CN110512023B - Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence - Google Patents
Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence Download PDFInfo
- Publication number
- CN110512023B CN110512023B CN201910832044.3A CN201910832044A CN110512023B CN 110512023 B CN110512023 B CN 110512023B CN 201910832044 A CN201910832044 A CN 201910832044A CN 110512023 B CN110512023 B CN 110512023B
- Authority
- CN
- China
- Prior art keywords
- mon89788
- soybean
- probe
- transgenic
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for rapidly identifying the genotype of a transgenic soybean MON89788 individual plant, and relates to a rapid identification technology of transgenic soybean MON89788 homozygous individual plant (single plant) and heterozygous individual plant in the fields of transgenic breeding and transgenic standard substance production. Primers and probes are designed according to soybean genome sequences at two sides of the exogenous gene insertion site of the transgenic soybean MON 89788. The primer probe combination and the MON89788 transformant specific primer probe combination are used together, so that homozygous single strains and heterozygous single strains of the transgenic soybean MON89788 can be quickly identified. The invention solves the problem that a method for quickly identifying the transgenic soybean MON89788 genotype is lacked in the cultivation of the transgenic soybean and the development of transgenic standard substances, and by applying the method, the homozygous single plant and the heterozygous single plant of the transgenic soybean MON89788 can be quickly and economically identified, so that the labor cost and the economic cost are reduced.
Description
Technical Field
The invention relates to an identification technology of the genotype of raw materials in the field of transgenic breeding and transgenic standard substance development, in particular to the design of primers/probes for identifying the genotype of a MON89788 soybean transformant and application thereof.
Background
With the rapid development of biotechnology industry, new transgenic varieties are continuously introduced and industrialized, and meanwhile, in order to supervise and mark the transgenic varieties in the industrialized and field test stages, transgenic detection standard substances need to be developed. In the process of cultivating transgenic varieties, characters of mature transformants are often transferred to varieties with better comprehensive characters through hybridization, and a large number of individual progeny plants need to be screened in the process of transfer. When the homozygous transgenic single plant and the heterozygous transgenic single plant are subjected to transgenic detection, the detection results are positive, and the homozygous single plant and the heterozygous single plant cannot be accurately identified. In actual production, a segregation test is usually adopted for identification, the progeny of a single plant needs to be planted for one generation, the progeny single plant is subjected to PCR detection again, the PCR result is counted, whether the transgenic character is segregated in the progeny and the segregation condition is analyzed, and then whether the parent plant is a homozygote or a heterozygote is judged. This type of genotyping is not only time consuming, but also labor intensive. Because the homozygous individual plant and the heterozygous individual plant have different transgenic contents, the genotype of the transgenic individual plant can also be identified by adopting real-time fluorescent quantitative PCR and digital PCR technologies, but the quantitative principle of the fluorescent quantitative PCR causes the identification deviation easily when the content difference of 2 times is identified, and the result is unreliable. And the genotype identification is carried out by adopting the digital PCR, and both reagents and a platform are very expensive, so that the method is not suitable for large-scale identification.
In the production of transgenic detection standard substances, the genotype identification of raw materials is involved. An important quantity value of the transgenic detection standard substance is the transgenic content, and the determination of the transgenic content is closely related to the genotype of the raw material. The transgene content is 100% at the DNA level for homozygous individuals or homozygous seeds, and 50% at the DNA level for heterozygous individuals or heterozygous seeds. In order to protect intellectual property, the raw materials provided by developers for developing standard substances are usually inactivated seeds, and the genotype of the seeds cannot be determined by separation tests. And the identification of the standard substance raw material not only needs to identify the genotype but also needs to carry out single-grain identification so as to determine the purity of the seeds. The cost of standard substance production is greatly increased by the quantitative PCR technology, and the workload is huge.
Under the background, a primer/probe combination MON89788-QF/MON89788-QR/MON89788-QP is designed by analyzing the genome sequence of the exogenous gene insertion site of the transgenic soybean MON89788, the primer/probe combination is combined with a MON89788 transformant specific detection primer/probe combination MON89788-F/MON89788-R/MON89788-P for use, the quick and economic qualitative detection of the homozygous single plant (homozygous seed) and the heterozygous single plant (heterozygous seed) of the transgenic soybean MON89788 can be realized on a common PCR platform or a real-time fluorescent PCR platform, the detection result is accurate and reliable, and the identification principle is shown in figure 1.
Disclosure of Invention
The invention aims to solve the problems of the lack of a transgenic soybean MON89788 homozygous single plant (homozygous seed) and the rapid and economic identification method of a heterozygous single plant (heterozygous seed), the soybean genome sequence at both sides of the insertion site of the exogenous gene of the transgenic soybean MON89788 and the insertion site sequence of the receptor genome are analyzed, and a primer/probe combination MON89788-QF/MON89788-QR/MON89788-QP is designed according to the insertion site sequence of the transgenic soybean MON89788 receptor genome, so that a rapid, economic and reliable method is provided for the identification of the transgenic soybean MON89788 homozygous single plant (homozygous seed) and the heterozygous single plant (heterozygous seed).
One aspect of the invention provides a specific common PCR detection primer composition for a receptor genomic insertion site of transgenic soybean MON 89788:
MON89788-QF 5′—CCTCTTGGCTTTTCTAAG—3′SEQ ID No.1
MON89788-QR 5′—GAAGGTGGTAGTCACTAG—3′SEQ ID No.2。
another aspect of the invention provides a primer and probe composition for specific real-time fluorescent PCR detection of the receptor genomic insertion site of transgenic soybean MON 89788:
MON89788-QF 5′—CCTCTTGGCTTTTCTAAG—3′SEQ ID No.1
MON89788-QR 5′—GAAGGTGGTAGTCACTAG—3′SEQ ID No.2
MON89788-QP 5′—CGTGGTCATGTTGATATCTTTGAGC—3′SEQ ID No.3。
in another aspect of the invention, there is provided a composition for general PCR detection for genotyping transgenic soybean MON89788, comprising:
the invention relates to a specific detection primer composition of a receptor genome insertion site of transgenic soybean MON89788,
second primer pair for MON89788 transformant:
MON89788-F 5′-TCCCGCTCTAGCGCTTCAAT-3′SEQ ID No.4
MON 89788-R5 '-TCGAGCAGGACCTGCAGAA-3' SEQ ID No.5; and
and (3) marking a gene lec primer pair in soybean.
Another aspect of the invention provides a composition for real-time fluorescent PCR detection for genotype identification of transgenic soybean MON89788, comprising:
the invention relates to a specific detection primer and a probe composition for a receptor genome insertion site of transgenic soybean MON89788,
second primer pair and second probe composition for MON89788 transformants:
MON89788-F 5′-TCCCGCTCTAGCGCTTCAAT-3′SEQ ID No.4
MON89788-R 5′-TCGAGCAGGACCTGCAGAA-3′SEQ ID No.5
MON 89788-P5 '-CTGAAGGCGGGAAACGACAATCTG-3' SEQ ID No.6; and
a soybean internal standard gene lec primer pair and a probe composition.
In the technical scheme of the invention, the soybean internal standard gene lec primer pair is as follows:
lec-F 5′-GCCCTCTACTCCACCCCCA-3′SEQ ID No.7
lec-R 5′-GGCGAAGCTGGCAACG-3′SEQ ID No.8，
in the technical scheme of the invention, the soybean internal standard gene lec probe is as follows:
lec-P 5′-AGCTTCGCCGCTTCCTTCAACTTCAC-3′SEQ ID No.9。
in another aspect, the invention provides a specific detection method for the genomic insertion site of the transgenic soybean MON89788 receptor, wherein the method is a general PCR method, and the detection method is performed by using the composition for general PCR detection, preferably:
amplifying a primer composition for detecting the specificity of the receptor genome insertion site of the transgenic soybean MON89788, a second primer pair of a MON89788 transformant and a soybean internal standard gene lec primer pair on a common PCR instrument;
in the amplification result, the soybean internal standard gene lec primer pair and the second primer pair are amplified with strips, and are judged to be homozygote; 3 sets of primer pairs have amplification products and are judged to be heterozygotes; and only the specific detection primer composition of the soybean internal standard gene lec primer pair and the receptor genome insertion site has amplification products, and the sample is judged to be a negative sample.
In another aspect, the invention provides a method for detecting the specificity of the genomic insertion site of the receptor of the transgenic soybean MON89788, wherein the method is a real-time fluorescent PCR method, and the composition for real-time fluorescent PCR detection is adopted for detection, preferably:
amplifying a primer pair and a probe composition by respectively using the receptor genome insertion site specificity of the transgenic soybean MON89788, a second primer pair and a second probe of a MON89788 transformant, a soybean internal standard gene lec primer pair and a probe composition on a real-time fluorescent PCR instrument;
in the amplification result, the soybean internal standard gene lec primer pair and the probe composition, and the second primer pair and the second probe have typical amplification curves in amplification, and are judged to be homozygotes; 3, judging the primer pairs and the probe compositions to be heterozygotes, wherein the primer pairs and the probe compositions have typical amplification curves; only the soybean internal standard gene lec primer pair and the probe composition and the receptor genome insertion site specificity detection primer composition have a typical amplification curve, and are judged as negative samples.
In another aspect, the invention provides an application of the receptor genome insertion site specific detection primer composition in preparation of a kit for detecting transgenic soybean MON 89788.
In yet another aspect, the invention provides uses of receptor genomic insertion site specific detection primers and probe compositions for transgenic soybean MON89788 in the preparation of kits for detecting transgenic soybean MON 89788.
In another aspect, the invention provides the use of a composition for general PCR detection of transgenic soybean MON89788 in the preparation of a kit for detecting transgenic soybean MON 89788.
In another aspect, the invention provides an application of the composition for real-time fluorescent PCR detection of transgenic soybean MON89788 in preparation of a kit for detecting transgenic soybean MON 89788.
In the technical scheme of the invention, SEQ ID No.10 is a nucleotide sequence of soybean MON89788 with a deletion of a receptor genome insertion site in a genetic transformation process. SEQ ID No.10 is as follows:
caatcgtggt catgttgata tctttgagct catcacattc tttactgacc。
in the technical scheme of the invention, SEQ ID No.11 is an amplification sequence of soybean MON89788 receptor genome insertion site specific PCR. SEQ ID No.11 is as follows:
cctcttggct tttctaagtt tgagctcgtt actgctgccc cacaaagccc ctcgaaacttgttcctgctc cactcttcct tttgggcttt tttgtttccc gctctagcgc ttcaatcgtggtcatgttga tatctttgag ctcatcacat tctttactga ccctagtgac taccaccttc
the purpose of the invention is realized as follows:
1. design of primer/probe combinations
Currently, a transformant-specific detection method for transgenic soybean MON89788 has been developed, which can specifically identify the components of the MON89788 transformant contained in a sample, but the genotype identification of MON89788 seeds and individuals on a qualitative PCR platform is difficult to realize only by using the transformant-specific detection method. By analyzing the molecular characteristics of MON89788 homozygote and heterozygote, a primer MON89788-QF/MON89788-QR is respectively designed at two sides of the insertion site of the foreign gene, a probe MON89788-QP is designed on the nucleotide sequence deleted at the insertion site, and the amplification product crosses the insertion site. For MON89788 homozygotes, which have foreign gene insertion on both chromosomes, only MON89788 transformant-specific primer/probe combination MON89788F/MON89788R/MON89788P has a typical amplification curve by controlling PCR extension time; for the MON89788 hybrid, with an exogenous gene insertion on one chromosome and no exogenous gene insertion on one chromosome, both primer probe combinations MON89788-QF/MON89788-QR/MON89788-QP and MON89788F/MON89788R/MON89788P had typical amplification curves; for negative plants, only the primer probe combination MON89788-QF/MON89788-QR/MON89788-QP had a typical amplification curve. The schematic diagram of the principle of the identification of homozygote and heterozygote of transgenic soybean MON89788 is shown in FIG. 1.
The primer probe sequence designed by the invention is as follows: the primers MON89788-QF5 '-CCTCTTGGCTTTTCTAAG-3' (SEQ ID No. 1) and MON89788-QR5 '-GAAGGTGGTAGTCACTAG-3' (SEQ ID No. 2), the probe MON89788-QP5 '-CGTGGTCATGTTGATATCTTTGAGC-3' (SEQ ID No. 3), and the amplified target sequence is 180bp long, as shown in SEQ ID No. 11. The positions of the primers and probes on the target sequence are shown in FIG. 2.
2. Use of primer/probe combinations
Synthesizing the primer/probe, the specific primer/probe of the MON89788 transformant and the primer probe of the soybean internal standard gene soybean gene. Total DNA of the transgenic soybean MON89788 sample was extracted and PCR amplification was performed on the sample genomic DNA using the internal standard gene soybean, MON89788 transformants and the primer pairs or primer/probe combinations of the invention, respectively. Separating the common PCR product by agarose gel electrophoresis, and identifying whether an amplification product exists after EB dyeing; and judging whether the real-time fluorescent PCR product has an amplification product according to whether a typical amplification curve exists. The genotype of each sample is determined based on the amplification result of each primer pair or primer/probe combination.
Compared with the prior art, the invention has the following advantages and positive effects:
(1) Accurately judging the genotype of a sample to be detected through qualitative PCR on a common PCR or real-time fluorescent PCR platform;
(2) The homozygote or the heterozygote is not required to be identified through a field separation test, so that the labor, time and economic cost are saved;
(3) Provides the identification of the genotype of the original material in the field of transgenic breeding and transgenic standard substance development
An accurate, fast and economical method is provided.
Drawings
FIG. 1 is a schematic diagram showing the principle of homozygote and heterozygote identification of transgenic soybean MON 89788;
FIG. 2 is a schematic diagram showing the position of a primer probe designed on a target sequence;
FIG. 3 electrophoretograms of homozygous, heterozygous and negative individuals of transgenic soybean MON89788 were identified using common qualitative PCR.
FIG. 4 amplification profiles for identification of transgenic soybean MON89788 homozygous, heterozygous and negative individuals using real-time fluorescent PCR.
Detailed Description
The invention is described in detail below with reference to the following figures and examples:
1. design of primer/probe combinations
(one) determination of Soybean genomic sequence at the site of insertion of transgenic Soybean MON89788
Collecting two side border sequences of an exogenous gene insertion site in the transgenic soybean MON89788, splicing the border sequences at two sides together, and carrying out comparison analysis with a genome sequence of the soybean to find that a 50bp nucleotide sequence (SEQ NO. 10) is deleted in the soybean genome at the insertion site in the process of inserting the exogenous gene into the soybean genome. The soybean genomic sequence at the insertion site of MON89788 transformants was determined by alignment.
(II) design of primer/Probe combinations
Primers MON89788-QF5 '-CCTCTTGGCTTTTCTAAG-3' SEQ ID No.1 and MON89788-QR5 '-GAAGGTGGTAGTCACTAG-3' SEQ ID No.2 were designed, respectively, on the soybean genomic sequences flanking the insertion site using Primer design software Primier Primer 5 software; a probe MON89788-QP5 '-CGTGGTCATGTTGATATCTTTGAGC-3' SEQ ID No.3 was designed on the deleted nucleotide sequence using Beacon Design software. The length of the amplified sequence is 180bp (SEQ NO. 11), and the positions of the primer probes on the nucleotide sequence are shown in FIG. 2.
2. Application method
(I) identification of genotype of transgenic soybean MON89788 on common PCR platform
Using single plant or seed of transgenic soybean MON89788 as a test sample, and using primer pair MON89788-QF/MON89788-QR, MON89788 transformant primer pair MON89788-F (5 '-TCCCGCTCTAGCGCTTCAAT-3' SEQ ID No. 4)/MON 89788-R (5 '-TCGAGCAGGACCTGCAGAA-3' SEQ ID No. 5), soybean internal standard gene soybean primer pair lecF2 (5 '-GCCCTCTACTCCACCCCCA-3' SEQ ID No. 7)/lecR 2 (5 '-GGCGAAGCTGGCAACG-3' SEQ ID No. 8) designed in the present invention, and genomic DNA extracted as a template, each sample was homozygote or heterozygote identified.
The PCR reaction employed 25ul of reaction system containing 1 uL of DNA template, 1 XPCR Buffer (containing 10mMTris HCl pH8.3, KCl 50mM), 200uM dNTPs,2.5mM MgCl2, 250nM forward and reverse primers, 1U of DNA Taq enzyme. The reaction procedure was pre-denaturation at 94 ℃ for 2 min, at 94 ℃ for 15 sec, at 60 ℃ for 30 sec, at 72 ℃ for 30 sec, with 35 cycles, and incubation at 72 ℃ for 2 min. The PCR products were separated by agarose gel electrophoresis and EB staining was followed to identify the presence of amplification products.
(II) identifying the genotype of the transgenic soybean MON89788 on a real-time fluorescent PCR platform
The hybrid of the primer/probe combination MON89788-QF/MON89788-QR/MON89788/QP and MON89788 transformant primer/probe combination MON89788-F (5 '-TCCCGCTCTAGCGCTTCAAT-3' SEQ ID No. 4)/MON 89788R (5 '-TCGAGCAGGACCTGCAGAA-3' SEQ ID No. 5)/MON 89788P (5 '-CTGAAGGCGGGAAACGACAATCTG-3' SEQ ID No. 6), the primer/probe combination soybean of soybean internal standard gene, lecF2 (5 '-GCCCTCTACTCCACCCCCA-3) and lec ID No. 7)/lec 2 (5' -3536 zxft SEQ ID No. 7)/lec 2 (5 '-3536 zxft 3926-3536-3') was extracted using the single strain or single seed of transgenic soybean MON89788 as the test sample, and the genomic DNA samples were identified as pure genomic DNA samples.
Real-time fluorescent PCR analysis was performed on a CFX96PCR instrument with 20. Mu.L of PCR reaction containing 1. Mu.L of DNA template, 1 XPCR buffer,1U of Taq DNA polymerase, 4.5mM MgCl2, 300. Mu.M dNTPs,200nM forward and reverse primers, 100nM probe. PCR reaction procedure: after pre-denaturation at 50 ℃ for 2 min and 95 ℃ for 10 min, 50 PCR cycles were performed: denaturation at 95 ℃ for 15 seconds, annealing and extension at 60 ℃ for 1 minute, and collection of fluorescence signals.
4. Results of the experiment
(I) identifying the genotype of MON89788 soybean by common PCR method
Three general PCR primer pairs were used: the invention designs a primer pair MON89788-QF/MON89788-QR, a MON89788 transformant primer pair MON89788-F/MON89788-R and a soybean internal standard gene soybean primer pair lecF2/lecR2, and amplifies the genomic DNA extracted from a single strain or a single seed. Some samples only have amplified bands of soybean internal standard gene Lectin and MON89788 transformants, and are judged to be homozygotes; 3 primer pairs of some samples have amplification products, and the samples are judged to be heterozygotes; some samples only contain soybean internal standard gene soybean and the primer pair designed by the invention, and are judged as negative samples (figure 3). The experimental result is in line with the expectation, and the homozygote and the heterozygote of the transgenic soybean MON89788 can be accurately identified.
(II) identifying the genotype of MON89788 soybean by adopting a real-time fluorescent PCR method
Three primer/probe combinations were used: the primer probe combination MON89788-QF/MON89788-QR/MON89788-QP, the MON89788 transformant primer probe combination MON89788-F/MON89788-R/MON89788-P, the soybean internal standard gene soybean primer probe combination lecF2/lecR2/LecP2 and the genomic DNA extracted from the amplified single strain or single seed. Some samples only have a typical amplification curve of soybean internal standard gene Lectin and MON89788 transformants, and are judged to be homozygotes; all 3 primer probe combinations in some samples have amplification products, and the samples are judged to be heterozygotes; some samples only contain the soybean internal standard gene Lectin and the primer probe designed by the invention, and the amplification product is combined, so that the samples are judged to be negative samples (figure 4). The experimental result is identical with the expectation, and the homozygote and heterozygote of the transgenic soybean MON89788 can be accurately identified.
SEQUENCE LISTING
<110> institute of oil crop of academy of agricultural sciences of China
<120> method for identifying genotype of soybean transformant MON89788 established based on insertion site genomic sequence
<130> CP11903959C
<160> 11
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
cctcttggct tttctaag 18
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
gaaggtggta gtcactag 18
<210> 3
<211> 25
<212> DNA
<213> Artificial sequence
<400> 3
cgtggtcatg ttgatatctt tgagc 25
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
tcccgctcta gcgcttcaat 20
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence
<400> 5
tcgagcagga cctgcagaa 19
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence
<400> 6
ctgaaggcgg gaaacgacaa tctg 24
<210> 7
<211> 19
<212> DNA
<213> Artificial sequence
<400> 7
gccctctact ccaccccca 19
<210> 8
<211> 16
<212> DNA
<213> Artificial sequence
<400> 8
ggcgaagctg gcaacg 16
<210> 9
<211> 26
<212> DNA
<213> Artificial sequence
<400> 9
agcttcgccg cttccttcaa cttcac 26
<210> 10
<211> 50
<212> DNA
<213> Artificial sequence
<400> 10
caatcgtggt catgttgata tctttgagct catcacattc tttactgacc 50
<210> 11
<211> 180
<212> DNA
<213> Artificial sequence
<400> 11
cctcttggct tttctaagtt tgagctcgtt actgctgccc cacaaagccc ctcgaaactt 60
gttcctgctc cactcttcct tttgggcttt tttgtttccc gctctagcgc ttcaatcgtg 120
gtcatgttga tatctttgag ctcatcacat tctttactga ccctagtgac taccaccttc 180
Claims (4)
1. A composition for transformant-specific real-time fluorescent PCR detection of transgenic soybean MON89788, comprising:
receptor genomic insertion site specific real-time fluorescent PCR detection primer pairs and probe compositions for transgenic soybean MON 89788:
MON89788-QF 5′—CCTCTTGGCTTTTCTAAG—3′SEQ ID No.1
MON89788-QR 5′—GAAGGTGGTAGTCACTAG—3′SEQ ID No.2
MON89788-QP 5′—CGTGGTCATGTTGATATCTTTGAGC—3′SEQ ID No.3；
second primer pair and second probe composition for MON89788 transformants:
MON89788-F 5′-TCCCGCTCTAGCGCTTCAAT-3′SEQ ID No.4
MON89788-R 5′-TCGAGCAGGACCTGCAGAA-3′SEQ ID No.5
MON 89788-P5 '-CTGAAGGCGGGAAACGACAATCTG-3' SEQ ID No.6; and
the soybean internal standard gene lec primer pair and the probe composition comprise:
lec-F 5′-GCCCTCTACTCCACCCCCA-3′SEQ ID No.7
lec-R 5′-GGCGAAGCTGGCAACG-3′SEQ ID No.8，
lec-P 5′-AGCTTCGCCGCTTCCTTCAACTTCAC-3′SEQ ID No.9。
2. the genotype identification method of the transgenic soybean MON89788 is a real-time fluorescent PCR method, and adopts a composition for real-time fluorescent PCR detection to detect:
amplifying on a real-time fluorescent PCR instrument by detecting primer pairs and probe compositions, MON89788 transformant second primer pairs and second probe compositions, and soybean internal standard gene lec primer pairs and probe compositions by real-time fluorescent PCR specific for the receptor genomic insertion site of transgenic soybean MON89788 described in claim 1, respectively;
in the amplification result, only the soybean internal standard gene lec primer pair and the probe composition, and the second primer pair and the second probe composition of the MON89788 transformant are amplified to have a typical amplification curve, and are judged to be homozygotes; 3, judging the primer pairs and the probe compositions to be heterozygotes, wherein the primer pairs and the probe compositions have typical amplification curves; and judging that only the soybean internal standard gene lec primer pair and the probe composition and the receptor genome insertion site have a typical amplification curve in the specific real-time fluorescent PCR detection primer pair and the probe composition as a negative sample.
3. A kit for detecting transgenic soybean MON89788 comprising the composition for transformant-specific real-time fluorescent PCR detection of transgenic soybean MON89788 of claim 1.
4. Use of the kit of claim 3 for detecting a transgenic soybean MON89788 genotype;
performing real-time fluorescent PCR detection by using the kit, wherein in an amplification result, only a soybean internal standard gene lec primer pair and a probe composition, and a second primer pair and a second probe of the MON89788 transformant are amplified to have a typical amplification curve, and the sample is judged to be a homozygote; 3, judging the primer pairs and the probe compositions to be heterozygotes, wherein the primer pairs and the probe compositions have typical amplification curves; and only the soybean internal standard gene lec primer pair and the probe composition and the receptor genome insertion site specific real-time fluorescence PCR detection primer probe composition have a typical amplification curve, and are judged as negative samples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910832044.3A CN110512023B (en) | 2019-09-04 | 2019-09-04 | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910832044.3A CN110512023B (en) | 2019-09-04 | 2019-09-04 | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110512023A CN110512023A (en) | 2019-11-29 |
| CN110512023B true CN110512023B (en) | 2022-10-11 |
Family
ID=68630797
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910832044.3A Active CN110512023B (en) | 2019-09-04 | 2019-09-04 | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110512023B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111876522A (en) * | 2020-09-16 | 2020-11-03 | 天津市农业科学院 | Specific primer and method for quantitatively detecting transgenic soybean ZH10-6 |
| CN112063743A (en) * | 2020-09-16 | 2020-12-11 | 天津市农业科学院 | Method for accurately and quantitatively detecting transgenic herbicide-tolerant soybean ZH10-6 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006128095A2 (en) * | 2005-05-27 | 2006-11-30 | Monsanto Technology Llc | A method for disease control in mon89788 soybean |
| CN101775440A (en) * | 2010-02-05 | 2010-07-14 | 吉林省农业科学院 | Plasmid control molecule for detection of transgenic soybean and building method thereof |
| CN104726582A (en) * | 2015-03-17 | 2015-06-24 | 苏州华麦生物科技有限公司 | Probe method based constant temperature detection primer group, detection kit and detection method of genetically modified soybeans MON89788 |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8450561B2 (en) * | 2008-02-29 | 2013-05-28 | Monsanto Technology Llc | Corn plant event MON87460 and compositions and methods for detection thereof |
| CN103409498A (en) * | 2013-03-14 | 2013-11-27 | 海康生物科技（北京）有限公司 | Detection method and a kit of transgenic soybean MON89788 transformation event |
| KR20140135576A (en) * | 2013-05-16 | 2014-11-26 | 한국표준과학연구원 | Standard Plasmid for Detection of Genetically Modified Organism, Qualitative detection method using the same and Detection Kit comprising the same |
| CN103725777B (en) * | 2013-12-18 | 2015-07-15 | 南京佳邦食品有限公司 | Real-time fluorescence PCR (Polymerase Chain Reaction) method for rapidly detecting transgenic soybean MON89788 |
| CN109136338A (en) * | 2018-10-19 | 2019-01-04 | 浙江省农业科学院 | A kind of primer, probe and kit and method detecting genetically engineered soybean MON89788 |
-
2019
- 2019-09-04 CN CN201910832044.3A patent/CN110512023B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006128095A2 (en) * | 2005-05-27 | 2006-11-30 | Monsanto Technology Llc | A method for disease control in mon89788 soybean |
| CN101775440A (en) * | 2010-02-05 | 2010-07-14 | 吉林省农业科学院 | Plasmid control molecule for detection of transgenic soybean and building method thereof |
| CN104726582A (en) * | 2015-03-17 | 2015-06-24 | 苏州华麦生物科技有限公司 | Probe method based constant temperature detection primer group, detection kit and detection method of genetically modified soybeans MON89788 |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110512023A (en) | 2019-11-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107090504B (en) | SNP molecular marker combination for corn genotyping and application thereof | |
| CN107385024B (en) | Rice fertility restorer gene assisted breeding molecular marker and application thereof | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN110512023B (en) | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN106521018A (en) | Primer and method for high-flux detection of transgenic maize containing NOS terminator | |
| CN117683927A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN110373491B (en) | KASP molecular marker for detecting rice blast-resistant broad-spectrum gene Pi1 and application | |
| CN107988418B (en) | Primer group, kit and method for pure heterozygous identification of transgenic papaya YK16-0-1 transformant | |
| CN111378781A (en) | Molecular marker primer for quickly and efficiently identifying salt-tolerant gene SKC1 of rice and application | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN110551842B (en) | Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment | |
| CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
| CN108411030A (en) | The method of primer pair and the kit comprising it, purposes and the detection M. truncatula ecotype A17 and R108 | |
| CN110423826B (en) | C57BL/6 subline mouse KASP genetic detection kit and primer | |
| CN109913575B (en) | KASP molecular marker for identifying CMS male sterility restoring gene of pepper, kit and application thereof | |
| CN114164292A (en) | Development and application of KASP marker of rice blast resistance gene Pid4 | |
| CN112251519A (en) | Specific primer, probe, kit and method for identifying homozygote and heterozygote of Hulenbel short-tailed sheep | |
| CN112609018A (en) | SNP molecular marker of rice grain type related gene GLW2 and application thereof | |
| CN112251536A (en) | SNP molecular marker closely linked with bolting property of radish and application thereof | |
| CN108060258B (en) | Primer group, kit and method for pure heterozygous identification of cotton MON15985 transformant | |
| CN113637790B (en) | KASP molecular marker of stripe rust resistance gene YrAS2388R, primer, kit and application | |
| CN115261504B (en) | Molecular marker related to pear pollen abortion traits and screening method thereof | |
| CN113699273B (en) | SNP locus combination for detecting resistance of tomato root-knot nematode and application thereof | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |