US20060015961A1 - Methods and compositions for producing germ cells from peripheral blood derived germline stem cells - Google Patents

Methods and compositions for producing germ cells from peripheral blood derived germline stem cells Download PDF

Info

Publication number
US20060015961A1
US20060015961A1 US11/131,152 US13115205A US2006015961A1 US 20060015961 A1 US20060015961 A1 US 20060015961A1 US 13115205 A US13115205 A US 13115205A US 2006015961 A1 US2006015961 A1 US 2006015961A1
Authority
US
United States
Prior art keywords
cells
cell
peripheral blood
germline stem
subject
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US11/131,152
Other languages
English (en)
Inventor
Jonathan Tilly
Joshua Johnson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Priority to US11/131,152 priority Critical patent/US20060015961A1/en
Assigned to GENERAL HOSPITAL CORPORATION, THE reassignment GENERAL HOSPITAL CORPORATION, THE ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: JOHNSON, JOSHUA, TILLY, JONATHAN L.
Publication of US20060015961A1 publication Critical patent/US20060015961A1/en
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: THE GENERAL HOSPITAL CORPORATION
Assigned to NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT reassignment NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF HEALTH AND HUMAN SERVICES (DHHS), U.S. GOVERNMENT CONFIRMATORY LICENSE (SEE DOCUMENT FOR DETAILS). Assignors: THE GENERAL HOSPITAL CORPORATION
Priority to US13/006,752 priority patent/US9267111B2/en
Assigned to THE GENERAL HOSPITAL CORPORATION reassignment THE GENERAL HOSPITAL CORPORATION ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: TILLY, JONATHAN L., JOHNSON, JOSHUA
Priority to US14/990,539 priority patent/US20160362657A1/en
Priority to US16/203,111 priority patent/US20190300852A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0608—Germ cells
    • C12N5/0611—Primordial germ cells, e.g. embryonic germ cells [EG]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61B—DIAGNOSIS; SURGERY; IDENTIFICATION
    • A61B17/00—Surgical instruments, devices or methods, e.g. tourniquets
    • A61B17/42—Gynaecological or obstetrical instruments or methods
    • A61B17/425—Gynaecological or obstetrical instruments or methods for reproduction or fertilisation
    • A61B17/43—Gynaecological or obstetrical instruments or methods for reproduction or fertilisation for artificial insemination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/12—Drugs for genital or sexual disorders; Contraceptives for climacteric disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/16—Masculine contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/18—Feminine contraceptives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0608—Germ cells
    • C12N5/0609—Oocytes, oogonia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00—Preparation of peptides or proteins
    • C12P21/06—Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K2035/124—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells the cells being hematopoietic, bone marrow derived or blood cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/11—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from blood or immune system cells

Definitions

  • Germ cell marker genes have now been identified in cells derived from bone marrow.
  • transplantation of bone marrow to a conditioned host allowed for bone marrow cell development into new oocytes within the ovary.
  • Umbilical cord blood from newborn infants is a known reservoir of stem cells that may contribute to a variety of somatic cell lineages, including hematopoietic precursors (for reviews see Korbling and Anderlini 2001 Blood 98: 2900-2908; Ho and Punzel, 2003 J Leukoc Biol 73: 547-555; Sanchez-Ramos 2002 J Neurosci Res 69: 880-893; Lee 2004 Blood 103:1669-75).
  • Cord blood samples are easily and safely collected and may be stored for future therapeutic use (Rogers and Casper 2004 sexuality, Reproduction & Menopause 2: 64-70); further, their availability to individual patients offers a potential source of perfectly-matched donor cells. It was heretofore unknown whether peripheral blood, such as cord blood also contained germ cell precursors.
  • Methods of the invention relate to the use of peripheral blood derived germline stem cells and their progenitor cells to, among other things, replenish or expand germ cell reserves of the testes and ovary, to enhance or restore fertility, and in females, to ameliorate symptoms and consequences of menopause.
  • the present invention provides compositions comprising peripheral blood derived female germline stem cells.
  • the present invention provides compositions comprising peripheral blood derived female germline stem cells, wherein the cells are mitotically competent and express Vasa, Dazl, and Stella. Consistent with their mitotically competent phenotype, peripheral blood derived female germline stem cells of the invention do not express growth/differentiation factor-9 (“GDF-9”), zona pellucida proteins (e.g., zona pellucida protein-3, “ZP3”), histone deacetylase-6 (“HDAC6”) and synaptonemal complex protein-3 (“SCP3”).
  • GDF-9 growth/differentiation factor-9
  • ZP3 zona pellucida proteins
  • HDAC6 histone deacetylase-6
  • SCP3 synaptonemal complex protein-3
  • peripheral blood derived female germline stem cells of the invention can produce oocytes after a duration of at least 1 week, more preferably 1 to about 2 weeks, about 2 to about 3 weeks, about 3 to about 4 weeks or more than about 5 weeks post transplantation.
  • the present invention provides compositions comprising progenitor cells derived from peripheral blood derived female germline stem cells.
  • the present invention provides compositions comprising peripheral blood derived female germline stem cell progenitors, wherein the cells express Vasa, Dazl and Stella, and wherein the cells do not express GDF-9, zona pellucida proteins, HDAC6 and SCP3.
  • peripheral blood derived female germline stem cell progenitors of the invention can produce oocytes after a duration of less than 1 week, preferably about 24 to about 48 hours post transplantation.
  • the present invention provides an isolated peripheral blood cell, wherein the cell is mitotically competent and expresses Vasa, Dazl and Stella.
  • the cell is a peripheral blood derived female germline stem cell, or its progenitor cell, having an XX karyotype.
  • the peripheral blood derived female germline stem cells, or their progenitor cells are non-embryonic, mammalian, and even more preferably, human.
  • the present invention provides purified populations of peripheral blood derived female germline stem cells and/or their progenitor cells.
  • the purified population of cells is about 50 to about 55%, about 55 to about 60%, about 65 to about 70%, about 70 to about 75%, about 75 to about 80%, about 80 to about 85%, about 85 to about 90%, about 90 to about 95% or about 95 to about 100% of the cells in the composition.
  • the present invention provides pharmaceutical compositions comprising peripheral blood derived female germline stem cells, and/or their progenitor cells, and a pharmaceutically acceptable carrier.
  • the pharmaceutical compositions can comprise purified populations of peripheral blood derived female germline stem cells and/or their progenitor cells.
  • compositions comprising peripheral blood derived germline stem cells of the invention can be provided by direct administration to ovarian tissue, or indirect administration, for example, to the circulatory system of a subject (e.g., to the extra-ovarian circulation).
  • the invention provides methods for manipulating peripheral blood derived germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro as described herein below.
  • the invention provides a method for expanding peripheral blood derived female germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising contacting peripheral blood derived female germline stem cells, or their progenitor cells, with an agent that increases the amount of peripheral blood derived female germline stem cells, or their progenitor cells, by promoting proliferation or survival thereof, thereby expanding the peripheral blood derived female germline stem cells, or their progenitor cells.
  • agents may promote mobilization of peripheral blood derived stem cells or of progenitor cells derived from peripheral blood derived stem cells from within the peripheral blood into the peripheral blood (e.g., GCSF, GMCSF).
  • the agent includes, but is not limited to, a hormone or growth factor (e.g., insulin-like growth factor (“IGF”), transforming growth factor (“TGF”), bone morphogenic protein (“BMP”), Wnt protein, or fibroblast growth factor (“FGF”)), a cell-signaling molecule (e.g., sphingosine-1-phosphate (“S1P”), or retinoic acid (“RA”)), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of glycogen synthase kinase-3 (“GSK-3”), an inhibitor of apoptosis such as a Bax inhibitor or a caspase inhibitor, an inhibitor of nitric oxide production, or an inhibitor of HDAC activity).
  • a hormone or growth factor e.g., insulin-like growth factor (“IGF”), transforming growth factor (“TGF”), bone morphogenic protein (“BMP”), Wnt protein, or fibroblast growth factor (“FGF”)
  • the invention provides a method for identifying an agent that promotes proliferation or survival of a peripheral blood derived female germline stem cell, or its progenitor cell, comprising contacting the peripheral blood derived female germline stem cells, or their progenitor cells, with a test agent; and detecting an increase in the number of peripheral blood derived female germline stem cells, or their progenitor cells, thereby identifying an agent that promotes proliferation or survival of a peripheral blood derived female germline stem cell, or its progenitor cell.
  • the invention provides a method for using the female germline stem cells, or their progenitor cells, to characterize pharmacogenetic cellular responses to biologic or pharmacologic agents, comprising isolating peripheral blood derived female germline stem cells, or their progenitor cells, from a population of subjects, expanding said cells in culture to establish a plurality of cell cultures, optionally differentiating said cells into a desired lineage, contacting the cell cultures with one or more biologic or pharmacologic agents, identifying one or more cellular responses to the one or more biologic or pharmacologic agents, and comparing the cellular responses of the cell cultures from different subjects.
  • the invention provides a method for oocyte production, comprising culturing a peripheral blood derived female germline stem cell, or its progenitor cell, in the presence of an agent that differentiates a peripheral blood derived female germline stem cell, or its progenitor cell, into an oocyte, thereby producing an oocyte.
  • the agent includes, but is not limited to, a hormone or growth factor (e.g., a TGF, BMP or Wnt family protein, kit-ligand (“SCF”) or leukemia inhibitory factor (“LIF”)), a signaling molecule (e.g., meiosis-activating sterol, “FF-MAS”), or a pharmacologic or pharmaceutical agent (e.g., a modulator of Id protein function or Snail/Slug transcription factor function).
  • a hormone or growth factor e.g., a TGF, BMP or Wnt family protein, kit-ligand (“SCF”) or leukemia inhibitory factor (“LIF”)
  • SCF kit-ligand
  • LIF leukemia inhibitory factor
  • FF-MAS meiosis-activating sterol
  • a pharmacologic or pharmaceutical agent e.g., a modulator of Id protein function or Snail/Slug transcription factor function
  • the invention provides a method for in vitro fertilization of a female subject, said method comprising the steps of:
  • a) producing an oocyte by culturing a peripheral blood derived female germline stem cell, or its progenitor, in the presence of an oocyte differentiation agent;
  • the invention provides a method for in vitro fertilization of a female subject, said method comprising the steps of:
  • a) producing an oocyte by contacting a peripheral blood derived female germline stem cell, or its progenitor cell, with an agent that differentiates said cell(s) into an oocyte;
  • the invention provides a method for identifying an agent that induces differentiation of a peripheral blood derived female germline stem cell, or its progenitor cell, into an oocyte comprising contacting peripheral blood derived female germline stem cells, or their progenitor cells, with a test agent; and detecting an increase in the number of oocytes, thereby identifying an agent that induces differentiation of a peripheral blood derived female germline stem cell, or its progenitor.
  • the present invention provides a method for oocyte production, comprising providing a peripheral blood derived female germline stem cell, or its progenitor cell, to a tissue, preferably the ovary, wherein the cell engrafts into the tissue and differentiates into an oocyte, thereby producing an oocyte.
  • the present invention provides a method for inducing folliculogenesis, comprising providing a peripheral blood derived female germline stem cell, or its progenitor cell, to a tissue, preferably the ovary, wherein the cell engrafts into the tissue and differentiates into an oocyte within a follicle, thereby inducing folliculogenesis.
  • the present invention provides a method for treating infertility in a female subject in need thereof comprising administering a therapeutically effective amount of a composition comprising peripheral blood derived female germline stem cells, or their progenitor cells, to the subject, wherein the cells engraft into a tissue, preferably ovarian tissue, and differentiate into oocytes, thereby treating infertility.
  • a composition comprising peripheral blood derived female germline stem cells, or their progenitor cells, to the subject, wherein the cells engraft into a tissue, preferably ovarian tissue, and differentiate into oocytes, thereby treating infertility.
  • the female subject in need of fertility treatment is not a subject who has undergone prior chemotherapy or radiotherapy.
  • the present invention provides a method for restoring fertility to a female subject having undergone chemotherapy or radiotherapy (or both treatments) and who desires restored fertility, comprising administering a therapeutically effective amount of peripheral blood derived female germline stem cells, or their progenitor cells, to the subject, wherein the cells engraft into a tissue, preferably ovarian tissue, and differentiate into oocytes, thereby restoring fertility in the subject.
  • the peripheral blood derived female germline stem cells comprise a purified sub-population of cells obtained from the peripheral blood.
  • Chemotherapeutic drugs include, but are not limited to, busulfan, cyclophosphamide, 5-FU, vinblastine, actinomycin D, etoposide, cisplatin, methotrexate, doxorubicin, among others.
  • Radiotherapy includes, but is not limited to, ionizing radiation, ultraviolet radiation, X-rays, and the like.
  • the present invention provides a method for protecting fertility in a female subject undergoing or expected to undergo chemotherapy or radiotherapy (or both treatments), comprising providing an agent that protects against reproductive injury prior to or concurrently with chemotherapy or radiotherapy (or both treatments) and providing a peripheral blood derived female germline stem cell, or its progenitor cell, to the subject, wherein the cell engrafts into a tissue, preferably ovarian tissue, and differentiates into an oocyte, thereby protecting fertility in the subject.
  • the protective agent can be S1P, a Bax antagonist, or any agent that increases SDF-1 activity.
  • the present invention provides a method for repairing damaged ovarian tissue, comprising providing a therapeutically effective amount of a composition comprising peripheral blood derived female germline stem cells, or their progenitor cells, to the tissue, wherein the cells engraft into the tissue and differentiate into oocytes, thereby repairing the damaged tissue.
  • Damage can be caused, for example, by exposure to cytotoxic factors, hormone deprivation, growth factor deprivation, cytokine deprivation, cell receptor antibodies, and the like. Except where expressly stated herein, the damage is not caused by prior chemotherapy or radiotherapy. Damage can also be caused be diseases that affect ovarian function, including, but not limited to cancer, polycystic ovary disease, genetic disorders, immune disorders, metabolic disorders, and the like.
  • the present invention provides a method for restoring ovarian function in a female subject having undergone chemotherapy or radiotherapy (or both treatments) and who desires restored ovarian function, comprising administering a therapeutically effective amount of peripheral blood derived female germline stem cells, or their progenitor cells, to an ovary of the subject, wherein the cells engraft into the ovary and differentiate into oocytes within the ovary, thereby restoring ovarian function in the subject.
  • the present invention provides a method for restoring ovarian function in a menopausal female subject, comprising administering a therapeutically effective amount of a composition comprising peripheral blood derived female germline stem cells, or their progenitor cells, to the subject, wherein the cells engraft into the ovary and differentiate into oocytes, thereby restoring ovarian function.
  • the menopausal female subject can be in a stage of either peri- or post-menopause, with said menopause caused by either normal (e.g., aging) or pathological (e.g., surgery, disease, ovarian damage) processes.
  • Restoration of ovarian function can relieve adverse symptoms and complications associated with menopausal disorders, including, but not limited to, somatic disorders such as osteoporosis, cardiovascular disease, somatic sexual dysfunction, hot flashes, vaginal drying, sleep disorders, depression, irritability, loss of libido, hormone imbalances, and the like, as well as cognitive disorders, such as loss of memory; emotional disorders, depression, and the like.
  • somatic disorders such as osteoporosis, cardiovascular disease, somatic sexual dysfunction, hot flashes, vaginal drying, sleep disorders, depression, irritability, loss of libido, hormone imbalances, and the like
  • cognitive disorders such as loss of memory; emotional disorders, depression, and the like.
  • the present invention provides a method for detecting or diagnosing premature ovarian failure in a subject, comprising determining the number of female germline stem cells, or their progenitors, present in a sample of peripheral blood obtained from the subject, wherein the number of female germline stem cells, or their progenitors, in the sample is substantially less than the number of female germline stem cells, or their progenitors, in a sample obtained from a healthy subject, thereby detecting or diagnosing premature ovarian failure in the subject.
  • the present invention provides compositions comprising peripheral blood derived male germline stem cells, wherein the peripheral blood derived male germline stem cells are mitotically competent and express Vasa and Dazl.
  • peripheral blood derived male germline stem cells of the invention have an XY karyotype
  • peripheral blood derived female germline stem cells of the invention have an XX karyotype.
  • the peripheral blood derived male germline stem cells are non-embryonic, mammalian, and even more preferably, human.
  • the invention provides an isolated peripheral blood cell that is mitotically competent, has an XY kayrotype and expresses Vasa and Dazl.
  • the present invention provides a method for restoring or enhancing spermatogenesis, comprising providing a peripheral blood derived male germline stem cell, or its progenitor cell, to the testes of a male subject, wherein the cell engrafts into the seminiferous epithelium and differentiates into a sperm cell, thereby restoring or enhancing spermatogenesis.
  • the present invention provides a method for restoring fertility to a male subject having undergone chemotherapy or radiotherapy (or both) and who desires restored fertility, comprising administering a therapeutically effective amount of peripheral blood derived male germline stem cells, or their progenitor cells, to the subject, wherein the cells engraft into the seminiferous epithelium and differentiate into sperm cells, thereby restoring fertility.
  • the invention provides a method for reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising contacting peripheral blood derived germline stem cells, or their progenitor cells, with an agent that reduces cell proliferation, thereby reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells.
  • the agent includes, but is not limited to, a hormone or growth factor (e.g., TGF- ⁇ ), a peptide antagonist of mitogenic hormones or growth factors (e.g., the BMP antagonists, Protein Related to DAN and Cerberus (“PRDC”) and Gremlin), or a pharmacological or pharmaceutical compound (e.g., a cell cycle inhibitor, or an inhibitor of growth factor signaling).
  • a hormone or growth factor e.g., TGF- ⁇
  • a peptide antagonist of mitogenic hormones or growth factors e.g., the BMP antagonists, Protein Related to DAN and Cerberus (“PRDC”) and Gremlin
  • PRDC Protein Related to DAN and Cerberus
  • Gremlin a pharmacological or pharmaceutical compound
  • the invention provides a method for reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising contacting peripheral blood derived germline stem cells, or their progenitor cells, with an agent that inhibits cell survival or promotes cell death, thereby reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells.
  • the agent the that inhibits cell survival includes, but is not limited to, a hormone, growth factor or cytokine (e.g., a pro-apoptotic tumor necrosis factor (“TNF”) super family member such as TNF- ⁇ , Fas-ligand (“FasL”) and TRAIL), an antagonist of pro-survival Bcl-2 family member function, a signaling molecule (e.g., a ceramide), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of growth factor signaling).
  • a hormone, growth factor or cytokine e.g., a pro-apoptotic tumor necrosis factor (“TNF”) super family member such as TNF- ⁇ , Fas-ligand (“FasL”) and TRAIL
  • TNF tumor necrosis factor
  • Fas-ligand Fas-ligand
  • TRAIL a pro-survival Bcl-2 family member
  • a signaling molecule e.g., a ceramide
  • the agent the that promotes cell death includes, but is not limited to, a pro-apoptotic tumor necrosis factor superfamily member (e.g., TNF- ⁇ , FasL and TRAIL), agonist of pro-apoptotic Bcl-2 family member function and ceramide.
  • a pro-apoptotic tumor necrosis factor superfamily member e.g., TNF- ⁇ , FasL and TRAIL
  • agonist of pro-apoptotic Bcl-2 family member function e.g., apoptotic Bcl-2 family member function
  • ceramide e.g., a pro-apoptotic tumor necrosis factor superfamily member
  • the invention provides a method for identifying an agent that reduces proliferation or survival, or promotes cell death, of a peripheral blood derived germline stem cell, or its progenitor cell, comprising contacting peripheral blood derived germline stem cells, or their progenitor cells, with a test agent; and detecting a decrease in the number of peripheral blood derived germline stem cells, or their progenitor cells, thereby identifying an agent that reduces proliferation or survival, or promotes cell death, of a female germline stem cell, or its progenitor cell.
  • the present invention provides a method for contraception in a male or female subject comprising contacting peripheral blood derived germline stem cells, or their progenitor cells, of the subject with an agent that decreases the proliferation, function or survival of peripheral blood derived germline stem cells, or their progenitor cells, or the ability of said cells to produce new oocytes or sperm cells or other somatic cell types required for fertility, thereby providing contraception to the subject.
  • the present invention provides kits for use in employing various agents of the invention.
  • the present invention provides a kit for expanding a peripheral blood derived female germline stem cell, or its progenitor cell, in vivo, ex vivo or in vitro, comprising an agent that promotes cell proliferation or survival of the peripheral blood derived female germline stem cell, or its progenitor cell, and instructions for using the agent to promote cell proliferation or survival of the peripheral blood derived female germline stem cell, or its progenitor, thereby expanding a female germline stem cell, or its progenitor cell in accordance with the methods of the invention.
  • the present invention provides a kit for oocyte production, comprising an agent that differentiates a peripheral blood derived female germline stem cell, or its progenitor cell, into an oocyte and instructions for using the agent to differentiate a peripheral blood derived female germline stem cell, or its progenitor cell, into an oocyte in accordance with the methods of the invention.
  • the present invention provides a kit for oocyte production, comprising an agent that increases the amount of peripheral blood derived female germline stem cells, or their progenitor cells, by promoting proliferation or survival thereof, and instructions for using the agent to increase the amount of peripheral blood derived female germline stem cells or their progenitor cells, thereby producing oocytes in accordance with the methods of the invention.
  • the present invention provides a kit for oocyte production comprising an agent that differentiates peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes and instructions for using the agent to differentiate the peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes, thereby producing oocytes in accordance with the methods of the invention.
  • the present invention provides a kit for treating infertility in a female subject in need thereof comprising an agent that increases the amount of peripheral blood derived female germline stem cells, or their progenitor cells, by promoting proliferation or survival thereof and instructions for using the agent to increase the amount of peripheral blood derived female germline stem cells or their progenitor cells, thereby treating infertility in the subject in accordance with the methods of the invention.
  • the present invention provides a kit for treating infertility in a female subject in need thereof comprising an agent that differentiates peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes, and instructions for using the agent to differentiate peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes, thereby treating infertility in the subject in accordance with the methods of the invention.
  • the present invention provides a kit for protecting fertility in a female subject undergoing or expected to undergo chemotherapy or radiotherapy (or both treatments), comprising an agent that that protects peripheral blood derived female germline stem cells, or their progenitor cells, against reproductive injury and instructions for using the agent to protect peripheral blood derived female germline stem cells, or their progenitor cells, against reproductive injury thereby protecting fertility in the female subject in accordance with the methods of the invention.
  • the present invention provides a kit for restoring ovarian function in a post-menopausal female subject comprising an agent that increases the amount of peripheral blood derived female germline stem cells, or their progenitor cells, by promoting proliferation or survival thereof and instructions for using the agent to increase the amount of peripheral blood derived female germline stem cells or their progenitor cells, thereby restoring ovarian function in the subject in accordance with the methods of the invention.
  • the present invention provides a kit for restoring ovarian function in a post-menopausal female subject comprising an agent that differentiates peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes, and instructions for using the agent to differentiate peripheral blood derived female germline stem cells, or their progenitor cells, into oocytes, thereby restoring ovarian function in the subject in accordance with the methods of the invention.
  • the present invention provides a kit for reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising an agent that inhibits cell survival or promotes cell death and instructions for using the agent to inhibit cell survival or promote cell death of the peripheral blood derived germline stem cells, or their progenitor cells, thereby the reducing the amount of peripheral blood derived germline stem cells, or their progenitor cells, in accordance with the methods of the invention.
  • the present invention provides a kit for contraception in a male of female subject comprising an agent that decreases the proliferation, function or survival of peripheral blood derived germline stem cells, or their progenitor cells, or the ability of said cells to produce new oocytes or other somatic cell types required for fertility and instructions for using the agent to decrease the proliferation, function or survival of peripheral blood derived germline stem cells, or their progenitor cells, or the ability of said cells to produce new oocytes or sperm cells or other somatic cell types required for fertility, thereby providing contraception to the subject in accordance with the methods of the invention.
  • FIG. 1 depicts results indicating that peripheral blood contains oocyte-producing germ cells.
  • FIG. 1 b shows an early primary oocyte in a wild-type ovary prior to PBCT, showing a lack of GFP signal (compare with a).
  • FIG. 1 b shows an early primary oocyte in a wild-type ovary prior to PBCT, showing a lack of G
  • FIGS. 1 c - e show examples of primordial and early primary follicles containing GFP-positive oocytes (compare with a) in ovaries of wild-type mice 24 hours after PBCT using peripheral blood harvested from adult GFP-transgenic females.
  • FIG. 1 f shows GFP-negative oocytes in the same ovaries as those shown in FIGS. 1 c - e.
  • FIG. 2 depicts further results indicating that peripheral blood contains oocyte-producing germ cells.
  • Primordial follicles containing GFP-positive oocytes in ovaries of wild-type female mice 28-30 hr after PBCT, using adult TgOG2 transgenic females as peripheral blood cell donors see also FIG.
  • FIG. 3 shows results indicating that male peripheral blood does not generate oocytes in transplanted female mice.
  • Immunohistochemical detection of GFP expression (brown, highlighted by arrowheads) in germ cells in the testes of adult TgOG2 male mice, confirming faithful and abundant expression of the transgene in males (A-C).
  • Serially sectioned ovaries from three recipients were screened in their entirety, and no GFP-positive oocytes were observed in over 750 sections analyzed.
  • ovaries from adult TgOG2 females were also run in parallel as a positive control for GFP detection in oocytes (data not shown, see FIG. 2 ).
  • FIG. 5 depicts analysis of germline markers in peripheral blood of mice and humans.
  • RT-PCR analysis of peripheral blood (PB) mononuclear cells isolated from adult female mice reveals expression of the germline markers, Dazl and Stella (L7, ‘house-keeping’ gene; Mock, mock reverse-transcribed RNA samples) (A).
  • Data shown are representative of results obtained from analysis of 6 wild-type female mice between 7-10 weeks of age.
  • PB peripheral blood mononuclear cells
  • GAPDH amplified as an internal loading control.
  • Mock mock reverse-transcribed RNA samples.
  • FIG. 6 depicts expression of Dazl in human umbilical cord blood, as detected by RT-PCR analysis.
  • FIG. 7 depicts real-time PCR analysis of Mvh levels in bone marrow or peripheral blood of adult female mice during the indicated stages of the estrous cycle.
  • the data shown represent the combined results from an analysis of 3-4 mice per group, with mean levels at estrus set as the reference point for comparisons to other stages of the cycle following normalization against beta-actin for sample loading.
  • Mvh expression in bone marrow was detected during linear amplification in only 1 of the 3 samples analyzed.
  • Peripheral blood derived germline stem cells are any multipotent cells obtained from peripheral blood that include a population of male or female germline stem cells.
  • “Expansion” refers to the propagation of a cell or cells without terminal differentiation. “Isolation phenotype” refers to the structural and functional characteristics of the peripheral blood derived germline stem cells upon isolation. “Expansion phenotype” refers to the structural and functional characteristics of the peripheral blood derived germline stem cells during expansion. The expansion phenotype can be identical to the isolation phenotype, or alternatively, the expansion phenotype can be more differentiated than the isolation phenotype.
  • “Differentiation” refers to the developmental process of lineage commitment.
  • a “lineage” refers to a pathway of cellular development, in which precursor or “progenitor” cells undergo progressive physiological changes to become a specified cell type having a characteristic function (e.g., nerve cell, muscle cell or endothelial cell). Differentiation occurs in stages, whereby cells gradually become more specified until they reach full maturity, which is also referred to as “terminal differentiation.”
  • a “terminally differentiated cell” is a cell that has committed to a specific lineage, and has reached the end stage of differentiation (i.e., a cell that has fully matured). Oocytes are an example of a terminally differentiated cell type.
  • isolated refers to a peripheral blood derived germline stem cell or its progenitor cell, in a non-naturally occurring state (e.g., isolated from the body or a biological sample, such as peripheral blood, from the body).
  • Progenitor cells as used herein are germ lineage cells that are 1) derived from germline stem cells of the invention as the progeny thereof which contain a set of common marker genes; 2) are in an early stage of differentiation; and 3) retain mitotic capacity.
  • Progeny as used herein are all cells derived from peripheral blood derived germline stem cells of the invention, including progenitor cells, differentiated cells, and terminally differentiated cells.
  • “Derived from” as used herein refers to the process of obtaining a daughter cell.
  • Endgraft refers to the process of cellular contact and incorporation into an existing tissue of interest (e.g., ovary) in vivo.
  • Agents refer to cellular (e.g., biologic) and pharmaceutical factors, preferably growth factors, cytokines, hormones 6 r small molecules, or to genetically-encoded products that modulate cell function (e.g., induce lineage commitment, increase expansion, inhibit or promote cell growth and survival).
  • expansion agents are agents that increase proliferation and/or survival of peripheral blood derived germline stem cells.
  • Dermatination agents are agents that induce peripheral blood derived germline stem cells to differentiate into committed cell lineages, such as oocytes or sperm cells.
  • a “follicle” refers to an ovarian structure consisting of a single oocyte surrounded by somatic (granulosa without or with theca-interstitial) cells. Somatic cells of the gonad enclose individual oocytes to form follicles. Each fully formed follicle is enveloped in a complete basement membrane. Although some of these newly formed follicles start to grow almost immediately, most of them remain in the resting stage until they either degenerate or some signal(s) activate(s) them to enter the growth phase.
  • ovarian structure, function and physiology see Gougeon, A., (1996) Endocr Rev. 17:121-55; Anderson, L. D., and Hirshfield, A. N. (1992) Md Med J. 41: 614-20; and Hirshfield, A. N. (1991) Int Rev Cytol. 124: 43-101.
  • a “sperm cell” refers to a male germ cell, in either a pre-meiotic (i.e., mitotically competent) or post-meiotic state of development, including a fully mature spermatozoan. “Spermatogenesis” is the developmental process by which a sperm cell is formed.
  • Mitotically competent refers to a cell that is capable of mitosis, the process by which a cell divides and produces two daughter cells from a single parent cell.
  • non-embryonic cell refers to a cell that is obtained from a post-natal source (e.g., infant, child or adult tissue).
  • a “subject” is a vertebrate, preferably a mammal, more preferably a primate and still more preferably a human. Mammals include, but are not limited to, primates, humans, farm animals, sport animals, and pets.
  • obtaining as in “obtaining the agent” is intended to include purchasing, synthesizing or otherwise acquiring the agent (or indicated substance or material).
  • Methods of the invention relate to the use of peripheral blood derived germline stem cells, or progenitors of peripheral blood derived germline stem cells, to restore or increase germ cell production.
  • Methods of the invention can be used to, among other things, enhance or restore fertility, and in females, to ameliorate symptoms and consequences of menopause.
  • peripheral blood derived germline stem cells can be involved with the ability of peripheral blood derived germline stem cells to repopulate the germ cell population.
  • Female germline stem cells have been detected in the peripheral blood, which may therefore serve as a reservoir for stem cells having the capacity to repopulate and/or expand the germ cell supply of reproductive organs.
  • Male germline stem cells can also exist in the peripheral blood of male subjects.
  • Other sub-populations of cells in the peripheral blood such as hematopoietic stem cells, may likewise have the ability to repopulate and/or expand the germ cell supply of reproductive organs, for example, through de-differentiation into a multipotent progenitor cell (see U.S. Pat. No.
  • Peripheral blood derived female germline stem cells express markers including Vasa, Dazl, and Stella.
  • Peripheral blood derived female germline stem cells are mitotically competent (i.e., capable of mitosis) and accordingly, do not express GDF-9, zona pellucida proteins (e.g., ZP3), HDAC6 or SCP3.
  • the present invention also provides peripheral blood derived female germline stem cell progenitors.
  • Peripheral blood derived female germline stem cell progenitors of the invention can circulate throughout the body and most preferably can be localized in bone marrow, peripheral blood and ovary.
  • Progenitor cells of the invention express Vasa, Dazl, and Stella but do not express GDF-9, zona pellucida proteins (e.g., ZP3), HDAC6 or SCP3.
  • Peripheral blood derived female germline stem cells and their progenitor cells have functional distinctions.
  • peripheral blood derived female germline stem cells of the invention can produce oocytes after a duration of at least 1 week, more preferably 1 to about 2 weeks, about 2 to about 3 weeks, about 3 to about 4 weeks or more than about 5 weeks post transplantation.
  • Peripheral blood derived female germline stem cell progenitors have the capacity to generate oocytes more rapidly than peripheral blood derived female germline stem cells.
  • peripheral blood derived female germline stem cell progenitors of the invention can produce oocytes after a duration of less than 1 week, preferably about 24 to about 48 hours post transplantation.
  • Stella is a gene expressed in peripheral blood derived female germline stem cells and their progenitor cells. Stella is a novel gene specifically expressed in primordial germ cells and their descendants, including oocytes (Bortvin et al. (2004) BMC Developmental Biology 4(2):1-5). Stella encodes a protein with a SAP-like domain and a splicing factor motif-like structure. Embryos deficient in Stella expression are compromised in preimplantation development and rarely reach the blastocyst stage. Thus, Stella is a maternal factor implicated in early embryogenesis.
  • Dazl is a gene expressed in peripheral blood derived female germline stem cells and their progenitor cells.
  • the autosomal gene Dazl is a member of a family of genes that contain a consensus RNA binding domain and are expressed in germ cells. Loss of expression of an intact Dazl protein in mice is associated with failure of germ cells to complete meiotic prophase. Specifically, in female mice null for Dazl, loss of germ cells occurs during fetal life at a time coincident with progression of germ cells through meiotic prophase. In male mice null for Dazl, germ cells were unable to progress beyond the leptotene stage of meiotic prophase I. Thus, in the absence of Dazl, progression through meiotic prophase is interrupted (Saunders et al. (2003), Reproduction, 126:589-597).
  • Vasa is a gene expressed in peripheral blood derived female germline stem cells and their progenitor cells.
  • Vasa is a component of the germplasm that encodes a DEAD-family ATP-dependent RNA helicase (Liang et al. (1994) Development, 120:1201-1211; Lasko et al. (1988) Nature, 335:611-167).
  • the molecular function of Vasa is directed to binding target mRNAs involved in germ cell establishment (e.g., Oskar and Nanos), oogenesis, (e.g., Gruken), and translation onset (Gavis et al. (1996) Development, 110: 521-528).
  • Vasa is required for pole cell formation and is exclusively restricted to the germ cell lineage throughout the development.
  • Vasa is a molecular marker for the germ cell lineage in most animal species (Toshiaki et al. (2001) Cell Structure and Function 26:131-136). Because Vasa has been associated with inhibition of cell migration, expression of Vasa in progenitor cells of the invention may be differentially regulated, depending on the migratory state of the progenitor. For example, while in the bone marrow, the progenitor may express Vasa, and while migrating to the reproductive tract, the progenitor may down regulate expression.
  • GDF-9 a gene expressed in cells that have already started to differentiate into oocytes.
  • Growth/differentiation factor-9 (GDF-9) is a member of the transforming growth factor- ⁇ superfamily, expressed specifically in ovaries. GDF-9 mRNA can be found in neonatal and adult oocytes from the primary one-layer follicle stage until after ovulation (Dong, J. et al (1996) Nature 383: 531-5). Analysis of GDF-9 deficient mice reveals that only primordial and primary one-layer follicles can be formed, but a block beyond the primary one-layer follicle stage in follicular development occurs, resulting in complete infertility.
  • ZP3, ZP1, ZP2, and ZP3, which are gene products that comprise the zona pellucida of the oocyte. Their expression is regulated by a basic helix-loop-helix (bHLH) transcription factor, FIG. ⁇ .
  • bHLH basic helix-loop-helix
  • Mice null in FIG. ⁇ do not express the Zp genes and do not form primordial follicles (Soyal, S. M., et al (2000) Development 127: 4645-4654).
  • Individual knockouts of the ZP genes result in abnormal or absent zonae pellucidae and decreased fertility (Zp1; Rankin T, et al (1999) Development.
  • ZP protein products are glycosylated, and subsequently secreted to form an extracellular matrix, which is important for in vivo fertilization and pre-implantation development. Expression of the ZP proteins is precisely regulated and restricted to a two-week growth phase of oogenesis. Zp mRNA transcripts are not expressed in resting oocytes, however once the oocytes begin to grow, all three Zp transcripts begin to accumulate.
  • HDAC6 Peripheral blood derived female germline stem cells and their progenitor cells do not express HDAC6.
  • HDACs, or histone deacetylases are involved in ovarian follicle development. HDAC6 in particular can be detected in resting germinal vesicle-stage (primordial) oocytes (Verdel, A., et al. (2003) Zygote 11: 323-8; FIG. 16 ).
  • HDAC6 is a class II histone deacetylase and has been implicated as a microtubule-associated deactylase (Hubbert, C. et al, (2002) Nature 417: 455-8).
  • HDACs are the target of inhibitors including, but not limited to, trichostatin A and trapoxin, both of which are microbial metabolites that induce cell differentiation, cell cycle arrest, and reversal of the transformed cell morphology.
  • the synaptonemal complex protein SCP3 is part of the lateral element of the synaptonemal complex, a meiosis-specific protein structure essential for synapsis of homologous chromosomes.
  • the synaptonemal complex promotes pairing and segregation of homologous chromosomes, influences the number and relative distribution of crossovers, and converts crossovers into chiasmata.
  • SCP3 is meiosis-specific and can form multi-stranded, cross-striated fibers, forming an ordered, fibrous core in the lateral element (Yuan, L. et al, (1998) J. Cell. Biol. 142: 331-339).
  • the absence of SCP3 in mice can lead to female germ cell aneuploidy and embryo death, possibly due to a defect in structural integrity of meiotic chromosomes (Yuan, L. et al, (2002) Science 296: 1115-8).
  • Peripheral blood derived female germline stem cells and their progenitor cells can be isolated by standard means known in the art for the separation of stem cells from the blood(e.g., cell sorting).
  • the isolation protocol includes generation of a kit + /lin ⁇ fraction that is depleted of hematopoietic cells.
  • Additional selection means based on the unique profile of gene expression e.g., Vasa, Dazl and Stella
  • Compositions comprising peripheral blood derived female germline stem cells and their progenitor cells can be isolated and subsequently purified to an extent where they become substantially free of the biological sample from which they were obtained (e.g. peripheral blood, including umbilical cord blood).
  • Peripheral blood derived female germline stem cell progenitors can be obtained from peripheral blood female germline stem cells by, for example, expansion in culture.
  • the progenitor cells can be cells having an “expansion phenotype.”
  • compositions comprising peripheral blood derived germline stem cells or their progenitors can be provided directly to the reproductive organ of interest (e.g., ovary or testes).
  • compositions comprising peripheral blood derived germline stem cells or their progenitors can be provided indirectly to the reproductive organ of interest, for example, by administration into the circulatory system (e.g., to extra-ovarian circulation).
  • the cells can engraft and differentiate into germ cells (e.g., oocytes or sperm cells).
  • Engraft refers to the process of cellular contact and incorporation into an existing tissue of interest (e.g., ovary) in vivo. Expansion and differentiation agents can be provided prior to, during or after administration to increase production of germ cells in vivo.
  • compositions of the invention include pharmaceutical compositions comprising peripheral blood derived germline stem cells or their progenitors and a pharmaceutically acceptable carrier.
  • Administration can be autologous or heterologous.
  • peripheral blood derived germline stem cells, or progenitors derived from peripheral blood derived germline stem cells can be obtained from one subject, and administered to the same subject or a different, compatible subject.
  • Peripheral blood derived germline stem cells of the invention or their progeny can be administered via localized injection, including catheter administration, systemic injection, localized injection, intravenous injection, intrauterine injection or parenteral administration.
  • a therapeutic composition of the present invention e.g., a pharmaceutical composition
  • it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion).
  • compositions of the invention can be conveniently provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH.
  • Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues.
  • Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.
  • carriers can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.
  • Sterile injectable solutions can be prepared by incorporating the cells utilized in practicing the present invention in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired.
  • Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like.
  • the compositions can also be lyophilized.
  • the compositions can contain auxiliary substances such as wetting, dispersing, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.
  • Standard texts such as “REMINGTON'S PHARMACEUTICAL SCIENCE”, 17th edition, 1985, incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.
  • compositions which enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added.
  • antimicrobial preservatives for example, parabens, chlorobutanol, phenol, sorbic acid, and the like.
  • Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the peripheral blood derived germline stem cells or their progenitors.
  • compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid.
  • the desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes.
  • Sodium chloride is preferred particularly for buffers containing sodium ions.
  • Viscosity of the compositions can be maintained at the selected level using a pharmaceutically acceptable thickening agent.
  • Methylcellulose is preferred because it is readily and economically available and is easy to work with.
  • suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer, and the like. The preferred concentration of the thickener will depend upon the agent selected. The important point is to use an amount that will achieve the selected viscosity.
  • liquid dosage form e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form.
  • a method to potentially increase cell survival when introducing the cells into a subject in need thereof is to incorporate peripheral blood derived germline stem cells or their progeny (e.g., in vivo, ex vivo or in vitro derived) of interest into a biopolymer or synthetic polymer.
  • the site of injection might prove inhospitable for cell seeding and growth because of scarring or other impediments.
  • biopolymer include, but are not limited to, cells mixed with fibronectin, fibrin, fibrinogen, thrombin, collagen, and proteoglycans. This could be constructed with or without included expansion or differentiation factors. Additionally, these could be in suspension, but residence time at sites subjected to flow would be nominal.
  • Another alternative is a three-dimensional gel with cells entrapped within the interstices of the cell biopolymer admixture. Again, expansion or differentiation factors could be included with the cells. These could be deployed by injection via various routes described herein.
  • compositions should be selected to be chemically inert and will not affect the viability or efficacy of the peripheral blood derived germline stem cells or their progenitors as described in the present invention. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.
  • peripheral blood derived germline stem cells of the invention One consideration concerning the therapeutic use of peripheral blood derived germline stem cells of the invention is the quantity of cells necessary to achieve an optimal effect. In current human studies of autologous mononuclear peripheral blood cells, empirical doses ranging from 1 to 4 ⁇ 10 7 cells have been used with encouraging results. However, different scenarios may require optimization of the amount of cells injected into a tissue of interest. Thus, the quantity of cells to be administered will vary for the subject being treated. In a preferred embodiment, between 10 4 to 10 8 , more preferably 10 5 to 10 7 , and still more preferably, 3 ⁇ 10 7 stem cells of the invention can be administered to a human subject.
  • cells can be administered directly to the ovary or testes.
  • 10 2 to 10 6 Preferably, between 10 2 to 10 6 , more preferably 10 3 to 10 5 , and still more preferably, 10 4 peripheral blood derived germline stem cells can be administered to a human subject.
  • the precise determination of what would be considered an effective dose may be based on factors individual to each patient, including their size, age, sex, weight, and condition of the particular patient. As few as 100-1000 cells can be administered for certain desired applications among selected patients. Therefore, dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art.
  • Peripheral blood derived germline stem cells of the invention can comprise a purified population of female germline stem cells.
  • Those skilled in the art can readily determine the percentage of female germline stem cells in a population using various well-known methods, such as fluorescence activated cell sorting (FACS).
  • FACS fluorescence activated cell sorting
  • Preferable ranges of purity in populations comprising female germline stem cells are about 50 to about 55%, about 55 to about 60%, and about 65 to about 70%. More preferably the purity is about 70 to about 75%, about 75 to about 80%, about 80 to about 85%; and still more preferably the purity is about 85 to about 90%, about 90 to about 95%, and about 95 to about 100%.
  • Purity of female germline stem cells can be determined according to the genetic marker profile within a population. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage).
  • any additives in addition to the active stem cell(s) and/or agent(s) are present in an amount of 0.001 to 50% (weight) solution in phosphate buffered saline, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001 to about 5 wt %, preferably about 0.0001 to about 1 wt %, still more preferably about 0.0001 to about 0.05 wt % or about 0.001 to about 20 wt %, preferably about 0.01 to about 10 wt %, and still more preferably about 0.05 to about 5 wt %.
  • any composition to be administered to an animal or human it is preferred to determine therefore: toxicity, such as by determining the lethal dose (LD) and LD 50 in a suitable animal model e.g., rodent such as mouse; and, the dosage of the composition(s), concentration of components therein and timing of administering the composition(s), which elicit a suitable response.
  • toxicity such as by determining the lethal dose (LD) and LD 50 in a suitable animal model e.g., rodent such as mouse
  • LD 50 lethal dose
  • LD 50 low-d dose
  • suitable animal model e.g., rodent such as mouse
  • the dosage of the composition(s), concentration of components therein and timing of administering the composition(s) which elicit a suitable response.
  • the present invention provides a method for oocyte production, comprising providing a peripheral blood derived female germline stem cell, or its progenitor, to a female subject, and more preferably to the ovary of said subject, wherein the cell engrafts into the a tissue of the subject (e.g., ovary) and differentiates into an oocyte.
  • the engrafted cells undergo folliculogenesis, wherein the cells differentiate into an oocyte within a follicle.
  • Folliculogenesis is a process in which an ovarian structure consisting of a single oocyte is surrounded by somatic (granulosa without or with theca-interstitial) cells. Somatic cells of the gonad enclose individual oocytes to form follicles. Each fully formed follicle is enveloped in a complete basement membrane. Although some of these newly formed follicles start to grow almost immediately, most of them remain in the resting stage until they either degenerate or some signal(s) activate(s) them to enter the growth phase.
  • a method of the invention can induce ovarian folliculogenesis by providing a peripheral blood derived female germline stem cell, or its progenitor, to the ovary by any one of several routes of administration.
  • the peripheral blood derived female germline stem cell, or its progenitor can engraft into the ovary and differentiate into an oocyte within a follicle of the ovary.
  • peripheral blood derived female germline stem cells or their progenitor cells can be increased by increasing the survival or proliferation of existing peripheral blood derived female germline stem cells, or their progenitor cells.
  • Agents which increase proliferation or survival of peripheral blood derived female germline stem cells, or progenitors derived from peripheral blood derived female germline stem cells, include, but are not limited to, a hormone or growth factor (e.g., a IGF, TGF, BMP, Wnt protein or FGF), a cell-signaling molecule (e.g., SIP or RA), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of GSK-3, an inhibitor of apoptosis such as a Bax inhibitor or caspase inhibitor, an inhibitor of nitric oxide production, or an inhibitor of HDAC activity).
  • a hormone or growth factor e.g., a IGF, TGF, BMP, Wnt protein or FGF
  • a cell-signaling molecule e.g., SIP or RA
  • a pharmacological or pharmaceutical compound e.g., an inhibitor of GSK-3, an inhibitor of apoptosis such as a Bax inhibitor or
  • Agents comprising growth factors are known in the art to increase proliferation or survival of stem cells.
  • U.S. Pat. Nos. 5,750,376 and 5,851,832 describe methods for the in vitro culture and proliferation of neural stem cells using TGF.
  • An active role in the expansion and proliferation of stem cells has also been described for BMPs (Zhu, G. et al, (1999) Dev. Biol. 215: 118-29 and Kawase, E. et al, (2001) Development 131: 1365) and Wnt proteins (Pazianos, G. et al, (2003) Biotechniques 35: 1240 and Constantinescu, S. (2003) J. Cell Mol. Med. 7: 103).
  • U.S. Pat. Nos. 5,453,357 and 5,851,832 describe proliferative stem cell culture systems that utilize FGFs. The contents of each of these references are specifically incorporated herein by reference for their description of expansion agents known in the art.
  • Agents comprising growth factors are also known in the art to increase mobilization of stem cells from the bone marrow or ovary into the peripheral blood.
  • Mobilizing agents include but are not limited to GCSF or GMCSF.
  • An agent that increases mobilization of stem cells into the blood can be provided before peripheral blood harvest or alternatively, to augment or supplement other methods of the invention where it would be desirable to increase circulating levels of female germline stem cells (e.g., to increase targeting of the cells to the ovary).
  • Agents comprising cell-signaling molecules are also known in the art to increase proliferation or survival of stem cells.
  • Sphingosine-1-phosphate is known to induce proliferation of neural progenitor cells (Harada, J. et al, (2004) J. Neurochem. 88: 1026).
  • U.S. patent application No. 20030113913 describes the use of retinoic acid in stem cell self renewal in culture. The contents of each of these references are specifically incorporated herein by reference for their description of expansion agents known in the art.
  • Agents comprising pharmacological or pharmaceutical compounds are also known in the art to increase production or survival of stem cells.
  • inhibitors of glycogen synthase kinase maintain pluripotency of embryonic stem cells through activation of Wnt signaling (Sato, N. et al, (2004) Nat. Med. 10: 55).
  • Inhibitors of apoptosis Wang, Y. et al, (2004) Mol. Cell. Endocrinol. 218: 165
  • inhibitors of nitric oxide/nitric oxide synthase (Matarredona, E. R. et al, (2004) Brain Res. 995: 274) and inhibitors of histone deacetylases (Lee, J. H.
  • the peptide humanin is an inhibitor of Bax function that suppresses apoptosis (Guo, B. et al, (2003) Nature 423: 456).
  • the contents of each of these references are specifically incorporated herein by reference for their description of expansion agents known in the art.
  • Oocyte production can be further increased by contacting compositions comprising peripheral blood derived female germline stem cells, or progenitors derived from peripheral blood derived female germline stem cells, with an agent that differentiates peripheral blood derived female germline stem cells or their progenitors into oocytes (e.g., differentiation agents).
  • differentiation agents include, but are not limited to, a hormone or growth factor (e.g., TGF, BMP, Wnt protein, SCF or LIF), a signaling molecule (e.g., meiosis-activating sterol, “FF-MAS”), or a pharmacologic or pharmaceutical agent (e.g., a modulator of Id protein function or Snail/Slug transcription factor function).
  • TGF- ⁇ can induce differentiation of hematopoietic stem cells
  • TGF- ⁇ can induce differentiation of hematopoietic stem cells
  • U.S. patent application No. 2002142457 describes methods for differentiation of cardiomyocytes using BMPs. Pera et al describe human embryonic stem cell differentiation using BMP-2 (Pera, M. F. et al, (2004) J. Cell Sci. 117: 1269).
  • U.S. patent application No. 20040014210 and U.S. Pat. No. 6,485,972 describe methods of using Wnt proteins to induce differentiation.
  • Agents comprising signaling molecules are also known to induce differentiation of oocytes.
  • FF-Mas is known to promote oocyte maturation (Marin Bivens, C. L. et al, (2004) BOR papers in press). The contents of each of these references are specifically incorporated herein by reference for their description of differentiation agents known in the art.
  • Agents comprising pharmacological or pharmaceutical compounds are also known in the art to induce differentiation of stem cells.
  • modulators of Id are involved in hematopoietic differentiation (Nogueria, M. M. et al, (2000) 276: 803) and Modulators of Snail/Slug are known to induce stem cell differentiation (Le Douarin, N. M. et al, (1994) Curr. Opin. Genet. Dev. 4: 685-695; Plescia, C. et al,. (2001) Differentiation 68: 254).
  • the contents of each of these references are specifically incorporated herein by reference for their description of differentiation agents known in the art.
  • the present invention also provides methods for reducing peripheral blood derived female germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising contacting peripheral blood derived female germline stem cells or their progenitor cells with an agent that reduces cell proliferation, inhibits cell survival or promotes cell death.
  • Unwanted proliferation of the cells of the invention can give rise to cancerous and pre-cancerous phenotypes (e.g., germ cell tumors, ovarian cancer, testicular cancer).
  • Such methods can be used to control unwanted proliferation (e.g., cancer) or for contraceptive measures by reducing the numbers of germline stem cells, and optionally their progenitors or oocytes.
  • Agents that reduce cell proliferation include, but are not limited to, a hormone or growth factor (e.g., TGF- ⁇ ), a peptide antagonist of mitogenic hormones or growth factors (e.g., the BMP antagonists, PRDC and Gremlin), or a pharmacological or pharmaceutical compound (e.g., a cell cycle inhibitor, or an inhibitor of growth factor signaling).
  • a hormone or growth factor e.g., TGF- ⁇
  • a peptide antagonist of mitogenic hormones or growth factors e.g., the BMP antagonists, PRDC and Gremlin
  • a pharmacological or pharmaceutical compound e.g., a cell cycle inhibitor, or an inhibitor of growth factor signaling.
  • Agents that inhibit cell survival include, but are not limited to, a hormone, growth factor or cytokine (e.g., a pro-apoptotic TNF super family member such as TNF- ⁇ , FasL and TRAIL), an antagonist of pro-survival Bcl-2 family member function, a signaling molecule (e.g., a ceramide), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of growth factor signaling).
  • a hormone, growth factor or cytokine e.g., a pro-apoptotic TNF super family member such as TNF- ⁇ , FasL and TRAIL
  • an antagonist of pro-survival Bcl-2 family member function e.g., a signaling molecule (e.g., a ceramide), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of growth factor signaling).
  • Pro-survival Bcl-2 family members include Bcl-2, Bcl-x1
  • Agents that promote cell death include, but are not limited to, a pro-apoptotic tumor necrosis factor superfamily member (e.g., TNF- ⁇ , FasL and TRAIL), agonist of pro-apoptotic Bcl-2 family member function and ceramide.
  • Pro-apoptotic Bcl-2 family members include Bax (Oltvai, Z N, et al. (1993): Cell 74: 609-619), Bak (Chittenden, T, et al. (1995) Nature 374:733-736), Bid (Luo, X., et al. (1998) Cell 94:481-490), Hrk (Inohara, N. et al.
  • Bcl-2 family members such as Bcl-2, Bcl-XL, Bcl-W, Mcl-1, A1, Bax, Bak, Bid, Hrk, Bod, Bim, Noxa, Puma, Bok and Bcl-xs, are known to inhibit stem cell survival (Lindsten, T. et al, (2003) J. Neurosci. 23: 11112-9).
  • Agents comprising pharmacological or pharmaceutical compounds are also known in the art to inhibit cell survival.
  • inhibitors of growth factor signaling such as QSulf1, a heparan sulfate 6-O-endosulfatase that inhibits fibroblast growth factor signaling, can inhibit stem cell survival (Wang, S. et al, (2004) Proc. Natl. Acad. Sci. USA 101: 4833).
  • QSulf1 a heparan sulfate 6-O-endosulfatase that inhibits fibroblast growth factor signaling
  • stem cell survival Wang, S. et al, (2004) Proc. Natl. Acad. Sci. USA 101: 4833.
  • the contents of each of these references are specifically incorporated herein by reference for their description of agents known in the art to inhibit cell survival.
  • Agents can be provided directly to the reproductive organ of interest.
  • agents can be provided indirectly to the reproductive organ of interest, for example, by administration into the circulatory system.
  • Agents can be administered to subjects in need thereof by a variety of administration routes.
  • Methods of administration may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of the active compounds without causing clinically unacceptable adverse effects.
  • modes of administration include oral, rectal, topical, intraocular, buccal, intravaginal, intracisternal, intracerebroventricular, intratracheal, nasal, transdermal, within/on implants, e.g., fibers such as collagen, osmotic pumps, or grafts comprising appropriately transformed cells, etc., or parenteral routes.
  • parenteral includes subcutaneous, intravenous, intramuscular, intraperitoneal, intragonadal or infusion.
  • Intravenous or intramuscular routes are not particularly suitable for long-term therapy and prophylaxis.
  • a particular method of administration involves coating, embedding or derivatizing fibers, such as collagen fibers, protein polymers, etc. with therapeutic proteins.
  • Other useful approaches are described in Otto, D. et al., J. Neurosci. Res. 22: 83 and in Otto, D. and Unsicker, K. J. Neurosci. 10: 1912.
  • In vitro and ex vivo applications can involve culture of the peripheral blood derived female germline stem cells or their progenitors with the selected agent to achieve the desired result. Cultures of cells (from the same individual and from different individuals) can be treated with differentiation agents of interest to stimulate the production of oocytes, which can then be used for a variety of therapeutic applications (e.g., in vitro fertilization, implantation).
  • Differentiated cells derived from cultures of the invention can be implanted into a host.
  • the transplantation can be autologous, such that the donor of the stem cells from which organ or organ units are derived is the recipient of the engineered tissue.
  • the transplantation can be heterologous, such that the donor of the stem cells from which organ or organ units are derived is not that of the recipient of the engineered-tissue.
  • Peripheral blood derived germline stem cells and the progeny thereof can be cultured, treated with agents and/or administered in the presence of polymer scaffolds.
  • Polymer scaffolds are designed to optimize gas, nutrient, and waste exchange by diffusion.
  • Polymer scaffolds can comprise, for example, a porous, non-woven array of fibers.
  • the polymer scaffold can be shaped to maximize surface area, to allow adequate diffusion of nutrients and growth factors to the cells. Taking these parameters into consideration, one of skill in the art could configure a polymer scaffold having sufficient surface area for the cells to be nourished by diffusion until new blood vessels interdigitate the implanted engineered-tissue using methods known in the art.
  • Polymer scaffolds can comprise a fibrillar structure.
  • the fibers can be round, scalloped, flattened, star-shaped, solitary or entwined with other fibers. Branching fibers can be used, increasing surface area proportionately to volume.
  • the term “polymer” includes polymers and monomers that can be polymerized or adhered to form an integral unit.
  • the polymer can be non-biodegradable or biodegradable, typically via hydrolysis or enzymatic cleavage.
  • biodegradable refers to materials that are bioresorbable and/or degrade and/or break down by mechanical degradation upon interaction with a physiological environment into components that are metabolizable or excretable, over a period of time from minutes to three years, preferably less than one year, while maintaining the requisite structural integrity.
  • the term “degrade” refers to cleavage of the polymer chain, such that the molecular weight stays approximately constant at the oligomer level and particles of polymer remain following degradation.
  • Materials suitable for polymer scaffold fabrication include polylactic acid (PLA), poly-L-lactic acid (PLLA), poly-D-lactic acid (PDLA), polyglycolide, polyglycolic acid (PGA), polylactide-co-glycolide (PLGA), polydioxanone, polygluconate, polylactic acid-polyethylene oxide copolymers, modified cellulose, collagen, polyhydroxybutyrate, polyhydroxpriopionic acid, polyphosphoester, poly(alpha-hydroxy acid), polycaprolactone, polycarbonates, polyamides, polyanhydrides, polyamino acids, polyorthoesters, polyacetals, polycyanoacrylates, degradable urethanes, aliphatic polyester polyacrylates, polymethacrylate, acyl substituted cellulose acetates, non-degradable polyurethanes, polystyrenes, polyvinyl chloride, polyvinyl flouride, polyvinyl imidazole, chlorosulphonated polyolif
  • Factors including but not limited to nutrients, growth factors, inducers of differentiation or de-differentiation, products of secretion, immunomodulators, inhibitors of inflammation, regression factors, hormones, or other biologically active compounds can be incorporated into or can be provided in conjunction with the polymer scaffold.
  • Agents of the invention may be supplied along with additional reagents in a kit.
  • kits can include instructions for the treatment regime or assay, reagents, equipment (test tubes, reaction vessels, needles, syringes, etc.) and standards for calibrating or conducting the treatment or assay.
  • the instructions provided in a kit according to the invention may be directed to suitable operational parameters in the form of a label or a separate insert.
  • the kit may further comprise a standard or control information so that the test sample can be compared with the control information standard to determine if whether a consistent result is achieved.
  • the present invention provides a method for restoring or enhancing spermatogenesis, comprising providing a peripheral blood derived male germline stem cell, or its progenitor, to the testes of a male subject, wherein the cell engrafts into the seminiferous epithelium and differentiates into a sperm cell.
  • Administration of a peripheral blood derived male germline stem cell, or its progenitor, to the testes is preferably carried out by testicular injection. Direct injection into the testes advantageously circumvents the blood barrier, and provides cells to suitable locations, such as the seminiferous epithelium.
  • Spermatogenesis can be further increased by contacting compositions comprising peripheral blood derived male germline stem cells, or progenitors derived from peripheral blood derived male germline stem cells, with an agent that increases the differentiation of peripheral blood derived male germline stem cells or their progenitors into oocytes (e.g., differentiation agents).
  • an agent that increases the differentiation of peripheral blood derived male germline stem cells or their progenitors into oocytes e.g., differentiation agents.
  • differentiation agents can be, but are not limited to, those described herein.
  • spermatogenesis or the formation of spernatocytes from spermatogonia, can be regulated by numerous factors. Regulators of apoptosis, including Bax, BCl XL family members, and caspase family members, can modulate spermatogenesis and affect male fertility (Said, T. M., et al. (2004) Hum. Reprod. Update 10: 39-51; Yan, W. et al, (2003) Mol. Endocrinol. 17: 1868). Caspases have been implicated in the pathogenesis of multiple andrological pathologies, such as, inter alia, impaired spermatogenesis, decreased sperm motility, and increased levels of sperm DNA fragmentation.
  • Caspase inhibitors such as survivin and FLIP
  • Caspase inhibitors can be used to regulate apoptotic events during spermatogenesis (Weikert S., (2004) Int. J. Androl. 27: 161; Giampietri, C. et al, (2003) Cell Death Differ. 10: 175).
  • Bax inhibitors such as humanin, are also implicated in spermatogenic apoptosis (Guo, B. et al., (2003) Nature 423: 456).
  • FGF-4 can play a critical role as a survival factor for germ cells by protecting them from apoptosis.
  • Sertoli cells lactate production was induced, which is indispensable for germ cell survival.
  • FGF-4 stimulation can also reduce DNA fragmentation in Sertoli cells.
  • Bone morphogenetic protein (BMP) signaling pathways have also been implicated in maintenance of germ line stem cells in Drosophila (Kawase, E. et al, (2004) Development 131: 1365-75; Pellegrini, M. et al, (2003) J. Cell Sci. 116: 3363).
  • BMP4 stimulation of cultured spermatogonia can induce Smad-mediated proliferation, as well as differentiation through the c-kit gene.
  • BMP signals from somatic cells were shown to be essential for maintaining germline stem cells through repression of the barn expression, indicating that Bmp signals from the somatic cells maintain germline stem cells at least in part, by repressing barn expression in the testis.
  • TGF Transforming growth factor
  • TGF- ⁇ signaling represses the expression of barn, which is necessary and sufficient for germ cell differentiation, thereby maintaining germ line stem cells and spermatogonia in their proliferative state.
  • Sphingosine-1-phosphate is also known to affect the survival and proliferation of germ line stem cells and spermatogonia.
  • SIP Sphingosine-1-phosphate
  • Glial-derived neurotrophic factor was found to markedly amplify germline stem cells in murine testis (Kubota, H. et al, (2004) Biol. Reprod. Apr 28 Epub ahead of print). Transplantation analysis demonstrated not only germline stem cells enrichment, but also differentiation from stem cells into sperm (Yomogida, K. et al, (2003) Biol. Reprod. 69: 1303).
  • the present invention also provides methods for reducing peripheral blood derived male germline stem cells, or their progenitor cells, in vivo, ex vivo or in vitro, comprising contacting peripheral blood derived male germline stem cells or their progenitor cells with an agent that reduces cell proliferation, inhibits cell survival or promotes cell death.
  • Unwanted proliferation of the cells of the invention can give rise to cancerous and pre-cancerous phenotypes (e.g., germ cell tumors).
  • Such methods can be used to control unwanted proliferation (e.g., cancer) or for contraceptive measures by reducing the numbers of germline stem cells, and optionally their progenitors or sperm cells.
  • Agents that reduce cell proliferation include, but are not limited to, a hormone or growth factor (e.g., TGF- ⁇ ), a peptide antagonist of mitogenic hormones or growth factors (e.g., the BMP antagonists, PRDC and Gremlin), or a pharmacological or pharmaceutical compound (e.g., a cell cycle inhibitor, or an inhibitor of growth factor signaling).
  • a hormone or growth factor e.g., TGF- ⁇
  • a peptide antagonist of mitogenic hormones or growth factors e.g., the BMP antagonists, PRDC and Gremlin
  • a pharmacological or pharmaceutical compound e.g., a cell cycle inhibitor, or an inhibitor of growth factor signaling.
  • Agents that inhibit cell survival include, but are not limited to, a hormone, growth factor or cytokine (e.g., a pro-apoptotic TNF super family member such as TNF- ⁇ , FasL and TRAIL), an antagonist of pro-survival Bcl-2 family member function, a signaling molecule (e.g., a ceramide), or a pharmacological or pharmaceutical compound (e.g., an inhibitor of growth factor signaling).
  • a hormone, growth factor or cytokine e.g., a pro-apoptotic TNF super family member such as TNF- ⁇ , FasL and TRAIL
  • a signaling molecule e.g., a ceramide
  • a pharmacological or pharmaceutical compound e.g., an inhibitor of growth factor signaling
  • Agents that promote cell death include, but are not limited to, a pro-apoptotic tumor necrosis factor superfamily member (e.g., TNF- ⁇ , FasL and TRAIL), agonist of pro-apoptotic Bcl-2 family member function and ceramide.
  • a pro-apoptotic tumor necrosis factor superfamily member e.g., TNF- ⁇ , FasL and TRAIL
  • agonist of pro-apoptotic Bcl-2 family member function e.g., apoptotic Bcl-2 family member function
  • ceramide e.g., a pro-apoptotic tumor necrosis factor superfamily member
  • the invention provides methods for identifying modulators, i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, small molecules or other drugs) which modulate peripheral blood derived germline stem cells or the progenitors thereof.
  • modulators i.e., candidate or test compounds or agents (e.g., proteins, peptides, peptidomimetics, peptoids, small molecules or other drugs) which modulate peripheral blood derived germline stem cells or the progenitors thereof.
  • Agents thus identified can be used to modulate, for example, proliferation, survival and differentiation of a peripheral blood derived germline stem cell or its progenitor e.g., in a therapeutic protocol.
  • test agents of the present invention can be obtained singly or using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; peptoid libraries (libraries of molecules having the functionalities of peptides, but with a novel, non-peptide backbone which are resistant to enzymatic degradation but which nevertheless remain bioactive; see, e.g., Zuckermann, R. N. (1994) et al., J. Med. Chem. 37:2678-85); spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ‘one-bead one-compound’ library method; and synthetic library methods using affinity chromatography selection.
  • the biological library and peptoid library approaches are limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12:145).
  • Chemical compounds to be used as test agents can be obtained from commercial sources or can be synthesized from readily available starting materials using standard synthetic techniques and methodologies known to those of ordinary skill in the art.
  • Synthetic chemistry transformations and protecting group methodologies useful in synthesizing the compounds identified by the methods described herein are known in the art and include, for example, those such as described in R. Larock (1989) Comprehensive Organic Transformations, VCH Publishers; T. W. Greene and P. G. M. Wuts, Protective Groups in Organic Synthesis, 2nd ed., John Wiley and Sons (1991); L. Fieser and M.
  • the compounds are organic small molecules, that is, compounds having molecular weight less than 1,000 amu, alternatively between 350-750 amu.
  • the compounds are: (i) those that are non-peptidic; (ii) those having between 1 and 5, inclusive, heterocyclyl, or heteroaryl ring groups, which may bear further substituents; (iii) those in their respective pharmaceutically acceptable salt forms; or (iv) those that are peptidic.
  • heterocyclyl refers to a nonaromatic 3-8 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tri cyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2 or 3 atoms of each ring can be substituted by a substituent.
  • heteroaryl refers to an aromatic 5-8 membered monocyclic, 8-12 membered bicyclic, or 11-14 membered tricyclic ring system having 1-3 heteroatoms if monocyclic, 1-6 heteroatoms if bicyclic, or 1-9 heteroatoms if tricyclic, said heteroatoms selected from O, N, or S (e.g., carbon atoms and 1-3, 1-6, or 1-9 heteroatoms of N, O, or S if monocyclic, bicyclic, or tricyclic, respectively), wherein 0, 1, 2, 3, or 4 atoms of each ring can be substituted by a substituent.
  • substituted refers to a group “substituted” on an alkyl, cycloalkyl, aryl, heterocyclyl, or heteroaryl group at any atom of that group.
  • Suitable substituents include, without limitation, alkyl, alkenyl, alkynyl, alkoxy, halo, hydroxy, cyano, nitro, amino, SO 3 H, perfluoroalkyl, perfluoroalkoxy, methylenedioxy, ethylenedioxy, carboxyl, oxo, thioxo, imino (alkyl, aryl, aralkyl), S(O) n alkyl (where n is 0-2), S(O) n aryl (where n is 0-2), S(O) n heteroaryl (where n is 0-2), S(O) n heterocyclyl (where n is 0-2), amine (mono-, di-, alkyl,
  • stable refers to compounds which possess stability sufficient to allow manufacture and which maintains the integrity of the compound for a sufficient period of time to be useful for the purposes detailed herein (e.g., transport, storage, assaying, therapeutic administration to a subject).
  • the compounds described herein can contain one or more asymmetric centers and thus occur as racemates and racemic mixtures, single enantiomers, individual diastereomers and diastereomeric mixtures. All such isomeric forms of these compounds are expressly included in the present invention.
  • the compounds described herein can also be represented in multiple tautomeric forms, all of which are included herein.
  • the compounds can also occur in cis-or trans-or E-or Z-double bond isomeric forms. All such isomeric forms of such compounds are expressly included in the present invention.
  • Test agents of the invention can also be peptides (e.g., growth factors, cytokines, receptor ligants).
  • peptides e.g., growth factors, cytokines, receptor ligants.
  • Screening methods of the invention can involve the identification of an agent that increases the proliferation or survival of peripheral blood derived germline stem cells or the progenitors thereof. Such methods will typically involve contacting a population of the germline stem or progenitor cells with a test agent in culture and quantitating the number of new stem or progenitor cells produced as a result. Comparison to an untreated control can be concurrently assessed. Where an increase in the number of stem or progenitor cells is detected relative to the control, the test agent is determined to have the desired activity.
  • a purified population of peripheral blood derived germline stem cells or the progenitors thereof have about 50-55%, 55-60%, 60-65% and 65-70% purity. More preferably the purity is about 70-75%, 75-80%, 80-85%; and still more preferably the purity is about 85-90%, 90-95%, and 95-100%.
  • Increased amounts of peripheral blood derived germline stem cells or the progenitors thereof can also be detected by an increase in gene expression of genetic markers including an Dazl, Stella and Vasa.
  • the level of expression can be measured in a number of ways, including, but not limited to: measuring the MRNA encoded by the genetic markers; measuring the amount of protein encoded by the genetic markers; or measuring the activity of the protein encoded by the genetic markers.
  • the level of mRNA corresponding to a genetic marker can be determined both by in situ and by in vitro formats.
  • the isolated mRNA can be used in hybridization or amplification assays that include, but are not limited to, Southern or Northern analyses, polymerase chain reaction analyses and probe arrays.
  • One diagnostic method for the detection of mRNA levels involves contacting the isolated mRNA with a nucleic acid molecule (probe) that can hybridize to the mRNA encoded by the gene being detected.
  • the nucleic acid probe is sufficient to specifically hybridize under stringent conditions to mRNA or genomic DNA.
  • the probe can be disposed on an address of an array, e.g., an array described below. Other suitable probes for use in the diagnostic assays are described herein.
  • mRNA (or cDNA) is immobilized on a surface and contacted with the probes, for example by running the isolated mRNA on an agarose gel and transferring the mRNA from the gel to a membrane, such as nitrocellulose.
  • the probes are immobilized on a surface and the mRNA (or cDNA) is contacted with the probes, for example, in a two-dimensional gene chip array described below.
  • a skilled artisan can adapt known mRNA detection methods for use in detecting the level of mRNA encoded by the genetic markers described herein.
  • the level of mRNA in a sample can be evaluated with nucleic acid amplification, e.g., by rtPCR (Mullis (1987) U.S. Pat. No. 4,683,202), ligase chain reaction (Barany (1991) Proc. Natl. Acad. Sci. USA 88:189-193), self sustained sequence replication (Guatelli et al. (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh et al. (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al.
  • amplification primers are defined as being a pair of nucleic acid molecules that can anneal to 5′ or 3′ regions of a gene (plus and minus strands, respectively, or vice-versa) and contain a short region in between.
  • amplification primers are from about 10 to 30 nucleotides in length and flank a region from about 50 to 200 nucleotides in length. Under appropriate conditions and with appropriate reagents, such primers permit the amplification of a nucleic acid molecule comprising the nucleotide sequence flanked by the primers.
  • a cell or tissue sample can be prepared/processed and immobilized on a support, typically a glass slide, and then contacted with a probe that can hybridize to mRNA that encodes the genetic marker being analyzed.
  • Screening methods of the invention can involve the identification of an agent that increases the differentiation of peripheral blood derived germline stem cells or the progenitors thereof into oocytes. Such methods will typically involve contacting the germline stem or progenitor cells with a test agent in culture and quantitating the number of new oocytes produced as a result. Comparison to an untreated control can be concurrently assessed. Where an increase in the number of oocytes is detected relative to the control, the test agent is determined to have the desired activity.
  • test agent can also be assayed using a biological sample (e.g., ovarian tissue); subsequent testing using a population of stem or progenitor cells may be conducted to distinguish the functional activity of the agent (e.g., differentiation rather then increase in proliferation or survival) where the result is ambiguous.
  • a biological sample e.g., ovarian tissue
  • subsequent testing using a population of stem or progenitor cells may be conducted to distinguish the functional activity of the agent (e.g., differentiation rather then increase in proliferation or survival) where the result is ambiguous.
  • Increased amounts of oocytes be detected by a decrease in gene expression of stem or progenitor genetic markers including an Dazl, Stella and Vasa or an increase in oocyte markers, such as HDAC6, GDF9 and ZP3.
  • Screening methods of the invention can involve the identification of an agent that decreases the proliferation or survival of peripheral blood derived germline stem cells or the progenitors thereof. Such methods will typically involve contacting a population of the stem or progenitor cells, or a biological sample (e.g., ovarian tissue) with a test agent in culture and quantitating the number of stem or progenitor cells lost as a result. Comparison to an untreated control can be concurrently assessed. Where a decrease in the number of stem or progenitor cells is detected relative to the control, the test agent is determined to have the desired activity.
  • a biological sample e.g., ovarian tissue
  • Peripheral blood derived germline stem cells of the invention or their progenitors can be used in a variety of therapeutic applications (e.g., oocyte generation for in vivo restoration or ex vivo procedures including in vitro fertilization and somatic cell nuclear transfer). Accordingly, methods of the invention relate to, among other things, the use of peripheral blood derived germline stem cells, or their progenitor cells, to provide germ cells in the treatment of reproductive disorders.
  • the present invention provides methods for treating infertility comprising providing a peripheral blood derived female germline stem cell, or its progenitor, to a female subject in need thereof, wherein the cell engrafts into a tissue and differentiates into an oocyte, which can later be provided for fertilization (e.g., following ovulation or in vitro fertilization in the subject).
  • the tissue is ovarian tissue, however, other tissues in the body may host the engrafted cell that in turn generates an oocyte. Oocytes harbored in extra-ovarian tissues can be harvested and used for procedures including in vitro fertilization.
  • the present invention also provides methods for treating infertility comprising administering an agent that increases the production or survival of peripheral blood derived female germline stem cells or their progenitors. Such agents may also promote cell proliferation or survival, thereby enhancing oocyte production.
  • Agents can be provided directly to the reproductive organ of interest.
  • agents can be provided indirectly to the reproductive organ of interest, for example, by administration into the circulatory system.
  • the present invention also provides methods for repairing damaged ovarian tissue, comprising providing a peripheral blood derived female germline stem cell, or its progenitor, to the ovarian tissue, wherein the cell engrafts into the ovarian tissue and differentiates into an oocyte. Except where expressly stated herein, the ovarian tissue was not damaged by chemotherapy or radiotherapy.
  • Damage can be caused, for example, by exposure to cytotoxic factors, hormone deprivation, growth factor deprivation, cytokine deprivation, cell receptor antibodies, and the like. Where damage may be caused by an anticipated course of chemotherapy and/or radiotherapy, administration of an agent that protects against reproductive injury prior to or concurrently with chemotherapy and/or radiotherapy can protect fertility and enhance the restoration methods described herein.
  • the protective agent can include but is not limited to S1P, Bax, or any agent that increases SDF-1 activity (i.e., SDF-1 mediated migration and homing of stem cells).
  • SDF-1 activity i.e., SDF-1 mediated migration and homing of stem cells.
  • the present invention also provides methods for restoring ovarian function in a menopausal female subject, comprising providing a peripheral blood derived female germline stem cell, or its progenitor, to the subject, wherein the cell engrafts into the ovary and differentiates into an oocyte.
  • the menopausal female subject can be in a stage of either peri- or post-menopause, with said menopause caused by either normal (e.g., aging) or pathological (e.g., surgery, disease, ovarian damage) processes.
  • Ovarian function in a post-menopausal female can also be restored by administering an an agent that increases the amount of peripheral blood derived female germline stem cells or their progenitors and/or their differentiation into oocytes (e.g., by increasing the number or life span of peripheral blood derived female germline stem cells, as well as by increasing the differentiation of peripheral blood derived female germline stem cells into oocytes).
  • an agent that increases the amount of peripheral blood derived female germline stem cells or their progenitors and/or their differentiation into oocytes e.g., by increasing the number or life span of peripheral blood derived female germline stem cells, as well as by increasing the differentiation of peripheral blood derived female germline stem cells into oocytes.
  • Restoration of ovarian function can relieve adverse symptoms and complications associated with menopausal disorders, including, but not limited to, somatic disorders such as osteoporosis, cardiovascular disease, somatic sexual dysfunction, hot flashes, vaginal drying, sleep disorders, depression, irritability, loss of libido, hormone imbalances, and the like, as well as cognitive disorders, such as loss of memory; emotional disorders, depression, and the like.
  • somatic disorders such as osteoporosis, cardiovascular disease, somatic sexual dysfunction, hot flashes, vaginal drying, sleep disorders, depression, irritability, loss of libido, hormone imbalances, and the like
  • cognitive disorders such as loss of memory; emotional disorders, depression, and the like.
  • Peripheral blood derived germline stem cells of the invention can be administered as previously described, and obtained by all methods known in the art.
  • Peripheral blood can be isolated by standard methods known in the art, which include methods for harvesting umbilical cord blood.
  • peripheral blood mononuclear cells PBMCs
  • lymphocytes including T-cells, B-cells, NK cells, etc.
  • monocytes including T-cells, B-cells, NK cells, etc.
  • stem cells including T-cells, B-cells, NK cells, etc.
  • only PBMCs are taken, either leaving or returning red blood cells and polymorphonuclear leucocytes to the patient. This is done as is known in the art, for example using leukophoresis techniques.
  • a 5 to 7 liter leukophoresis step it done, which essentially removes PBMCs from a patient, returning the remaining blood components.
  • Collection of the cell sample is preferably done in the presence of an anticoagulant such as heparin, as is known in the art.
  • the sample comprising the PBMCs can be preheated in a wide variety of ways.
  • the cells can be additionally concentrated, if this was not done simultaneously with collection or to further purify and/or concentrate the cells.
  • the cells may be washed, counted, and resuspended in buffer transferred to a sterile, closed system for further purification and activation.
  • the PBMCs are generally concentrated for treatment, using standard techniques in the art in a preferred embodiment, the leukophoresis collection step results in a concentrated sample of PBMCs, in a sterile leukopak, that may contain reagents or doses of the suppressive composition, as is more fully outlined below.
  • an additional concentration/purification step is done, such as Ficoll-Hypaque density gradient centrifugation as is known in the art.
  • Separation or concentration procedures include but are not limited to magnetic separation, using antibody-coated magnetic beads, affinity chromatography, cytotoxic agents, either joined to a monoclonal antibody or used with complement, “panning”, which uses a monoclonal antibody a to a solid matrix.
  • Antibodies attached to solid matrices such as magnetic beads, agarose beads, polystyrene beads, follow fiber membranes and plastic surfaces, allow for direct separation. Cells bound by, antibody can be removed or concentration by physically separating the solid support from the cell suspension. The exact conditions a and procedure depend on factors specific to the system employed. The selection of appropriate conditions is well within the skill in the art.
  • Antibodies may be conjugated to biotin, which then can be removed with avidin or streptavidin bound to a support, or fluorochromes, which can be used with a fluorescence activated cell sorter (FACS), to enable cell separation. Any technique may be employed as long as it is not detrimental to the viability of the desired cells.
  • FACS fluorescence activated cell sorter
  • the PBMCs are separated in a automated, closed system such as the Nexell Isolex 300i Magnetic Cell Selection System. Generally, this is done to maintain sterility and to insure standardization of the methodology used for cell separation, activation and development of suppressor cell function.
  • the cells may be aliquoted and frozen, preferably, in liquid nitrogen or used immediately as described below. Frozen cells may be thawed and used as needed.
  • Cryoprotective agents which can be used, include but are not limited to dimethyl sulfoxide (DMSO) (Lovelock, J. E. and Bishop, M. W. H., 1959, Nature 183:1394-1395; Ashwood-Smith, M. J., 1961, Nature 190:1204-1205), hetastarch, glycerol, polyvinylpyrrolidine (Rinfret, A. P., 1960, Ann. N.Y. Acad. Sci. 85:576), polyethylene glycol (Sloviter, H. A.
  • the cells may be stored in 10% DMSO, 50% serum, and 40% RPMI 1640 medium. Methods of cell separation and purification are found in U.S. Pat. No. 5,888,499, which is expressly incorporated by reference.
  • the PBMCs are then washed to remove serum proteins and soluble blood components, such as autoantibodies, inhibitors, etc., using techniques well known in the art Generally, this involves addition of physiological media or buffer, followed by centrifugation. This may be repeated as necessary. They can be resuspended in physiological media, preferably AIM-V serum free medium (Life Technologies) (since serum contains significant amounts of inhibitors of TGF- ⁇ ) although buffers such as Hanks balanced salt solution (HBBS) or physiological buffered saline (PBS) can also be used.
  • physiological media preferably AIM-V serum free medium (Life Technologies) (since serum contains significant amounts of inhibitors of TGF- ⁇ ) although buffers such as Hanks balanced salt solution (HBBS) or physiological buffered saline (PBS) can also be used.
  • HBBS Hanks balanced salt solution
  • PBS physiological buffered saline
  • the cells are then counted; in general from 1 ⁇ 10 9 to 2 ⁇ 10 9 white blood cells are collected from a 5-7 liter leukophoresis step. These cells are brought up roughly 200 mls of buffer or media.
  • Mobilizing agents include but are not limited to GCSF or GMCSF.
  • Peripheral blood derived germline stem cells of the invention can, if needed, be purified from peripheral blood, including umbilical cord blood. Therefore, peripheral blood derived germline stem cells that can be used in the methods of the invention can comprise a purified sub-population of cells including, but not limited to female and male germline stem cells. Purified cells can be collected and separated, for example, by flow cytometry.
  • Peripheral blood derived germline stem cells of the invention can be autologous (obtained from the subject) or heterologous (e.g., obtained from a donor). Heterologous cells can be provided together with immunosuppressive therapies known in the art to prevent immune rejection of the cells.
  • peripheral blood can be harvested during the lifetime of the subject, but a pre-menopausal harvest is recommended. Furthermore, harvest prior to illness (e.g., cancer) is desirable, and harvest prior to treatment by cytotoxic means (e.g., radiation or chemotherapy) will improve yield and is therefore also desirable. For increased yield from female donors, it may be desirable to coordinate isolation with appropriate stages of the female reproductive cycle that exhibit higher levels of female germline stem cells in the peripheral blood, as described in Example 4.
  • cytotoxic means e.g., radiation or chemotherapy
  • the amount of female germline stem cells or their progenitors in a subject is substantially reduced (e.g., less than 100) in comparison to that of a healthy subject, she can have, or be at risk of developing, premature ovarian failure.
  • the quantity of female germline stem cells or their progenitors circulating in the peripheral blood can be highest during particular stages of the female reproductive cycle. Thus, it may be desirable to coordinate the timing of sample extraction and diagnosis with the timing of such a stage of the female reproductive cycle.
  • Purified peripheral blood derived female germline stem cells or their progenitors can be obtained by standard methods known in the art, including cell sorting by FACs. Isolated peripheral blood can be sorted using flow cytometers known in the art (e.g., a BD Biosciences FACScalibur cytometer) based on cell surface expression of Sca-1 (van de Rijn et al., (1989) Proc. Natl. Acad. Sci.
  • peripheral blood derived female germline stem cells or their progenitors in-vitro For serial passage-based enrichment of peripheral blood derived female germline stem cells or their progenitors in-vitro (Meirelles and Nardi, (2003) Br. J. Haematol. 123, 702-711); (Tropel et al., (2004) Exp. Cell Res. 295, 395-406), isolated peripheral blood can be plated on plastic in Dulbecco's modified Eagle's medium (Fisher Scientific, Pittsburgh, Pa.) with 10% fetal bovine serum (Hyclone, Logan, Utah), penicillin, streptomycin, L-glutamine and amphotericin-B.
  • the supernatants containing non-adherent cells can be removed and replaced with fresh culture medium after gentle washing.
  • the cultures can then be maintained and passed once confluence is reached (e.g., for a total of about three times over the span of about 6 weeks) at which time the cultures can be terminated to collect adherent cells for analysis.
  • compositions comprising peripheral blood derived germline stem cells or their progenitors can be provided directly to the reproductive organ of interest (e.g., ovary or testes).
  • compositions comprising peripheral blood derived germline stem cells or their progenitors can be provided indirectly to the reproductive organ of interest, for example, by administration into the circulatory system (e.g., to extra-ovarian circulation).
  • peripheral blood derived germline stem cells, their progenitors or their progeny, described herein can optionally be genetically modified, in vitro, in vivo or ex vivo, by introducing heterologous DNA or RNA or protein into the cell by a variety of recombinant methods known to those of skill in the art.
  • viral transfer including the use of DNA or RNA viral vectors, such as retroviruses (including lentiviruses), Simian virus 40 (SV40), adenovirus, Sindbis virus, and bovine papillomavirus, for example;
  • chemical transfer including calcium phosphate transfection and DEAE dextran transfection methods;
  • membrane fusion transfer using DNA-loaded membranous vesicles such as liposomes, red blood cell ghosts, and protoplasts, for example; and (4) physical transfer techniques, such as microinjection, electroporation, or direct “naked” DNA transfer.
  • peripheral blood derived germline stem cells of the invention can be genetically altered by insertion of pre-selected isolated DNA, by substitution of a segment of the cellular genome with pre-selected isolated DNA, or by deletion of or inactivation of at least a portion of the cellular genome of the cell. Deletion or inactivation of at least a portion of the cellular genome can be accomplished by a variety of means, including but not limited to genetic recombination, by antisense technology (which can include the use of peptide nucleic acids, or PNAs), or by ribozyme technology, for example.
  • antisense technology which can include the use of peptide nucleic acids, or PNAs
  • ribozyme technology for example.
  • the altered genome may contain the genetic sequence of a selectable or screenable marker gene that is expressed so that the cell with altered genome, or its progeny, can be differentiated from cells having an unaltered genome.
  • the marker may be a green, red, yellow fluorescent protein, ⁇ -galactosidase, the neomycin resistance gene, dihydrofolate reductase (DHFR), or hygromycin, but are not limited to these examples.
  • the underlying defect of a pathological state is a mutation in DNA encoding a protein such as a metabolic protein.
  • the polypeptide encoded by the heterologous DNA lacks a mutation associated with a pathological state.
  • a pathological state is associated with a decrease in expression of a protein.
  • a genetically altered peripheral blood derived germline stem cell, or its progeny may contain DNA encoding such a protein under the control of a promoter that directs strong expression of the recombinant protein.
  • the cell may express a gene that can be regulated by an inducible promoter or other control mechanism where conditions necessitate highly controlled regulation or timing of the expression of a protein, enzyme, or other cell product.
  • Such stem cells when transplanted into a subject suffering from abnormally low expression of the protein, produce high levels of the protein to confer a therapeutic benefit.
  • the peripheral blood derived germline stem cell of the invention, its progenitor or its in vitro-derived progeny can contain heterologous DNA encoding genes to be expressed, for example, in gene therapy.
  • Peripheral blood derived germline stem cells of the invention, their progenitors or their in vitro-derived progeny can contain heterologous DNA encoding Atm, the gene responsible for the human disease Ataxia-telangiectasia in which fertility is disrupted.
  • peripheral blood derived germline stem cells their progenitors or their in vitro-derived progeny, can further relieve defects in ovarian function.
  • DNA encoding a gene product that alters the functional properties of peripheral blood derived germline stem cells in the absence of any disease state is also envisioned. For example, delivery of a gene that inhibits apoptosis, or that prevents differentiation would be beneficial.
  • Insertion of one or more pre-selected DNA sequences can be accomplished by homologous recombination or by viral integration into the host cell genome.
  • the desired gene sequence can also be incorporated into the cell, particularly into its nucleus, using a plasmid expression vector and a nuclear localization sequence. Methods for directing polynucleotides to the nucleus have been described in the art.
  • the genetic material can be introduced using promoters that will allow for the gene of interest to be positively or negatively induced using certain chemicals/drugs, to be eliminated following administration of a given drug/chemical, or can be tagged to allow induction by chemicals (including but not limited to the tamoxifen responsive mutated estrogen receptor) expression in specific cell compartments (including but not limited to the cell membrane).
  • Calcium phosphate transfection can be used to introduce plasmid DNA containing a target gene or polynucleotide into isolated or cultured peripheral blood derived germline stem cells or their progenitors and is a standard method of DNA transfer to those of skill in the art.
  • DEAE-dextran transfection which is also known to those of skill in the art, may be preferred over calcium phosphate transfection where transient transfection is desired, as it is often more efficient.
  • the cells of the present invention are isolated cells, microinjection can be particularly effective for transferring genetic material into the cells. This method is advantageous because it provides delivery of the desired genetic material directly to the nucleus, avoiding both cytoplasmic and lysosomal degradation of the injected polynucleotide. This technique has been used effectively to accomplish peripheral blood derived modification in transgenic animals.
  • Cells of the present invention can also be genetically modified using electroporation.
  • Liposomal delivery of DNA or RNA to genetically modify the cells can be performed using cationic liposomes, which form a stable complex with the polynucleotide.
  • dioleoyl phosphatidylethanolamine (DOPE) or dioleoyl phosphatidylcholine (DOPQ) can be added.
  • DOPE dioleoyl phosphatidylethanolamine
  • DOPQ dioleoyl phosphatidylcholine
  • Commercially available reagents for liposomal transfer include Lipofectin (Life Technologies). Lipofectin, for example, is a mixture of the cationic lipid N-[1-(2,3-dioleyloxy)propyl]-N-N-N-trimethyl ammonia chloride and DOPE.
  • Liposomes can carry larger pieces of DNA, can generally protect the polynucleotide from degradation, and can be targeted to specific cells or tissues. Cationic lipid-mediated gene transfer efficiency can be enhanced by incorporating purified viral or cellular envelope components, such as the purified G glycoprotein of the vesicular stomatitis virus envelope (VSV-G). Gene transfer techniques which have been shown effective for delivery of DNA into primary and established mammalian cell lines using lipopolyamine-coated DNA can be used to introduce target DNA into the peripheral blood derived germline stem cells described herein.
  • VSV-G vesicular stomatitis virus envelope
  • Naked plasmid DNA can be injected directly into a tissue mass formed of differentiated cells from the isolated peripheral blood derived germline stem cells or their progenitors. This technique has been shown to be effective in transferring plasmid DNA to skeletal muscle tissue, where expression in mouse skeletal muscle has been observed for more than 19 months following a single intramuscular injection. More rapidly dividing cells take up naked plasmid DNA more efficiently. Therefore, it is advantageous to stimulate cell division prior to treatment with plasmid DNA. Microprojectile gene transfer can also be used to transfer genes into stem cells either in vitro or in vivo. The basic procedure for microprojectile gene transfer was described by J. Wolff in Gene Therapeutics (1994), page 195. Similarly, microparticle injection techniques have been described previously, and methods are known to those of skill in the art. Signal peptides can be also attached to plasmid DNA to direct the DNA to the nucleus for more efficient expression.
  • Viral vectors are used to genetically alter peripheral blood derived germline stem cells of the present invention and their progeny. Viral vectors are used, as are the physical methods previously described, to deliver one or more target genes, polynucleotides, antisense molecules, or ribozyme sequences, for example, into the cells. Viral vectors and methods for using them to deliver DNA to cells are well known to those of skill in the art. Examples of viral vectors that can be used to genetically alter the cells of the present invention include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors (including lentiviral vectors), alphaviral vectors (e.g., Sindbis vectors), and herpes virus vectors.
  • Peptide or protein transfection is another method that can be used to genetically alter peripheral blood derived germline stem cells of the invention and their progeny.
  • Peptides including, but not limited to, Pep-1 (commercially available as ChariotTM) and MPG, can quickly and efficiently transport biologically active proteins, peptides, antibodies, and nucleic acids directly into cells, with an efficiency of about 60% to about 95% (Morris, M. C. et al, (2001) Nat. Biotech. 19: 1173-1176).
  • the peptide forms a non-covalent bond with the macromolecule of interest (i.e., protein, nucleic acid). The binding reaction stabilizes the protein and protects it from degradation.
  • the peptide-macromolecule complex Upon delivery into the cell of interest, such as stem cells of the invention, the peptide-macromolecule complex dissociates, leaving the macromolecule biologically active and free to proceed to its target organelle. Delivery can occur in the presence of absence of serum. Uptake and delivery can occur at 4° C., which eliminates endosomal processing of incoming macromolecules. Movement of macromolecules through the endosomal pathway can modify the macromolecule upon uptake. Peptides such as Pep-1, by directly delivering a protein, antibody, or peptide of interest, bypass the transcription-translation process.
  • Methods of the invention can provide oocyte reserves for use in ex vivo procedures, such as somatic cell nuclear transfer.
  • Employing recombinant techniques prior to nuclear transfer will allow for the design of customized oocytes and ultimately produce embryos from which embryonic stem cells can be derived.
  • genetic manipulation of donor DNA prior to nuclear transfer will result in embryos that possess the desired modification or genetic trait.
  • Insertion of the donor cell or nucleus into the enucleated oocyte to form a reconstituted cell is usually by microinjection of a donor cell under the zona pellucida prior to fusion. Fusion may be induced by application of a DC electrical pulse across the contact/fusion plane (electrofusion), by exposure of the cells to fusion-promoting chemicals, such as polyethylene glycol, or by way of an inactivated virus, such as the Sendai virus.
  • a reconstituted cell is typically activated by electrical and/or non-electrical means before, during, and/or after fusion of the nuclear donor and recipient oocyte.
  • Activation methods include electric pulses, chemically induced shock, penetration by sperm, increasing levels of divalent cations in the oocyte, and reducing phosphorylation of cellular proteins (as by way of kinase inhibitors) in the oocyte.
  • the activated reconstituted cells, or embryos, are typically cultured in medium well known to those of ordinary skill in the art and then transferred to the womb of an animal.
  • embryos produced from oocytes of the invention can be genetically modified, either through manipulation of the oocyte in vitro prior to fertilization or manipulation of donor DNA prior to nuclear transfer into the enucleated oocyte, to produce embryos having a desired genetic trait.
  • Oocytes produced from peripheral blood derived female germline stem cells of the invention, or progenitors derived from peripheral blood derived female germline stem cells of the invention, as described herein can also be used for methods of in vitro fertilization. Accordingly, the invention provides methods for in vitro fertilization of a female subject, comprising the steps of:
  • Couples are generally first evaluated to diagnose their particular infertility problem(s). These may range from unexplained infertility of both partners to severe problems of the female (e.g., endometriosis resulting in nonpatent oviducts with irregular menstrual cycles or polycystic ovarian disease) or the male (e.g., low sperm count with morphological abnormalities, or an inability to ejaculate normally as with spinal peripheral lesions, retrograde ejaculation, or reversed vasectomy). The results of these evaluations also determine the specific procedure to be performed for each couple.
  • Procedures often begin with the administration of a drug to down-regulate the hypothalamic/pituitary system (LHRH agonist). This process decreases serum concentrations of the gonadotropins, and developing ovarian follicles degenerate, thereby providing a set of new follicles at earlier stages of development. This permits more precise control of the maturation of these new follicles by administration of exogenous gonadotropins in the absence of influences by the hypothalamic pituitary axis. The progress of maturation and the number of growing follicles (usually four to ten stimulated per ovary) are monitored by daily observations using ultrasound and serum estradiol determinations. When the follicles attain preovulatory size (18-21 mm) and estradiol concentrations continue to rise linearly, the ovulatory response is initiated by exogenous administration of human chorionic gonadotropins (hCG).
  • hCG human chorionic gonadotropins
  • Oocytes can be obtained from peripheral blood derived female germline stem cells, or progenitors derived from peripheral blood derived female germline stem cells, as previously described herein.
  • Peripheral blood derived female germline stem cells, or progenitors derived from peripheral blood derived female germline stem cells can be cultured in the presence of an oocyte differentiation agent which induces differentiation into oocytes.
  • the differentiation agent can be supplied exogenously (e.g., added to the culture medium) or from endogenous sources during co-culture with allogenic or heterogenic ovarian tissue.
  • Peripheral blood derived female germline stem cells of the invention can also be cultured in a tissue-engineered structure wherein the differentiation agent is either exogenously or endogenously supplied and oocytes are obtained.
  • oocytes can be evaluated morphologically and transferred to a petri dish containing culture media and heat-inactivated serum.
  • a semen sample is provided by the male partner and processed using a “swim up” procedure, whereby the most active, motile sperm will be obtained for insemination.
  • a procedure called GIFT gamete intrafallopian transfer
  • oocyte-cumulus complexes surrounded by sperm are placed directly into the oviducts by laproscopy. This procedure best simulates the normal sequences of events and permits fertilization to occur within the oviducts.
  • GIFT has the highest success rate with 22% of the 3,750 patients undergoing ova retrieval in 1990 having a live delivery.
  • An alternative procedure ZIFT zygote intrafallopian transfer
  • Extra zygotes can be cryopreserved at this time for future transfer or for donation to couples without female gametes.
  • Most patients having more serious infertility problems, however, will require an additional one to two days incubation in culture so that preembryos in the early cleavage states can be selected for transfer to the uterus.
  • This IVF-UT (in vitro fertilization uterine transfer) procedure entails the transcervical transfer of several 2-6 cell (day 2) or 8-16 (day 3) preembryos to the fundus of the uterus (4-5 preembryos provides optimal success).
  • peripheral blood contains germline stem cells and thus, peripheral blood cell transplantation (PBCT) can be used to rescue oocyte production in female recipients.
  • PBCT peripheral blood cell transplantation
  • doxorubicin insult model was utilized, in which there occurs a rapid and spontaneous regeneration of the primordial follicle pool following doxorubicin insult, presumably through germline stem cell-derived progeny arriving to the ovaries via the general circulation. Accordingly, such a model lends itself well to rapidly assessing the contribution of peripheral blood-derived germ cells to de-novo oocyte production in adult females.
  • peripheral blood mononuclear cells were collected from adult transgenic female mice with ubiquitous expression of green fluorescent protein (GFP).
  • GFP green fluorescent protein
  • peripheral blood was collected and layered on Ficoll-Paque Plus (Amersham Biosciences). The samples were centrifuged at 800 ⁇ g for 15 minutes at 4 C, and mononuclear cells were collected from the Ficoll-buffer interface. After collection, the cells were washed and resuspended in PBS at a final concentration of 3-6 ⁇ 10 6 cell ml ⁇ 1 .
  • GFP expression was detectable in primordial and primary oocytes of transgenic females ( FIG. 1 a ) but was not observed in oocytes of wild-type females prior to PBCT ( FIG. 1 b ).
  • primordial and early primary follicles with GFP-positive oocytes were detected in the ovaries of adult wild-type female mice within 24 hours of PBCT ( FIG. 1 c - e ).
  • GFP-negative primordial and primary oocytes were also found in the same ovaries of mice receiving PBCT ( FIG. 1 f ), representing either those oocytes not destroyed by doxorubicin treatment or new oocytes formed from host germline stem cell-derived progeny following the insult.
  • transgenic female mice with GFP expression driven by an 18-kb fragment of the Oct4 promoter in which the proximal enhancer region has been inactivated (GOF18- ⁇ PE or TgOG2) (Yeom et al., (1996) Development 122, 881-894); (Yoshimizu et al., (1999) Dev. Growth Differ. 41, 675-684); (Szabo et al., (2002) Mech. Dev. 115, 157-160); were used as donors for peripheral blood cell transplantation (PBCT).
  • PBCT peripheral blood cell transplantation
  • Peripheral blood was harvested from adult (7-10 weeks of age) transgenic female mice with Oct4-specific expression of GFP, or from adult male Oct4-GFP transgenic mice, and layered on Ficoll-Paque Plus (Amersham Biosciences/GE Healthcare, Piscataway, N.J.). The samples were centrifuged at 800 ⁇ g for 15 min at 4 C, and mononuclear cells were collected from the Ficoll-buffer interface. The cells were then washed and resuspended in PBS at a final concentration of 2-4 ⁇ 10 7 cells/ml.
  • recipient adult (6-7 weeks of age) wild-type or Atm-null female mice were conditioned with chemotherapy as described above for BMT, followed by PBCT (0.5 ml of cells per mouse, via the tail vein) 24 hr later.
  • PBCT 0.5 ml of cells per mouse, via the tail vein
  • ovaries were collected 28-30 hr after PBCT and analyzed for GFP expression by immunohistochemistry.
  • recipient ovaries were fixed, serially sectioned and screened in their entirety for GFP-expressing oocytes.
  • testicular and ovarian tissues from Oct4-GFP (TgOG2) mice were analyzed in parallel to confirm transgene expression in males as well as antigen detection in ovaries.
  • FIGS. 2A-2B As controls, GFP expression was detected only in primordial and growing oocytes of transgenic females ( FIGS. 2A-2B ), and the GFP signal was absent in oocytes of wild-type females prior to PBCT ( FIG. 2C ). However, primordial follicles with highly GFP-positive (GFP + ) oocytes were detected in the ovaries of chemo-ablated adult wild-type female mice within 28-30 hr of PBCT ( FIGS. 2D-2F ; see also FIG. 4 ).
  • FIGS. 2G-2H Similar findings were obtained when the experiments were repeated using chemo-ablated Atm-null female mice as recipients ( FIGS. 2G-2H ), thus excluding the possibility of a non-specific ‘restorative’ effect of PBCT on endogenous oocyte production in the host females.
  • transplantation of peripheral blood-derived mononuclear cells harvested from adult male TgOG2 mice, which also exhibit abundant expression of the transgene in germ cells did not result in the production of GFP + oocytes in chemotherapy-conditioned female recipients ( FIGS. 3D-3F ), ruling out the possibility that the oocytes observed following transplantation of female peripheral blood developed as a result of fusion between GFP-expressing donor cells and any residual host germ cells not destroyed by the chemo-ablation protocol.
  • peripheral blood derived female germline stem cells and their progenitors collected from Oct-4 GFP transgenic female donors to generate oocytes following transplantation into adult wildtype female mice was further evaluate by immunohistochemical analysis using antibodies specific for MVH (generously provided by T. Noce; Fujiwara et al., 1994), HDAC6 (2162; Cell Signaling Technology, Beverly, Mass.), NOBOX (A. Rajkovic; Suzumori et al., 2002), GDF-9 (AF739; R&D Systems, Minneapolis, Minn.) or GFP (sc-9996; Santa Cruz Biotechnology, Santa Cruz, Calif.) after high temperature antigen unmasking, as recommended by each supplier.
  • MVH gene provided by T. Noce; Fujiwara et al., 1994
  • HDAC6 2162; Cell Signaling Technology, Beverly, Mass.
  • NOBOX A. Rajkovic; Suzumori et al., 2002
  • GDF-9 AF739; R&D Systems, Minneapolis, Minn.
  • RNA encoded by the ribosomal gene L7 (mouse studies), beta-actin (mouse studies) or the glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH; human studies) was amplified and used as a loading control (‘house-keeping’ gene). All PCR products were isolated, subcloned and sequenced for confirmation.
  • Human cord blood was evaluated to determine whether cells that express the germ cell marker Dazl were present. Dazl has previously been detected in germ cells of both human fetal females (Brekhman et al., 2000 Mol Hum Reprod 6: 465-468; Tsai et al., 2000 Fertil Steril 73: 627-630) and human males (Brekhman et al., 2000 Mol Hum Reprod 6:465-468). A single human cord blood sample was split into two replicate samples and RNA was extracted from each. The replicates were then reverse-transcribed, with mock-reverse transcribed negative control samples prepared in parallel.
  • One aspect of the PBCT procedure that may impact the number of donor-derived oocytes generated is the stage of the donor female's reproductive cycle during which blood is harvested for transplantation.
  • peripheral blood was collected from adult female mice during estrus, metestrus, diestrus and proestrus, and then analyzed by real-time PCR for Mvh expression.
  • PCR was performed using a Cepheid Smart Cycler II and primers specific for amplification of Mvh (FAM-labeled LUXTM Fluorogenic Custom Primers, Invitrogen; forward: cacctcagagggttttccaagcgaggg; reverse: cctcttctgaacgggcctga) and beta-actin (LUXTM Primer Sets for Housekeeping Genes 101M-01; Invitrogen). Expression ratios were calculated using the method of Pfaffl (2001), with Mvh levels in bone marrow at estrus set as the reference point (1.0) for comparisons.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Developmental Biology & Embryology (AREA)
  • Cell Biology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Reproductive Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Surgery (AREA)
  • Pregnancy & Childbirth (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Medical Informatics (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
US11/131,152 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from peripheral blood derived germline stem cells Abandoned US20060015961A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
US11/131,152 US20060015961A1 (en) 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from peripheral blood derived germline stem cells
US13/006,752 US9267111B2 (en) 2004-05-17 2011-01-14 Methods of treating female subjects in need of in vitro fertilization
US14/990,539 US20160362657A1 (en) 2004-05-17 2016-01-07 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US16/203,111 US20190300852A1 (en) 2004-05-17 2018-11-28 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US57222204P 2004-05-17 2004-05-17
US57418704P 2004-05-24 2004-05-24
US58664104P 2004-07-09 2004-07-09
US11/131,152 US20060015961A1 (en) 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from peripheral blood derived germline stem cells

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US13/006,752 Continuation US9267111B2 (en) 2004-05-17 2011-01-14 Methods of treating female subjects in need of in vitro fertilization

Publications (1)

Publication Number Publication Date
US20060015961A1 true US20060015961A1 (en) 2006-01-19

Family

ID=35428927

Family Applications (7)

Application Number Title Priority Date Filing Date
US11/131,152 Abandoned US20060015961A1 (en) 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from peripheral blood derived germline stem cells
US11/131,153 Abandoned US20060010509A1 (en) 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US13/006,752 Expired - Fee Related US9267111B2 (en) 2004-05-17 2011-01-14 Methods of treating female subjects in need of in vitro fertilization
US14/308,048 Abandoned US20160137978A1 (en) 2004-05-17 2014-06-18 Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US14/990,539 Abandoned US20160362657A1 (en) 2004-05-17 2016-01-07 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US16/203,111 Abandoned US20190300852A1 (en) 2004-05-17 2018-11-28 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US16/254,130 Abandoned US20190352602A1 (en) 2004-05-17 2019-01-22 Methods and Compositions for Producing Germ Cells from Bone Marrow Derived Germline Stem Cells

Family Applications After (6)

Application Number Title Priority Date Filing Date
US11/131,153 Abandoned US20060010509A1 (en) 2004-05-17 2005-05-17 Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US13/006,752 Expired - Fee Related US9267111B2 (en) 2004-05-17 2011-01-14 Methods of treating female subjects in need of in vitro fertilization
US14/308,048 Abandoned US20160137978A1 (en) 2004-05-17 2014-06-18 Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US14/990,539 Abandoned US20160362657A1 (en) 2004-05-17 2016-01-07 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US16/203,111 Abandoned US20190300852A1 (en) 2004-05-17 2018-11-28 Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US16/254,130 Abandoned US20190352602A1 (en) 2004-05-17 2019-01-22 Methods and Compositions for Producing Germ Cells from Bone Marrow Derived Germline Stem Cells

Country Status (14)

Country Link
US (7) US20060015961A1 (sl)
EP (5) EP1765085B1 (sl)
JP (3) JP2007537754A (sl)
AU (3) AU2005252636A1 (sl)
CA (6) CA2566857A1 (sl)
CY (1) CY1116768T1 (sl)
DK (1) DK1765085T3 (sl)
ES (1) ES2547953T3 (sl)
HK (1) HK1221975A1 (sl)
HU (1) HUE027620T2 (sl)
PL (1) PL1765085T3 (sl)
PT (1) PT1765085E (sl)
SI (1) SI1765085T1 (sl)
WO (3) WO2006001938A2 (sl)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060010508A1 (en) * 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof
US20060010509A1 (en) * 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells
WO2007142651A1 (en) * 2006-06-09 2007-12-13 Caritas St. Elizabeth Medical Center Of Boston, Inc. Methods and compositions for the treatment of neuropathy
US20090028834A1 (en) * 2007-07-27 2009-01-29 Hal Siegel Methods and compositions for stimulating the proliferation or differentiation of stem cells with substance P or an analog thereof
WO2012142500A2 (en) 2011-04-14 2012-10-18 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
WO2013002880A1 (en) 2011-06-29 2013-01-03 The General Hospital Corporation Compositions and methods for enhancing bioenergetic status in female germ cells
WO2013078312A1 (en) * 2011-11-23 2013-05-30 Mezadata Medical Ip Holding Llp Method of in vitro fertilization with delay of embryo transfer and use of peripheral blood mononuclear cells

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080050814A1 (en) * 2006-06-05 2008-02-28 Cryo-Cell International, Inc. Procurement, isolation and cryopreservation of fetal placental cells
WO2007146105A2 (en) * 2006-06-05 2007-12-21 Cryo-Cell International, Inc. Procurement, isolation and cryopreservation of fetal placental cells
CZ2007197A3 (cs) * 2007-03-14 2008-06-04 Ceská zemedelská univerzita v Praze Použití inhibitoru histon deacetylázy pro prípravu kultivacního média na prodloužení životnosti savcích oocytu in vitro
EP2022847A1 (en) * 2007-08-07 2009-02-11 Irma Virant-Klun Pluripotent stem cells, methods for their isolation and their use and culture media
EP2176399A1 (en) * 2007-08-07 2010-04-21 PrimeGen Biotech LLC Isolation, characterization and propagation of germline stem cells
WO2009042127A2 (en) * 2007-09-24 2009-04-02 The General Hospital Corporation Compositions and methods for rescuing fertility
CN102250830B (zh) * 2011-07-05 2013-01-16 西北农林科技大学 一种雌性生殖干细胞的体外分离及培养方法
CA2932581A1 (en) * 2013-10-07 2015-04-16 Northeastern University Methods and compositions for ex vivo generation of developmentally competent eggs from germ line cells using autologous cell systems
CA2943037C (en) 2014-03-27 2021-07-27 Northeastern University Methods for growth and maturation of ovarian follicles
KR20170056521A (ko) 2014-09-16 2017-05-23 오바사이언스, 인크. 항-vasa 항체, 및 이것의 제조 및 사용 방법
AU2016324669B2 (en) * 2015-09-17 2022-12-01 Kyushu University, National University Corporation Culture method for differentiating primordial germ cells into functionally mature oocytes
JP6754966B2 (ja) * 2016-02-25 2020-09-16 国立大学法人広島大学 始原生殖細胞の培養方法及び始原生殖細胞の培養用培地添加物
US20190177687A1 (en) * 2016-06-23 2019-06-13 Tithon Biotech Inc. Cells expressing parathyroid hormone 1 receptor and uses thereof
JP7021828B2 (ja) * 2017-11-10 2022-02-17 一公 川島 卵巣由来幹細胞の減数分裂誘導法
CN113355386B (zh) * 2021-06-02 2022-05-17 福建省妇幼保健院 一种应用三原核受精卵检测体外受精环境质量的方法
WO2022272042A2 (en) * 2021-06-25 2022-12-29 The J. David Gladstone Institutes, A Testamentary Trust Established Under The Will Of J. David Gladstone Primordial germ cells
WO2024128499A1 (ko) * 2022-12-13 2024-06-20 (주)차바이오텍 탯줄 유래 부착형 줄기세포를 포함하는 난소부전 예방 또는 치료용 약학적 조성물

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050130302A1 (en) * 2003-09-29 2005-06-16 Reprocell Inc. Method and composition for regulating expansion of stem cells
US20060010508A1 (en) * 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof
US20060010509A1 (en) * 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells

Family Cites Families (67)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3854470A (en) 1973-11-23 1974-12-17 L Augspurger Reproduction processes for cellular bodies
IT1057895B (it) 1975-02-17 1982-03-30 Serono Lab Gonadotropina corionica umana parzialmente desalinizzata per indurre l'ouvulazione
US4193392A (en) 1977-09-23 1980-03-18 Barnett Gordon R Method for removing ova from animals
US4326505A (en) 1980-01-07 1982-04-27 Occidental Petroleum Corporation Surgical procedure for embryo transplants on animals
US4339434A (en) 1981-08-17 1982-07-13 Gametrics Limited Method of increasing the incidence of female offspring
US4845077A (en) 1984-04-03 1989-07-04 Serono Laboratories, Inc. Method of inducing ovulation
FR2563726B1 (fr) 1984-05-04 1986-10-10 Robert Cassou Appareil d'insemination artificielle, notamment des carnivores
US4642094A (en) 1984-05-29 1987-02-10 North Jr Walter L Non-surgical embryo transfer device
US4589402A (en) 1984-07-26 1986-05-20 Serono Laboratories, Inc. Method of in vitro fertilization
US4725579A (en) 1985-02-21 1988-02-16 Serono Laboratories, Inc. Method of in vitro fertilization by a unique combination of gonadotropins
US4683202A (en) 1985-03-28 1987-07-28 Cetus Corporation Process for amplifying nucleic acid sequences
FR2580933B1 (fr) 1985-04-24 1987-08-07 Lenck Lucien Capacite trans-uterine pour fecondation " in vitro in vivo "
FR2589879B1 (fr) 1985-11-08 1989-05-12 Claude Ranoux Conteneur pour culture anaerobie d'embryons humains
AT387718B (de) 1986-04-09 1989-03-10 Fischl Franz H Dr Katheder zur kuenstlichen befruchtung
FR2608037A1 (fr) 1986-12-10 1988-06-17 Lenck Lucien Methode d'intubation destinee a permettre la transplantation de l'oeuf ou de la matiere embryonnaire, et moyens pour sa mise en oeuvre
FR2609885B1 (fr) 1987-01-22 1989-04-14 Cassou Robert Instrument pour l'insemination artificielle, le transfert d'embryons ou le prelevement de liquides folliculaires chez les mammiferes
US5538948A (en) 1987-01-30 1996-07-23 Novo Nordisk A/S Method for treating infertility comprising administering GnRH analog, gonadotrophins, and growth hormone
US4865589A (en) 1987-04-22 1989-09-12 Ludwig Simmet Instrument for the transfer of materials such as sperm and embryos
FR2614626B1 (fr) 1987-04-30 1989-07-21 Ranoux Claude Conteneur pour fecondation des ovocytes et replacement des embryons chez l'homme et l'animal
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5160312A (en) 1990-02-09 1992-11-03 W. R. Grace & Co.-Conn. Cryopreservation process for direct transfer of embryos
US5147315A (en) 1990-04-06 1992-09-15 C. R. Bard, Inc. Access catheter and system for use in the female reproductive system
US5627066A (en) 1991-05-14 1997-05-06 Mount Sinai School Of Medicine Of The City University Of New York Method and apparatus for in vitro fertilization
AU2016392A (en) 1991-05-14 1992-12-30 Mount Sinai School Of Medicine Of The City University Of New York, The Method and apparatus for (in vitro) fertilization
FR2678506B1 (fr) 1991-07-01 2000-03-10 Claude Ranoux Procede de fecondation en cycle spontane.
US5851832A (en) 1991-07-08 1998-12-22 Neurospheres, Ltd. In vitro growth and proliferation of multipotent neural stem cells and their progeny
US5750376A (en) 1991-07-08 1998-05-12 Neurospheres Holdings Ltd. In vitro growth and proliferation of genetically modified multipotent neural stem cells and their progeny
US5296375A (en) 1992-05-01 1994-03-22 Trustees Of The University Of Pennsylvania Mesoscale sperm handling devices
US5744366A (en) 1992-05-01 1998-04-28 Trustees Of The University Of Pennsylvania Mesoscale devices and methods for analysis of motile cells
US5453357A (en) 1992-10-08 1995-09-26 Vanderbilt University Pluripotential embryonic stem cells and methods of making same
GB9227123D0 (en) 1992-12-30 1993-02-24 Applied Research Systems Method
US5563059A (en) 1993-02-23 1996-10-08 Genentech, Inc. Use of human inhibin and human activin to increase the number of mature primate oocytes
GB9305984D0 (en) 1993-03-23 1993-05-12 Royal Free Hosp School Med Predictive assay
US5360389A (en) 1993-05-25 1994-11-01 Chenette Philip E Methods for endometrial implantation of embryos
US5541081A (en) 1994-03-22 1996-07-30 President And Fellows Of Harvard College Process for assessing oocyte and embryo quality
GB9410639D0 (en) 1994-05-27 1994-07-13 Queen Mary & Westfield College Method of improving fertilization
JP3660026B2 (ja) 1995-09-04 2005-06-15 扶桑薬品工業株式会社 体外受精用培地組成物
US5827174A (en) 1995-09-26 1998-10-27 Reuss, Jr.; William Alexander Biological speciman containment and incubation pouch
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US6040340A (en) 1996-05-07 2000-03-21 Schering Aktiengesellschaft Implantation rates after in vitro fertilization, treatment of infertility and early pregnancy loss with a nitric oxide donor alone or in combination with progesterone, and a method for contraception with nitric oxide inhibitors
US5824548A (en) 1996-05-29 1998-10-20 Wisconsin Alumni Research Foundation Method of increasing survival of cultured primate embryos in medium containing exogenous gonadotrophin releasor hormone
US6251665B1 (en) 1997-02-07 2001-06-26 Cem Cezayirli Directed maturation of stem cells and production of programmable antigen presenting dentritic cells therefrom
CA2199663C (en) 1997-03-11 2004-08-10 Ruth Miriam Moses In vitro maturation and fertilization of mammalian oocytes
US5935968A (en) 1997-03-17 1999-08-10 Merck & Co., Inc. Methods for treating polycystic ovary syndrome
US6010448A (en) 1997-10-17 2000-01-04 Medworks Corp Embryo transfer arrangement
US5961444A (en) 1997-10-17 1999-10-05 Medworks Corporation In vitro fertilization procedure using direct vision
US6196965B1 (en) 1998-05-21 2001-03-06 Cryofacets, Inc. Compositions methods and devices for embryo implantation for in vitro fertilization
US6485972B1 (en) 1998-10-15 2002-11-26 President And Fellows Of Harvard College WNT signalling in reproductive organs
KR20010093280A (ko) 1999-02-24 2001-10-27 한센 핀 베네드, 안네 제헤르, 웨이콥 마리안느 불임증 치료
ATE361091T1 (de) 1999-02-24 2007-05-15 Novo Nordisk As Behandlung von unfruchtbarkeit
CA2389117A1 (en) 1999-10-27 2001-05-03 Mount Sinai Hospital Methods and compositions for enhancing developmental potential of oocytes and zygotes
WO2001036445A1 (en) 1999-11-18 2001-05-25 The Brigham And Women's Hospital, Inc. Compositions and methods for the improved diagnosis and treatment of germ cell tumors
US6875854B1 (en) * 1999-11-18 2005-04-05 The Brigham And Women's Hospital, Inc. Compositions and methods for the improved diagnosis and treatment of germ cell tumors
US6544166B1 (en) 1999-11-25 2003-04-08 Groendahl Christian Treatment of human infertility
US20020142457A1 (en) 1999-12-28 2002-10-03 Akihiro Umezawa Cell having the potentiality of differentiation into cardiomyocytes
US6395546B1 (en) 2000-02-01 2002-05-28 Neurogeneration, Inc. Generation of dopaminergic neurons from human nervous system stem cells
FR2812004B1 (fr) 2000-07-24 2002-12-27 Ccd Lab Milieux de culture pour fecondation in vitro, ou pour la culture de follicules, cellules germinales males ou embryons
HUP0501094A2 (en) 2001-11-06 2006-04-28 Univ Shanghai 2Nd Medical Somatic cell derived embryonic stem cells and its differentiated cells
AUPR892501A0 (en) 2001-11-16 2001-12-13 Peter Maccallum Cancer Institute, The Method of enhancing self renewal of stem cells and uses thereof
US20030134422A1 (en) 2002-01-16 2003-07-17 Sayre Chauncey Bigelow Stem cell maturation for all tissue lines
US7390659B2 (en) 2002-07-16 2008-06-24 The Trustees Of Columbia University In The City Of New York Methods for inducing differentiation of embryonic stem cells and uses thereof
AU2003247135A1 (en) 2002-07-23 2004-02-09 Nanodiagnostics, Inc. Embryonic stem cell markers and uses thereof
WO2005007687A1 (en) 2003-07-09 2005-01-27 Dana-Farber Cancer Institute, Inc Compositions and methods for modulating ovarian follicular initiation
US20080050347A1 (en) * 2006-08-23 2008-02-28 Ichim Thomas E Stem cell therapy for cardiac valvular dysfunction
US8062222B2 (en) * 2007-06-13 2011-11-22 Litron Laboratories, Ltd. Method for measuring in vivo hematotoxicity with an emphasis on radiation exposure assessment
US20090111764A1 (en) * 2007-10-25 2009-04-30 Searete Llc, A Limited Liability Corporation Of The State Of Delaware Mitochondrial selection
CA2868239C (en) 2011-04-14 2018-07-31 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050130302A1 (en) * 2003-09-29 2005-06-16 Reprocell Inc. Method and composition for regulating expansion of stem cells
US20060010508A1 (en) * 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof
US20060010509A1 (en) * 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060010508A1 (en) * 2004-05-17 2006-01-12 Tilly Jonathan L Compositions comprising female germline stem cells and methods of use thereof
US9267111B2 (en) 2004-05-17 2016-02-23 The General Hospital Corporation Methods of treating female subjects in need of in vitro fertilization
US9962411B2 (en) 2004-05-17 2018-05-08 The General Hospital Corporation Isolated populations of female germline stem cells and cell preparations and compositions thereof
US20060010509A1 (en) * 2004-05-17 2006-01-12 Joshua Johnson Methods and compositions for producing germ cells from bone marrow derived germline stem cells
US7955846B2 (en) 2004-05-17 2011-06-07 The General Hospital Corporation Compositions comprising female germline stem cells and methods of use thereof
US8652840B2 (en) 2004-05-17 2014-02-18 The General Hospital Corporation Method for obtaining female germline stem cells and uses thereof
WO2007142651A1 (en) * 2006-06-09 2007-12-13 Caritas St. Elizabeth Medical Center Of Boston, Inc. Methods and compositions for the treatment of neuropathy
US20090028834A1 (en) * 2007-07-27 2009-01-29 Hal Siegel Methods and compositions for stimulating the proliferation or differentiation of stem cells with substance P or an analog thereof
WO2012142500A2 (en) 2011-04-14 2012-10-18 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
EP3498826A1 (en) 2011-04-14 2019-06-19 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
EP2787073A1 (en) 2011-04-14 2014-10-08 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
US8647869B2 (en) 2011-04-14 2014-02-11 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
US9150830B2 (en) 2011-04-14 2015-10-06 The General Hospital Corporation Compositions for autologous ovarian oogonial stem cell mitochondrial energy transfer
US8642329B2 (en) 2011-04-14 2014-02-04 The General Hospital Corporation Compositions and methods for autologous germline mitochondrial energy transfer
WO2013002880A1 (en) 2011-06-29 2013-01-03 The General Hospital Corporation Compositions and methods for enhancing bioenergetic status in female germ cells
EP3495470A1 (en) 2011-06-29 2019-06-12 The General Hospital Corporation In vivo methods for enhancing bioenergetic status in female germ cells
US9845482B2 (en) 2011-06-29 2017-12-19 The General Hospital Corporation Compositions and methods for enhancing bioenergetic status in female germ cells
CN104126004A (zh) * 2011-11-23 2014-10-29 迈渣德塔医学知识产权控股公司 有关胚胎移植延迟和使用外周血单核细胞的体外受精方法
US10271876B2 (en) 2011-11-23 2019-04-30 Mezadata Medical Ip Holding Llc Method of in vitro fertilization with delay of embryo transfer and use of peripheral blood mononuclear cells
MD4526B1 (ro) * 2011-11-23 2017-11-30 Mezadata Medical Ip Holding Llp Metodă de fertilizare in vitro cu întârzierea transferului embrionar şi utilizarea celulelor mononucleare din sângele periferic
WO2013078312A1 (en) * 2011-11-23 2013-05-30 Mezadata Medical Ip Holding Llp Method of in vitro fertilization with delay of embryo transfer and use of peripheral blood mononuclear cells
EA038427B1 (ru) * 2011-11-23 2021-08-27 Проджена Инк. Способ экстракорпорального оплодотворения с отсрочкой переноса эмбриона и использованием мононуклеарных клеток периферической крови
US11185348B2 (en) 2011-11-23 2021-11-30 Progena Inc. Method of in vitro fertilization with delay of embryo transfer and use of peripheral blood mononuclear cells
US20220039834A1 (en) * 2011-11-23 2022-02-10 Progena Inc. Method of in vitro fertilization with delay of embryo transfer and use of peripheral blood mononuclear cells
US11957384B2 (en) * 2011-11-23 2024-04-16 Progena Inc. Method of producing a peripheral blood mononuclear cell composition suitable for repairing or engineering a tissue

Also Published As

Publication number Publication date
AU2005257839A1 (en) 2006-01-05
EP1765983A4 (en) 2008-10-22
US20190300852A1 (en) 2019-10-03
CA2841716A1 (en) 2005-12-01
JP2008512990A (ja) 2008-05-01
CA2569031A1 (en) 2006-01-05
AU2005245899A1 (en) 2005-12-01
EP1765085A4 (en) 2008-11-12
HK1221975A1 (zh) 2017-06-16
US20190352602A1 (en) 2019-11-21
JP2007537754A (ja) 2007-12-27
CY1116768T1 (el) 2017-03-15
WO2006001938A2 (en) 2006-01-05
AU2005252636A1 (en) 2005-12-22
CA2566851C (en) 2015-11-10
PT1765085E (pt) 2015-10-20
CA2566857A1 (en) 2005-12-01
EP1765085A2 (en) 2007-03-28
SI1765085T1 (sl) 2015-11-30
EP2987855B1 (en) 2018-11-21
HUE027620T2 (en) 2016-10-28
US20160362657A1 (en) 2016-12-15
CA2841716C (en) 2020-01-07
US9267111B2 (en) 2016-02-23
DK1765085T3 (en) 2015-10-05
EP1765085B1 (en) 2015-07-08
US20060010509A1 (en) 2006-01-12
EP1765983A2 (en) 2007-03-28
CA2897658A1 (en) 2005-12-22
WO2005121321A3 (en) 2006-09-28
EP1765985A4 (en) 2008-10-15
PL1765085T3 (pl) 2015-11-30
WO2005121321A2 (en) 2005-12-22
CA2566851A1 (en) 2005-12-22
US20160137978A1 (en) 2016-05-19
JP2008512989A (ja) 2008-05-01
WO2006001938A3 (en) 2006-10-12
EP1765985A2 (en) 2007-03-28
CA3009909A1 (en) 2005-12-22
US20120195861A1 (en) 2012-08-02
WO2005113752A2 (en) 2005-12-01
WO2005113752A3 (en) 2007-06-07
EP3498827A1 (en) 2019-06-19
EP2987855A1 (en) 2016-02-24
ES2547953T3 (es) 2015-10-09

Similar Documents

Publication Publication Date Title
US20190300852A1 (en) Methods and Compositions for Producing Germ Cells from Peripheral Blood Derived Germline Stem Cells
US20180200305A1 (en) Isolated Populations of Female Germline Stem Cells and Cell Preparations and Compositions Thereof
JP2021126129A (ja) 疾患を処置するための遺伝子改変された細胞、組織および臓器
Class et al. Patent application title: METHODS AND COMPOSITIONS FOR PRODUCING GERM CELLS FROM BONE MARROW DERIVED GERMLINE STEM CELLS Inventors: Jonathan L. Tilly (Windham, NH, US) Joshua Johnson (New Haven, CT, US)
US20070204357A1 (en) Process for producing normal parenchymal cells, tissues or organs by bioincubator
Class et al. Patent application title: Isolated populations of female germline stem cells and cell preparations and compositions thereof Inventors: Jonathan Lee Tilly (Windham, NH, US) Joshua Johnson (New Haven, CT, US)
Class et al. Patent application title: COMPOSITIONS COMPRISING FEMALE GERMLINE STEM CELLS AND METHODS OF USE THEREOF Inventors: Jonathan Lee Tilly (Windham, NH, US) Joshua Johnson (New Haven, CT, US) Assignees: The General Hospital Corporation

Legal Events

Date Code Title Description
AS Assignment

Owner name: GENERAL HOSPITAL CORPORATION, THE, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TILLY, JONATHAN L.;JOHNSON, JOSHUA;REEL/FRAME:017047/0681;SIGNING DATES FROM 20050818 TO 20050819

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE GENERAL HOSPITAL CORPORATION;REEL/FRAME:024622/0101

Effective date: 20100629

AS Assignment

Owner name: NATIONAL INSTITUTES OF HEALTH (NIH), U.S. DEPT. OF

Free format text: CONFIRMATORY LICENSE;ASSIGNOR:THE GENERAL HOSPITAL CORPORATION;REEL/FRAME:024663/0614

Effective date: 20100629

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION

AS Assignment

Owner name: THE GENERAL HOSPITAL CORPORATION, MASSACHUSETTS

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:TILLY, JONATHAN L.;JOHNSON, JOSHUA;SIGNING DATES FROM 20120315 TO 20120424;REEL/FRAME:028168/0437