube upside down every 30min until the tissue is completely lysed;
2) taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, fully shaking up, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernatant into a new 1.5mL centrifuge tube, then centrifuging at 12000rpm for 10min at 4 ℃, taking 500 mu L of supernatant into a new 1.5mL centrifuge tube, adding equivalent isopropanol, shaking up and mixing evenly, placing on ice for 1-2min, centrifuging at 12000rpm for 10min at 4 ℃, and discarding the supernatant;
3) adding 1mL of 70% ethanol, cleaning, centrifuging at 12000rpm at 4 ℃ for 10min, removing the supernatant, and cleaning again;
4) adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm at 4 ℃ for 5min, discarding the supernatant, reversing the centrifuge tube on filter paper, drying for 15-20min, and adding proper double distilled water for dissolving; after the concentration and the quality are detected, the solution is diluted to 100 ng/. mu.L and stored at the temperature of minus 20 ℃ for later use.
8. The method according to claim 6, wherein in the step 2), the PCR reaction system is: total volume 12.5 μ L: 2 XPremix Taq 6.25. mu.L, forward and reverse primers 0.5. mu.L each, DNA template 0.5. mu.L, ddH2O 4.75μL。
9. The method of claim 8, wherein: in the step 2), the PCR reaction procedure is as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at a suitable annealing temperature for 30s, extension at 72 ℃ for 30s, and 35 cycles; finally, extension is carried out for 7min at 72 ℃ and temporary storage is carried out at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111110152.3A CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111110152.3A CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981103A true CN113981103A (en) | 2022-01-28 |
| CN113981103B CN113981103B (en) | 2023-07-21 |
Family
ID=79736324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111110152.3A Active CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981103B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116042843A (en) * | 2022-09-26 | 2023-05-02 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979341A (en) * | 2020-09-07 | 2020-11-24 | 浙江省淡水水产研究所 | Primer group developed based on macrobrachium rosenbergii transcriptome sequence and application thereof |
-
2021
- 2021-09-18 CN CN202111110152.3A patent/CN113981103B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979341A (en) * | 2020-09-07 | 2020-11-24 | 浙江省淡水水产研究所 | Primer group developed based on macrobrachium rosenbergii transcriptome sequence and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| GIREESH BABU ET AL: "Parentage determination in the freshwater prawn Macrobrachium rosenbergii De Man, 1879 using microsatellite markers" * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116042843A (en) * | 2022-09-26 | 2023-05-02 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
| CN116042843B (en) * | 2022-09-26 | 2024-05-24 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981103B (en) | 2023-07-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Okumuş et al. | Fish population genetics and molecular markers: II-molecular markers and their applications in fisheries and aquaculture | |
| CN104357553B (en) | A kind of Pelteobagrus fulvidraco microsatellite Parentage determination method | |
| CN107502663B (en) | Channel catfish microsatellite family identification method | |
| CN106939348A (en) | A kind of microsatellite marker primer and its authentication method for acipenser dabryanus Parentage determination | |
| CN106818552B (en) | Method for inducing artificial gynogenesis of siniperca chuatsi by heterologous sperms | |
| CN105002267A (en) | Penaeus japonicus molecule marking method and application | |
| CN105603098A (en) | Microsatellite marker primers used for penaeus monodon microsatellite family identification, identification method and application | |
| CN111304337B (en) | SRAP molecular marker, kit and method for identifying pelteobagrus fulvidraco, pelteobagrus vachelli and filial generation and application | |
| CN114592070B (en) | Microsatellite family identification method and application of sparus flavescens | |
| CN114606332A (en) | SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof | |
| CN106399530A (en) | Spinibarbus dneticulatus microsatellite family identification method | |
| CN108753987A (en) | A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead | |
| CN112592998B (en) | KASP primer combination for constructing grape DNA fingerprint atlas database and application | |
| CN113981103A (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellites, detection kit and identification method | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN114574600B (en) | Male molecular marker of alosa sapidissima, and specific primer pair and application thereof | |
| CN115679004A (en) | Primers, method and kit for identifying Pelteobagrus vachelli, leiocassis longirostris and hybrid species | |
| CN111793699B (en) | Efficient matching and breeding method for procypris merus | |
| CN108841983A (en) | A kind of SSR primer of sugarcane overall length transcript profile data large-scale development | |
| CN114480666A (en) | Method for distinguishing black porgy and two hybrid offspring thereof by using ISSR molecular marker | |
| CN108841930B (en) | Paramisgurnus dabryanus microsatellite family identification method and application thereof | |
| CN116042843B (en) | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method | |
| CN107988386B (en) | SSR fluorescence labeling primer for paternity test of siniperca chuatsi and application | |
| CN105603097A (en) | Microsatellite marker primers used for pinctada fucata martensii microsatellite family identification, identification method and application | |
| KR102527604B1 (en) | Genetic marker for parentage and thereof in Tribolodon hakonensis. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |