CN114606332A - SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof - Google Patents
SNP (Single nucleotide polymorphism) site and Hf-KASP1 marker for judging pulp hardness of watermelon and application thereof Download PDFInfo
- Publication number
- CN114606332A CN114606332A CN202011446976.3A CN202011446976A CN114606332A CN 114606332 A CN114606332 A CN 114606332A CN 202011446976 A CN202011446976 A CN 202011446976A CN 114606332 A CN114606332 A CN 114606332A
- Authority
- CN
- China
- Prior art keywords
- watermelon
- hard
- pulp
- deoxyribonucleotide
- chromosome
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241000219109 Citrullus Species 0.000 title claims abstract description 245
- 235000012828 Citrullus lanatus var citroides Nutrition 0.000 title claims abstract description 245
- 239000003550 marker Substances 0.000 title abstract description 26
- 239000002773 nucleotide Substances 0.000 title description 8
- 125000003729 nucleotide group Chemical group 0.000 title description 8
- 210000000349 chromosome Anatomy 0.000 claims abstract description 64
- 239000005547 deoxyribonucleotide Substances 0.000 claims abstract description 64
- 125000002637 deoxyribonucleotide group Chemical group 0.000 claims abstract description 64
- 235000013372 meat Nutrition 0.000 claims abstract description 47
- 238000000034 method Methods 0.000 claims abstract description 42
- 238000009395 breeding Methods 0.000 claims abstract description 37
- 230000001488 breeding effect Effects 0.000 claims abstract description 37
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 25
- 239000000126 substance Substances 0.000 claims abstract description 13
- 239000003147 molecular marker Substances 0.000 claims abstract description 12
- 108020004414 DNA Proteins 0.000 claims description 29
- 239000007850 fluorescent dye Substances 0.000 claims description 27
- 238000011144 upstream manufacturing Methods 0.000 claims description 26
- 238000010791 quenching Methods 0.000 claims description 22
- 230000000171 quenching effect Effects 0.000 claims description 22
- 102000053602 DNA Human genes 0.000 claims description 17
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 17
- 239000000523 sample Substances 0.000 claims description 15
- 230000003321 amplification Effects 0.000 claims description 11
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 11
- 239000003153 chemical reaction reagent Substances 0.000 claims description 9
- 125000006853 reporter group Chemical group 0.000 claims description 8
- 230000000295 complement effect Effects 0.000 claims description 6
- 238000012408 PCR amplification Methods 0.000 claims description 4
- 238000012163 sequencing technique Methods 0.000 claims description 4
- 239000000463 material Substances 0.000 abstract description 24
- 238000013461 design Methods 0.000 abstract description 4
- 238000009396 hybridization Methods 0.000 abstract description 4
- 238000012216 screening Methods 0.000 abstract description 2
- 239000000047 product Substances 0.000 description 19
- 235000013399 edible fruits Nutrition 0.000 description 14
- 239000000203 mixture Substances 0.000 description 14
- 241000196324 Embryophyta Species 0.000 description 9
- 238000004458 analytical method Methods 0.000 description 6
- 238000001514 detection method Methods 0.000 description 6
- 238000012360 testing method Methods 0.000 description 6
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 239000012154 double-distilled water Substances 0.000 description 4
- 238000002156 mixing Methods 0.000 description 4
- 108700028369 Alleles Proteins 0.000 description 3
- 238000006243 chemical reaction Methods 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000005284 excitation Effects 0.000 description 3
- 238000002474 experimental method Methods 0.000 description 3
- 238000011160 research Methods 0.000 description 3
- 238000012795 verification Methods 0.000 description 3
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 3
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 2
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 230000002457 bidirectional effect Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- PHTQWCKDNZKARW-UHFFFAOYSA-N isoamylol Chemical compound CC(C)CCO PHTQWCKDNZKARW-UHFFFAOYSA-N 0.000 description 2
- 238000012257 pre-denaturation Methods 0.000 description 2
- 230000000306 recurrent effect Effects 0.000 description 2
- 239000006228 supernatant Substances 0.000 description 2
- 244000241235 Citrullus lanatus Species 0.000 description 1
- 235000009831 Citrullus lanatus Nutrition 0.000 description 1
- 241001386813 Kraken Species 0.000 description 1
- 102000006382 Ribonucleases Human genes 0.000 description 1
- 108010083644 Ribonucleases Proteins 0.000 description 1
- 229910000831 Steel Inorganic materials 0.000 description 1
- 230000006978 adaptation Effects 0.000 description 1
- 239000011543 agarose gel Substances 0.000 description 1
- 238000007605 air drying Methods 0.000 description 1
- 238000003287 bathing Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- BKHZIBWEHPHYAI-UHFFFAOYSA-N chloroform;3-methylbutan-1-ol Chemical compound ClC(Cl)Cl.CC(C)CCO BKHZIBWEHPHYAI-UHFFFAOYSA-N 0.000 description 1
- 230000002860 competitive effect Effects 0.000 description 1
- 238000001816 cooling Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000011156 evaluation Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000012254 genetic linkage analysis Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 238000007542 hardness measurement Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 239000010959 steel Substances 0.000 description 1
- 238000003860 storage Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000010998 test method Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 235000013311 vegetables Nutrition 0.000 description 1
- 238000005406 washing Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SNP locus for judging the pulp hardness of watermelon, a Hf-KASP1 marker and application thereof. The invention provides an application of a substance for detecting whether the 13317084 th deoxyribonucleotide on the No. 6 chromosome in watermelon genome is T or A or T and A in any one of the following methods: identifying the pulp hardness of the watermelon, and breeding hard pulp/non-hard pulp watermelon varieties. The invention is based on the whole genome sequence of watermelon 97103 and hard meat material GS43(PI482307), the resequencing information of TWF of cultivated soft meat material, according to the determined SNP design marker, BC after hybridization of wild hard pulp watermelon GS43 and TWF of cultivated watermelon1F9The generation positioning group finely positions the watermelon hard meat gene and develops a closely linked KASP marker. The molecular marker KASP can be used for carrying out initial screening on watermelon pulp hardness varieties so as to achieve the aim of molecular assisted breeding.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an SNP locus for judging pulp hardness of watermelons, a Hf-KASP1 marker and application thereof.
Background
Watermelon (Citrullus lanatus) is an important vegetable crop in China, and the yield and sales of the watermelon are in the first place in the world. With the development of the production, sale and transportation ways of fruits, the hardness of watermelon fruits is increasingly paid attention to people as an important watermelon quality character.
At present, the market favors the watermelon variety with hard pulp, the watermelon variety is storage and transportation resistant, fruit slicing and tray splicing are convenient, most of traditional cultivated varieties are crisp in pulp, and how to effectively cultivate the watermelon variety with hard pulp is a hotspot of the current watermelon breeding work. The breeding practice proves that the molecular marker assisted breeding can greatly shorten the breeding period and improve the breeding efficiency. However, at present, the related research on the hardness gene of the watermelon fruit is less at home and abroad, and the hardness gene can not be accurately positioned. Therefore, the key target gene for controlling the fruit hardness is determined, and the developed functional molecular marker is a precondition for the molecular marker-assisted transformation of the watermelon hard meat character. In the research of watermelon molecular breeding, scientists in China firstly publish the whole genome sequence and variant group sequence of watermelon, so that the research of watermelon molecular biology in China is in the front of the world. The premise of the work is to determine the position of the watermelon fruit hardness control gene and develop a stable and available molecular marker. The laboratory develops related molecular markers developed aiming at the situation of different sequences near the loci of two candidate watermelon hardness genes based on the hardness phenotypes and subsequent genes of various watermelon varieties, and obtains national invention patents (patent numbers: ZL201610591704.X, ZL 201610542951.0). However, the above-mentioned markers require sequencing of the PCR product, the process is complicated and the throughput is low, and the two markers are still at a certain distance from the target gene. The application of the markers in the aspect of watermelon fruit hardness molecular marker assisted breeding has certain limitation. In order to better serve the practice of watermelon quality breeding, the molecular breeding work efficiency is to improve the watermelon fruit quality, further fine positioning needs to be carried out on pulp hardness genes, tightly linked SNP markers are obtained, and meanwhile, a high-flux molecular marker detection means is developed.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides an SNP locus for judging the pulp hardness of watermelon, a Hf-KASP1 marker and application thereof.
In a first aspect, the present invention claims the use of a substance for detecting whether the deoxyribonucleotide at position 13317084 of chromosome 6 of watermelon genome is T, A or T and A in any one of the following:
(A) identifying or assisting in identifying the hardness of watermelon pulp;
(B) preparing a product for identifying or assisting in identifying the pulp hardness of the watermelon;
(C) identifying or assisting in identifying whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety;
(D) preparing a product for identifying or assisting in identifying whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety;
(E) breeding a hard-meat watermelon variety;
(F) preparing a product for breeding a hard-meat watermelon variety;
(G) breeding a non-hard-meat watermelon variety;
(H) preparing products for breeding non-hard-meat watermelon varieties.
The substance for detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T, A or T and A can be a primer set or a reagent or a kit containing the primer set.
The primer set contains two upstream primers and one downstream primer.
The upstream primers are designed according to 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome and an upstream sequence thereof, the 3 'terminal deoxyribonucleotide of one upstream primer is 13317084 th deoxyribonucleotide T on chromosome 6 in the watermelon genome, and the 3' terminal deoxyribonucleotide of the other upstream primer is 13317084 th deoxyribonucleotide A on chromosome 6 in the watermelon genome; the downstream primer is designed according to the downstream sequence of 13317084 th deoxyribonucleotide on No. 6 chromosome in the watermelon genome.
Further, the primer set may be a primer set consisting of a single-stranded DNA molecule shown in the 22 nd to 46 th positions of SEQ ID No.1 or a derivative thereof, a single-stranded DNA molecule shown in the 22 nd to 46 th positions of SEQ ID No.2 or a derivative thereof, and a single-stranded DNA molecule shown in SEQ ID No. 3.
Furthermore, the derivative of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.1 is that the 5' end of the single-stranded DNA molecule shown in 22 nd to 46 th positions of SEQ ID No.1 is connected with a specific fluorescent label sequence A. The derivative of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.2 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.2 is connected with a specific fluorescent label sequence B.
The reagent or the kit can also contain a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B.
The fluorescent probe A is a sequence consistent with the specific fluorescent label sequence A, and the 5' end is connected with a fluorescent reporter group A; the quenching probe A is a reverse complementary sequence of the specific fluorescent label sequence A, and the 3' end is connected with a fluorescent quenching group.
The fluorescent probe B is a sequence consistent with the specific fluorescent label sequence B, and the 5' end is connected with a fluorescent reporter group B; the quenching probe B is a reverse complementary sequence of the specific fluorescent label sequence B, and the 3' end is connected with a fluorescent quenching group.
Further, the specific fluorescent tag sequence A is a fluorescent tag sequence FAM, and the specific fluorescent tag sequence B is a fluorescent tag sequence HEX; the fluorescence reporter group A is FAM, and the fluorescence reporter group B is HEX; the fluorescence quenching group is BHQ.
In a specific embodiment of the invention, the fluorescent tag sequence FAM is specifically SEQ ID No.1 at positions 1-21; the fluorescent tag sequence HEX is specifically the 1 st to 21 st sites of SEQ ID No. 2. Namely, the primer set is a primer set consisting of a single-stranded DNA molecule shown by SEQ ID No.1, a single-stranded DNA molecule shown by SEQ ID No.2 and a single-stranded DNA molecule shown by SEQ ID No. 3.
The fluorescent probe A, the fluorescent probe B, the quenching probe A and the quenching probe B of the present invention are present in KASP 2 XMASter Mix, wherein the KASP 2 XMASter Mix is a product of LGC company, UK.
The reagent or the kit can also contain high-fidelity Taq enzyme and dNTP.
In a second aspect, the invention claims any of the following methods:
the method A comprises the following steps: a method for detecting whether the deoxyribonucleotide at 13317084 th position on chromosome 6 in the genome of watermelon is T, A or T and A, which comprises the following steps (A1) or (A2):
(A1) and (4) directly sequencing.
(A2) Performing PCR amplification on watermelon genomic DNA to be detected by using the reagent or the kit, scanning the amplified product with a fluorescent signal (analyzing the scanning data by using Kraken software), and determining whether the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the watermelon gene to be detected is T or A or T and A according to the following steps:
and if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorophore A (blue is shown in the obtained typing cluster map by the analysis of Kraken software), the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of T.
And if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorescent group B (red is shown in the obtained typing cluster map through the analysis of Kraken software), the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is the homozygote of A.
And if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorophore A and the fluorophore B (the obtained typing cluster map shows green through analysis of Kraken software), the 13317084 th deoxyribonucleotide on the chromosome 6 in the genome of the watermelon to be detected is a hybrid of T and A.
Wherein, the conditions for performing the PCR amplification can be: pre-denaturation at 94 ℃ for 15 min; circulating for 10 times at 94 deg.C for 20s and 61-55 deg.C for 1min, and reducing the temperature by 0.6 deg.C per cycle; the circulation is carried out for 26 times at the temperature of 94 ℃ for 20s and at the temperature of 55 ℃ for 1 min.
The method B comprises the following steps: a method for identifying or assisting in identifying whether a watermelon to be tested is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety comprises the following steps:
(B1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(B2) determining whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety as follows:
and if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is the homozygote of A, determining that the watermelon to be detected is or is selected as a hard-flesh watermelon variety.
And if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is not the homozygote of A, determining that the watermelon to be detected is or is selected as a non-hard-flesh watermelon variety.
Further, if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of T, the watermelon to be detected is or is selected as a soft-flesh watermelon variety; and if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a hybrid of T and A, determining that the watermelon to be detected is or is selected as a medium-hard-meat watermelon variety.
The method C comprises the following steps: a method for breeding a hard-meat watermelon variety can comprise the following steps:
(C1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(C2) selecting a watermelon to be tested, wherein 13317084 th deoxyribonucleotide on the 6 th chromosome in a genome is a homozygote of A, as a parent to breed, selecting the watermelon, wherein 13317084 th deoxyribonucleotide on the 6 th chromosome in the genome is a homozygote of A, in each generation of breeding, and finally obtaining a watermelon variety with hard meat.
The (C2) may specifically be as follows: uses soft meat (non-hard meat) and high-quality material as receptor parent P1, and mixes them with hard meat gene (i.e. the 13317084 th position deoxyribonucleotide on chromosome 6 in watermelon genome is homozygote of A) and donor parent P2 with general qualityPreparation of F1Generation hybridization combination; then backcrossing is carried out by taking the receptor parent P1 as a recurrent parent to obtain BC1F1Backcrossing the separated population; for the BC1F1Selecting single plant with genotype of homozygous hard meat (namely, the 13317084 th deoxyribonucleotide on No. 6 chromosome in watermelon genome is homozygote of A) to continue backcross to obtain BC2F1Backcrossing the separated population; selecting individual plant whose genotype is homozygous hard meat (i.e. the 13317084 th deoxyribonucleotide on No. 6 chromosome in watermelon genome is homozygote of A), and backcrossing for n generations to obtain BCnF1Backcrossing the separated population; to BCnF1And (3) backcrossing the separated population for generation, continuously selecting a single plant of which the genotype is homozygous hard meat (namely, the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the watermelon genome is a homozygote of A) for selfing, and obtaining a homozygous hard meat line.
The method D comprises the following steps: a method for breeding a non-hard-meat (soft-meat) watermelon variety can comprise the following steps:
(D1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(D2) selecting to-be-tested watermelon with 13317084 th deoxyribonucleotide on chromosome 6 in genome being homozygote of T as parent to breed, and selecting watermelon with 13317084 th deoxyribonucleotide on chromosome 6 in genome being homozygote of T in each generation of breeding, finally obtaining non-hard meat (soft meat) watermelon variety.
The (D2) may specifically be: f is prepared from hard meat and high-quality material as acceptor parent P1, non-hard meat (soft meat) gene (i.e. homozygote of 13317084 th deoxyribonucleotide on chromosome 6 in watermelon genome is T) and donor parent P2 with general quality1Generation hybridization combination; backcrossing with receptor parent P1 as recurrent parent to obtain BC1F1Backcrossing the separated population; for the BC1F1Selecting individual plants with genotype of homozygous non-hard meat (soft meat) (i.e. the homozygote of T at 13317084 th deoxyribonucleotide on chromosome 6 in watermelon genome)Crossing to obtain BC2F1Backcrossing the separated population; selecting the individual plant whose genotype is homozygous non-hard meat (soft meat) (i.e. the 13317084 th deoxyribonucleotide on chromosome 6 in watermelon genome is homozygote of T), and continuously backcrossing for n generations to obtain BCnF1Backcrossing the separated population; to BCnF1And (3) backcrossing the separated population for generation, and continuously selecting a single plant with the genotype of homozygous non-hard meat (soft meat) (i.e. the homozygote of the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the watermelon genome is T) for selfing to obtain a homozygous non-hard meat (soft meat) line.
Further, in the method B, the method C and the method D, the method for detecting whether the deoxyribonucleotide at 13317084 th position on chromosome 6 in the watermelon genome is T, A or a substance of T and A may be the method A.
In a third aspect, the invention claims a substance having at least one function of the following (a) to (d):
(a) identifying or assisting in identifying the hardness of watermelon pulp;
(b) identifying or assisting in identifying whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp (soft-pulp or medium-hard-pulp) watermelon variety;
(c) breeding a hard-meat watermelon variety;
(d) breeding non-hard-meat (soft-meat) watermelon varieties.
The claimed substance is the substance for detecting whether the deoxyribonucleotide at position 13317084 on chromosome 6 in the watermelon genome is T, A or T and A as described above. The method specifically comprises the following steps: a set of primers as hereinbefore described or a reagent or kit comprising said set of primers.
In a fourth aspect, the invention claims the use of the method or the substance in molecular marker assisted breeding of watermelon.
In each of the above aspects, the hard pulp watermelon is specifically a pulp firmness value of greater than or equal to 12.5Kg/cm2The watermelon of (1). The hardness value of the pulp of the non-hard-pulp watermelon is less than 12.5Kg/cm2The watermelon of (1). The non-hard meat includes soft meat and medium hard meat. Further, the soft-flesh watermelon is the flesh hardness valueLess than 8Kg/cm2The watermelon of (1); the hardness value of the medium hard pulp watermelon is more than or equal to 8Kg/cm2And less than 12.5Kg/cm2The watermelon of (1).
In the invention, the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome takes the watermelon genome (watermelonon 97103genome v2) as a reference genome.
In the invention, the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the watermelon genome is also the 51 st deoxyribonucleotide of a sequence shown by SEQ ID No.4 on the No. 6 chromosome in the watermelon genome.
In the invention, the watermelon pulp hardness value is a value obtained by detecting the central pulp of the watermelon to be detected by a handheld hardness tester (KMH-51, KIYA SEISAKUSHD, LTD.).
The invention designs a marker according to the determined SNP (single nucleotide polymorphism) based on the whole genome sequence of the watermelon 97103, the resequencing information of the hard meat material GS43(PI482307) and the soft meat material TWF, and the BC after the hybridization of the wild hard pulp watermelon GS43 and the TWF of the cultivated watermelon is utilized1F9The generation-oriented population finely maps the gene of watermelon Hard meat (Hard flesh, Hf) and develops a closely linked KASP marker. Experiments prove that: the molecular marker KASP can be used for carrying out initial screening on watermelon pulp hardness varieties so as to achieve the purpose of molecular assisted breeding.
Drawings
FIG. 1 shows fruit hardness gene at BC1F9And (5) finely positioning a result graph of the population.
FIG. 2 shows KASP primer set BC of example 11F8And (5) detecting the population. In the figure, the red label A: A, the blue label T: T, and the green label A: T are labeled according to the SNP sites Chr.6: 13317084.
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise specified, were carried out in a conventional manner according to the techniques or conditions described in the literature in this field or according to the product instructions. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Example 1 development of SNP and Hf-KASP1 marker related to watermelon pulp firmness and establishment of genotype test method
First, test materials
The test material comprises male parent, female parent and BC1F9A population;
the male parent is: GS43(PI482307, https:// npgscheb. ars-grid. gov/gringlobal/accessdeciilide ═ 1377243) is typical wild type watermelon material, with high fruit firmness (flesh firmness value of 15 Kg/cm)2) The sugar content is low;
the female parent is: TWF, a typical east Asia type cultivated watermelon variety, is an excellent parent material of commercial hybrid watermelon, has high sugar content, but has fragile and easily-cracked pulp (the pulp hardness value is 5 Kg/cm)2)。
BC1F9The population is as follows: BC as described above1F8BC obtained by generation selfing1F9Group, 144 strains in total
All the test materials are germplasm resource materials stored in germplasm resource library of vegetable research center of agriculture and forestry academy of sciences of Beijing.
Second, obtaining KASP marker closely linked with watermelon pulp hardness
1、BC1F9Individual pulp hardness identification of population
Detection of BC in step one Using a hand-held sclerometer (KMH-51, KIYA SEISAKUSHD, LTD.)1F9The center flesh of the group and the parent material is obtained to obtain the pulp hardness value. The pulp hardness value is greater than or equal to 12.5Kg/cm2The watermelon is a hard pulp watermelon variety, and the pulp hardness value is less than 12.5Kg/cm2The watermelon is a non-hard-pulp watermelon variety (the pulp hardness value is less than 8 Kg/c)m2The watermelon is soft pulp watermelon with pulp hardness value of 8Kg/cm or more2And less than 12.5Kg/cm2The watermelon is medium hard pulp watermelon). Each test material was planted three times and averaged to ensure the accuracy of the pulp hardness values.
2. Development of KASP tagged primers
High throughput KASP tags were designed based on the KASP technique. KASP is a competitive allele specificity PCR technical system, has the characteristics of simple flow, high efficiency, flexibility, easy operation and the like, and the primer design principle is to design two upstream primers and one downstream primer aiming at the SNP locus of an allele; the 3 'terminal bases of the two upstream primers are different alleles, and the 5' terminal comprises specific joints GAAGGTGACCAAGTTCATGCT and GAAGGTCGGAGTCAACGGATT which can be combined with fluorescent labels. In the first round of PCR, the upstream primer which can be complemented with the template can be extended, and the upstream primer which cannot be complemented with the template cannot be extended; in the second round of PCR, the specific sequence complementary to the upstream primer is extended, and the universal tag sequence is introduced into the PCR product corresponding to the SNP. As the number of PCR cycles increases, the number of amplifications increases exponentially, and the fluorescent probe anneals more to the newly synthesized complementary strand, fluorescing. Different color fluorescence reflects different SNP types, and the detection aim is achieved by detecting the experimental result.
The sequencing result of the watermelon whole gene is utilized to analyze the SNP of the parent material in the No. 6 chromosome interval, 30 SNP loci (shown in table 1) are screened out in total, and related KASP markers are developed for fine positioning.
TABLE 1 SNP differences for TWT and GS43 parent materials for mapping in chromosome 6 region
Note: the physical location of the SNP sites in the table is that of Watermelon (97103) v2 Genome (http:// www.cucurbitgenomics.org/organissm/21) as reference Genome.
3. Fine positioning analysis of watermelon pulp hardness gene
The extraction of the genomic DNA of the watermelon material to be tested is referred to a method of Murray et al (1980) and is slightly improved, and the specific steps are as follows:
(1) 0.3-0.5g of young leaves are put into a 1.5mL centrifuge tube, 300 mu L of CTAB is added into each tube, 2 steel balls are put into the tube, and the tube is broken by a Retch instrument.
(2) Adding 300 μ L CTAB into each tube, mixing, water bathing at 65 deg.C for 60min, and mixing by reversing every 10 min.
(3) Placing in water bath, cooling at room temperature for 10min, adding 300 μ L of chloroform-isoamyl alcohol mixture (volume ratio of chloroform to isoamyl alcohol is 24:1), mixing, and centrifuging at 4500rpm for 15 min.
(4) Adding 400 μ L of supernatant into 400 μ L of pre-cooled isopropanol (in a 96-well deep-well plate), and gently mixing; standing at-20 deg.C for 30 min.
(5) Centrifuging at 4500rpm for 30min, discarding supernatant, washing precipitate with 70% ethanol for 2-3 times, and air drying at room temperature until no ethanol smell is generated.
(6) Adding 50-100 μ L (containing 0.5-1 μ L RNase 10mg/mL) ddH2O, water bath at 37 ℃ for 30 min.
(7) Samples of 5. mu.L were run on a 1.0% agarose gel and the sample concentrations were adjusted to be identical using standard lambda DNA as a control.
Using Joinmap software to pair BC1F9And carrying out genetic linkage analysis on the pulp hardness phenotype data of the population and the high-density KASP molecular marker genetic map constructed by the population, and finely positioning the Hf target gene interval positioned on the No. 6 chromosome of the watermelon. FIG. 1 is a diagram showing the fine positioning result of watermelon pulp hardness gene.
4. Acquisition of Hf-KASP1 marker closely linked to hardness control Gene
It was found that the SNP site Chr.6:13317084 (the corresponding sequence is shown in SEQ ID No.4, the 51 st W of SEQ ID No.4 is the SNP site, the nucleotide polymorphism is T or A) in Table 1 is closely linked with the fruit hardness phenotype. Thus obtaining the Hf-KASP1 labeled core primer sequence closely linked with the watermelon hardness gene.
The Hf-KASP1 labeled core primer sequence is as follows:
an upstream primer 1:
an upstream primer 2:
a downstream primer: 5'-GCATCTGAACAGGCATGAAAGTCTATAT-3' are provided.
In the above core primer sequences, the 3' ends of the upstream primers 1 and 2 are allelic variant bases (T or a in bold underlined part), the 5' end of the upstream primer 1 is added with a corresponding universal adaptor sequence (FAM fluorescent tag sequence), and the 5' end of the upstream primer 2 is added with a corresponding universal adaptor sequence (HEX fluorescent tag sequence), so as to obtain a KASP labeled primer combination for high-throughput detection of watermelon hardness:
the Hf-KASP1 labeled primer combination comprises the following three primers:
an upstream primer 3: 5' -GAAGGTGACCAAGTTCATGCTAGGCCTCCTGAGAATATTAGGAGAT-3' (SEQ ID No.1, the underlined part is the specific fluorescent tag sequence FAM);
an upstream primer 4: 5' -GAAGGTCGGAGTCAACGGATTAGGCCTCCTGAGAATATTAGGAGAA-3' (SEQ ID No.2, specific fluorescent tag sequence HEX is underlined);
a downstream primer: 5'-GCATCTGAACAGGCATGAAAGTCTATAT-3' (SEQ ID No. 3).
The above primers were synthesized by Beijing Synthesis division of Shanghai Biotech.
The upstream primer 3 and the downstream primer are used for amplifying a fragment with T at the SNP site Chr.6:13317084 of the watermelon genome (namely, the 51 st site of the sequence shown by SEQ ID No.4 is T).
The upstream primer 4 and the downstream primer are used for amplifying a fragment of the watermelon genome with A at the Chr.6:13317084 SNP site (namely, the 51 st site of the sequence shown by SEQ ID No.4 is A).
5. Method for detecting genotype by using Hf-KASP1 marker
KASP genotyping PCR reaction System:
96-well plate: 10ng genomic DNA, 5. mu.l KASP V4.02 × Master Mix, 0.14. mu.l primer Mix (forward primer 3, forward primer 4 and reverse primer), plus ddH2O to 10. mu.l.
384 well plates: 5 ng DNA, 2.5. mu.l KASP V4.02 × Master Mix, 0.07. mu.l primer Mix (forward primer 3, forward primer 4, and reverse primer), plus ddH2O to 5. mu.l.
1536 well plates: 5 ng DNA, 2.5. mu.l KASP V4.02 × Master Mix, 0.07. mu.l primer Mix (forward primer 3, forward primer 4, and reverse primer), plus ddH2O to 5. mu.l.
Wherein KASP V4.02 × Master Mix is LGC company product, KASP V4.02 × Master Mix for 96/384 orifice plate has catalog number KBS-1016-; the KASP V4.02 × Master Mix for 1536 well plates has catalog number KBS-1016-.
Wherein the final concentration of the upstream primer 3 and the final concentration of the upstream primer 4 in the primer mixture are both 12 mu M, and the final concentration of the downstream primer is 30 mu M.
Wherein, the KASP Master Mix consists of a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B, as well as high fidelity Taq enzyme, dNTP and Mg2+And the like. The nucleotide sequence of the fluorescent probe A is as follows: 5'-GAAGGTGACCAAGTTCATGCT-3', wherein the 5' end is connected with a FAM fluorescent group; the nucleotide sequence of the fluorescent probe B is as follows: 5'-GAAGGTCGGAGTCAACGGATT-3', connecting a HEX fluorescent group at the 5' end; the nucleotide sequence of the quenching probe A is as follows: 5'-AGCATGAACTTGGTCACCTTC-3', wherein the 3' end is connected with a quenching group BHQ; the nucleotide sequence of the quenching probe B is as follows: 5'-AATCCGTTGACTCCGACCTTC-3', wherein the 3' end is connected with a quenching group BHQ.
PCR reaction procedure: stage 1: pre-denaturation at 94 ℃ for 15 min; and (2) stage: 20s at 94 ℃; circulating for 10 times at 61-55 deg.C for 1min, and reducing the temperature by 0.6 deg.C in each circulation; and (3) stage: the circulation is carried out for 26 times at the temperature of 94 ℃ for 20s and at the temperature of 55 ℃ for 1 min.
And scanning the PCR amplification product by adopting a bidirectional single-excitation plate reader PHERAStar, wherein the FAM excitation wavelength is 485nm, the emission wavelength is 520nm, the HEX excitation wavelength is 528nm, the emission wavelength is 560nm, the system reference fluorescence ROX excitation wavelength is 575nm, and the emission wavelength is 610 nm. The fluorescence signal is KrakenTMSoftware analyzes the PHERAStar scanning data of the bidirectional single-excitation plate reader (the specific operation method refers to KrakenTMSoftware Specifications, publicly available directly from LGC company, see the website http:// www.lgcgroup.com/products/genotyping-software/kraken/#. Vhcat9Kl8_ M).
The experiment can be performed by simultaneously setting blanks (NTC) without adding template DNA to the reaction system, and setting 1 or more blanks per plate.
Determining the genotype of the SNP locus Chr.6:13317084 in the watermelon genome to be detected as follows:
and if the fluorescence signal data of the amplification product of the watermelon to be detected shows red color in the obtained typing cluster map through the analysis of Kraken software, the homozygote of A is arranged at the Chr.6:13317084 position of the SNP site in the genome of the watermelon to be detected (the genotype of the watermelon pulp hardness gene is marked as HH, and the hard pulp type).
And if the fluorescence signal data of the amplification product of the watermelon to be detected shows blue or green in the obtained typing cluster map through the analysis of Kraken software, determining that the SNP locus Chr.6:13317084 in the genome of the watermelon to be detected is not a homozygote of A (recorded as a non-hard meat type).
Specifically, if the fluorescence signal data of the amplification product of the watermelon to be detected is analyzed by Kraken software to show blue in the obtained typing cluster map, the homozygote of T is arranged at the Chr.6:13317084 position of the SNP locus in the genome of the watermelon to be detected (the genotype of the watermelon pulp hardness gene is hh, and the soft pulp type is recorded). If the fluorescence signal data of the amplification product of the watermelon to be detected is analyzed by Kraken software to be green in the obtained typing cluster map, a hybrid of T and A is arranged at the Chr.6:13317084 position of the SNP site in the genome of the watermelon to be detected (the genotype of the watermelon pulp hardness gene is Hh, and the medium and hard pulp type is recorded).
Preliminary verification of the three, KASP Mark
Using Hf-KASP1 to mark male parent, female parent and BC1F8The generation group was verified, and part of the results are shown in FIG. 2. The results showed that 119 fruits in a total of 400 plants were found to be hard flesh (flesh hardness value of 12.5Kg/cm or more)2) The individual of (1), wherein the genotype detected by the Hf-KASP1 marker is a hard meat type (HH type); 106 fruits were found to be soft flesh (flesh hardness value less than 8 Kg/cm)2) The individual of (1), wherein the genotype detected by the Hf-KASP1 marker is also soft meat type (hh type); in addition, 175 fruits were measured as medium-hard meat (pulp hardness value of 8Kg/cm or more)2And less than 12.5Kg/cm2) The individual of (1), wherein the genotype detected by the Hf-KASP1 marker is a medium hard meat type (Hh type). Namely, the pulp hardness values of the watermelons which are homozygotes A at the detected SNP sites Chr.6:13317084 are all more than or equal to 12.5Kg/cm2(hard meat), the hardness values of the watermelon meat of the homozygote with T at the SNP site Chr.6:13317084 are all less than 8Kg/cm2(soft meat), the hardness value of the watermelon with T and A heterozygotes at the SNP site Chr.6:13317084 is more than or equal to 8Kg/cm2And less than 12.5Kg/cm2(medium hard meat). The result shows that the Hf-KASP1 marker located on No. 6 chromosome of watermelon genome is coseparated with watermelon pulp hardness phenotype, which shows that the SNP locus and the Hf-KASP1 marker designed by utilizing the SNP locus have higher utilization value in identifying watermelon pulp hardness, and can be effectively applied to molecular assisted breeding of watermelon.
Example 2 verification of the KASP1 marker
To further verify the linkage relationship between the Hf-KASP1 marker in example 1 and the watermelon pulp firmness gene Hf (corresponding trait: pulp firmness), natural population was used for verification. The method comprises the following specific steps:
the test material is a natural resource group; the natural population is: 96 natural groups composed of representative watermelon germplasm resources in 1484 watermelon resource pools (see table 2 for details); in Table 2, each test material is a germplasm resource material stored in a germplasm resource library of vegetable research center of agriculture and forestry academy of sciences of Beijing.
Referring to example 1, the results of the evaluation of pulp firmness of each watermelon germplasm (Table 2) are shown in Table 2, in which the "firmness" column is obtained, and the identification of the genotype of SNP site Chr.6:13317084 is carried out using Hf-KASP1 marker.
TABLE 2, 96 shares of watermelon germplasm resources constituted natural group individual plant material and individual plant pulp hardness identification result (in the marker detection, HH is soft meat type, HH is hard meat type)
Note: in the table, "hardness" column, "soft" means the pulp hardness value is less than 8Kg/cm2"hard" means that the pulp hardness value is 12.5Kg/cm or more2。
The results show that: the result of the pulp hardness measurement is consistent with the result of 100% of the SNP site Chr.6:13317084 genotype identification by using Hf-KASP1 marker. The Hf-KASP1 marker detected homozygous hard meat genotypes in both hard meat materials of the natural population material. The detection results further prove that the Hf-KASP1 marker can be used for molecular marker assisted breeding of watermelon hard meat varieties.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
<110> agriculture, forestry, and scientific colleges in Beijing
<120> SNP site for judging watermelon pulp hardness, Hf-KASP1 marker and application thereof
<130> GNCLN202551
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 46
<212> DNA
<213> Artificial sequence
<400> 1
gaaggtgacc aagttcatgc taggcctcct gagaatatta ggagat 46
<210> 2
<211> 46
<212> DNA
<213> Artificial sequence
<400> 2
gaaggtcgga gtcaacggat taggcctcct gagaatatta ggagaa 46
<210> 3
<211> 28
<212> DNA
<213> Artificial sequence
<400> 3
gcatctgaac aggcatgaaa gtctatat 28
<210> 4
<211> 101
<212> DNA
<213> Artificial sequence
<400> 4
ataattaatg gcgcatcaga gatattaggc ctcctgagaa tattaggaga wggatataga 60
ctttcatgcc tgttcagatg ccaggtttca atactaattc t 101
Claims (10)
1. Use of a substance for detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the genome of watermelon is T or A or T and A in any one of the following:
(A) identifying or assisting in identifying the hardness of watermelon pulp;
(B) preparing a product for identifying or assisting in identifying the pulp hardness of the watermelon;
(C) identifying or assisting in identifying whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety;
(D) preparing a product for identifying or assisting in identifying whether the watermelon to be detected is a hard pulp watermelon variety or a non-hard pulp watermelon variety;
(E) breeding a hard-meat watermelon variety;
(F) preparing a product for breeding a hard-meat watermelon variety;
(G) breeding a non-hard-meat watermelon variety;
(H) preparing products for breeding non-hard-meat watermelon varieties.
2. Use according to claim 1, characterized in that: a substance for detecting whether the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the watermelon genome is T, A or T and A is a set of primers or a reagent or a kit containing the set of primers;
the primer set contains two upstream primers and one downstream primer;
the upstream primers are designed according to 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome and an upstream sequence thereof, the 3 'terminal deoxyribonucleotide of one upstream primer is 13317084 th deoxyribonucleotide T on chromosome 6 in the watermelon genome, and the 3' terminal deoxyribonucleotide of the other upstream primer is 13317084 th deoxyribonucleotide A on chromosome 6 in the watermelon genome; the downstream primer is designed according to the downstream sequence of 13317084 th deoxyribonucleotide on No. 6 chromosome in the watermelon genome.
3. Use according to claim 2, characterized in that: the primer set is a primer set consisting of a single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.1 or a derivative thereof, a single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.2 or a derivative thereof and a single-stranded DNA molecule shown in SEQ ID No. 3.
4. Use according to claim 3, characterized in that: the derivative of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.1 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.1 is connected with a specific fluorescent label sequence A;
the derivative of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.2 is that the 5' end of the single-stranded DNA molecule shown in 22 th to 46 th positions of SEQ ID No.2 is connected with a specific fluorescent label sequence B.
5. Use according to claim 4, characterized in that: the reagent or the kit also contains a fluorescent probe A, a fluorescent probe B, a quenching probe A and a quenching probe B;
the fluorescent probe A is a sequence consistent with the specific fluorescent label sequence A, and the 5' end is connected with a fluorescent reporter group A; the quenching probe A is a reverse complementary sequence of the specific fluorescent label sequence A, and the 3' end is connected with a fluorescent quenching group;
the fluorescent probe B is a sequence consistent with the specific fluorescent label sequence B, and the 5' end is connected with a fluorescent reporter group B; the quenching probe B is a reverse complementary sequence of the specific fluorescent label sequence B, and the 3' end is connected with a fluorescent quenching group;
further, the specific fluorescent tag sequence A is a fluorescent tag sequence FAM, and the specific fluorescent tag sequence B is a fluorescent tag sequence HEX; the fluorescence reporter group A is FAM, and the fluorescence reporter group B is HEX; the fluorescence quenching group is BHQ.
6. Any one of the following methods:
the method A comprises the following steps: a method for detecting whether a deoxyribonucleotide at 13317084 th position on chromosome 6 in a watermelon genome is T, A or T and A, which comprises the following steps (A1) or (A2):
(A1) direct sequencing;
(A2) performing PCR amplification on the watermelon genomic DNA to be detected by using the reagent or the kit of claim 5, scanning the amplified product with a fluorescent signal, and then determining whether the 13317084 th deoxyribonucleotide on the chromosome 6 in the watermelon gene to be detected is T or A or T and A according to the following steps:
if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorophore A, the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of T;
if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorophore B, the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of A;
if the fluorescence signal of the amplification product of the watermelon to be detected is the signal of the fluorophore A and the fluorophore B, the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a heterozygote of T and A;
the method B comprises the following steps: a method for identifying or assisting in identifying whether a watermelon to be tested is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety comprises the following steps:
(B1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(B2) determining whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety as follows:
if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of A, the watermelon to be detected is or is a candidate watermelon variety with hard meat;
if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is not the homozygote of A, the watermelon to be detected is or is selected as a non-hard pulp watermelon variety;
further, if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a homozygote of T, the watermelon to be detected is or is selected as a soft-flesh watermelon variety; if the 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome of the watermelon to be detected is a hybrid of T and A, the watermelon to be detected is or is selected as a medium-hard-meat watermelon variety;
the method C comprises the following steps: a method for breeding a hard-meat watermelon variety comprises the following steps:
(C1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(C2) selecting to-be-tested watermelons of which 13317084 th deoxyribonucleotide on the No. 6 chromosome in a genome is a homozygote of A as parents for breeding, selecting watermelons of which 13317084 th deoxyribonucleotide on the No. 6 chromosome in the genome is a homozygote of A in each generation of breeding, and finally obtaining a watermelon variety with hard meat;
the method D comprises the following steps: a method for breeding a non-hard pulp watermelon variety comprises the following steps:
(D1) detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A;
(D2) selecting a watermelon to be tested, wherein 13317084 th deoxyribonucleotide on the 6 th chromosome in a genome is a homozygote of T, as a parent to breed, selecting the watermelon, wherein 13317084 th deoxyribonucleotide on the 6 th chromosome in the genome is a homozygote of T, in each generation of breeding, and finally obtaining a non-hard-flesh watermelon variety.
7. The method of claim 6, wherein: the method B, the method C and the method D, wherein the method for detecting whether the 13317084 th deoxyribonucleotide on chromosome 6 in the watermelon genome is T or A or T and A is the method A.
8. A substance having at least one function selected from the group consisting of (a) to (d) as described in any one of claims 1 to 5, for detecting whether T or A or T and A is the deoxyribonucleotide at position 13317084 on chromosome 6 in the genome of watermelon;
(a) identifying or assisting in identifying the hardness of watermelon pulp;
(b) identifying or assisting in identifying whether the watermelon to be detected is a hard-pulp watermelon variety or a non-hard-pulp watermelon variety;
(c) breeding a hard-meat watermelon variety;
(d) and (5) breeding a non-hard-meat watermelon variety.
9. Use of the method of claim 6 or 7 or the substance of claim 8 in molecular marker assisted breeding of watermelon.
10. The use or method or substance of any one of claims 1-9, wherein: the hard pulp watermelon is pulp with hardness value greater than or equal to 12.5Kg/cm2The watermelon of (1);
the hardness value of the pulp of the non-hard pulp watermelon is less than 12.5Kg/cm2The watermelon of (1);
further, the soft-flesh watermelon has a flesh hardness value less than 8Kg/cm2The watermelon of (1); the hardness value of the medium hard pulp watermelon is more than or equal to 8Kg/cm2And less than 12.5Kg/cm2The watermelon of (1).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011446976.3A CN114606332B (en) | 2020-12-09 | 2020-12-09 | SNP locus for judging pulp hardness of watermelon, hf-KASP1 marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011446976.3A CN114606332B (en) | 2020-12-09 | 2020-12-09 | SNP locus for judging pulp hardness of watermelon, hf-KASP1 marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114606332A true CN114606332A (en) | 2022-06-10 |
| CN114606332B CN114606332B (en) | 2023-11-07 |
Family
ID=81857151
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011446976.3A Active CN114606332B (en) | 2020-12-09 | 2020-12-09 | SNP locus for judging pulp hardness of watermelon, hf-KASP1 marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114606332B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115449562A (en) * | 2022-10-25 | 2022-12-09 | 中国农业科学院郑州果树研究所 | SNP (Single nucleotide polymorphism) marker related to soluble solid content of watermelon fruit and application thereof |
| CN115852025A (en) * | 2022-10-25 | 2023-03-28 | 广东省农业科学院蔬菜研究所 | SNP molecular marker linked with wax gourd pulp quality main effect QTL and application thereof |
| CN115927734A (en) * | 2022-12-26 | 2023-04-07 | 上海市农业科学院 | KASP molecular marker for identifying pear fruit hardness, KASP primer and application thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060005284A1 (en) * | 2004-07-02 | 2006-01-05 | Greg Tolla | Watermelon with improved processing qualities |
| CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
| US20090077683A1 (en) * | 2007-09-17 | 2009-03-19 | Donghoon Yang | Watermelon line wnv142-1115 |
| CN102220315A (en) * | 2011-04-15 | 2011-10-19 | 北京市农林科学院 | Watermelon complete genomic sequence information based analyzed and developed SSR core primer combinations and application thereof |
| CN106011284A (en) * | 2016-07-25 | 2016-10-12 | 北京市农林科学院 | Watermelon flesh harness-related molecular marker Hf2-Indel and application thereof |
| CN106148526A (en) * | 2016-07-11 | 2016-11-23 | 北京市农林科学院 | A kind of molecular marker Hf1 Indel relevant to watermelon flesh hardness and application thereof |
| CN108770332A (en) * | 2015-10-06 | 2018-11-06 | 纽海姆有限公司 | With cucumber vein yellows poison（CVYV）The watermelon plant of resistance |
| EP3517615A1 (en) * | 2011-08-31 | 2019-07-31 | Seminis Vegetable Seeds, Inc. | Methods and compositions for watermelon firmness |
| CN110195062A (en) * | 2019-05-21 | 2019-09-03 | 浙江大学 | The KASP molecular labeling and application thereof of watermelon anti-cracking character |
-
2020
- 2020-12-09 CN CN202011446976.3A patent/CN114606332B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060005284A1 (en) * | 2004-07-02 | 2006-01-05 | Greg Tolla | Watermelon with improved processing qualities |
| CN101365786A (en) * | 2005-12-01 | 2009-02-11 | 克罗普迪塞恩股份有限公司 | Plants having improved growth characteristics and methods for making the same |
| US20090077683A1 (en) * | 2007-09-17 | 2009-03-19 | Donghoon Yang | Watermelon line wnv142-1115 |
| CN102220315A (en) * | 2011-04-15 | 2011-10-19 | 北京市农林科学院 | Watermelon complete genomic sequence information based analyzed and developed SSR core primer combinations and application thereof |
| EP3517615A1 (en) * | 2011-08-31 | 2019-07-31 | Seminis Vegetable Seeds, Inc. | Methods and compositions for watermelon firmness |
| CN108770332A (en) * | 2015-10-06 | 2018-11-06 | 纽海姆有限公司 | With cucumber vein yellows poison（CVYV）The watermelon plant of resistance |
| CN106148526A (en) * | 2016-07-11 | 2016-11-23 | 北京市农林科学院 | A kind of molecular marker Hf1 Indel relevant to watermelon flesh hardness and application thereof |
| CN106011284A (en) * | 2016-07-25 | 2016-10-12 | 北京市农林科学院 | Watermelon flesh harness-related molecular marker Hf2-Indel and application thereof |
| CN110195062A (en) * | 2019-05-21 | 2019-09-03 | 浙江大学 | The KASP molecular labeling and application thereof of watermelon anti-cracking character |
Non-Patent Citations (8)
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115449562A (en) * | 2022-10-25 | 2022-12-09 | 中国农业科学院郑州果树研究所 | SNP (Single nucleotide polymorphism) marker related to soluble solid content of watermelon fruit and application thereof |
| CN115852025A (en) * | 2022-10-25 | 2023-03-28 | 广东省农业科学院蔬菜研究所 | SNP molecular marker linked with wax gourd pulp quality main effect QTL and application thereof |
| CN115852025B (en) * | 2022-10-25 | 2023-09-12 | 广东省农业科学院蔬菜研究所 | SNP molecular marker linked with main effect QTL of white gourd flesh texture and application thereof |
| CN115927734A (en) * | 2022-12-26 | 2023-04-07 | 上海市农业科学院 | KASP molecular marker for identifying pear fruit hardness, KASP primer and application thereof |
| CN115927734B (en) * | 2022-12-26 | 2024-04-05 | 上海市农业科学院 | KASP molecular marker for identifying hardness of pear fruit, KASP primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114606332B (en) | 2023-11-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3789506B1 (en) | Prunus mume pendulous trait snp molecular markers and use thereof | |
| CN114606332B (en) | SNP locus for judging pulp hardness of watermelon, hf-KASP1 marker and application thereof | |
| CN110295248B (en) | KASP molecular marker for detecting Chinese cabbage wax powder character and application thereof | |
| CN105256031B (en) | Utilize the method and its primer special of high-throughput molecular labeling transformation muskmelon female series | |
| CN110438252B (en) | Molecular marker closely linked with male and female sex of spinach and application thereof | |
| CN109988862B (en) | PCR (polymerase chain reaction) marker related to male sterility of dominant nuclear gene of cabbage and application of PCR marker | |
| CN111979349B (en) | Main effect QTL and SNP molecular marker for controlling lotus flower color character, detection primer and application thereof | |
| CN109295179B (en) | Method for screening wheat with different zinc content and iron content and special kit thereof | |
| CN111961753B (en) | SNP (Single nucleotide polymorphism) marker related to resistance gene of pepper and tomato leaf blight virus, and specific primer and application thereof | |
| CN109593876A (en) | The KASP label serotype specific primer group and its application of high throughput detection AhFAD2B gene mutation site | |
| CN111471790B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-7D.1 and application thereof | |
| CN109609687B (en) | KASP marker primer combination for detecting watermelon fusarium wilt resistance and application thereof | |
| KR101979218B1 (en) | Composition for determining bud mutation cultivar of Fuji apple | |
| CN117887895B (en) | KASP molecular marker for pumpkin fruit length character and application thereof | |
| CN105200144A (en) | High-flux molecular marker for identifying pulp color of Cucumis melo L. and special primer for high-flux molecular marker | |
| CN112575102B (en) | Main effect QTL for controlling lotus seed heart skin number, SNP molecular marker, KASP detection primer group and application | |
| CN107619875B (en) | Insertion deletion marker locus for identifying watermelon fruit shape, primer and application | |
| CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof | |
| CN111647677B (en) | Molecular marker closely linked with wheat grain filling rate QTL QGfr. sicau-6D and application | |
| CN110283929B (en) | SNP (single nucleotide polymorphism) marker 5-160 related to pepper phytophthora blight resistance gene as well as specific primer and application thereof | |
| CN112251535A (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN114480721A (en) | Method for identifying whether melon variety to be detected is thin-skin melon or thick-skin melon and special SNP primer combination thereof | |
| CN110358855B (en) | SNP (Single nucleotide polymorphism) marker 5-156 of pepper phytophthora disease resistance gene as well as specific primer and application thereof | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |