CN113981103B - Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method - Google Patents
Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method Download PDFInfo
- Publication number
- CN113981103B CN113981103B CN202111110152.3A CN202111110152A CN113981103B CN 113981103 B CN113981103 B CN 113981103B CN 202111110152 A CN202111110152 A CN 202111110152A CN 113981103 B CN113981103 B CN 113981103B
- Authority
- CN
- China
- Prior art keywords
- microsatellite
- parent
- taking
- identification
- macrobrachium rosenbergii
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, a detection kit and an identification method; the method comprises the steps of firstly, respectively extracting DNA from different individuals to be identified; performing PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product; detecting the amplified products marked by fluorescence on an ABI 3730XL genetic typing instrument, taking GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and offspring by using CERVUS 3.0 software, determining the parents of each offspring, comparing with the known actual genetic relationship, and judging the success rate of paternity test. The microsatellite loci have high polymorphism, and a good identification effect can be obtained in parent-child identification of macrobrachium rosenbergii by using a few loci.
Description
Technical Field
The invention relates to the field of animal molecular genetics, in particular to a microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, a detection kit and an identification method.
Background
Macrobrachium rosenbergii (Macrobrachium rosenbergii), also known as Macrobrachium malayan, macrobrachium rosenbergii, is classified as a river-tracing organism, native to south-east asia, widely distributed in tropical and subtropical zones, and belongs to the phylum Arthropoda (Arthropoda), crustacea (Crustaceae), decapoda (Decapoda), porphyra (Natasia), palaesculaceae (Palaemonidae), macrobrachium (Macrobrachium). Macrobrachium rosenbergii was introduced into China for the first time in 1976, and is widely cultivated in more than ten provinces such as Guangdong, zhejiang, jiangsu and the like due to the advantages of large individual, wide feeding habit, quick growth, high nutritive value and the like. At present, the culture yield of China accounts for more than half of the world, and the China becomes the country with the highest culture yield of the giant freshwater shrimps worldwide. However, in artificial breeding models, long-term inbreeding and inbreeding among small populations cause more and more serious degeneration of germplasm resources, which is mainly characterized by slow growth speed, individual trend to be miniaturized, premature sexual maturity, reduced reproductive rate and increased diseases. Therefore, in order to promote the sustainable development of the macrobrachium rosenbergii breeding industry, developing the fine variety breeding work is one of the work which is urgently needed at present.
In the aquatic animal breeding process, clear genealogy information is important to research of genetic parameters and family breeding. The macrobrachium rosenbergii has a special and complex natural mating propagation mode, amphiprotic encounter and identification can be carried out during the period, the male shrimp occupies space, the female shrimp sloughs, mating and spawning and egg-holding hatching of the female shrimp are carried out, so that the establishment of the isotactic cell family of the macrobrachium rosenbergii is different from other aquatic animals capable of carrying out artificial propagation, and only single male and female pairing with parent identification or low efficiency can be carried out. In addition, in the traditional breeding work of macrobrachium rosenbergii, in order to distinguish the offspring of different families, the aim of distinguishing the offspring after the polyculture is generally achieved by injecting physical marks such as visible embedded fluorescent marks at the tail parts before the polyculture, but the method can be implemented only when macrobrachium rosenbergii grows to the larva stage, physical damage is caused to the larva in the implementation process, and the death phenomenon of the individual usually occurs after the marks. Crustaceans also undergo multiple molting during growth, resulting in the disappearance of individual physical markers with molting. Studies show that in animal and plant populations, genealogy errors caused by individual label falling, fluorescent label drifting, artificial errors and the like occur, the probability is about 10%, and the occurrence of the errors can lead to errors in genetic parameter prediction based on family breeding to a certain extent. Based on the problems, how to maintain accurate pedigree information in the breeding process becomes one of the main difficulties faced by macrobrachium rosenbergii breeding work.
Paternity test (Parentage Identification), or paternity test, is a technique based on molecular genetics theory, which uses molecular markers to determine whether there is a relationship between offspring and parents. Can provide complete and accurate pedigree information for the family selection and comprehensive selection of modern animals. Meanwhile, the establishment of the technology can allow the aquatic animals to realize family polyculture in early incubation, so that the influence of environmental factors caused by independent culture is reduced, and the estimation of family growth performance, hybridization advantages and genetic parameters is more accurate. At present, molecular markers of microsatellite (Simple Sequence Repeat, SSR) are mainly adopted for paternity test of aquatic animals, and the microsatellite markers are widely applied to paternity test and population genetic diversity analysis of aquatic animals such as megalobrama amblycephala, grass carp, yellow perch, grouper and the like due to the advantages of wide distribution, co-dominance, high polymorphism, low requirement on DNA sample quality and the like. At present, the research of applying microsatellite markers to parent identification of macrobrachium rosenbergii is only found in the reconstruction of family relationships by using double-base repeated microsatellite loci developed by Karaket and the like, but after the amplification effect detection is carried out on primer pairs in the research, serious shadow bands are found, the existence of the shadow bands can cause a certain degree of errors on typing results, and in addition, different microsatellite primer pairs are combined in different populations to have different identification effects due to population differentiation. Therefore, the construction of a paternity test system consisting of three-base and more than one repeated base microsatellite loci which are stable in amplification and are highly polymorphic has important significance for genetic breeding of macrobrachium rosenbergii.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, a detection kit and an identification method. The invention utilizes the fluorescent marked primer of the microsatellite locus with high polymorphism and capillary electrophoresis typing to identify families, and establishes an effective paternity test system for molecular marker assisted breeding of macrobrachium rosenbergii, thereby providing a meaningful molecular technology for fine breed breeding work of macrobrachium rosenbergii.
In order to achieve the above purpose, the invention designs a microsatellite primer pair for parent-child identification of macrobrachium rosenbergii, wherein the 5' end of a forward primer of the microsatellite primer pair is subjected to fluorescent group modification, and the microsatellite primer pair is as follows:
| MRO1 | F: | cgaaaaagttgaagcaccgt | R: | Actgcaacacgctacatggt |
| MRO4 | F: | ctgcaaagctgtatgtgcgt | R: | tgaccaggaacgacattttg |
| MRO5 | F: | agcggaggtccctaggaata | R: | gccattcttttcaataagacctgt |
| MRO7 | F: | gtgaggtgcactgacggc | R: | gacaaggaggacggtgacag |
| MRO9 | F: | gaagaaggtacgaacgcat | R: | gtgagccgccttattccttt |
| MRO12 | F: | ccacgaatgccatagttcct | R: | tcgcgacctagacctatgct |
| MRO16 | F: | actgttctccccgatgagc | R: | tccagggctattttgactgg |
| MRO17 | F: | cgtccaagcctatgggacta | R: | gatgctggtgatgatgatgc |
| Mr-70 | F: | catcagcatttggcagtc | R: | cattggagcccttgaact |
| 51708 | F: | gtgagatctccacgcccaaa | R: | tcagcgcattcagtcggttt |
further, the fluorescent group is selected from FAM (blue), HEX (green), TAMRA (black), ROX (red).
The invention also provides a detection kit for parent-child identification of macrobrachium rosenbergii microsatellite, which comprises the microsatellite primer pair according to claim 1.
Further, the detection kit also comprises cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2×Premix Taq and ddH 2 O; wherein the main component of 2 XPAmix Taq is 0.05U/. Mu.L Taq DNA polySynthase, 3mM Mg 2+ And 0.4mM dNTPs
Still further, the cell lysate comprises the following components: tris-HCl 100mM, pH 8.0; EDTA50mM, pH 8.0; SDS 1%, pH 8.0; naCl 125mM.
The invention also provides a method for parent-child identification of macrobrachium rosenbergii microsatellite by using the kit, which comprises the following steps:
1) Respectively extracting DNA from different individuals to be identified;
2) Performing PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product;
3) Detecting the amplified products marked by fluorescence on an ABI 3730XL genetic typing instrument, taking a primer GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and offspring by using CERVUS 3.0 software, determining the parents of each offspring, comparing with the known actual genetic relationship, and judging the success rate of paternity test.
The method for extracting DNA as a preferable scheme comprises the following steps:
1) Taking 100mg of sample, sucking up ethanol by using filter paper, placing the sample into a 2mL centrifuge tube, adding 600mL of cell lysate, shearing the tissue by using scissors, adding 6 mu L of proteinase K (20 mg/L) into each tube, uniformly mixing, placing the mixture into a water bath at 65 ℃ for 2-4 hours, and reversing the centrifuge tube up and down every 30 minutes until the tissue is completely lysed;
2) Taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, shaking uniformly, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernatant into a new 1.5mL centrifuge tube, centrifuging at 12000rpm for 10min at 4 ℃ again, taking 500 mu L of supernatant into the new 1.5mL centrifuge tube, adding equal amount (500 mL) of isopropanol, shaking uniformly, placing on ice for 1-2min, centrifuging at 12000rpm for 10min at 4 ℃, and discarding the supernatant;
3) Adding 1mL of 70% ethanol, cleaning, centrifuging at 12000rpm and 4 ℃ for 10min, discarding the supernatant, and repeating the cleaning;
4) Adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm and 4 ℃ for 5min, discarding the supernatant, reversely buckling a centrifuge tube on filter paper, drying for 15-20min, and adding proper double distilled water for dissolution; after concentration and quality detection, the mixture is diluted to 100 ng/. Mu.L and stored at-20 ℃ for standby.
Preferably, in the step 2), the PCR reaction system is: total volume 12.5 μl:2 XPAmix Taq 6.25. Mu.L, forward and reverse primers of 0.5. Mu.L each, DNA template of 0.5. Mu.L, ddH 2 O 4.75μL。
Preferably, in the step 2), the PCR reaction procedure is as follows: pre-denaturation at 94℃for 5min; denaturation at 94℃for 30s, annealing at a suitable annealing temperature for 30s, extension at 72℃for 30s, and 35 cycles; finally, the extension is carried out for 7min at 72 ℃ and temporary storage is carried out at 4 ℃.
The invention has the beneficial effects that:
1) The microsatellite loci developed and screened by the invention have high polymorphism, and a good identification effect can be obtained in parent-child identification of macrobrachium rosenbergii by using a few loci.
2) The invention utilizes different fluorescent groups to modify the primer, and can mix different fluorescent modified sites and then carry out machine detection, thereby greatly reducing the detection cost.
3) The invention allows the mixed culture of individuals with different families to be carried out in early stage, reduces the cost of the single culture of the families and the environmental influence caused by the single culture, and ensures that the breeding result is more accurate and reliable.
Drawings
FIG. 1 is a diagram of polypropylene gel electrophoresis of a portion of sites in example 1, each site being PCR amplified using 8 individuals' whole genome DNA as a template.
Figure 2 genotyping plot of part of the loci in example 3, two alleles of the offspring were from the male parent and female parent, respectively, conforming to mendelian's law of segregation.
Detailed Description
The present invention is described in further detail below with reference to the drawings and specific embodiments for the understanding of those skilled in the art.
EXAMPLE 1 polymorphic microsatellite locus screening
Based on transcriptome data and published articles, selecting microsatellite locus synthesis primers with more than 150 3 base repeats, amplifying in 8 wild individuals, selecting clear bands through agarose gel electrophoresis, amplifying stable primers for subsequent polymorphism detection, selecting primers with the band number more than 3 as shown in figure 1 through polypropylene gel electrophoresis to synthesize fluorescent primers, respectively modifying the 5' end of forward primers of each primer by FAM, HEX, TAMRA, ROX, and synthesizing common primers and fluorescent primers by Wuhan qingke biotechnology Co-Ltd.
The synthesized fluorescent primers were amplified in 32 individuals, amplified products were detected on an ABI 3730XL genetic typing instrument, the calibrated typing data were arranged in an excel table, then observed heterozygosity, expected heterozygosity, polymorphism, average exclusion rate and cumulative exclusion rate of each site were analyzed by Cervus software (Table 1), and finally 10 pairs of primers with ten top polymorphism ranks were selected as primers for paternity test by comprehensively considering the cumulative exclusion rate and the identification cost, and the primer information is shown in Table 2.
The PCR reaction system was 12.5. Mu.L, including 6.25. Mu.L of Premix Taq (Takara Bio Inc, dalian, china), 0.5. Mu.L of forward and reverse primer (10. Mu.m/L), 0.5. Mu.L of DNA template (100 ng. Mu.L) -1 ) 4.75 μl of double distilled water. The PCR reaction procedure is that the reaction is pre-denatured for 5min at 95 ℃; denaturation at 95℃for 30s, ta annealing for 30s, elongation at 72℃for 30s, and 35 cycles; then extending at 72 ℃ for 7min, and finally preserving at 4 ℃.
TABLE 1 genetic information of 21 candidate Macrobrachium rosenbergii microsatellite loci in 32 individuals
Note that: ND represents no significant deviation (P > 0.05), NS represents significant deviation (P < 0.05), x represents significant deviation (P < 0.01), and x represents very significant deviation (P < 0.001).
TABLE 2 microsatellite primer information for parent-child identification of Macrobrachium rosenbergii
Note that: f is a forward primer, R is a reverse primer
Example 2
The detection kit for the parent-child identification of the macrobrachium rosenbergii microsatellite comprises a microsatellite primer pair, a cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2X Premix Taq and ddH 2 O。
Wherein, the components of the cell lysate are as follows: tris-HCl 100mM, pH 8.0; EDTA50mM, pH 8.0; SDS 1%, pH 8.0; naCl 125mM.
The microsatellite primer pairs are as follows:
| MRO1 | F: | cgaaaaagttgaagcaccgt | R: | actgcaacacgctacatggt |
| MRO4 | F: | ctgcaaagctgtatgtgcgt | R: | tgaccaggaacgacattttg |
| MRO5 | F: | agcggaggtccctaggaata | R: | gccattcttttcaataagacctgt |
| MRO7 | F: | gtgaggtgcactgacggc | R: | gacaaggaggacggtgacag |
| MRO9 | F: | gaagaaggtacgaacgcat | R: | gtgagccgccttattccttt |
| MRO12 | F: | ccacgaatgccatagttcct | R: | tcgcgacctagacctatgct |
| MRO16 | F: | actgttctccccgatgagc | R: | tccagggctattttgactgg |
| MRO17 | F: | cgtccaagcctatgggacta | R: | gatgctggtgatgatgatgc |
| Mr-70 | F: | catcagcatttggcagtc | R: | cattggagcccttgaact |
| 51708 | F: | gtgagatctccacgcccaaa | R: | tcagcgcattcagtcggttt |
example 3
The method for carrying out the parent-child identification of the macrobrachium rosenbergii microsatellite by using the kit comprises the following steps:
1. establishment of macrobrachium rosenbergii isotactic cell family
A male and a female individual with bigger size, health, no disease and complete appendages are selected, and the male and the female are 1:3, mating and developing each group of shrimps in a separate net cage, establishing 30 families in total, and simultaneously cutting off the appendages of each parent and storing the appendages in absolute ethyl alcohol for DNA extraction. Offspring from 30 families were grown in separate drums, and when the daphnia larvae developed to stage X, 30 tail larvae were selected from each family and stored in absolute ethanol as a paternity test sample.
2. Parent and offspring DNA extraction
Taking 100mg of appendages of each parent and each acquired larva, sucking up ethanol by filter paper, placing the dried ethanol into a 2mL centrifuge tube, adding 600mL of cell lysate (Tris-HCL 100mM,pH 8.0;EDTA50mM,pH 8.0;SDS 1%, pH 8.0; naCl 125 mM), shearing tissues by scissors, adding 6 mu L of proteinase K (20 mg/L) into each tube, uniformly mixing, placing the mixture into a water bath at 65 ℃ for 2-4 hours, and reversing the centrifuge tube up and down every 30 minutes until the tissues are completely lysed. Taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, shaking fully and uniformly, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernatant into a new 1.5mL centrifuge tube, centrifuging at 12000rpm for 10min at 4 ℃ again, taking 500 mu L of supernatant into the new 1.5mL centrifuge tube, adding equal amount (500 mL) of isopropanol, shaking gently and mixing uniformly, placing on ice for 1-2min, centrifuging at 12000rpm at 4 ℃ for 10min, and discarding the supernatant. 1mL of 70% ethanol was added, washing was performed, centrifugation was performed at 12000rpm at 4℃for 10min, and the supernatant was discarded, and the procedure was repeated. Adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm and 4 ℃ for 5min, discarding the supernatant, reversely buckling a centrifuge tube on filter paper, drying for 15-20min, adding proper double distilled water for dissolution, and diluting to 100 ng/mu L for standby at-20 ℃ after detecting the concentration and quality.
3. Microsatellite locus genotyping and paternity test analysis
PCR amplification was performed on 10 pairs of selected primers in all samples, and the amplified products were detected on an ABI 3730XL genotyping instrument using GS-500LIZ as the molecular weight internal standard and the fragment length of each site was read using GeneMapper 4.0 software. Allele frequencies, expected heterozygosity, observed heterozygosity, polymorphic information content, mean exclusion probabilities, hadi-hilbert balance and null allele probabilities for each microsatellite locus were calculated using Cervus software (table 3). Then, simulation analysis and genetic relationship analysis are sequentially carried out, and the parent pair of each offspring is identified according to the LOD value.
4. Paternity test results
In the simulation analysis, 50 pairs of parents are used for simulation to generate 10000 offspring, and the probability of success of paternity test can reach 100% in the range of 80% and 95% confidence intervals. Of the 852 individuals of the 30 families actually identified, 827 individuals found the parent and female parent that were consistent with the family record, and the genotype of each locus in the parent and offspring met mendelian segregation law, taking loci MRO1, MRO4, MRO5 as an example, the two alleles of the offspring were from the parent and female parent, respectively (fig. 2). In addition, 12 cases did not find true male parent, 16 cases did not find true female parent, and 3 cases of male and female parent all had mismatch. Therefore, the probability of finding the true parent from the candidate parent is 98.6% and 98.1% respectively, the overall identification success rate is 97.1%, and the requirements of the genetic breeding pedigree relationship reconstruction can be met.
TABLE 3 statistics of genetic diversity and exclusion rates for 10 microsatellite loci
Note that: * Represents a very significant deviation (P < 0.001)
Other parts not described in detail are prior art. Although the foregoing embodiments have been described in some, but not all, embodiments of the invention, it should be understood that other embodiments may be devised in accordance with the present embodiments without departing from the spirit and scope of the invention.
Sequence listing
<110> university of agriculture in China
Microsatellite primer pair for parent-child identification of <120> macrobrachium rosenbergii microsatellite, detection kit and identification method
<160> 20
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 1
cgaaaaagtt gaagcaccgt 20
<210> 2
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 2
actgcaacac gctacatggt 20
<210> 3
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 3
ctgcaaagct gtatgtgcgt 20
<210> 4
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 4
tgaccaggaa cgacattttg 20
<210> 5
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 5
agcggaggtc cctaggaata 20
<210> 6
<211> 24
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 6
gccattcttt tcaataagac ctgt 24
<210> 7
<211> 18
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 7
gtgaggtgca ctgacggc 18
<210> 8
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 8
gacaaggagg acggtgacag 20
<210> 9
<211> 19
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 9
gaagaaggta cgaacgcat 19
<210> 10
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 10
gtgagccgcc ttattccttt 20
<210> 11
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 11
ccacgaatgc catagttcct 20
<210> 12
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 12
tcgcgaccta gacctatgct 20
<210> 13
<211> 19
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 13
actgttctcc ccgatgagc 19
<210> 14
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 14
tccagggcta ttttgactgg 20
<210> 15
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 15
cgtccaagcc tatgggacta 20
<210> 16
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 16
gatgctggtg atgatgatgc 20
<210> 17
<211> 18
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 17
catcagcatt tggcagtc 18
<210> 18
<211> 18
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 18
cattggagcc cttgaact 18
<210> 19
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 19
gtgagatctc cacgcccaaa 20
<210> 20
<211> 20
<212> DNA
<213> synthetic sequences (Synthetic sequence)
<400> 20
tcagcgcatt cagtcggttt 20
Claims (5)
1. A microsatellite primer pair for parent-child identification of macrobrachium rosenbergii is characterized in that: the 5' end of the forward primer of the microsatellite primer pair is modified by a fluorescent group, and the microsatellite primer pair is as follows:
the fluorescent group is selected from FAM, HEX, TAMRA, ROX.
2. A detection kit for parent-child identification of macrobrachium rosenbergii microsatellite is characterized in that: the detection kit comprises the microsatellite primer pair according to claim 1, cell lysate, proteinase K, 7.5M ammonium acetate, isopropanol, 70% ethanol, absolute ethanol, 2X Premix Taq and ddH 2 O, wherein 2X Premix TaqThe main component is 0.05U/. Mu.L Taq DNA polymerase and 3mM Mg 2+ 、0.4mM dNTPs。
3. The test kit of claim 2, wherein: the cell lysate comprises the following components: tris-HCl 100mM, pH 8.0; EDTA50mM, pH 8.0; SDS 1%, pH 8.0; naCl 125mM.
4. A method for parent-child identification of macrobrachium rosenbergii by using the kit of claim 2, which is characterized in that: the method comprises the following steps:
1) Respectively extracting DNA from different individuals to be identified;
2) Performing PCR by taking the extracted DNA as a template; obtaining a fluorescent PCR product;
3) Detecting the amplified products marked by fluorescence on an ABI 3730XL genetic typing instrument, taking GS-500LIZ as a molecular weight internal standard, reading the fragment length of each site by using GeneMapper 4.0 software, analyzing the genotypes of parents and offspring by using CERVUS 3.0 software, determining the parents of each offspring, comparing with the known actual genetic relationship, and judging the success rate of paternity test.
5. The method of authentication of claim 4, wherein: the method for extracting DNA comprises the following steps:
1) Taking 100mg of sample, sucking up ethanol by using filter paper, placing the sample into a 2mL centrifuge tube, adding 600mL of cell lysate, shearing the tissue by using scissors, adding 6 mu L of proteinase K into each tube, uniformly mixing, placing the mixture into a water bath at 65 ℃ for 2-4 hours, and reversing the centrifuge tube up and down every 30 minutes until the tissue is completely lysed;
2) Taking out the centrifuge tube, cooling to room temperature, adding 200mL of 7.5M ammonium acetate into each tube, shaking uniformly, placing on ice for 5min, centrifuging at 12000rpm for 10min at 4 ℃, taking 570 mu L of supernatant into a new 1.5mL centrifuge tube, centrifuging at 12000rpm for 10min at 4 ℃ again, taking 500 mu L of supernatant into the new 1.5mL centrifuge tube, adding equal amount of isopropanol, shaking uniformly, placing on ice for 1-2min, centrifuging at 12000rpm at 4 ℃ for 10min, and discarding the supernatant;
3) Adding 1mL of 70% ethanol, cleaning, centrifuging at 12000rpm and 4 ℃ for 10min, discarding the supernatant, and repeating the cleaning;
4) Adding 1mL of absolute ethyl alcohol, cleaning, centrifuging at 12000rpm and 4 ℃ for 5min, discarding the supernatant, reversely buckling a centrifuge tube on filter paper, drying for 15-20min, and adding proper double distilled water for dissolution; after concentration and quality detection, the mixture is diluted to 100 ng/. Mu.L and stored at-20 ℃ for standby.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111110152.3A CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111110152.3A CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113981103A CN113981103A (en) | 2022-01-28 |
| CN113981103B true CN113981103B (en) | 2023-07-21 |
Family
ID=79736324
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111110152.3A Active CN113981103B (en) | 2021-09-18 | 2021-09-18 | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113981103B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116042843B (en) * | 2022-09-26 | 2024-05-24 | 华中农业大学 | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111979341B (en) * | 2020-09-07 | 2021-08-06 | 浙江省淡水水产研究所 | Primer group developed based on macrobrachium rosenbergii transcriptome sequence and application thereof |
-
2021
- 2021-09-18 CN CN202111110152.3A patent/CN113981103B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113981103A (en) | 2022-01-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Poompuang et al. | Toward detection of quantitative trait loci and marker‐assisted selection in fish | |
| CN104357553B (en) | A kind of Pelteobagrus fulvidraco microsatellite Parentage determination method | |
| CN107502663B (en) | Channel catfish microsatellite family identification method | |
| CN105603098B (en) | For the microsatellite marker primer and identification method of Penaeus monodon microsatellite Parentage determination and application | |
| CN106939348A (en) | A kind of microsatellite marker primer and its authentication method for acipenser dabryanus Parentage determination | |
| CN106818552B (en) | Method for inducing artificial gynogenesis of siniperca chuatsi by heterologous sperms | |
| CN107022647B (en) | SNP marker related to growth traits of micropterus salmoides and application thereof | |
| WO2022227692A1 (en) | Intermuscular bone-free crucian strain and cultivation method therefor | |
| CN105002267A (en) | Penaeus japonicus molecule marking method and application | |
| CN108179200B (en) | Microsatellite marker linked with procambarus clarkii high fertility character and application thereof | |
| CN108753987A (en) | A kind of method of the general microsatellite Multiplex fluorescent PCR of silver carp flathead | |
| Poompuang et al. | A preliminary genetic map of walking catfish (Clarias macrocephalus) | |
| CN114574600B (en) | Male molecular marker of alosa sapidissima, and specific primer pair and application thereof | |
| CN114592070B (en) | Microsatellite family identification method and application of sparus flavescens | |
| CN113981103B (en) | Microsatellite primer pair for parent-child identification of macrobrachium rosenbergii microsatellite, detection kit and identification method | |
| CN111304337A (en) | SRAP molecular marker, kit and method for identifying first filial generation of pelteobagrus fulvidraco, pelteobagrus vachelli and hybride and application | |
| CN111793699B (en) | Efficient matching and breeding method for procypris merus | |
| CN114959050A (en) | Method for identifying parent and child of red swamp crayfish based on four-base microsatellite fluorescent multiplex PCR | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN108841930B (en) | Paramisgurnus dabryanus microsatellite family identification method and application thereof | |
| CN105603097B (en) | Microsatellite marker primer for identifying pinctada fucata microsatellite families as well as identification method and application | |
| CN111378765B (en) | SNP (Single nucleotide polymorphism) marker of fast-growing grass carp individual and application of SNP marker | |
| CN108184736B (en) | Nondestructive sampling method and application of procambarus clarkii living body | |
| CN116042843B (en) | Marking kit for parent identification of procambarus clarkia based on four-base microsatellite marking and application method | |
| CN111826449A (en) | Method for obtaining molecular marker related to gynogenesis bighead malformation character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |