US20060135459A1 - Targeted innate immunity - Google Patents

Targeted innate immunity Download PDF

Info

Publication number
US20060135459A1
US20060135459A1 US11/269,123 US26912305A US2006135459A1 US 20060135459 A1 US20060135459 A1 US 20060135459A1 US 26912305 A US26912305 A US 26912305A US 2006135459 A1 US2006135459 A1 US 2006135459A1
Authority
US
United States
Prior art keywords
cells
cancer
antibody
cpg
therapeutic agent
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/269,123
Other languages
English (en)
Inventor
Alan Epstein
Leslie Khawli
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Southern California USC
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Individual filed Critical Individual
Priority to US11/269,123 priority Critical patent/US20060135459A1/en
Assigned to UNIVERSITY OF SOUTHERN CALIFORNIA reassignment UNIVERSITY OF SOUTHERN CALIFORNIA ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: EPSTEIN, ALAN L., KHAWLI, LESLIE A.
Publication of US20060135459A1 publication Critical patent/US20060135459A1/en
Priority to US13/228,317 priority patent/US9522958B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549—Sugars, nucleosides, nucleotides or nucleic acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6851—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a determinant of a tumour cell
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/80—Immunoglobulins specific features remaining in the (producing) cell, i.e. intracellular antibodies or intrabodies

Definitions

  • the invention relates to cancer therapeutic agents and methods for cancer therapy.
  • Immunotherapy sometimes called biological therapy, biotherapy, or biological response modifier therapy
  • the human immune system is an untapped resource for cancer therapy and that effective treatment can be developed once the components of the immune system are properly harnessed.
  • the clinical effectiveness of such reagents can be tested using well-known cancer models.
  • Immunotherapeutic strategies include administration of vaccines, activated cells, antibodies, cytokines, chemokines, as well as small molecular inhibitors, anti-sense oligonucleotides, and gene therapy (Mocellin, et al., Cancer Immunol. & Immunother. (2002) 51: 583-595; Dy, et al., J. Clin. Oncol. (2002) 20: 2881-2894, 2002).
  • T-cells The growth and metastasis of tumors depends to a large extent on their capacity to evade host immune surveillance and overcome host defenses. Most tumors express antigens that can be recognized to a variable extent by the host immune system, but in many cases, the immune response is inadequate. Failure to elicit a strong activation of effector T-cells may result from the weak immunogenicity of tumor antigens or inappropriate or absent expression of co-stimulatory molecules by tumor cells. For most T-cells, proliferation and IL-2 production require a co-stimulatory signal during TCR engagement, otherwise, T-cells may enter a functionally unresponsive state, referred to as clonal anergy.
  • innate immunity provides an early first line defense to pathogenic organisms which is followed by antibody and cellular T cell responses characteristic of the adaptive immune system.
  • Innate immunity is highly robust and utilizes specific cells such as macrophages, neutrophils/PMNs, dendritic cells, and NK cells which are effective in destroying and removing diseased tissues and cells (Cooper et al., BioEssays (2002) 24:319-333). Since the demonstration by Coley that tumors could be treated by intratumoral injections of pathogens (Wiemann and Stames (1994) Pharmacol. Ther. 64:529-564), investigators have investigated if the innate immune system could be harnessed for the treatment of human diseases (Ulevitch, Nature Rev. Immunol. (2004) 4:512-520). However, attempts to use the innate immune system for cancer immunotherapy have been limited in comparison to the adaptive immune system.
  • the innate immune system is directed to recognition of invariant molecular structures in pathogens that are distinct from self-antigens yet are found on a large number of infecting organisms.
  • These microbial stimulators of innate immune responses include lipopolysaccharides and teichoic acids shared by all gram-negative and gram-positive bacteria, respectively, unmethylated CpG motifs characterized by bacterial but not mammalian DNA, double-stranded RNA as a structural signature of RNA viruses, and mannans which are conserved elements of yeast cell walls.
  • CpG Oligodeoxynucleotides are synthetic oligonucleotides that are comprised of unmethylated CG dinucleotides, arranged in a specific sequence and framework known as CpG motifs (Tokunaga, et al., JNCI (1984) 72:955-962; Messina, et al, J. Immunol. (1991) 147:1759-1764; Krieg, et al, Nature (1995) 374:546-549).
  • CpG motifs trigger the production of T-helper 1 and pro-inflammatory cytokines and stimulate the activation of professional antigen-presenting cells (APCs) including macrophages and dendritic cells (Klinman et al.
  • CpG ODNs behave as immune adjuvants which accelerate and enhance antigen-specific antibody responses and are now thought to play a large role in the effectiveness of Freund's Adjuvant and BCG (Krieg, Nature Med. (2003) 9:831-835). Recently, it was discovered that CpG ODNs interact with Toll-like receptor (TLR) 9 to trigger the maturation and functional activation of professional antigen presenting cells, B-cells, and natural killer cells (Hemmi, et al. Nature (2000) 208:740-745; Tauszig, et al, PNAS (2000) 97:10520-10525; Lawton and Ghosh Current Opin. Chem. Biol.
  • TLR Toll-like receptor
  • CpG ODNs are quickly internalized by immune cells, through a speculated pathway involving phophatidylinositol 3-kinases (PI3Ks), and interact with TLR9 present in endocytic vesicles (Latz, et al. Nature Immunol. (2004) 5:190-198).
  • the resultant immune response is characterized by the production of polyreactive IgM antibodies, cytokines, and chemokines which induce T-helper 1 immunity (Lipford, et al., Eur. J. Immunol. (1997) 27:2340-2344; Weiner, J. Leukocyte Biol.
  • the TLR9 receptor recognizes CpG ODNs with a strict bias for the chemical and conformational nature of the unmethylated CpG ODN since conjugation of an oligonucleotide and a CpG DNA at the 5′-end has been shown to reduce significantly the immunostimulatory activity of the CpG DNA.
  • conjugation of an oligonucleotide and a CpG ODN at the 3′-end does not perturb or may even enhance the immunostimulatory activity of the CpG DNA (Kandimilla, et al., Bioconjug. Chem. (2002) 13:966-974).
  • CpG-A CpG-A
  • CpG-B CpG-C
  • CpG-A ODNs are potent inducers of natural killer cell activation and interferon- ⁇ secretion; CpG-B ODNs predominantly elicit B-cell proliferation and plasmacytoid dendritic cells; and CpG-C ODNs have the activity of both CpG-A and CpG-B and therefore induce both NK, plasmacytoid dendritic cell, and B-cell activation.
  • CpG-C ODNs are characterized by the absence of poly-G stretches and have palidromic sequences combined with stimulatory CpG motifs (Vollmer, et al, Eur. J. Immunol. (2004) 34:252-262).
  • CpG ODNs have shown efficacy in mouse models as a monotherapy (Klinman, Nature Rev. Immunol. (2004) 4:249-258; Lonsdorf, et al., J. Immunol. (2003) 171:3941-3946; Ishii et al., Clin. Cancer Res. (2003) 9:6516-6522; Baines and Celis, Clin. Cancer Res. (2003) 9:2693-2700).
  • Direct injection of CpG ODN into tumor lesions is reported to activate local dendritic cells and induces the production of IL-12 in and around the tumor.
  • injection of CpG-B ODN led to regression of established tumors in a T-cell dependent fashion.
  • CpG ODNs have shown efficacy in mouse models when administered in combination with antitumor antibodies (Wooldridge et al, Blood (1997) 89:2994-2998).
  • Administration of CpG ODN was found to activate dramatically ADCC effector cells and induce expression of CD64.
  • This treatment was followed by injection of an antitumor antibody, dramatic increases in biologic activity were seen. Regression was achieved with large tumors that would not normally respond to antibody therapy alone, as well as with tumors that only express the target antigen at low concentrations.
  • CpG ODNs have also shown efficacy as radiotherapy enhancers. Recent results have shown that CpG ODNs are potent enhancers of tumor radioresponse and as such have potential to improve clinical radiotherapy (Milas, et al., Cancer Res. (2004) 64:5074-5077). Likewise, CpG ODN therapy has been shown to be enhanced by prior chemotherapy and as such have the potential to improve with prior drug therapy (Li and Levy, Abstract, 19th Intl. Soc. Biol. Therapy, San Francisco, (2004).
  • a cancer therapeutic agent comprising a cancer targeting molecule linked to an oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide.
  • the oligonucleotide contains multiple such immunostimulatory motifs which may be all the same or a mixture of different motifs.
  • the immunostimulatory motif of the oligonucleotide contains TCGTT and/or TCGTA with the CG dinucleotide unmethylated.
  • the cancer targeting molecule of the immunoconjugate is an antibody.
  • the antibody can be specific for a tumor cell-surface antigen, a stromal component of a tumor, an intracellular antigen or an intranuclear antigen.
  • the antibody can be a murine, chimeric, humanized, or human form of murine antibody TNT-1, TNT-2, or TNT-3 or is NHS76.
  • the cancer therapeutic methods described herein may further include administration of an agent that reduces the immunoregulatory T cell activity in the individual.
  • educing immunoregulatory T cell activity is achieved by removing ex vivo immunoregulatory T cells from the individual.
  • Reducing immunoregulatory T cell activity may be achieved by administering an agent to the individual that depletes or inactivates immunoregulatory T cells in the individual.
  • Reducing immunoregulatory T cell activity also may be achieved using at least one antibody that binds to the immunoregulatory T cells.
  • Such antibody may be selected from the group consisting of anti-CD4, anti-CD25, anti-neuropilin, and anti-CTLA4.
  • Reducing immunoregulatory T cell activity also may be achieved by administering a GITR ligand agonist.
  • Immunoregulatory T cell activity may be reduced in the individual before, during or after administering the cancer therapeutic agent.
  • the cancer therapeutic methods described herein may also include administering T cells which have cytotoxic activity against the cancer. This may be achieved by adoptive transfer of immune cells. These immune cells are preferably T cells, which may be activated ex vivo. In one embodiment, activation is achieved by exposure to IL-2 and/or anti-CD3 antibody. In another embodiment, ex vivo activation is achieved by exposure to the cancer cells or to a cancer cell vaccine. Adoptive transfer of immune cells may occur before, during or after administering the invention agent. Adoptive transfer is preferably given after removal, depletion or inactivation of immunoregulatory T cells.
  • an “oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide” includes sequences that bind to the TLR9 receptor on B cells and plasmacytoid dendritic cells (pDCs) and initiate an immunostimulatory response. Such response may include maturation, differentiation and/or proliferation of natural killer (NK) cells, T cells and monocytes/macrophages. Many such immunostimulatory sequence motifs are known and described in the art while others may be identified by routine efforts.
  • An immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide refers to the portion of an oligonucleotide that includes the unmethylated CG dinucleotide and several nucleotides on each side of the CpG that are critical for the immunostimulatory activity.
  • the immunostimulatory motif containing the CG dinucleotide is shown bolded and italicized with the CpG bolded and underlined in the following sequence: 5′-TCGT CG TTT-3′.
  • Oligonucleotides which comprise an immunostimulatory sequence motif that contains at least one unmethylated CG dinucleotide have been referred to the in art as “oligodeoxynucleotide containing unmethylated CpG motifs,” or “CpG oligodeoxynucleotides (“CpG ODNs”).
  • CpG ODNs CpG oligodeoxynucleotides
  • the phrase “oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide” may be referred to herein as a “CpG immunostimulatory oligonucleotide.”
  • CpG immunostimulatory oligonucleotide secrete cytokines and chemokines (IL-1, IL-6, IL-18 and TNF) including Th1-biased cyokines (interferon- ⁇ , IFN- ⁇ , and IL-12) to create a pro-inflammatory immune response (Klinman, Nature Rev. Immunol. (2004) 4:249-258).
  • cytokines and chemokines IL-1, IL-6, IL-18 and TNF
  • Th1-biased cyokines interferon- ⁇ , IFN- ⁇ , and IL-12
  • APCs professional antigen-presenting cells
  • macrophages and dendritic cells Kerrieg, et al., Nature (1995) 374:546-549; Klinman, et al. PNAS (1996) 93:2879-2883).
  • the CpG ODN contain one or more unmethylated CG dinucleotides arranged within a specific sequence (Tokunaga, et al., JNCI (1984) 72:955-962; Messina, et al, J. Immunol. (1991) 147:1759-1764; Krieg, et al, Nature (1995) 374:546-549).
  • the optimal CpG flanking region in mice consists of two 5′ purines and two 3′ pyrimidines, whereas the optimal motif in humans and certain other species is TCGTT and/or TCGTA (Klinman, Nature Rev. Immunol. (2004) 4:249-258).
  • the CpG immunostimulatory oligonucleotide is generally from 6 to 100 nucleotides in length, more preferably between about 15 to 25 nucleotides in length. As described by Sen et al., (Cell Immunol. 2004 November-December; 232(1-2):64-74), portions of an oligonucleotide that has immunostimulatory motifs containing an unmethylated CpG can be replaced with RNA. For example, the RNA can be used in the oligonucleotide to flank the critical immunostimulatory motif.
  • the TLR9 receptor has been reported to diverge through evolution, so the precise sequence motifs (unmethylated CpG dinucleotides plus flanking regions) optimal for stimulating immune cells from different animal species varies (Klinman, Nature Rev. Immunol. (2004) 4:249-258).
  • the TLR9 molecules in mice differ from those in humans by 24% at the amino-acid level. It has been reported that the cell populations that express TLR9 have been reported to differ between species (Klinman, Nature Rev. Immunol. (2004) 4:249-258).
  • TLR9 In mice, immune cells of the myeloid lineage (including monocytes, macrophages and myeloid DCs) express TLR9 and respond to CpG stimulation, whereas in humans, these cell types generally do not express TLR9 and cannot be directly activated by CpG ODNs (Klinman, Nature Rev. Immunol. (2004) 4:249-258).
  • the structural characteristics of human TLR9 are found in the Swiss-Prot database under accession no. Q9NR96. The molecule is synthesized as a 1032 amino acid precursor of which about 25 amino acids are removed as a leader sequence leaving a 1007 amino acid receptor.
  • FIG. 1 discloses a scheme for preparing a CpG ODN antibody conjugate by crosslinking with EMCS.
  • FIG. 2 demonstrates the induction of IL-6 secretion in (A) J7-74 and (B) J77743A cells after incubation with increasing concentrations of chTNT-3/CpG immunoconjugates.
  • the CpG 1826 immunoconjugate was able to induce the secretion of IL-6 in the J7 cell lines.
  • FIG. 3 shows immunotherapy of Colon 26 tumor bearing BALB/c mice following administration of CpG and chTNT-3/CpG immunoconjugates.
  • Cancer therapeutic agents comprise a tumor targeting agent linked to an oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide.
  • Linkage can be achieved by any of a variety of approaches provided that the tumor targeting agent retains its ability to bind to its cognate antigen and the oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide retains its immune stimulatory activity.
  • Initial activity testing can be done in vitro and followed by pharmacokinetic, biodistribution and radioimmunoscintigraphy analysis conducted in tumor-bearing animals.
  • the cancer targeting agent may be linked to multiple immunostimulatory oligonucleotides.
  • a cancer targeting agent may be linked to multiple immunostimulatory oligonucleotides all of which are the same.
  • the a cancer targeting agent may be linked to different immunostimulatory oligonucleotides.
  • cancer therapeutic agent refers to a conjugate formed between a cancer targeting molecule and an oliognucleotide comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide.
  • a preferred cancer targeting molecule is an antibody.
  • An antibody containing cancer therapeutic agent can be referred to as an immunoconjugate.
  • linking means that under physiological conditions of pH, ionic strength and osmotic potential, the majority of the entities are associated with each other at equilibrium.
  • Covalent linkage may be by any of a variety of chemical linking and crosslinking agents including, for example, homobifunctional or heterobifunctional crosslinking reagents, many of which are commercially available (see, e.g., Pierce Chemical Co. or Sigma Chemical Co.).
  • Linking or crosslinking can be achieved by any of a variety of chemistries well known in the art including, for example, activated polyethylene glycols, aldehydes, isocyanates, maleimides and the like.
  • Oligonucleotides comprising an immunostimulatory sequence motif which contains at least one unmethylated CG dinucleotide and have in vivo immunostimulatory activity may be used to prepare invention conjugates.
  • the oligonucleotide may be chemically modified to enable linkage to the cancer targeting molecule. Modification may involve adding a thiol group to the 3′ terminal nucleotide using a non-nucleoside linker (3′-thiol-modifier C3) (Zukermann et al., Nucleic Acids Res, 15: 5305-5321, 1987) to facilitate covalent linkage with linker modified antibody.
  • CpG immunostimulatory oligonucleotides are exemplary (CpG motifs identified by bolded text with underlining).
  • CpG-1826 5′-TCCATGA CG TTCCTGA CG TT-3′ SEQ ID NO:1 (class A) (untitled): 5′-TCTCCCAG CG TG CG CCAT-3′ SEQ ID NO:2 (class A) (CpG-2395): 5′-T CG T CG TTTT CG G CGCGCG C CG SEQ ID NO:3 (class C) (CpG-1668): 5′-TCCATGA CG TTCCTGATGCT-3′ SEQ ID NO:4
  • CpG immunostimulatory oligonucleotides for human application (CpG-2006): 5′-T CG T CG TTTTGT CG TTTTGT CG TT SEQ ID NO:5 (class B) (CpG 1585): 5′ GGGGTCAACGTTGAGGGGGG 3′ SEQ ID NO:6 (CpG 2216): 5′ GGGGGACGATCGTCGGGGGG 3′ SEQ ID NO:7 (CpG 2395): 5′ TCGTCGTTTTCGGCGCGCGCCG 3′ SEQ ID NO:8 (CpG 5397): 5′ TCGTCGTTTTCCGGCGCCGG 3′ SEQ ID NO:9 (CpG 2429): 5′ TCGTCGTTTTCGGCGGCCGCCG 3′ SEQ ID NO:10 (K23): 5′ TCGAGCGTTCTC 3′ SEQ ID NO:11 (D35): 5′ GGTGCATCGATGCAGGGGGG 3′ SEQ ID NO:
  • CpG immunostimulatory oligonucleotides having applications for human use include class A, B or C type CpG ODNs which are well known and may linked to a cancer targeting molecule as described herein. Exemplary such CpG immunostimulatory oligonucleotides are described in the following:
  • CpG-A type CpG 2216, CpG 1585
  • CpG-B CpG 2006
  • CpG immunostimulatory oligonucleotide class A is CpG-1826 (Ballas et al., J. Immunol. 167: 4878-86, 2001), which has two motifs (5′-GACGTT-3′) and has been shown to induce immunostimulatory activity in mice (Baines et al., Clin. Cancer Res. (2003) 9:2693-2700; Lonsdorf et al. J. Immunol. (2003) 171:3941-3946).
  • a 20-mer CpG ODN (SEQ ID NO: 2) is also useful because it has a significant effect on murine NK cells with little effect on murine B cells (Wooldridge et al., Blood (1997) 89:2994-2998).
  • Other CpG ODN have been reported in the literature and can be used to link to an antibody (Krieg et al., Nature (1995) 374:546-549; Bauer et al., J. Immunol. (2001) 166:5000-5007).
  • SEQ ID NO: 3 has been described to be active on murine B-cells by Gursel et al. (J. Leukocyte Biol. (71:813-820), while a class C CpG motif, SEQ ID NO:4 (CpG-2395) was described by Vollmer et al. (Eur. J. Immunol. (2004) 34:252-262).
  • oligonucleotides including the GpC type may be used as a negative control in experimental analysis of CpG immunostimulatory oligonucleotide and invention conjugates.
  • 1745 5′-TCCAATGAGCTTCCTGAGTCT-3′ SEQ ID NO:6 (negative control)
  • GpC-1982 5′-TCCA GG ACTTCTCTCA GG TT-3′ SEQ ID NO:7 (negative control)
  • GpC-1668 5′-TCCATGA GG TTCCTGATGCT-3′ SEQ ID NO:8 (negative control)
  • SEQ ID NO: 6 (CpG-1745) has been previously shown to have no CpG immunostimulatory activity.
  • CpG immunostimulatory oligonucleotides may be synthesized by replacing the phosphodiester backbone with a phosphorothioate linkage (“PS linkage”).
  • PS linkage a phosphorothioate linkage
  • PS forms of CpG immunostimulatory oligonucleotides display an extremely high degree of nuclease resistance and stability (Stein et al. Nucleic Acids Res. (1988) 16:3209-3221).
  • CpG immunostimulatory oligonucleotides also may be used in which part has the phosphodiester backbone and part has an alternative backbone such as a phosphorothioate linkage.
  • CpG immunostimulatory oligonucleotide sequences not disclosed herein may be prepared along principles of those currently known.
  • CpG immunostimulatory oligonucleotides may be prepared with different backbone chemistry provided that the resulting CpG immunostimulatory oligonucleotides can
  • endotoxin levels of all oligonucleotides, antibodies and the invention conjugates can be measured by Limulus amebocyte lysate assay (Bio-Whitaker, Walkersville, Md.) to confirm that levels are below 0.01 Units/ml.
  • cancer targeting molecule refers to a molecule that has the ability to localize to cancer cells in an individual.
  • the phrase “localizing to cancer cells in an individual” means that the agent can bind to a tumor cell(s) or can bind in the vicinity of a tumor cell(s) following administration to the individual.
  • the cancer targeting molecule may bind to a receptor or ligand on the surface of the cancer cell or may bind to an intracellular target of cancer cell provided that the target is accessible to the molecule. Accessibility to intracellular cancer cell targets may arise in cancer cells that have a compromised plasma membrane such as cells which are undergoing apoptosis, necrosis, and the like.
  • Some cancer targeting molecules can bind intracellular portions of a cell that does not have a compromised plasma membrane. See e.g., Porkka et al., Proc Natl Acad Sci U S A. (2002) 99(11): 7444-9.
  • Cancer targeting molecules also may bind to a target that is present in the tumor.
  • tumor includes cancer cells, necrosis, as well as stroma.
  • Stroma includes cells such as fibroblasts and endothelial cells of vessels and capillaries and extracellular matrix, which is composed of fibrillar and non-fibrillar components. The major fibrillar proteins are collagen and elastin.
  • a cancer targeting molecule may target to the tumor by binding to the stroma which surrounds the cancer cells in the tumor.
  • a cancer targeting molecule may target in the vicinity of a cancer by binding to a stromal component such as a fibroblast or endothelial cell or a component of the extracellular matrix. See, e.g. Schraa et al. Control Release (2002) 83(2): 241-51; Arap et al. Haemostasis (2001) 31 Suppl 1: 30-1.
  • Cancer targeting molecules useful in the present invention include those that bind to tumor specific or tumor associated antigens.
  • tumor associated antigen refers to a protein which is present on tumor cells, and on normal cells during fetal life (onco-fetal antigens), after birth in selected organs, or on normal cells, but at much lower concentration than on tumor cells.
  • a TAA also may be present in the stroma in the vicinity of the cancer cell but be expressed at lower amounts in the stroma elsewhere in the body.
  • TAA tumor specific antigen
  • TSA tumor specific antigen
  • tumor-specific transplantation antigen refers to a tumor cell expressed molecule absent from normal cells. TSA usually appear when an infecting virus has caused the cell to become immortal and express viral antigens. Exemplary viral TSAs are the E6 or E7 proteins of HPV type 16. TSAs not induced by viruses can be idiotypes of the immunoglobulin on B cell lymphomas or the T cell receptor (TCR) on T cell lymphomas.
  • Cancers treatable using the methods of the invention include carcinomas, sarcomas, and leukemias and lymphomas and other types of cancer.
  • Carcinomas include those of lung, breast, colon, ovarian, prostate, and the like. These cancers may be primary or metastatic.
  • the cancer cells treatable with the invention methods include those in the form of a tumor as well as cancer cells in the bone marrow and in the circulation.
  • Cancer targeting molecules include small molecule compounds such as drugs, organic compounds, peptides, peptidomimetics, as well as larger molecules such as glycoproteins, proteoglycans, lipids glycolipids, phospholipids, lipopolysaccharide, nucleic acids, proteoglycans, carbohydrates, and the like. Small molecule cancer targeting molecules may be about 5,000 daltons or less in size. Cancer targeting molecules may include well known therapeutic compounds including anti-neoplastic agents.
  • Anti-neoplastic targeting molecules may include paclitaxel, daunorubicin, doxorubicin, carminomycin, 4′-epiadriamycin, 4-demethoxy-daunomycin, 11-deoxydaunorubicin, 13-deoxydaunorubicin, adriamycin-14benzoate, adriamycin-14-octanoate, adriamycin-14-naphthaleneacetate, vinblastine, vincristine, mitomycin C, N-methyl mitomycin C, bleomycin A2, dideazatetrahydrofolic acid, aminopterin, methotrexate, cholchicine and cisplatin, and the like.
  • Cancer targeting molecules also may include toxins such as diphtheria toxin, cytokines such as CSF, GSF, GMCSF, TNF, erythropoietin, immunomodulators or cytokines such as the interferons or interleukins, a neuropeptide, reproductive hormone such as HGH, FSH, or LH, thyroid hormone, neurotransmitters such as acetylcholine, and hormone receptors such as the estrogen receptor.
  • toxins such as diphtheria toxin, cytokines such as CSF, GSF, GMCSF, TNF, erythropoietin, immunomodulators or cytokines such as the interferons or interleukins
  • a neuropeptide such as HGH, FSH, or LH
  • reproductive hormone such as HGH, FSH, or LH
  • neurotransmitters such as acetylcholine
  • hormone receptors such as the estrogen receptor.
  • Cancer targeting molecules can be a protein or peptide.
  • Polypeptide”, “peptide,” and “protein” are used interchangeably to refer to a polymer of amino acid residues linked by amide bonds. As used herein, these terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid. Thus, proteins may include natural and non-natural amino acids. Amino acids can be in the L or D form as long as the binding function of the peptide is maintained. Peptides can be of variable length, but are generally between about 4 and 200 amino acids in length.
  • Peptides may be cyclic, having an intramolecular bond between two non-adjacent amino acids within the peptide, e.g., backbone to backbone, side-chain to backbone and side-chain to side-chain cyclization.
  • Cyclic peptides can be prepared by methods well know in the art. See e.g., U.S. Pat. No. 6,013,625.
  • the cancer targeting molecule may be an antagonist or agonist of an integrin.
  • Integrin is a heterodimeric transmembrane glycoprotein complex that functions in cellular adhesion events and signal transduction processes. Integrins, which comprise and alpha and a beta subunit, include numerous types including ⁇ 1 ⁇ 1 , ⁇ 2 ⁇ 1 , ⁇ 3 ⁇ 1 , ⁇ 4 ⁇ 1 , ⁇ 5 ⁇ 1 , ⁇ 6 ⁇ 1 , ⁇ 7 ⁇ 1 , ⁇ 8 ⁇ 1 , ⁇ 9 ⁇ 1 , ⁇ 1 ⁇ 1 , ⁇ 6 ⁇ 4 , ⁇ 4 ⁇ 7 , ⁇ D ⁇ 2 , ⁇ D ⁇ 2 , ⁇ L ⁇ 2 , ⁇ M ⁇ 2 , ⁇ v ⁇ 1 , ⁇ v ⁇ 3 , ⁇ v ⁇ 5 , ⁇ v ⁇ 6 , ⁇ v ⁇ 8 , ⁇ x ⁇ 2 ,
  • Integrin ⁇ v ⁇ 3 is expressed on a variety of cells and has been shown to mediate several biologically relevant processes, including adhesion of osteoclasts to bone matrix, migration of vascular smooth muscle cells, and angiogenesis.
  • Suitable targeting molecules for integrins include RGD peptides or peptidomimetics or non-RGD peptides or peptidomimetics (see, e.g., U.S. Pat. Nos. 5,767,071 and 5,780,426) as well as for other integrins such as ⁇ 4 ⁇ 1 (VLA-4), ⁇ 4 ⁇ 7 (see, e.g., U.S. Pat. No.
  • a preferred cancer targeting molecule is an antibody.
  • antibody as used herein includes immunoglobulins, which are the product of B cells and variants thereof as well as the T cell receptor (TcR), which is the product of T cells, and variants thereof.
  • An immunoglobulin is a protein comprising one or more polypeptides substantially encoded by the immunoglobulin kappa and lambda, alpha, gamma, delta, epsilon and mu constant region genes, as well as myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda.
  • Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. Also subclasses of the heavy chain are known. For example, IgG heavy chains in humans can be any of IgG1, IgG2, IgG3 and IgG4 subclass.
  • a typical immunoglobulin structural unit is known to comprise a tetramer.
  • Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one “light” (about 25 kD) and one “heavy” chain (about 50-70 kD).
  • the N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition.
  • the terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively.
  • Antibodies exist as full length intact antibodies or as a number of well-characterized fragments produced by digestion with various peptidases or chemicals.
  • pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab′)2, a dimer of Fab, which itself is a light chain joined to VH-CH1 by a disulfide bond.
  • the F(ab′)2 may be reduced under mild conditions to break the disulfide linkage in the hinge region thereby converting the F(ab′)2 dimer into an Fab′ monomer.
  • the Fab′ monomer is essentially a Fab fragment with part of the hinge region (see, Fundamental Immunology, W. E. Paul, ed., Raven Press, N.Y.
  • a Fab fragment and Fc fragment are generated by digesting IgG with papain. Papain cleaves in the hinge region just above the residues involved in interchain S—S bonding, resulting in monovalent Fab fragments and the Fc fragment, which includes two constant region fragments, each containing the lower part of the hinge, CH2 and CH3 domains. The constant region fragments of the Fc are stabilized as a dimer though interchain S—S bonding of the lower residues of the hinge region.
  • Immunoglobulin “Fc” classically refers to the portion of the constant region generated by digestion with papain. Includes the lower hinge which has the interchain S—S bonds.
  • the term “Fc” as used herein refers to a dimeric protein comprising a pair of immunoglobulin constant region polyeptides, each containing the lower part of the hinge, CH2 and CH3 domain. Such “Fc” fragment may or may not contain S—S interchain bridging in the hinge region. It should be understood that an Fc may be from any Ig class and, as such, may include a CH4 domain such as in the case of IgM. Mutant sequences of an Fc are known such as described by Wines et al., J Immunol. 2000 May 15;164(10):5313-8 and may be used herein.
  • antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that any of a variety of antibody fragments may be synthesized de novo either chemically or by utilizing recombinant DNA methodology.
  • antibody as used herein also includes antibody fragments either produced by the modification of whole antibodies or synthesized de novo or antibodies and fragments obtained by using recombinant DNA methodologies.
  • Recombinant antibodies may be conventional full length antibodies, antibody fragments known from proteolytic digestion, unique antibody fragments such as Fv or single chain Fv (scFv), domain deleted antibodies, and the like. Fragments may include a domains or polypeptides with as little as one or a few amino acid deleted or mutated while more extensive deletion is possible such as deletion of one or more domains.
  • An Fv antibody is about 50 Kd in size and comprises the variable regions of the light and heavy chain.
  • a single chain Fv (“scFv”) polypeptide is a covalently linked VH::VL heterodimer which may be expressed from a nucleic acid including VH- and VL-encoding sequences either joined directly or joined by a peptide-encoding linker. See Huston, et al. (1988) Proc. Nat. Acad. Sci. USA, 85:5879-5883.
  • a number of structures for converting the naturally aggregated, but chemically separated light and heavy polypeptide chains from an antibody V region into an scFv molecule which will fold into a three dimensional structure substantially similar to the structure of an antigen-binding site. See, e.g. U.S. Pat. Nos. 5,091,513, 5,132,405 and 4,956,778.
  • An antibody may be a non-human antibody, a human antibody, a humanized antibody or a chimeric antibody, the latter comprising human and non-human antibody sequence.
  • chimeric antibody is prepared by exchanging a non-human constant region (heavy chain, light chain or both) with a human constant region antibody. See e.g. U.S. Pat. No. 4,816,567 to Cabilly et al. Methods of making humanized antibodies from non-human antibodies such as from murine antibodies are also well known (see, e.g., U.S. Pat. No. 5,565,332 to Winter).
  • a cancer targeting molecule may be an antibody that targets to a nuclear antigen that is accessible in necrotic portions of a tumor.
  • Necrotic cell targeting also known as Tumor Necrosis Therapy (TNT) (Epstein et al. (Cancer Res. (1988) 48:5842-5848; Chen et al., Cancer Res. (1989) 49:4578-4585; Hornick et al., Cancer Biotherapy and Radiopharmaceuticals (1998) 13:255-268; Sharifi et al., Hybridoma and Hybridomics (2001) 20:305-312) represents a different approach from methods that employ antibodies that bind to tumor-associated cell surface antigens and require the use of different antibodies for each type of tumor.
  • TNT Tumor Necrosis Therapy
  • TNT antibodies bind intracellular antigens found in all cells and which are retained by dying cells and which show preferential localization in malignant tumors due to the presence of abnormally permeable, degenerating cells only rarely present in normal tissues. Rapidly dividing tumors contain a proportion of degenerating or dead cells, but, with attention focused upon attempts to kill the dividing cells, the degenerating component has largely been ignored. Calculations of tumor cell loss have revealed that, in contrast to normal tissues, 30-80% of the progeny of tumor cell divisions shortly undergo degeneration.
  • the imperfect vasculature and impaired phagocytic response permit the accumulation of degenerating cells, often with the formation of large areas of necrosis, long recognized by pathologists to be a typical feature of malignant tumors (Epstein, et al., Cancer Res (1988) 48:5842-5848).
  • the accumulation within tumors of a high proportion of dying cells constitutes a major distinction between malignant tumors and normal tissues wherein sporadic cell death occurs at a relatively low rate and is accompanied by a rapid (within minutes) and orderly removal of necrotic elements from the tissue.
  • TNT antibodies Since degenerating cells have a permeable cell surface membrane not observed in viable cells, TNT antibodies enter and bind to their intracellular antigens in necrotic areas of the tumor. Contrarily, TNT antibodies diffusing in viable regions of the tumor and normal tissues do not bind and are removed from the circulation by normal clearance mechanisms. Hence, TNT antibodies provide a useful approach for specifically targeting necrotic regions of tumors and can be used to deliver diagnostic and therapeutic reagents into these regions which are may be situated deep within the central core of tumors. TNT antibodies have a number of unique features that distinguishes from other forms of antibody therapy. Because of these attributes, TNT antibodies have several advantages that enable the delivery of radionuclides (Epstein et al. (Cancer Res.
  • the cancer targeting antibody is specific for a tumor cell-surface antigen.
  • the antibody is specific for a stromal component of a tumor.
  • the antibody is specific for an intracellular antigen, such as an intranuclear antigen(s).
  • the antibody may be a humanized or human chimeric antibody based on the murine antibody TNT-1, TNT-2, TNT-3.
  • the human antibody NHS76 is a genetically engineered counterpart to TNT-1. The sequence of TNT antibody NHS76 can be found in U.S. Pat. No. 6,827,925.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705.
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705
  • identity in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aligned for maximum correspondence over a comparison window or designated region as measured using any number of
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1981, Adv. Appl. Math. 2:482) by the homology alignment algorithm of Needleman and Wunsch, (1970, J. Mol. Biol. 48:443) by the search for similarity method of Person and Lipman (1988, Proc. Nat'l. Acad. Sci. USA 85:2444) by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection.
  • Such alignment programs can also be used to screen genome databases to identify polynucleotide sequences having substantially identical sequences. For example, a substantial portion of the human genome sequence is available for searching via the BLAST search tool at the National Center for Biotechnology Information (NCBI). Information about multiple sequenced genomes and the resources to analyze them also is available from NCBI on its Genomic Biology web page.
  • NCBI National Center for Biotechnology Information
  • BLAST e.g., BLAST 2.0
  • HSPs high scoring sequence pairs
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • W word length
  • E expectation
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873).
  • One measure of similarity provided by BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • Antibodies may be prepared using recombinant expression methods such as in prokaryotic or eukaryotic cells as is well known in the art. (see e.g., U.S. Pat. Nos. 5,116,943 and 6,331,415).
  • nucleic acid encoding the protein can be cloned into an expression vector for high yield expression of the encoded product.
  • the expression vector can be part of a plasmid, virus, or may be a nucleic acid fragment.
  • the expression vector includes an expression cassette into which the nucleic acid encoding the protein is cloned in operable association with a promoter and optionally an enhancer.
  • the expression cassette may also include other features such as an origin of replication, and/or chromosome integration elements such as retroviral LTRs, or adeno associated viral (AAV) ITRs.
  • DNA encoding a signal sequence may be placed upstream of the nucleic acid encoding the mature amino acids of the protein.
  • DNA encoding a short protein sequence that could be used to facilitate later purification (e.g., a histidine tag) or assist in labeling the protein may be included within or at the ends of the protein encoding nucleic acid.
  • Cells suitable for replicating and for supporting recombinant expression of protein are well known in the art. Such cells may be transfected or transduced as appropriate with the particular expression vector and large quantities of vector containing cells can be grown for seeding large scale fermenters to obtain sufficient quantities of the protein for clinical applications.
  • Such cells may include prokaryotic microorganisms, such as E. coli , or various other eukaryotic cells, such as Chinese hamster ovary cells (CHO), insect cells, or the like. Standard technologies are known in the art to express foreign genes in these systems.
  • Antibody may be linked to CpG immunostimulatory oligonucleotides using crosslinkers such as maleimide crosslinkers (Table 1), which possess two different reactive groups that allow for conjugations with specific sites on antibodies, minimizing undesirable polymerization or self-conjugation.
  • crosslinkers such as maleimide crosslinkers (Table 1), which possess two different reactive groups that allow for conjugations with specific sites on antibodies, minimizing undesirable polymerization or self-conjugation.
  • Sulfo-EMCS aliphatic maleimide linker
  • sulfo-SMPB aromatic maleimide linker
  • maleimide crosslinkers are water-soluble analogues and consist of an N-hydroxysuccinimide (NHS) ester and a maleimide group connected with a spacer arm which limits steric hindrance.
  • NHS esters will react with primary amines of the antibody and after purification, the maleimide group will react with the thio functional group of CpG immunostimulatory oligonucleotides (see FIG. 1 ).
  • the antibody conjugated with the various crosslinkers to CpG immunostimulatory oligonucleotides will be compared for differences in yields, binding of the antibody moiety, and CpG immunostimulatory oligonucleotide activity.
  • Antibody can be crosslinked according to the standard procedures (e.g., chemical manufacturer's instructions) such as optimized procedures previously described (Khawli et al. Cancer Biother & Radiopharm. (1996) 11:203-215; Sharifi et al., Q.J. Nucl. Med. (1998) 42:242-249). Briefly, antibody is derivatized with conjugation buffer (0.05M PBS, 3 mM EDTA, pH 7.5) for 30 min at room temperature with different molar ratios of the maleimide crosslinking agent to antibody using water-soluble analogues. Excess crosslinking reagents is removed by Sephadex G-25 column chromatography.
  • conjugation buffer 0.05M PBS, 3 mM EDTA, pH 7.5
  • Free CpG immunostimulatory oligonucleotide is separated from conjugated CpG immunostimulatory oligonucleotide by Sephadex G-50 column chromatography. The different fractions are concentrated, filtered, and further analyzed by sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and by high-pressure liquid chromatography (HPLC) to determine purity.
  • SDS-PAGE sodium dodecylsulfate-polyacrylamide gel electrophoresis
  • HPLC high-pressure liquid chromatography
  • the number of CpG immunostimulatory oligonucleotide molecules per antibody in the conjugate may be determined spectrophotometrically and calculated as OD 260 /OD 280 ratio as described by Ngo and Oliva (protocol according to TriLink BioTechnologies, La Jolla, Calif.).
  • linker chemistry that will facilitate release of CpG immunostimulatory oligonucleotides from the invention conjugate within the tumor. This would be useful because CpG immunostimulatory oligonucleotides can enter the cell and bind to the Toll-like receptor 9 (Hemmi et al., Nature (2000) 208:740-745; Tauszig et al., Proc. Natl. Acad. Sci. (USA) (2000) 97:10520-10525). Tumors with significant necrosis may contain abundant enzymes capable of releasing the CpG immunostimulatory oligonucleotides from the invention conjugate for many different linker chemistries. Labile linkers also may be suitable in this regard.
  • an acid-labile heterobifunctional linker that would take advantage of the lower pH of necrotic and hypoxic regions of tumors where lactic acid buildup has been observed (Cooper, Cell Tissue Kinet. (1973) 6:87-95) is advantageous.
  • a maleimide derivative of 2-methylmaleic anhydride (Pierce Chemical) may be used to generate a CpG immunostimulatory oligonucleotide/protein immunoconjugate with an acid-labile bond (Blattner et al., Biochem. (1985) 24:1517-1525; Yang and Reisfeld, Proc. Natl. Acad. Sci.
  • the resulting CpG immunostimulatory oligonucleotide/protein immunoconjugate has a carboxamide bond that is susceptible to hydrolysis under mildly acidic conditions likely to be encountered in the tumor parenchyma, which conditions will foster release of the CpG immunostimulatory oligonucleotide moiety from the targeting agent protein.
  • Invention conjugates may be evaluated for reactivity and avidity.
  • purified CpG immunostimulatory oligonucleotide/antibody preparations can be radiolabeled with I-125 using a modified chloramine-T method as described previously (Hornick et al., Cancer Biother. & Radiopharm. (1998) 13:255-268).
  • the in vitro immunoreactivities of radiolabeled fusion proteins can be evaluated by a conventional fixed Raji cell radioimmunoassay (Miller et al., Hybridoma (1993) 12:689-698). Briefly, Raji lymphoma cells are resuspended in freshly prepared 2% paraformaldehyde in PBS to fix the cells and cause disruption of the cell membrane.
  • Radioiodinated preparations (approximately 100,000 cpm/tube) are incubated in triplicate with 10 6 fixed Raji cells for 1 h. Following incubation, the cells are washed 3 times with 1% bovine serum albumin in PBS. Bound immunoconjugate is detected by measuring the cell pellet-associated radioactivity in a gamma counter.
  • In vitro serum stability of invention conjugates can be evaluated using well known methods such as described previously (Hornick et al., Cancer Biother. & Radiopharm. (1998) 13:225-268). For example, radioiodinated preparations are incubated for 48 h in mouse and/or human serum at 37° C. After trichloroacetic acid precipitation and centrifugation, protein-bound radioactivity is measured in a gamma counter in order to calculate the percentage of intact fusion protein. In addition, the in vitro reactivities of radiolabeled invention conjugates before and after incubation in serum can be determined as described above.
  • In vitro assays using splenocytes and macrophages or other types of cells that express TLR9 receptors may be used to demonstrate that the CpG immunostimulatory oligonucleotide portion of the invention conjugate remains active after chemical conjugation.
  • in vitro assays using mouse splenocytes or J7-74 and J77743A mouse macrophages can be performed as described by Kandimalla et al. (Kandimilla et al., Bioconjug. Chem. (2002) 13:966-974). Briefly, splenocytes or J7-74 or J77743A cells are plated in 24 well dishes using 10 6 cells/ml.
  • CpG ODN alone positive control
  • CpG conjugate is added at different equimolar concentrations (0.03 to 10.0 ⁇ g/ml) to the cell cultures.
  • the cells are incubated at 37° C. for 24 hr and the supernatants collected for ELISA determination of secreted cytokines such as IL-12, IL-6, IFN- ⁇ , and other pertinent cytokines and chemokines.
  • Sandwich ELISAs are commercially available for such cytokines (see e.g., R&D Sciences, Minneapolis, Minn.).
  • Activity of invention conjugates can be demonstrated in tumor animal models such as tumor-bearing nude or BALB/c mice. Studies may include in vivo determination of pharmacokinetic clearance, biodistribution, imaging, and toxicity.
  • the anti-tumor activity of each reagent can be studied in tumor-bearing mice by assessing their effects on tumor growth (tumor volume, survival times) and morphology.
  • the tumor used for targeting needs to express the antigen or other agent to the antibody tumor targeting portion of the invention conjugate binds.
  • 125 I-labeled versions of the invention conjugates which comprise protein can be prepared using a modified chloramine-T method as described previously (Hornick et al., Cancer Biother. & Radiopharm. (1998) 13:225-226).
  • Tissue biodistribution studies can be performed in tumor-bearing mice to evaluate the in vivo targeting ability of invention conjugates.
  • six-week-old BALB/c mice are injected subcutaneously with a 0.2 ml inoculum containing 1 ⁇ 10 7 tumor cells in the left flank. The tumors are grown for 7-10 days until they reach 0.5-1 cm in diameter.
  • individual mice are injected i.v. with a 0.1 ml inoculum containing 30-40 ⁇ Ci of 125 I-labeled conjugate.
  • mice Animals are sacrificed by sodium pentobarbital overdose at 3 different time points post-injection (24, 48 and 72 h), and tissues are removed, weighed, and measured in a gamma counter. For each mouse, data is expressed as percentage injected dose/gram (% ID/g) and as tumor/organ ratio (cpm per gram tumor/cpm per gram organ). Significance levels are determined using the Wilcoxon's rank-sum test.
  • the anti-tumor activity of invention conjugates may be compared with that of unconjugated tumor targeting agent, free CpG immunostimulatory oligonucleotide, and inactive CpG oligonucleotide containing conjugates to validate the efficacy of the conjugate.
  • the conjugate is more active per unit dose that either the antibody alone or the CpG immunostimulatory oligonucleotide alone, administered similarly.
  • the administered dose of each preparation per mouse is determined from the MTD data and efficacy is evaluated by monitoring tumor volume 3 ⁇ per week as determined by caliper measurement performed in three dimensions. Regression or inhibition of growth relative to the controls indicates efficacy of the therapy.
  • different tumor models may be used.
  • Groups of tumor-bearing mice receive intravenous treatment 7-10 days after tumor implantation for 5 consecutive days with MTD doses determined by the toxicity studies described above.
  • This treatment regimen is similar to others previously used to study cytokine and chemokine immunoconjugates of the chTNT-3 antibody (Hornick et al., Clin. Cancer Res. (1999) 5:51-60). All doses are administered in a 0.1 ml inoculum by the same person to maintain consistency. If a particular preparation is found effective, the minimal optimal dose and the fewest number of doses is determined using alternative treatment regimens such as 1,2, or 3 times per week for one or two courses.
  • Morphological analysis and immunohistochemical evaluation of tumor samples can be used to identify the effects of invention conjugates.
  • tumor samples removed at 1, 3, 5, and 7 days after the completion of a single course of therapy (5 daily injections) are either fixed overnight in 10% neutral buffered formalin for paraffin embedding or snap frozen submerged in O.C.T. compound to prepare samples for frozen sectioning.
  • Paraffin embedded sections are stained with H & E for morphological examination and frozen sections are used for immunohistochemical studies using a panel of anti-sera specific for lymphoid subsets.
  • Exemplary primary antibodies used in immunohistochemical studies and their working dilutions are shown below in Table 2. Similar antibody reagents are available for detecting human lymphocyte subsets.
  • Monoclonal Antibodies Titration Lymphocyte subset
  • Anti-Pan NK 1:100 NK cells ⁇ 90%)
  • Cytokines/chemokines induced in the tumor or in draining lymph nodes by invention conjugates may be determined by real-time PCR.
  • tumors and tumor draining lymph nodes TDLN are removed at days 0, 3, 6, 9, 12, 15 after the initiation of treatment.
  • Total RNA is extracted by Trizol (Gibco, Rockville, Md.) and 1 ⁇ g of total RNA is reverse transcribed into cDNA by a first-strand cDNA synthesis kit (Invitrogen Life technologies, CA).
  • the PCR reaction mixture consists of 5 ⁇ l of cDNA, 10 ⁇ l of SYBR green master Mix (Applied Biosystems, Foster Calif.), 2 ⁇ l of primers (3.3 ⁇ M) and 1 ⁇ l of water.
  • PCR is performed for 30 cycles.
  • the quantity of cytokines (IL-2, IL-10, IL-4, IFN- ⁇ , TGF- ⁇ 1, and TNF ⁇ ) is detected by an ABI PRISM® 7900HT Sequence Detection System (Applied biosystems, Foster, Calif.).
  • Exemplary DNA primers that can be used to detect cytokines/chemokines is shown in Table 3. Primers for detecting human versions of these cytokines are well known in the art. TABLE 3 DNA Primers for Real-Time PCR Studies.
  • Lymphocyte subset infiltration and intracellular cytokine expression analyzed by flow cytometry can be used to evaluate the in vivo biological effects of invention conjugates.
  • flow cytometry i.e. FACS
  • tumors and TDLNs are removed on days 0, 3, 6, 9, 12, 15 after the initiation of treatment and cut into 2-3 mm pieces in a culture petri dish.
  • the tissues are digested with 0.01% DNAse, 0.01% hyaluranidase, and 0.1% collagenase for 2-3 hr at 37° C. with continuous stirring.
  • the resulting single cell suspensions are washed twice with 0.1% FCS in PBS and stained by standard flow cytometry methods.
  • Subpopulations of lymphocytes infiltrating the tissues are identified by staining with conjugated antibodies including PE-anti-CD4, FITC-anti-CD8, PE-anti-PMN, FITC-anti-CD25, and FITC-anti-NK1.1 (BD Biosciences PharMingen, San Diego, Calif.).
  • conjugated antibodies including PE-anti-CD4, FITC-anti-CD8, PE-anti-PMN, FITC-anti-CD25, and FITC-anti-NK1.1 (BD Biosciences PharMingen, San Diego, Calif.).
  • PMA Sigma Aldrich, St. Louis, Mo.
  • 500 ng/ml ionomycin in the presence of GolgiStop (BD PharMingen, San Diego, Calif.).
  • Samples may also be stimulated specifically with tumor lysates for 4-6 hr in the presence of GolgiStop. T-cells are then stained for surface markers (CD45 + or CD8 + ) and for presence of cytokines using anti-cytokine antibodies. Briefly, single cell suspensions are reacted with CD16 (BD PharMingen, San Diego, Calif.) for 15 min at 4° C. to block mouse Fc receptors. The cells are washed and incubated for 30 min either with FITC-CD45 + to stain total lymphocytes or PE-anti-CD8 + for CD8 + T-cells.
  • CD16 BD PharMingen, San Diego, Calif.
  • Cells are fixed and permeabilized with 100 ⁇ l Cytofix/Cytoperm (BD PharMingen, San Diego, Calif.) for 15 min, washed with 300 ⁇ l of Penn/Wash, resuspended in 50 ⁇ l Perm/Wash with anti-IL-2, anti-IFN- ⁇ , or anti-TNF ⁇ for 30 min in the dark. Binding of antibody to the cells is determined by FACS analysis.
  • Cytofix/Cytoperm BD PharMingen, San Diego, Calif.
  • the invention conjugates described herein can be used for treatment of cancer in an individual so afflicted. Accordingly, the present invention includes a method of reducing the size of a tumor or inhibiting the growth of cancer in an individual comprising administering an effective amount of the invention conjugates.
  • a further aspect of the invention is a method of inhibiting the development of metastasis in an individual suffering from cancer, comprising administering an effective amount of the invention conjugates.
  • immunoregulatory T cells Reducing the activity of immunoregulatory T cells in an individual as part of the methods of the invention may be achieved by removing ex vivo or by depleting or inactivating immunoregulatory T cells in the individual.
  • immunoregulatory T cells refers to a population of T cells that function, directly or indirectly, to suppress the host anti-tumor immune response. Immunoregulatory T cells may be CD4+, CD25+ or positive for both markers.
  • removing ex vivo as used herein with reference to immunoregulatory T cells means that immunoregulatory T cells are removed from the circulation of an individual by an ex vivo method such as flow cytometric cell separation, column or filter separation, and the like.
  • the column or filter may have bound thereto an antibody that can bind to immunoregulatory T cells.
  • Antibodies that bind to immunoregulatory T cells also may be used to identify such cells for removal by a flow cytometric device.
  • Antibody suitable for binding to immunoregulatory T cells include antibody specific for the CD4 antigen, the alpha chain subunit of the IL-2 receptor (i.e. CD25), and the like. A combination of such anti-T cell antibodies also may be used.
  • Daclizumab® a humanized monoclonal antibody that binds to CD25 or Basiliximab®, a chimeric version of this same antibody is commercially available from Novartis Pharma AG.
  • Hu-Max-CD4® a fully humanized antibody against CD4 has been made (GenMab). CD4 antibody is described by North and Awwad 1990, while CD25 is described by Onizuka et al. 1999.
  • the term “depleting or inactivating in vivo immunoregulatory T cells” as used herein refers to a reduction in the number or functional capability of immunoregulatory T cells which suppress the host anti-tumor immune response that occurs following administration of a pharmaceutical agent to the host.
  • the pharmaceutical agent is one that when administered causes a loss of immunoregulatory T cells (i.e., depletion) or inactivation of anti-tumor immune suppression function of the immunoregulatory T cells.
  • the ultimate result of such treatment is to reduce immunoregulatory T cell activity in the recipient of the treatment.
  • Depleting or inactivating immunoregulatory T cells may be achieved by administering a pharmaceutical agent such as an antibody specific for the CD4 antigen, the alpha chain subunit of the IL-2 receptor (i.e. CD25), and the like, as described above.
  • a pharmaceutical agent such as an antibody specific for the CD4 antigen, the alpha chain subunit of the IL-2 receptor (i.e. CD25), and the like, as described above.
  • an antibody to gamma delta immunoregulatory T cells can be used to deplete such cells and stimulate anti-tumor immunity as described previously. Seo et al., J. Immunol. (1999) 163:242-249.
  • Anti-CD40 ligand also may be used to deplete or inactivate immunoregulatory T cells.
  • Partial antibody constructs such as CTLA4Ig, a fusion protein of CTLA4 and Fc of immunoglobulin (Ig) heavy chain, can be used to inhibit the essential co-stimulatory signal for full T cell activation via blocking the interaction between CD28 and B7 molecules.
  • CTLA4Ig may be administered as a pharmaceutical to render regulatory T cells nonresponsive (i.e. inactivation). See Park et al. Pharm Res. (2003) 20(8): 1239-48.
  • An IL-2 fusion to pseudomonas exotoxin (OnTac) is yet another agent for depleting or inactivating regulatory T cells.
  • agents may be administered that prevent the induction of CD8+ cytolytic T-lymphocyte (CTL) tumor anergy.
  • CTL cytolytic T-lymphocyte
  • Agents that agonize CD137 such as agonistic antibodies, may be used to restore the tumor cytolytic function of established anergic CTLs upon reencountering their cognate antigen. See Wilcox et al., Blood (2004) 103:177-184. This approach can be used to break T-cell tolerance to tumor antigens.
  • GITR glucocorticoid-induced tumor necrosis factor receptor
  • Antibodies to neurophilin e.g. Bruder et al. 2004
  • antibodies to CTLA-4 e.g. Leach et al. 1996) also can be administered in vivo to deplete immunoregulatory T cells or reduce their activity.
  • Methods of removing, depleting or inactivating immunoregulatory T cells may be used even if the methods are not limited solely to such cells. Effort to remove, deplete or inactivate immunoregulatory T cells may be performed multiple times during a given period of treatment. Also, different methods may be used together (e.g., ex vivo cell removal and in vivo depletion or inactivation). The amount of anti-T cell antibody administered for depletion or inactivation may be similar to the amount used in the transplantation field. See, e.g., Meiser et al., Transplantation. (1994) 27; 58(4): 419-23.
  • Immunoregulatory T cells may be removed, depleted or inactivated before, during and/or after administration of the invention conjugates. Immunoregulatory T cells are preferably removed, depleted or inactivated before administering the invention conjugates.
  • the invention methods for cancer therapy may include adoptive transfer of immune cells to enhance anti-tumor immunity.
  • adoptive transfer refers to the administration of immune cells, from another individual or from the same individual. These are preferably T cells, which may be activated ex vivo to enhance their ability to function in supporting an anti-tumor immune response.
  • adoptively transferred immune cells may be activated ex vivo by any of a variety of well known agents including, for example, exposure to IL-2 and/or to anti-CD3 antibodies. Ex vivo activation also may include exposure to a cancer cell vaccine.
  • Such cancer cell vaccine may constitute live (but non-replicating), or killed cancer cells from the individual to be treated or from another cancer entirely.
  • the vaccine also may be a cancer cell extract or purified vaccine preparation derived from cancer cells. Cancer cell vaccines are well known in the art and may be prepared in accordance with well known methods.
  • patients receive multiple infusions of T-cells after ex vivo stimulation with IL-2 (Lum, et al., J Immunother. (2001) 24:408-19) or other agents such as anti-CD3+ and anti-CD28+antibodies (June, C. H.: J. Immunother (2001) 24(5): 389-391).
  • compositions of the invention may be formulated as solutions or lyophilized powders for parenteral administration. Powders may be reconstituted by addition of a suitable diluent or other pharmaceutically acceptable carrier prior to use. Liquid formulations may be buffered, isotonic, aqueous solutions. Powders also may be sprayed in dry form. Examples of suitable diluents are normal isotonic saline solution, standard 5% dextrose in water, or buffered sodium or ammonium acetate solution.
  • Such formulations are especially suitable for parenteral administration, but may also be used for oral administration or contained in a metered dose inhaler or nebulizer for insufflation. It may be desirable to add excipients such as polyvinylpyrrolidone, gelatin, hydroxy cellulose, acacia, polyethylene glycol, mannitol, sodium chloride, sodium citrate, and the like.
  • compounds may be encapsulated, tableted or prepared in an emulsion or syrup for oral administration.
  • Pharmaceutically acceptable solid or liquid carriers may be added to enhance or stabilize the composition, or to facilitate preparation of the composition.
  • Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, magnesium stearate or stearic acid, talc, pectin, acacia, agar or gelatin.
  • Liquid carriers include syrup, peanut oil, olive oil, saline and water.
  • the carrier may also include a sustained release material such as glyceryl monostearate or glyceryl distearate, alone or with a wax.
  • the amount of solid carrier varies but, preferably, will be between about 20 mg to about 1 g per dosage unit.
  • the pharmaceutical preparations are made following the conventional techniques of pharmacy involving milling, mixing, granulating, and compressing, when necessary, for tablet forms; or milling, mixing and filling for hard gelatin capsule forms.
  • the preparation may be in the form of a syrup, elixir, emulsion, or an aqueous or non-aqueous suspension.
  • the invention compounds may be combined with excipients such as cocoa butter, glycerin, gelatin or polyethylene glycols and molded into a suppository.
  • Compounds may be formulated to include other medically useful drugs or biological agents.
  • the compounds also may be administered in conjunction with the administration of other drugs or biological agents useful for the disease or condition to which the invention compounds are directed.
  • an effective amount refers to a dose sufficient to provide concentrations high enough to impart a beneficial effect on the recipient thereof.
  • the specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the disorder being treated, the severity of the disorder, the activity of the specific compound, the route of administration, the rate of clearance of the compound, the duration of treatment, the drugs used in combination or coincident with the compound, the age, body weight, sex, diet, and general health of the subject, and like factors well known in the medical arts and sciences.
  • a compound can be administered parenterally, such as intravascularly, intravenously, intraarterially, intramuscularly, subcutaneously, or the like. Administration can also be orally, nasally, rectally, transdermally or inhalationally via an aerosol.
  • the compound may be administered as a bolus, or slowly infused.
  • a therapeutically effective dose can be estimated initially from cell culture assays by determining an IC50.
  • a dose can then be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 as determined in cell culture. Such information can be used to more accurately determine useful initial doses in humans.
  • Levels of drug in plasma may be measured, for example, by HPLC. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition.
  • the administration of the cancer therapeutic agent (invention conjugate) to an immunocompetent individual may result in the production of antibodies against the agents.
  • Reducing the immunogenicity of the invention cancer therapeutic agents can be addressed by methods well known in the art such as by attaching long chain polyethylene glycol (PEG)-based spacers, and the like, to the agent.
  • PEG polyethylene glycol
  • Long chain PEG and other polymers are known for their ability to mask foreign epitopes, resulting in the reduced immunogenicity of therapeutic proteins that display foreign epitopes (Katre et al., J. Immunol. (1990,) 144, 209-213; Francis et al., Int. J. Hematol. (1998) 68, 1-18).
  • the individual administered the cancer therapeutic agents or compositions may be administered an immunosuppressent such as cyclosporin A, anti-CD3 antibody, and the like.
  • Chimeric TNT-3 antibody was produced according to published results (Hornick et al., Cancer Biother. & Radiopharm. (1998)13:255-268).
  • cTNT-3 was incubated with the cross-linker N-[ ⁇ -Maleimidocaproyloxy]sulfosuccinimide ester (Sulfo-EMCS; Pierce, Ill.) in a 100 mM EDTA-PBS buffer solution (pH 8.3) at a molar ratio of 1:20 for 1 h at room temperature.
  • Phosphothioate backbone CpG ODN modified with sulfhydral group at the terminal nucleotide was custom synthesized by Norris Cancer Center Microchemical Core Facility (Los Angeles, Calif.).
  • the phosphothioated sulfhydryl-modified ODN 1826 (SEQ ID NO:1) comprised a CpG motif with the sequence 5′-S-TCCATGACGTTCCTGACGTT-3′.
  • Phosphothioated sulfhydryl-modified ODN 1745 (SEQ ID NO 6):, used as a negative control, 5′-S-TCCAATGAGCTTCCTGAGTCT-3′ for CpG activity along with Phosphothioated sulfhydryl-modified ODN 2006 (SEQ ID NO: 3), 5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′, which is B cell specific.
  • Sulfhydryl-modified ODN were activated by reducing in a 50 mM DTT-EDTA-PBS solution for 2 h at room temperature. Subsequently, unbound Sulfo-EMCS and DTT were removed from the respective solutions by chromatography using a PD-10 column.
  • Activated ODN were incubated overnight with the linker-modified chTNT-3 (sulfo-EMCS/chTNT-3) at a molar ratio of 10:1 at 4° C. and thereafter L-cysteine was added to quench reactive Sulfo-EMCS. Free ODN was removed by centrifugation on a Centricon-100. Purified conjugate was analyzed on a 4-15% gradient reducing SDS-PAGE and consecutively visualized with coomassie-blue stain. The ratio of bound CpG ODN on chTN-3 was determined spectrophotometrically and calculated as OD260/OD280 ratio using the method of Ngo and Oliva (protocol according to TriLink BioTechnologies, La Jolla, Calif.). The batches of CpG/chTNT-3 immunoconjugates used in this study had a ratio of about 1.5 CpG molecules linked to one chTNT-3 molecule.
  • CpG/chTNT-3 preparations were radiolabeled with 125 I using a modified chloramine-T method. Immunoreactivity was evaluated by a conventional fixed Raji cell radioimmunoassay. Briefly, Raji lymphoma cells (ATCC: Rockville, Md.) were resuspended in freshly prepared 2% paraformaldehyde in PBS to fix the cells and cause disruption of the cell membrane. Radioiodinated immunoconjugates (approximately 100,000 cpm/tube) were then incubated in triplicate with 106 fixed Raji cells for 1 h. Both the chTNT-3 parental antibody and chTNT-3/CpG immunoconjugates showed immunoreactivities of 70% or greater.
  • the biological activity of the CpG motif in the immunoconjugates was assessed using the murine macrophage cell lines J7-74 and J77743A, available from the ATCC (Rockville, Md.) as described by Kandimalla et al. Bioconjug. Chem. (2002) 13:966-974. Briefly, cells were plated in 24 well dishes using 10 6 cells/ml. CpG alone (positive control) and the CpG/chTNT-3 immunoconjugates were added at equimolar concentrations of 0.1, 0.3, 1.0, or 3.0 ⁇ g/ml to the cell cultures. The cells are then incubated at 37° C. for 24 hr and the supernatants collected for IL-6 determination using a commercial sandwich ELISA assay from R&D Sciences (Minneapolis, Minn.). Results were interpolated from the standard curves.
  • both cell lines showed a dose dependent induction of IL-6 secretion after incubation with chTNT-3/CpG 1826 motif.
  • Other immunoconjugates were negative in this assay including control immunoconjugate CpG 1745 and CpG 2006, which is specific for B-lymphocytes.
  • tumor reduction of about 50% was observed at day 21 post-treatment in the chTNT-3/CpG 1826 group compared to control treated mice.
  • the amount of tumor reduction by chTNT-3/CpG 1826 at a 30 ug dose was comparable to that achieved with the 5 ug intratumoral administration of free CpG 1826 even though this dose represented about 1 ⁇ 3 as much CpG as the intratumoral injection.
  • those groups of mice receiving intravenous control parental antibody or chTNT-3/CpG 1745 had similar growth curves demonstrating inactivity for this conjugate.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
US11/269,123 2004-11-09 2005-11-08 Targeted innate immunity Abandoned US20060135459A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
US11/269,123 US20060135459A1 (en) 2004-11-09 2005-11-08 Targeted innate immunity
US13/228,317 US9522958B2 (en) 2004-11-09 2011-09-08 Cancer targeted innate immunity

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US62682904P 2004-11-09 2004-11-09
US11/269,123 US20060135459A1 (en) 2004-11-09 2005-11-08 Targeted innate immunity

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/228,317 Division US9522958B2 (en) 2004-11-09 2011-09-08 Cancer targeted innate immunity

Publications (1)

Publication Number Publication Date
US20060135459A1 true US20060135459A1 (en) 2006-06-22

Family

ID=36337107

Family Applications (2)

Application Number Title Priority Date Filing Date
US11/269,123 Abandoned US20060135459A1 (en) 2004-11-09 2005-11-08 Targeted innate immunity
US13/228,317 Expired - Fee Related US9522958B2 (en) 2004-11-09 2011-09-08 Cancer targeted innate immunity

Family Applications After (1)

Application Number Title Priority Date Filing Date
US13/228,317 Expired - Fee Related US9522958B2 (en) 2004-11-09 2011-09-08 Cancer targeted innate immunity

Country Status (5)

Country Link
US (2) US20060135459A1 (fr)
EP (1) EP1809671B1 (fr)
AU (1) AU2005304771A1 (fr)
CA (1) CA2586913A1 (fr)
WO (1) WO2006052900A2 (fr)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007089871A2 (fr) * 2006-02-01 2007-08-09 The Johns Hopkins University Conjugue d'acide nucleique de polypeptides destine a l'immunoprophylaxie ou a l'immunotherapie des troubles neoplasiques ou infectieux
US20080031887A1 (en) * 2006-06-30 2008-02-07 Joseph Lustgarten Conjugates for inducing targeted immune responses and methods of making and using same
WO2009018500A1 (fr) * 2007-07-31 2009-02-05 The Johns Hopkins University Conjugué d'acide nucléique de polypeptide destiné à l'immunoprophylaxie ou à l'immunothérapie des troubles néoplasiques ou infectieux
WO2009082448A2 (fr) * 2007-12-18 2009-07-02 The Texas A & M University System Oligonucléotides modifiés pour le traitement d'une infection de type hépatite c
WO2011109789A3 (fr) * 2010-03-05 2012-04-05 The Johns Hopkins University Compositions et procédés pour des anticorps et protéines de fusion immunomodulateurs ciblés
US8685416B2 (en) 2010-03-02 2014-04-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for the treatment of cancer
US9540439B2 (en) 2012-10-08 2017-01-10 St. Jude Children's Research Hospital Therapies based on control of regulatory T cell stability and function via a neuropilin-1:semaphorin axis
US9827329B2 (en) 2014-01-10 2017-11-28 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US9878052B2 (en) 2012-07-18 2018-01-30 Birdie Biopharmaceuticals Inc. Compounds for targeted immunotherapy
JP2021509674A (ja) * 2018-01-04 2021-04-01 アカデミア シニカＡｃａｄｅｍｉａ Ｓｉｎｉｃａ 治療を強化するための細胞会合免疫アジュバント
US10973826B2 (en) 2015-10-29 2021-04-13 Novartis Ag Antibody conjugates comprising toll-like receptor agonist
US11046781B2 (en) 2016-01-07 2021-06-29 Birdie Biopharmaceuticals, Inc. Anti-HER2 combinations for treating tumors
US11053240B2 (en) 2017-04-27 2021-07-06 Birdie Biopharmaceuticals, Inc. 2-amino-quinoline derivatives
US11130812B2 (en) 2014-09-01 2021-09-28 Birdie Biopharmaceuticals, Inc. Anti PD-L1 conjugates for treating tumors
US11136397B2 (en) 2016-01-07 2021-10-05 Birdie Pharmaceuticals, Inc. Anti-EGFR combinations for treating tumors
US11179473B2 (en) 2020-02-21 2021-11-23 Silverback Therapeutics, Inc. Nectin-4 antibody conjugates and uses thereof
US11203611B2 (en) 2017-04-14 2021-12-21 Tollnine, Inc. Immunomodulating polynucleotides, antibody conjugates thereof, and methods of their use
US11220552B2 (en) 2016-01-07 2022-01-11 Birdie Biopharmaceuticals, Inc. Anti-CD20 combinations for treating tumors
WO2022056043A1 (fr) * 2020-09-09 2022-03-17 University Of Southern California Immunoconjugués cpg de thérapie anti-cancéreuse
US11279761B2 (en) 2014-07-09 2022-03-22 Birdie Biopharmaceuticals, Inc. Anti-PD-L1 combinations for treating tumors
US11517567B2 (en) 2017-06-23 2022-12-06 Birdie Biopharmaceuticals, Inc. Pharmaceutical compositions
US11541126B1 (en) 2020-07-01 2023-01-03 Silverback Therapeutics, Inc. Anti-ASGR1 antibody TLR8 agonist comprising conjugates and uses thereof

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9186371B2 (en) 2010-09-17 2015-11-17 Japan Science And Technology Agency Inhibitor of HMGB protein-mediated immune response activation, and screening method
WO2014144666A2 (fr) 2013-03-15 2014-09-18 The University Of Chicago Procédés et compositions associés à l'activité des lymphocytes t
US10894963B2 (en) 2013-07-25 2021-01-19 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
US10434064B2 (en) 2014-06-04 2019-10-08 Exicure, Inc. Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
US9919058B2 (en) 2014-07-15 2018-03-20 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Polyketal particles including a CpG oligodeoxynucleotide for the treatment of lung cancer
EP3220895B1 (fr) 2014-11-21 2022-08-31 Northwestern University Absorption cellulaire spécifique à une séquence de conjugués nanoparticulaires d'acides nucléiques sphériques
US20190263919A1 (en) * 2016-07-01 2019-08-29 Five Prime Therapeutics, Inc. Combined anti tumor therapy with a gitr agonist and cpg
WO2018009916A1 (fr) 2016-07-07 2018-01-11 The Board Of Trustees Of The Leland Stanford Junior University Conjugués d'adjuvant d'anticorps
CN110087665A (zh) * 2016-08-03 2019-08-02 H·李·莫菲特癌症中心与研究所公司 Tlr9靶向治疗
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
US11433131B2 (en) 2017-05-11 2022-09-06 Northwestern University Adoptive cell therapy using spherical nucleic acids (SNAs)
WO2019182996A1 (fr) * 2018-03-19 2019-09-26 The Regents Of The University Of California Protéines de fusion anticorps-interféron pour améliorer les thérapies par transfert cellulaire adoptif de lymphocytes t pour le traitement du cancer
JP2022525594A (ja) 2019-03-15 2022-05-18 ボルト バイオセラピューティクス、インコーポレーテッド Ｈｅｒ２を標的とする免疫結合体

Citations (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US4956778A (en) * 1987-07-02 1990-09-11 Mitsubishi Denki Kabushiki Kaisha Constant speed holding device
US5091513A (en) * 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5116943A (en) * 1985-01-18 1992-05-26 Cetus Corporation Oxidation-resistant muteins of Il-2 and other protein
US5132405A (en) * 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5306809A (en) * 1990-12-31 1994-04-26 Akzo N.V. Acid-labile linker molecules
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5767071A (en) * 1995-06-07 1998-06-16 Ixsys Incorporated Sevenmer cyclic peptide inhibitors of diseases involving αv β3
US5780426A (en) * 1995-06-07 1998-07-14 Ixsys, Incorporated Fivemer cyclic peptide inhibitors of diseases involving αv β3
US6013625A (en) * 1990-04-06 2000-01-11 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
US6365619B1 (en) * 1999-07-22 2002-04-02 Novartis Ag Treatment of arteriosclerosis
US6827925B1 (en) * 1998-07-02 2004-12-07 Cambridge Antibody Technology Limited Specific binding proteins including antibodies which bind to the necrotic center of tumors, and uses thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1296714B1 (fr) * 2000-06-22 2009-08-26 University Of Iowa Research Foundation Combinaison de CpG et d'anticorps contre le CD19, CD20, CD22 ou CD40 pour la prévention ou pour le traitement du cancer.
US20030149246A1 (en) * 2002-02-01 2003-08-07 Russell John C. Macromolecular conjugates and processes for preparing the same
US20040053880A1 (en) * 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses

Patent Citations (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4816567A (en) * 1983-04-08 1989-03-28 Genentech, Inc. Recombinant immunoglobin preparations
US6331415B1 (en) * 1983-04-08 2001-12-18 Genentech, Inc. Methods of producing immunoglobulins, vectors and transformed host cells for use therein
US5116943A (en) * 1985-01-18 1992-05-26 Cetus Corporation Oxidation-resistant muteins of Il-2 and other protein
US5091513A (en) * 1987-05-21 1992-02-25 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US5132405A (en) * 1987-05-21 1992-07-21 Creative Biomolecules, Inc. Biosynthetic antibody binding sites
US4956778A (en) * 1987-07-02 1990-09-11 Mitsubishi Denki Kabushiki Kaisha Constant speed holding device
US5530101A (en) * 1988-12-28 1996-06-25 Protein Design Labs, Inc. Humanized immunoglobulins
US6013625A (en) * 1990-04-06 2000-01-11 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
US5306809A (en) * 1990-12-31 1994-04-26 Akzo N.V. Acid-labile linker molecules
US5565332A (en) * 1991-09-23 1996-10-15 Medical Research Council Production of chimeric antibodies - a combinatorial approach
US5767071A (en) * 1995-06-07 1998-06-16 Ixsys Incorporated Sevenmer cyclic peptide inhibitors of diseases involving αv β3
US5780426A (en) * 1995-06-07 1998-07-14 Ixsys, Incorporated Fivemer cyclic peptide inhibitors of diseases involving αv β3
US6827925B1 (en) * 1998-07-02 2004-12-07 Cambridge Antibody Technology Limited Specific binding proteins including antibodies which bind to the necrotic center of tumors, and uses thereof
US6365619B1 (en) * 1999-07-22 2002-04-02 Novartis Ag Treatment of arteriosclerosis

Cited By (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007089871A2 (fr) * 2006-02-01 2007-08-09 The Johns Hopkins University Conjugue d'acide nucleique de polypeptides destine a l'immunoprophylaxie ou a l'immunotherapie des troubles neoplasiques ou infectieux
US20070212337A1 (en) * 2006-02-01 2007-09-13 The Johns Hopkins University Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders
WO2007089871A3 (fr) * 2006-02-01 2008-10-30 Univ Johns Hopkins Conjugue d'acide nucleique de polypeptides destine a l'immunoprophylaxie ou a l'immunotherapie des troubles neoplasiques ou infectieux
US20080031887A1 (en) * 2006-06-30 2008-02-07 Joseph Lustgarten Conjugates for inducing targeted immune responses and methods of making and using same
GB2464887A (en) * 2007-07-31 2010-05-05 Univ Johns Hopkins Polypeptide-nucleic acid conjugate for immunoprophylaxis or immunotherapy for neoplastic or infectious disorders
US20090123467A1 (en) * 2007-07-31 2009-05-14 The Johns Hopkins University Polypeptide-Nucleic Acid Conjugate for Immunoprophylaxis or Immunotherapy for Neoplastic or Infectious Disorders
JP2010535248A (ja) * 2007-07-31 2010-11-18 ザ ジョンズ ホプキンス ユニバーシティー 腫瘍性障害または感染症の免疫学的予防または免疫療法のためのポリペプチド−核酸複合体
WO2009018500A1 (fr) * 2007-07-31 2009-02-05 The Johns Hopkins University Conjugué d'acide nucléique de polypeptide destiné à l'immunoprophylaxie ou à l'immunothérapie des troubles néoplasiques ou infectieux
WO2009082448A2 (fr) * 2007-12-18 2009-07-02 The Texas A & M University System Oligonucléotides modifiés pour le traitement d'une infection de type hépatite c
WO2009082448A3 (fr) * 2007-12-18 2010-03-18 The Texas A & M University System Oligonucléotides modifiés pour le traitement d'une infection de type hépatite c
US8685416B2 (en) 2010-03-02 2014-04-01 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Compositions and methods for the treatment of cancer
US10442860B2 (en) 2010-03-05 2019-10-15 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
WO2011109789A3 (fr) * 2010-03-05 2012-04-05 The Johns Hopkins University Compositions et procédés pour des anticorps et protéines de fusion immunomodulateurs ciblés
US8993524B2 (en) 2010-03-05 2015-03-31 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US9441044B2 (en) 2010-03-05 2016-09-13 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US11274156B2 (en) 2010-03-05 2022-03-15 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US9850306B2 (en) 2010-03-05 2017-12-26 The Johns Hopkins University Compositions and methods for targeted immunomodulatory antibodies and fusion proteins
US10660971B2 (en) 2012-07-18 2020-05-26 Birdie Biopharmaceuticals, Inc. Compounds for targeted immunotherapy
US9878052B2 (en) 2012-07-18 2018-01-30 Birdie Biopharmaceuticals Inc. Compounds for targeted immunotherapy
US10548988B2 (en) 2012-07-18 2020-02-04 Birdie Biopharmaceuticals, Inc. Compounds for targeted immunotherapy
US9540439B2 (en) 2012-10-08 2017-01-10 St. Jude Children's Research Hospital Therapies based on control of regulatory T cell stability and function via a neuropilin-1:semaphorin axis
US10548985B2 (en) 2014-01-10 2020-02-04 Birdie Biopharmaceuticals, Inc. Compounds and compositions for treating EGFR expressing tumors
US9827329B2 (en) 2014-01-10 2017-11-28 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US10744206B2 (en) 2014-01-10 2020-08-18 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US10780180B2 (en) 2014-01-10 2020-09-22 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US11786604B2 (en) 2014-01-10 2023-10-17 Birdie Biopharmaceuticals, Inc. Compounds and compositions for treating HER2 positive tumors
US11633494B2 (en) 2014-01-10 2023-04-25 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US11633495B2 (en) 2014-01-10 2023-04-25 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US10328158B2 (en) 2014-01-10 2019-06-25 Birdie Biopharmaceuticals, Inc. Compounds and compositions for immunotherapy
US11279761B2 (en) 2014-07-09 2022-03-22 Birdie Biopharmaceuticals, Inc. Anti-PD-L1 combinations for treating tumors
US11130812B2 (en) 2014-09-01 2021-09-28 Birdie Biopharmaceuticals, Inc. Anti PD-L1 conjugates for treating tumors
US10973826B2 (en) 2015-10-29 2021-04-13 Novartis Ag Antibody conjugates comprising toll-like receptor agonist
US11046781B2 (en) 2016-01-07 2021-06-29 Birdie Biopharmaceuticals, Inc. Anti-HER2 combinations for treating tumors
US11702476B2 (en) 2016-01-07 2023-07-18 Birdie Biopharmaceuticals, Inc. Anti-EGFR combinations for treating tumors
US11220552B2 (en) 2016-01-07 2022-01-11 Birdie Biopharmaceuticals, Inc. Anti-CD20 combinations for treating tumors
US11136397B2 (en) 2016-01-07 2021-10-05 Birdie Pharmaceuticals, Inc. Anti-EGFR combinations for treating tumors
US11203611B2 (en) 2017-04-14 2021-12-21 Tollnine, Inc. Immunomodulating polynucleotides, antibody conjugates thereof, and methods of their use
US11053240B2 (en) 2017-04-27 2021-07-06 Birdie Biopharmaceuticals, Inc. 2-amino-quinoline derivatives
US11834448B2 (en) 2017-04-27 2023-12-05 Birdie Biopharmaceuticals, Inc. 2-amino-quinoline derivatives
US11517567B2 (en) 2017-06-23 2022-12-06 Birdie Biopharmaceuticals, Inc. Pharmaceutical compositions
JP7230035B2 (ja) 2018-01-04 2023-02-28 アカデミア シニカ 治療を強化するための細胞会合免疫アジュバントならびに同アジュバントを含むキットおよび処方物
JP2021509674A (ja) * 2018-01-04 2021-04-01 アカデミア シニカＡｃａｄｅｍｉａ Ｓｉｎｉｃａ 治療を強化するための細胞会合免疫アジュバント
US11179473B2 (en) 2020-02-21 2021-11-23 Silverback Therapeutics, Inc. Nectin-4 antibody conjugates and uses thereof
US11541126B1 (en) 2020-07-01 2023-01-03 Silverback Therapeutics, Inc. Anti-ASGR1 antibody TLR8 agonist comprising conjugates and uses thereof
WO2022056043A1 (fr) * 2020-09-09 2022-03-17 University Of Southern California Immunoconjugués cpg de thérapie anti-cancéreuse

Also Published As

Publication number Publication date
US20120076804A1 (en) 2012-03-29
EP1809671B1 (fr) 2014-07-16
EP1809671A4 (fr) 2009-02-25
AU2005304771A1 (en) 2006-05-18
US9522958B2 (en) 2016-12-20
WO2006052900A2 (fr) 2006-05-18
WO2006052900A3 (fr) 2006-07-20
CA2586913A1 (fr) 2006-05-18
EP1809671A2 (fr) 2007-07-25

Similar Documents

Publication Publication Date Title
US9522958B2 (en) Cancer targeted innate immunity
Barth et al. Ki-4 (scFv)–ETA′, a new recombinant anti-CD30 immunotoxin with highly specific cytotoxic activity against disseminated Hodgkin tumors in SCID mice
US8545838B2 (en) Compositions and methods for cancer immunotherapy
Kaspar et al. The antibody-mediated targeted delivery of interleukin-15 and GM-CSF to the tumor neovasculature inhibits tumor growth and metastasis
Burris III et al. Trastuzumab emtansine (T-DM1): a novel agent for targeting HER2+ breast cancer
Vallera et al. A bispecific recombinant immunotoxin, DT2219, targeting human CD19 and CD22 receptors in a mouse xenograft model of B-cell leukemia/lymphoma
Sun et al. Therapeutic applications of an expanded genetic code
US20180100026A1 (en) Optimized chimeric receptor t cell switches and uses thereof
Vallera et al. Genetic alteration of a bispecific ligand-directed toxin targeting human CD19 and CD22 receptors resulting in improved efficacy against systemic B cell malignancy
Onda et al. In vitro and in vivo cytotoxic activities of recombinant immunotoxin 8H9 (Fv)-PE38 against breast cancer, osteosarcoma, and neuroblastoma
CN106414500B (zh) 抗-wt1/hla双特异性抗体
JP2017512752A (ja) 親水性抗体−薬物コンジュゲート
US20210283267A1 (en) Therapeutic methods using antibody drug conjugates (adcs)
KR20200135841A (ko) 고형 종양을 치료하기 위한 튜불린 교란제들을 포함하는 항체 약물 접합체들의 용도
Li et al. Generation of tumor-targeted antibody–CpG conjugates
Ma et al. DT390-triTMTP1, a novel fusion protein of diphtheria toxin with tandem repeat TMTP1 peptide, preferentially targets metastatic tumors
EP4288109A1 (fr) Composés et conjugués immunostimulateurs
US20230346969A1 (en) Intermediate for preparing antibody-drug conjugate (adc), preparation method therefor, and use thereof
WO2023190827A1 (fr) Anticorps de glycosaminoglycane anti-sulfaté dépendant du ph et conjugué anticorps-médicament
US20190008983A1 (en) Extracellular drug conjugates targeting cd20
TW201827084A (zh) 抗體—藥物結合物併用免疫介導治療劑
CN102372780A (zh) 抗人绒毛膜促性腺激素抗体-白介素2融合蛋白的制备及其应用
JP2024075771A (ja) 固形腫瘍を治療するためのチューブリン破壊剤を含む抗体薬物コンジュゲートの使用
KR20230019798A (ko) 항 cd154 항체 및 이의 용도

Legal Events

Date Code Title Description
AS Assignment

Owner name: UNIVERSITY OF SOUTHERN CALIFORNIA, CALIFORNIA

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:EPSTEIN, ALAN L.;KHAWLI, LESLIE A.;REEL/FRAME:017284/0602

Effective date: 20060201

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION