CN110551842B - Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment - Google Patents
Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment Download PDFInfo
- Publication number
- CN110551842B CN110551842B CN201910832581.8A CN201910832581A CN110551842B CN 110551842 B CN110551842 B CN 110551842B CN 201910832581 A CN201910832581 A CN 201910832581A CN 110551842 B CN110551842 B CN 110551842B
- Authority
- CN
- China
- Prior art keywords
- mir604
- probe
- transgenic
- primer
- corn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for rapidly identifying the genotype of a transgenic corn MIR604 single plant (single plant), and relates to a rapid identification technology of transgenic corn MIR604 homozygous single plants and heterozygous single plants in the fields of transgenic breeding and transgenic standard substance production. According to the corn genome sequence on both sides of the exogenous gene insertion site of the transgenic corn MIR604, a primer and a probe are designed. The primer probe combination and the MIR604 transformant specific primer probe combination are used together, so that homozygous single plants and heterozygous single plants of the transgenic corn MIR604 can be quickly identified. The invention solves the problem that the method for quickly identifying the MIR604 genotype of the transgenic corn is lacked in the cultivation of the transgenic corn and the development of transgenic standard substances, and the application of the method can quickly and economically identify the MIR604 homozygous single plant and heterozygous single plant of the transgenic corn, thereby reducing the labor cost and the economic cost.
Description
Technical Field
The invention relates to the identification technology of the genotype of raw materials in the field of transgenic breeding and transgenic standard substance development, in particular to the design of a primer/probe for identifying the genotype of an MIR604 corn transformant and application thereof.
Background
With the rapid development of biotechnology industry, new transgenic varieties are continuously introduced and industrialized, and meanwhile, in order to supervise and mark the transgenic varieties in the industrialized and field test stages, transgenic detection standard substances need to be developed. In the process of cultivating transgenic varieties, characters of mature transformants are often transferred to varieties with better comprehensive characters through hybridization, and a large number of individual progeny plants need to be screened in the process of transfer. When the homozygous transgenic single plant and the heterozygous transgenic single plant are subjected to transgenic detection, detection results are positive, and the homozygous single plant and the heterozygous single plant cannot be accurately identified. In actual production, a segregation test is usually adopted for identification, the progeny of a single plant needs to be planted for one generation, the progeny single plant is subjected to PCR detection again, the PCR result is counted, whether the transgenic character is segregated in the progeny and the segregation condition are analyzed, and then whether the parent plant is a homozygote or a heterozygote is judged. This type of genotyping is not only time consuming, but also labor intensive. Because the homozygous individual plant and the heterozygous individual plant have different transgenic contents, the genotype of the transgenic individual plant can also be identified by adopting real-time fluorescent quantitative PCR and digital PCR technologies, but the quantitative principle of the fluorescent quantitative PCR causes the identification deviation easily when the content difference of 2 times is identified, and the result is unreliable. And the genotype identification is carried out by adopting the digital PCR, and both reagents and a platform are very expensive, so that the method is not suitable for large-scale identification.
In the production of transgenic detection standard substances, the genotype identification of raw materials is involved. An important quantity value of the transgenic detection standard substance is the transgenic content, and the determination of the transgenic content is closely related to the genotype of the raw material. The transgene content is 100% at the DNA level for homozygous individuals or homozygous seeds, and 50% at the DNA level for heterozygous individuals or heterozygous seeds. In order to protect intellectual property, the raw materials provided by developers for developing standard substances are usually inactivated seeds, and the genotype of the seeds cannot be determined by separation tests. And the identification of the standard substance raw material not only needs to identify the genotype but also needs to carry out single-grain identification so as to determine the purity of the seeds. The cost of standard substance production is greatly increased by the quantitative PCR technology, and the workload is huge.
Under the background, a primer/probe combination MIR604-QF/MIR604-QR/MIR604-QP is designed by analyzing the genome sequence of the exogenous gene insertion site of the transgenic corn MIR604, the primer/probe combination is combined with a MIR604 transformant specific detection primer/probe combination MIR604F/MIR604R/MIR604P for use, the quick and economic qualitative detection of the transgenic corn MIR604 homozygous single plant (homozygous seed) and the heterozygous single plant (heterozygous seed) can be realized on a common PCR platform or a real-time fluorescent PCR platform, the detection result is accurate and reliable, and the identification principle is shown in figure 1.
Disclosure of Invention
The invention aims to solve the problems of lack of a transgenic corn MIR604 homozygous single plant (homozygous seed) and a quick and economic identification method of a heterozygous single plant (heterozygous seed), analyze corn genome sequences at two sides of an exogenous gene insertion site of the transgenic corn MIR604 and an insertion site sequence of a receptor genome, design a primer/probe combination MIR604-QF/MIR604-QR/MIR604-QP according to the insertion site sequence of the transgenic corn MIR604 receptor genome, and provide a quick, economic and reliable method for identification of the transgenic corn MIR604 homozygous single plant (homozygous seed) and the heterozygous single plant (heterozygous seed).
One aspect of the invention provides a specific common PCR detection primer composition for a receptor genome insertion site of transgenic corn MIR 604:
MIR604-QF 5′—GACGCCAGATCACACATG—3′SEQ ID No.1
MIR604-QR 5′—CACACCTCGTTGCCAAAG—3′SEQ ID No.2。
the invention also provides a specific real-time fluorescent PCR detection primer and a probe composition of the receptor genome insertion site of the transgenic corn MIR604, wherein the specific real-time fluorescent PCR detection primer comprises the following components:
MIR604-QF 5′—GACGCCAGATCACACATG—3′SEQ ID No.1
MIR604-QR 5′—CACACCTCGTTGCCAAAG—3′SEQ ID No.2
MIR604-QP 5′—CGTGCCGATCTCGCACCAGCA—3′SEQ ID No.3。
in another aspect, the invention provides a composition for general PCR detection for identification of MIR604 genotype of transgenic corn, comprising:
the invention relates to a specific common PCR detection primer composition for a receptor genome insertion site of transgenic corn MIR604,
second primer pair of MIR604 transformant:
MIR604-1F 5′-TCGCGCGCGGTGTCATCTATG-3′SEQ ID No.4
MIR604-1R 5 '-CGCGACACACCTCGTTGAGTTAA-3' SEQ ID No.5; and
a maize internal standard gene zSSIIb primer pair.
In another aspect, the invention provides a composition for real-time fluorescent PCR detection for transgenic corn MIR604 genotype identification, comprising:
the invention relates to a specific detection primer and a probe composition for a receptor genome insertion site of transgenic corn MIR604,
MIR604 transformant third primer pair and third probe composition:
MIR604-F 5′-GCGCACGCAATTCAACAG-3′SEQ ID No.6
MIR604-R 5′-GGTCATAACGTGACTCCCTTAATTCT-3′SEQ ID No.7
MIR 604-P5 '-AGGCGGGAAACGACATCTGACTCATG-3' SEQ ID No.8; and
a corn internal standard gene zSSIIb primer pair and a probe composition.
In the technical scheme of the invention, the maize internal standard gene zSSIIb primer pair is as follows:
zSSIIb-F 5′-CGGTGGATGCTAAGGCTGATG-3′SEQ ID No.9
zSSIIb-R 5′-AAAGGGCCAGGTTCATTATCCTC-3′SEQ ID No.10，
in the technical scheme of the invention, the corn internal standard gene zSSIIb probe is as follows:
zSSIIb-P 5′-TAAGGAGCACTCGCCGCCGCATCTG-3′SEQ ID No.11。
in another aspect, the invention provides a specific detection method for the genomic insertion site of the MIR604 receptor of transgenic corn, wherein the method is a general PCR method, and the composition for general PCR detection is adopted for detection, preferably:
the specific detection primer composition of the receptor genome insertion site of the transgenic corn MIR604, the second primer pair of the MIR604 transformant and the primer pair of the corn internal standard gene zSSIIb are respectively used for amplification on a common PCR instrument;
in the amplification result, the maize internal standard gene zSSIIb primer pair and the second primer pair are amplified with strips and are judged to be homozygotes; 3 sets of primer pairs have amplification products and are judged to be heterozygotes; and only the corn internal standard gene zSSIIb primer pair and the receptor genome insertion site specificity detection primer composition have amplification products, and the sample is judged to be a negative sample.
In another aspect, the invention provides a method for detecting the specificity of the genomic insertion site of the MIR604 receptor of transgenic corn, wherein the method is a real-time fluorescent PCR method, and the composition for real-time fluorescent PCR detection is adopted for detection, preferably:
amplifying a primer pair and a probe composition which are respectively detected by the specificity of the receptor genome insertion site of the transgenic corn MIR604, a third primer pair and a third probe of a MIR604 transformant, a corn internal standard gene zSSIIb primer pair and a probe composition on a real-time fluorescent PCR instrument;
in the amplification result, the corn internal standard gene zSSIIb primer pair and probe composition, and the third primer pair and the third probe have typical amplification curves in amplification, and are judged to be homozygotes; all the 3 groups of primer pairs have typical amplification curves and are judged to be heterozygotes; only the corn internal standard gene zSSIIb primer pair and probe composition and the receptor genome insertion site specificity detection primer composition have a typical amplification curve, and are judged as negative samples.
The invention further provides application of the receptor genome insertion site specific detection primer composition in preparation of a kit for detecting transgenic corn MIR 604.
In another aspect, the invention provides application of a receptor genome insertion site specificity detection primer and a probe composition of transgenic corn MIR604 in preparing a kit for detecting transgenic corn MIR 604.
In another aspect, the invention provides an application of the composition for the common PCR detection of the transgenic corn MIR604 in preparing a kit for detecting the transgenic corn MIR 604.
In another aspect, the invention provides an application of the composition for real-time fluorescent PCR detection of transgenic corn MIR604 in preparation of a kit for detecting transgenic corn MIR 604.
In the technical scheme of the invention, SEQ ID No.12 is a nucleotide sequence of the deletion of the receptor genome insertion site of corn MIR604 in the genetic transformation process. SEQ ID No.12 is as follows:
gtgtcgtgcc gatctcgcac cagcagcatc gcgtcctaaa caaaggaggt cctgtcctgc actgcactgc actgcacgga tgcagctttg gc。
in the technical scheme of the invention, SEQ ID No.13 is an amplification sequence of corn MIR604 receptor genome insertion site specificity PCR. SEQ ID No.13 is as follows:
gacgccagat cacacatgga tgacgcggca cggcagctag ccgagcaggc gctctgcgcacgcaagtgtc gtgccgatct cgcaccagca gcatcgcgtc ctaaacaaag gaggtcctgtcctgcactgc actgcactgc acggatgcag ctttggcaac gaggtgtg
the purpose of the invention is realized as follows:
1. design of primer/probe combinations
At present, a transformant specificity detection method of transgenic corn MIR604 has been developed, which can specifically identify MIR604 transformant components contained in a sample, but the genotype identification of MIR604 seeds and individuals on a qualitative PCR platform is difficult to realize only by using the transformant specificity detection method. By analyzing the molecular characteristics of MIR604 homozygote and heterozygote, a primer MIR604-QF/MIR604-QR is respectively designed at two sides of an insertion site of an exogenous gene, a probe MIR604-QP is designed on a nucleotide sequence deleted at the insertion site, and an amplification product crosses the insertion site. For MIR604 homozygote, the insertion of exogenous gene is carried out on both chromosomes, so that only MIR604 transformant-specific primer/probe combination MIR604F/MIR604R/MIR604P has a typical amplification curve by controlling the PCR extension time; for MIR604 heterozygote, exogenous gene insertion exists on one chromosome, exogenous gene insertion does not exist on one chromosome, and the two primer probe combinations MIR604-QF/MIR604-QR/MIR604-QP and MIR604F/MIR604R/MIR604P have typical amplification curves; for negative plants, only the primer probe combination MIR604-QF/MIR604-QR/MIR604-QP has a typical amplification curve. The schematic diagram of the principle of identification of the homozygote and heterozygote of the transgenic corn MIR604 is shown in figure 1.
The primer probe sequence designed by the invention is as follows: primer MIR604-QF5 '-GACGCCAGATCACACATG-3' (SEQ ID No. 1), primer MIR604-QR5 '-CACACCTCTCGTTGCCAAAG-3' (SEQ ID No. 2), probe MIR604-QP5 '-CGTGCCGATCTCGCACCAGCA-3' (SEQ ID No. 3), and the amplified target sequence is 168bp in length and is shown as SEQ ID No. 13. The positions of the primers and probes on the target sequence are shown in FIG. 2.
2. Use of primer/probe combinations
Synthesizing the primer/probe, the MIR604 transformant specific primer/probe and the primer probe of the maize internal standard gene zSSIIb gene. Extracting total DNA of a transgenic corn MIR604 sample, and respectively carrying out PCR amplification on the genomic DNA of the sample by using internal standard genes zSSIIb, an MIR604 transformant and a primer pair or a primer/probe combination in the invention. Separating the common PCR product by agarose gel electrophoresis, and identifying whether an amplification product exists after EB dyeing; and judging whether the real-time fluorescent PCR product has an amplification product according to whether a typical amplification curve exists. The genotype of each sample is determined based on the amplification result of each primer pair or primer/probe combination.
Compared with the prior art, the invention has the following advantages and positive effects:
(1) Accurately judging the genotype of a sample to be detected through qualitative PCR on a common PCR or real-time fluorescent PCR platform;
(2) The homozygote or the heterozygote is not required to be identified through a field separation test, so that the labor, time and economic cost are saved;
(3) Provides an accurate, rapid and economic method for identifying the genotype of the raw material in the fields of transgenic breeding and transgenic standard substance development.
Drawings
FIG. 1 is a schematic diagram of the principle of homozygote and heterozygote identification of transgenic maize MIR 604;
FIG. 2 is a schematic diagram of the position of a primer probe designed on a target sequence;
FIG. 3 uses general qualitative PCR to identify the electropherograms of transgenic maize MIR604 homozygous, heterozygous and negative individuals.
FIG. 4 is a graph of amplification curves for identifying transgenic maize MIR604 homozygous, heterozygous and negative individuals using real-time fluorescent PCR.
Detailed Description
The invention is described in detail below with reference to the following figures and examples:
1. design of primer/probe combinations
(one) determination of maize genomic sequence at the site of transgenic maize MIR604 insertion
Collecting two side border sequences of an exogenous gene insertion site in the transgenic corn MIR604, splicing the border sequences at two sides together, and carrying out comparison analysis with a corn genome sequence to find that a 92bp nucleotide sequence (SEQ NO. 2) is deleted at the insertion site of the corn genome in the process of inserting the exogenous gene into the corn genome. The maize genomic sequence at the MIR604 transformant insertion site was determined by alignment.
(II) design of primer/Probe combinations
Respectively designing primers MIR604-QF5 '-GACGCCAGATCACACATG-3' SEQ ID No.1 and MIR604-QR5 '-CACCTCTGTCGCCAAAAG-3' SEQ ID No.2 on the corn genomic sequences at two sides of the insertion site by using Primer design software Primier Primer 5 software; a probe MIR604-QP5 '-CGTGCCGATCGCACCAGCA-3' SEQ ID No.3 is designed on the deleted nucleotide sequence by using Beacon Design software. The length of the amplified sequence is 160bp, and the positions of the primer probes on the nucleotide sequence are shown in FIG. 2.
2. Application method
Identification of genotype of transgenic maize MIR604 on a common PCR platform
Pure and mixed individuals of each sample were identified using single plant or seed of transgenic corn MIR604 as a test sample, using primer set MIR604-QF/MIR604-QR, MIR604 transformant primer set MIR604-1F (5 ' -TCGCGCGCGGTGTCATCTATG-3 SEQ ID No. 4)/MIR 604-1R (5 ' -CGCGACACACCTCTTAGTTAA-3 SEQ ID No. 5), and maize internal standard gene zSSIIb primer set zSSIIb-F (5 ' -CGGTGGATGCTAAGGCTGATG-3' SEQ ID No. 9)/zSSIIb-R (5 ' -AAAGGGCCAGGCAGTTAGATC-3 GTSSI SEQ ID No. 10) as a template, and genomic DNA extracted as a template.
The PCR reaction used 25ul of reaction system containing 1 uL of DNA template, 1 XPCR Buffer (containing 10mM Tris HCl pH8.3, KCl 50mM), 200uM dNTPs,2.5mM MgCl2, 250nM forward and reverse primers, 1U DNA Taq enzyme. The reaction procedure was pre-denaturation at 94 ℃ for 2 min, 15 sec at 94 ℃,30 sec at 60 ℃,30 sec at 72 ℃,35 cycles, and incubation at 72 ℃ for 2 min. The PCR products were separated by agarose gel electrophoresis and EB staining was followed to identify the presence of amplification products.
(II) identifying the genotype of the transgenic corn MIR604 on a real-time fluorescent PCR platform
The genomic mixture of the mixture of 5 '-GGTCATAACGTGGAGCCGTTCATTCATTCT-3' (SEQ ID No.6)/MIR 604R (5 '-GGTCATAACGTGACTCCTTAATTCT-3) SEQ ID No.7)/MIR 604P (5' -AGGCGGGAAACGATCATCTGTGATG-3 ') and ZSSIIb primer/probe combination of maize internal standard gene zSSIIb (5' -CGGTGGATGCTAAGGCTGA-3)/SSIIb-R (5 '-AAATCAGGGGAGGCTGATCCGTGTTCATTCATTCAATCTGAID No.9)/SSIIb-3 (5' -AAATCAGGGCTGATCTGACTGACTGACTGACTG-3)/SSI-R (5 '-GCAGCGT) was prepared by using single or single seed of transgenic maize MIR604 as a test sample, and the primer/probe combination MIR604F (5' -GCACGCACGCACGCACGCAGGCAGGCAGGCAGGCATGCATCTGAATCTGACTGAT) designed in the present invention was used as a sample, and the genomic mixture was identified as a pure sample as SSICTSSITG and the sample.
Real-time fluorescent PCR analysis was performed on a CFX96 PCR instrument with 20. Mu.L of PCR reaction containing 1. Mu.L of DNA template, 1 XPCR buffer,1U of Taq DNA polymerase, 4.5mM MgCl2, 300. Mu.M dNTPs,200nM forward and reverse primers, 100nM probe. PCR reaction procedure: after pre-denaturation at 50 ℃ for 2 min and 95 ℃ for 10 min, 50 PCR cycles were performed: denaturation at 95 ℃ for 15 seconds, annealing and extension at 60 ℃ for 1 minute, and collection of fluorescent signals.
4. Results of the experiment
(I) identifying the genotype of MIR604 corn by adopting a common PCR method
Three general PCR primer pairs were used: the invention designs a primer pair MIR604-QF/MIR604-QR, an MIR604 transformant primer pair MIR604-1F/MIR604-1R and a corn internal standard gene zSSIIb primer pair zSSIIb-F/zSSIIb-R, and amplifies genome DNA extracted from a single plant or single seed. Some samples only have amplification bands of the maize internal standard gene zSSIIb and the MIR604 transformant, and are judged to be homozygotes; 3 primer pairs of some samples have amplification products, and the samples are judged to be heterozygotes; some samples only contain the maize internal standard gene zSSIIb and the primer pair designed by the invention, and the samples are judged to be negative samples (figure 3). The experimental result is in line with the expectation, and the homozygote and heterozygote of the transgenic corn MIR604 can be accurately identified.
(II) identifying the genotype of MIR604 corn by adopting a real-time fluorescent PCR method
Three primer/probe combinations were used: the primer probe combination MIR604-QF/MIR604-QR/MIR604-QP, the MIR604 transformant primer probe combination MIR604F/MIR604R/MIR604P, the corn internal standard gene zSSIIb primer probe combination zSSIIb-F/zSSIIb-R/zSSIIb-P designed by the invention can amplify the genome DNA extracted from a single plant or a single seed. Some samples only have typical amplification curves of the maize internal standard genes zSSIIb and the MIR604 transformant, and are judged to be homozygotes; judging that the amplification products of 3 primer probe combinations of some samples are heterozygotes; some samples only contain the maize internal standard gene zSSIIb and the primer probe designed by the invention, and the amplification product is combined, so that the samples are judged to be negative samples (figure 4). The experimental result is in line with the expectation, and the homozygote and heterozygote of the transgenic corn MIR604 can be accurately identified.
SEQUENCE LISTING
<110> institute of oil crop of academy of agricultural sciences of China
<120> method for identifying MIR604 genotype of maize transformant established based on insertion site genomic sequence
<130> CP11903958C
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 18
<212> DNA
<213> Artificial sequence
<400> 1
gacgccagat cacacatg 18
<210> 2
<211> 18
<212> DNA
<213> Artificial sequence
<400> 2
cacacctcgt tgccaaag 18
<210> 3
<211> 21
<212> DNA
<213> Artificial sequence
<400> 3
cgtgccgatc tcgcaccagc a 21
<210> 4
<211> 21
<212> DNA
<213> Artificial sequence
<400> 4
tcgcgcgcgg tgtcatctat g 21
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence
<400> 5
cgcgacacac ctcgttagtt aa 22
<210> 6
<211> 18
<212> DNA
<213> Artificial sequence
<400> 6
gcgcacgcaa ttcaacag 18
<210> 7
<211> 26
<212> DNA
<213> Artificial sequence
<400> 7
ggtcataacg tgactccctt aattct 26
<210> 8
<211> 26
<212> DNA
<213> Artificial sequence
<400> 8
aggcgggaaa cgacaatctg atcatg 26
<210> 9
<211> 21
<212> DNA
<213> Artificial sequence
<400> 9
cggtggatgc taaggctgat g 21
<210> 10
<211> 23
<212> DNA
<213> Artificial sequence
<400> 10
aaagggccag gttcattatc ctc 23
<210> 11
<211> 25
<212> DNA
<213> Artificial sequence
<400> 11
taaggagcac tcgccgccgc atctg 25
<210> 12
<211> 92
<212> DNA
<213> Artificial sequence
<400> 12
gtgtcgtgcc gatctcgcac cagcagcatc gcgtcctaaa caaaggaggt cctgtcctgc 60
actgcactgc actgcacgga tgcagctttg gc 92
<210> 13
<211> 168
<212> DNA
<213> Artificial sequence
<400> 13
gacgccagat cacacatgga tgacgcggca cggcagctag ccgagcaggc gctctgcgca 60
cgcaagtgtc gtgccgatct cgcaccagca gcatcgcgtc ctaaacaaag gaggtcctgt 120
cctgcactgc actgcactgc acggatgcag ctttggcaac gaggtgtg 168
Claims (4)
1. A composition for transformant-specific real-time fluorescent PCR detection of transgenic corn MIR604 comprising:
specific real-time fluorescent PCR detection primer pairs and probe compositions for receptor genomic insertion sites of transgenic maize MIR 604:
MIR604-QF 5′—GACGCCAGATCACACATG—3′SEQ ID No.1
MIR604-QR 5′—CACACCTCGTTGCCAAAG—3′SEQ ID No.2
MIR604-QP 5′—CGTGCCGATCTCGCACCAGCA—3′SEQ ID No.3
MIR604 transformant third primer pair and third probe composition:
MIR604-F 5′-GCGCACGCAATTCAACAG-3′SEQ ID No.6
MIR604-R 5′-GGTCATAACGTGACTCCCTTAATTCT-3′SEQ ID No.7
MIR 604-P5 '-AGGCGGGAAACGACATCTGATCATG-3' SEQ ID No.8; and
maize endogenous reference gene zSSIIb primer pair and probe composition:
zSSIIb-F 5′-CGGTGGATGCTAAGGCTGATG-3′SEQ ID No.9
zSSIIb-R 5′-AAAGGGCCAGGTTCATTATCCTC-3′SEQ ID No.10，
zSSIIb-P 5′-TAAGGAGCACTCGCCGCCGCATCTG-3′SEQ ID No.11。
2. the method for identifying the genotype of the MIR604 of the transgenic corn is a real-time fluorescent PCR method, and the real-time fluorescent PCR method adopts a composition for real-time fluorescent PCR detection to detect:
detecting amplification of primer pairs and probe compositions by real-time fluorescent PCR with the receptor genomic insertion site specificity of transgenic maize MIR604 described in claim 1, MIR604 transformant third primer pairs and third probes, and maize internal standard gene zSSIIb primer pairs and probe compositions, respectively, on a real-time fluorescent PCR instrument;
in the amplification result, only the corn internal standard gene zSSIIb primer pair and the probe composition, and the third primer pair and the third probe composition of the MIR604 transformant are amplified to have a typical amplification curve, and are judged to be homozygotes; 3, judging the primer pairs and the probe compositions to be heterozygotes, wherein the primer pairs and the probe compositions have typical amplification curves; and judging that only the corn internal standard gene zSSIIb primer pair and probe composition and the receptor genome insertion site specific real-time fluorescent PCR detection primer pair and probe composition have a typical amplification curve as a negative sample.
3. A kit for detecting transgenic corn MIR604, comprising the composition for transformant-specific real-time fluorescent PCR detection of transgenic corn MIR604 of claim 1.
4. Use of the kit of claim 3 for detecting the MIR604 genotype of transgenic corn; the kit is adopted for real-time fluorescent PCR detection, and only a corn internal standard gene zSSIIb primer pair and probe composition, and a third primer pair of an MIR604 transformant and a third probe are amplified to form a typical amplification curve in an amplification result, and the amplification result is judged to be a homozygote; 3, judging the primer pairs and the probe compositions to be heterozygotes, wherein the primer pairs and the probe compositions have typical amplification curves; only the corn internal standard gene zSSIIb primer pair and probe composition and the receptor genome insertion site specificity real-time fluorescence PCR detection primer probe composition have a typical amplification curve, and are judged as negative samples.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910832581.8A CN110551842B (en) | 2019-09-04 | 2019-09-04 | Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910832581.8A CN110551842B (en) | 2019-09-04 | 2019-09-04 | Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110551842A CN110551842A (en) | 2019-12-10 |
| CN110551842B true CN110551842B (en) | 2022-10-11 |
Family
ID=68738905
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910832581.8A Active CN110551842B (en) | 2019-09-04 | 2019-09-04 | Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110551842B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101978065A (en) * | 2008-02-29 | 2011-02-16 | 孟山都技术公司 | Corn plant event mon87460 and compositions and methods for detection thereof |
| CN102586442A (en) * | 2012-03-02 | 2012-07-18 | 山东省农业科学院植物保护研究所 | Specific primer and probe for assaying genetically modified corn MIR162 and application thereof |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005103301A2 (en) * | 2004-03-25 | 2005-11-03 | Syngenta Participations Ag | Corn event mir604 |
| CN101724702B (en) * | 2009-12-23 | 2012-04-11 | 天津市农业科学院中心实验室 | Standard molecule contrast for genetically modified maize detection and prepration method thereof |
| CN102206632A (en) * | 2011-03-11 | 2011-10-05 | 山东省农业科学院植物保护研究所 | Para-gene for exogenous insertion vector of transgenic maize transformation event MON88017 and application thereof |
| CN105112531A (en) * | 2015-09-15 | 2015-12-02 | 中国检验检疫科学研究院 | Double digital PCR fluorescent quantitative detection method for transgenic maize MIR604 |
-
2019
- 2019-09-04 CN CN201910832581.8A patent/CN110551842B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101978065A (en) * | 2008-02-29 | 2011-02-16 | 孟山都技术公司 | Corn plant event mon87460 and compositions and methods for detection thereof |
| CN102586442A (en) * | 2012-03-02 | 2012-07-18 | 山东省农业科学院植物保护研究所 | Specific primer and probe for assaying genetically modified corn MIR162 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110551842A (en) | 2019-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110241248B (en) | KASP marker related to wheat grain weight under salt stress condition and application thereof | |
| CN108998562B (en) | Grain length gene marker based on wheat 895 genetic background in wheat variety and application | |
| CN109468315B (en) | Rice flooding-resistant gene Sub1 codominant molecular marker and application thereof | |
| CN107090504B (en) | SNP molecular marker combination for corn genotyping and application thereof | |
| CN109762812B (en) | Wheat growth potential related SNP and application thereof as target point in identification of wheat growth potential traits | |
| CN111394506A (en) | Wheat molecular marker and application thereof in identification of wheat grain weight character | |
| CN111979345A (en) | Development and application of KASP (Kaempferi protein) marker related to wheat biomass and yield under salt stress condition | |
| CN110512023B (en) | Method for identifying soybean transformant MON89788 genotype established based on insertion site genome sequence | |
| CN108220473B (en) | Identification of maize S-type cytoplasmic male sterile material by using chloroplast InDel marker | |
| CN106367498B (en) | Periplaneta americana microsatellite loci and application thereof | |
| CN117106967A (en) | Functional KASP molecular marker of rice blast resistance gene and application thereof | |
| CN110551842B (en) | Method for identifying genotype of corn transformant MIR604 based on insertion site genome sequence establishment | |
| CN107988418B (en) | Primer group, kit and method for pure heterozygous identification of transgenic papaya YK16-0-1 transformant | |
| CN106636406B (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application thereof | |
| CN106676176B (en) | Method for performing SSR (simple sequence repeat) analysis on tetraploid alfalfa by utilizing multiple PCR (polymerase chain reaction) | |
| CN112359098B (en) | Method for detecting content of herbicide-tolerant transgenic soybean J12 by real-time fluorescence quantitative PCR | |
| CN115125326A (en) | Development and application of corn S-type cytoplasmic male sterility gene KASP molecular marker | |
| CN112251519A (en) | Specific primer, probe, kit and method for identifying homozygote and heterozygote of Hulenbel short-tailed sheep | |
| CN112251536A (en) | SNP molecular marker closely linked with bolting property of radish and application thereof | |
| CA2515211A1 (en) | Compositions and methods for detecting a sequence mutation in the cinnamyl alcohol dehydrogenase gene associated with altered lignification in loblolly pine | |
| CN116411106B (en) | Flanking sequence of rice GAT transformation event GATV-34-3 and detection primer and application thereof | |
| CN105112526B (en) | A kind of SNP marker and its application with regulating and controlling temperature sensitive semidwarf type peach panel length close linkage | |
| CN108060258B (en) | Primer group, kit and method for pure heterozygous identification of cotton MON15985 transformant | |
| CN116287373B (en) | KASP molecular marker closely linked with wheat spike number major QTL as well as method and application thereof | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |