US20050106726A1 - RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) - Google Patents

RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) Download PDF

Info

Publication number
US20050106726A1
US20050106726A1 US10/652,791 US65279103A US2005106726A1 US 20050106726 A1 US20050106726 A1 US 20050106726A1 US 65279103 A US65279103 A US 65279103A US 2005106726 A1 US2005106726 A1 US 2005106726A1
Authority
US
United States
Prior art keywords
nucleotides
sina
sina molecule
molecule
ecgf1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US10/652,791
Inventor
James McSwiggen
Bharat Chowrira
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sirna Therapeutics Inc
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US2003/005028 external-priority patent/WO2003074654A2/en
Priority claimed from PCT/US2003/005346 external-priority patent/WO2003070918A2/en
Priority to US10/652,791 priority Critical patent/US20050106726A1/en
Application filed by Individual filed Critical Individual
Priority to US10/693,059 priority patent/US20080039414A1/en
Priority to US10/720,448 priority patent/US8273866B2/en
Priority to US10/724,270 priority patent/US20050080031A1/en
Priority to US10/757,803 priority patent/US20050020525A1/en
Priority to US10/783,128 priority patent/US20050096284A1/en
Priority to US10/824,036 priority patent/US20050191638A1/en
Priority to US10/826,966 priority patent/US20050032733A1/en
Priority to PCT/US2004/011848 priority patent/WO2004111237A1/en
Priority to US10/840,731 priority patent/US20050137153A1/en
Priority to AU2004266311A priority patent/AU2004266311B2/en
Priority to PCT/US2004/016390 priority patent/WO2005019453A2/en
Priority to CA2526831A priority patent/CA2526831C/en
Priority to DE602004022535T priority patent/DE602004022535D1/en
Priority to AT04776102T priority patent/ATE439438T1/en
Priority to EP04776102A priority patent/EP1627061B1/en
Priority to JP2006514948A priority patent/JP4948163B2/en
Priority to US10/557,542 priority patent/US20070032441A1/en
Priority to US10/562,561 priority patent/US20060247194A1/en
Priority to US10/567,888 priority patent/US20070093437A1/en
Priority to US10/922,034 priority patent/US20050164967A1/en
Priority to US10/923,379 priority patent/US20050239731A1/en
Priority to US10/944,611 priority patent/US20050233998A1/en
Assigned to SIRNA THERAPEUTICS, INC. reassignment SIRNA THERAPEUTICS, INC. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: CHOWRIRA, BHARAT, MCSWIGGEN, JAMES
Publication of US20050106726A1 publication Critical patent/US20050106726A1/en
Priority to HK06108326.2A priority patent/HK1086036A1/en
Priority to US12/204,572 priority patent/US7678897B2/en
Priority to US12/689,714 priority patent/US7897755B2/en
Priority to US13/480,655 priority patent/US8618277B2/en
Priority to US14/083,525 priority patent/US20140288148A1/en
Priority to US14/514,112 priority patent/US9181551B2/en
Priority to US14/731,346 priority patent/US9771588B2/en
Priority to US14/861,805 priority patent/US9657294B2/en
Priority to US15/084,865 priority patent/US9732344B2/en
Priority to US15/483,354 priority patent/US9738899B2/en
Priority to US15/617,814 priority patent/US9957517B2/en
Priority to US15/637,579 priority patent/US10000754B2/en
Priority to US15/677,719 priority patent/US10351852B2/en
Priority to US15/977,746 priority patent/US20180245083A1/en
Priority to US16/136,191 priority patent/US20190010497A1/en
Priority to US16/183,530 priority patent/US10889815B2/en
Priority to US16/295,274 priority patent/US20190194658A1/en
Priority to US16/381,288 priority patent/US10662428B2/en
Priority to US17/105,174 priority patent/US20220056441A1/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07FACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
    • C07F9/00Compounds containing elements of Groups 5 or 15 of the Periodic Table
    • C07F9/02Phosphorus compounds
    • C07F9/547Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
    • C07F9/6561Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings
    • C07F9/65616Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings containing the ring system having three or more than three double bonds between ring members or between ring members and non-ring members, e.g. purine or analogs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A61K47/544Phospholipids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/549Sugars, nucleosides, nucleotides or nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00Medicinal preparations characterised by special physical form
    • A61K9/0012Galenical forms characterised by the site of application
    • A61K9/0019Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/317Chemical structure of the backbone with an inverted bond, e.g. a cap structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3212'-O-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/346Spatial arrangement of the modifications having a combination of backbone and sugar modifications
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/51Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00Production
    • C12N2330/30Production chemically synthesised
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention concerns compounds, compositions, and methods for the study, diagnosis, and treatment of conditions and diseases that respond to the modulation of platelet-derived endothelial cell growth factor (ECGF1) and platelet-derived endothelial cell growth factor receptor (ECGF1r) gene expression and/or activity.
  • the present invention also concerns compounds, compositions, and methods relating to conditions and diseases that respond to the modulation of expression and/or activity of genes involved in ECGF1 and ECGF1 receptor pathways.
  • the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against ECGF1 and ECGF1 receptor gene expression.
  • siNA short interfering nucleic acid
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998 , Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi.
  • the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., 1999 , Trends Genet., 15, 358).
  • Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
  • dsRNAs double-stranded RNAs
  • the presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2′,5′-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • dsRNAs ribonuclease III enzyme
  • Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., 2001 , Nature, 409, 363).
  • Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al., 2001 , Genes Dev., 15, 188).
  • Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001 , Science, 293, 834).
  • the RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al., 2001 , Genes Dev., 15, 188).
  • RISC RNA-induced silencing complex
  • RNAi has been studied in a variety of systems. Fire et al., 1998 , Nature, 391, 806, were the first to observe RNAi in C. elegans . Wianny and Goetz, 1999 , Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000 , Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001 , Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • RNAi activity Single mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity.
  • these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5′-end of the siRNA guide sequence rather than the 3′-end of the guide sequence (Elbashir et al., 2001 , EMBO J., 20, 6877).
  • Other studies have indicated that a 5′-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5′-phosphate moiety on the siRNA (Nykanen et al., 2001 , Cell, 107, 309).
  • siRNA may include modifications to either the phosphate-sugar backbone or the nucleoside to include at least one of a nitrogen or sulfur heteroatom, however, neither application postulates to what extent such modifications would be tolerated in siRNA molecules, nor provides any further guidance or examples of such modified siRNA. Kreutzer et al., Canadian Patent Application No.
  • 2,359,180 also describe certain chemical modifications for use in dsRNA constructs in order to counteract activation of double-stranded RNA-dependent protein kinase PKR, specifically 2′-amino or 2′-O-methyl nucleotides, and nucleotides containing a 2′-O or 4′-C methylene bridge.
  • PKR double-stranded RNA-dependent protein kinase
  • 2′-amino or 2′-O-methyl nucleotides specifically 2′-amino or 2′-O-methyl nucleotides, and nucleotides containing a 2′-O or 4′-C methylene bridge.
  • Kreutzer et al. similarly fails to provide examples or guidance as to what extent these modifications would be tolerated in siRNA molecules.
  • the authors describe the introduction of thiophosphate residues into these siRNA transcripts by incorporating thiophosphate nucleotide analogs with T7 and T3 RNA polymerase and observed that RNAs with two phosphorothioate modified bases also had substantial decreases in effectiveness as RNAi.
  • Parrish et al. reported that phosphorothioate modification of more than two residues greatly destabilized the RNAs in vitro such that interference activities could not be assayed. Id. at 1081.
  • the authors also tested certain modifications at the 2′-position of the nucleotide sugar in the long siRNA transcripts and found that substituting deoxynucleotides for ribonucleotides produced a substantial decrease in interference activity, especially in the case of Uridine to Thymidine and/or Cytidine to deoxy-Cytidine substitutions. Id.
  • the authors tested certain base modifications, including substituting, in sense and antisense strands of the siRNA, 4-thiouracil, 5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil, and inosine for guanosine.
  • Parrish reported that inosine produced a substantial decrease in interference activity when incorporated in either strand. Parrish also reported that incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the antisense strand resulted in a substantial decrease in RNAi activity as well.
  • RNAi can be used to cure genetic diseases or viral infection due to the danger of activating interferon response.
  • Li et al, International PCT Publication No. WO 01/68836 describes specific methods for attenuating gene expression using endogenously-derived dsRNA.
  • Tuschl et al., International PCT Publication No. WO 01/75164 describe a Drosophila in vitro RNAi system and the use of specific siRNA molecules for certain functional genomic and certain therapeutic applications; although Tuschl, 2001 , Chem. Biochem., 2, 239-245, doubts that RNAi can be used to cure genetic diseases or viral infection due to the danger of activating interferon response.
  • WO 00/44914 describe the use of specific dsRNAs for attenuating the expression of certain target genes.
  • Zernicka-Goetz et al., International PCT Publication No. WO 01/36646 describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain dsRNA molecules.
  • Fire et al., International PCT Publication No. WO 99/32619 describe particular methods for introducing certain dsRNA molecules into cells for use in inhibiting gene expression.
  • Plaetinck et al., International PCT Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype in a cell using specific dsRNA molecules.
  • RNAi and gene-silencing systems have reported on various RNAi and gene-silencing systems. For example, Parrish et al., 2000 , Molecular Cell, 6, 1977-1087, describe specific chemically-modified siRNA constructs targeting the unc-22 gene of C. elegans . Grossniklaus, International PCT Publication No. WO 01/38551, describes certain methods for regulating polycomb gene expression in plants using certain dsRNAs. Churikov et al., International PCT Publication No. WO 01/42443, describe certain methods for modifying genetic characteristics of an organism using certain dsRNAs. Cogoni et al., International PCT Publication No. WO 01/53475, describe certain methods for isolating a Neurospora silencing gene and uses thereof.
  • Reed et al., International PCT Publication No. WO 01/68836 describe certain methods for gene silencing in plants.
  • Honer et al., International PCT Publication No. WO 01/70944 describe certain methods of drug screening using transgenic nematodes as Parkinson's Disease models using certain dsRNAs.
  • Deak et al., International PCT Publication No. WO 01/72774 describe certain Drosophila -derived gene products that may be related to RNAi in Drosophila .
  • Arndt et al., International PCT Publication No. WO 01/92513 describe certain methods for mediating gene suppression by using factors that enhance RNAi. Tuschl et al., International PCT Publication No.
  • WO 02/44321 describe certain synthetic siRNA constructs.
  • Pachuk et al., International PCT Publication No. WO 00/63364, and Satishchandran et al., International PCT Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain dsRNAs.
  • Echeverri et al., International PCT Publication No. WO 02/38805 describe certain C. elegans genes identified via RNAi.
  • Kreutzer et al. International PCT Publications Nos. WO 02/055692, WO 02/055693, and EP 1144623 B1 describes certain methods for inhibiting gene expression using RNAi.
  • This invention relates to compounds, compositions, and methods useful for modulating the expression of genes, such as those genes associated with angiogenesis and proliferation, using short interfering nucleic acid (siNA) molecules.
  • This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of platelet-derived endothelial cell growth factor (e.g., ECGF1) and/or platelet-derived endothelial cell growth factor receptor (e.g., ECGF1r) genes.
  • ECGF1 platelet-derived endothelial cell growth factor
  • ECGF1r platelet-derived endothelial cell growth factor receptor
  • the invention further relates to compounds, compositions, and methods useful for modulating the expression and activity of genes involved in ECGF1 and/or ECGF1r pathways of gene expression and/or ECGF1 activity by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules.
  • siNA short interfering nucleic acid
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (mRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of ECGF1 and/or ECGF1r genes.
  • siNA of the invention can be unmodified or chemically-modified.
  • a siNA of the instant invention can be chemically synthesized, expressed from a vector or enzymatically synthesized.
  • the instant invention also features various chemically-modified synthetic short interfering nucleic acid (siNA) molecules capable of modulating ECGF1 and/or ECGF1r gene expression or activity in cells by RNA interference (RNAi).
  • siNA synthetic short interfering nucleic acid
  • RNAi RNA interference
  • the use of chemically-modified siNA improves various properties of native siNA molecules through increased resistance to nuclease degradation in vivo and/or through improved cellular uptake. Further, contrary to earlier published studies, siNA having multiple chemical modifications retains its RNAi activity.
  • the siNA molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, diagnostic, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications.
  • the invention features one or more siNA molecules and methods that independently or in combination modulate the expression of gene(s) encoding proteins, such as platelet-derived endothelial cell growth factor (ECGF1) and/or platelet-derived endothelial cell growth factor receptors (e.g., ECGF1r), associated with the maintenance and/or development of cancer and other proliferative diseases, such as genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I, referred to herein generally as ECGF1 and/or ECGF1r.
  • ECGF1 and/or ECGF1r are examples of genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I, referred to herein generally as ECGF1 and/or ECGF1r.
  • ECGF1 and ECGF1r platelet-derived endothelial cell growth factor receptor genes
  • the invention is not meant to be limited to the referenced molecules.
  • the various aspects and embodiments of the invention are meant to include other related ECGF1 and/or ECGF1r genes, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors.
  • the various aspects and embodiments are also directed to other genes that are involved in ECGF1 and/or ECGF1r mediated pathways of signal transduction or gene expression that are involved in the progression, development, and/or maintenance of disease (e.g., cancer or macular degeneration).
  • Those additional genes can be analyzed for target sites using the methods described for ECGF1 and/or ECGF1r genes herein.
  • the inhibition and the effects of such inhibition of the other genes can be performed as described herein.
  • the invention features a siNA molecule that down-regulates expression of an ECGF1 gene, for example, wherein the ECGF1 gene comprises ECGF1 encoding sequence.
  • the invention features a siNA molecule that down-regulates expression of an ECGF1r gene, for example, wherein the ECGF1r gene comprises ECGF1r encoding sequence.
  • the invention features a siNA molecule having RNAi activity against ECGF1 and/or ECGF1r RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having ECGF1 and/or ECGF1r encoding sequence, such as those sequences having ECGF1 and/or ECGF1r GenBank Accession Nos. shown in Table I.
  • the invention features a siNA molecule having RNAi activity against ECGF1 and/or ECGF1r RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having other ECGF1 and/or ECGF1r encoding sequence, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors.
  • Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
  • the invention features a siNA molecule having RNAi activity against an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises nucleotide sequence complementary to nucleotide sequence of an ECGF1 and/or ECGF1r gene, such as those ECGF1 and/or ECGF1r sequences having GenBank Accession Nos. shown in Table I or other ECGF1 and/or ECGF1r encoding sequence, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors.
  • the siNA molecule comprises nucleotide sequence complementary to nucleotide sequence of an ECGF1 and/or ECGF1r gene, such as those ECGF1 and/or ECGF1r sequences having GenBank Accession Nos. shown in Table I or other ECGF1 and/or EC
  • a siNA molecule of the invention includes nucleotide sequence that can interact with nucleotide sequence of an ECGF1 and/or ECGF1r gene and thereby mediate silencing of ECGF1 and/or ECGF1r gene expression, for example, wherein the siNA mediates regulation of ECGF1 and/or ECGF1r gene expression by cellular processes that modulate the chromatin structure of the ECGF1 and/or ECGF1r gene and prevent transcription of the ECGF1 and/or ECGF1 r gene.
  • the invention features a siNA molecule comprising nucleotide sequence, for example, nucleotide sequence in the antisense region of the siNA molecule, that is complementary to a nucleotide sequence or portion of sequence of an ECGF1 and/or ECGF1r gene.
  • the invention features a siNA molecule comprising a region, for example, the antisense region of the siNA construct, complementary to a sequence or portion of sequence comprising an ECGF1 and/or ECGF1r gene sequence.
  • the antisense region of ECGF1 siNA constructs can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1-89 or 179-186. In one embodiment, the antisense region can also comprise sequence having any of SEQ ID NOs. 90-178, 187-190, 195-198, 203-206, 208, 210, 212, 215, 217, 219, 221, or 224. In another embodiment, the sense region of ECGF1 constructs can comprise sequence having any of SEQ ID NOs. 1-89, 179-186, 191-194, 199-202, 207, 209, 211, 213, 214, 216, 218, 220, 222, or 223.
  • a siNA molecule of the invention comprises any of SEQ ID NOs. 1-224.
  • the sequences shown in SEQ ID NOs: 1-224 are not limiting.
  • a siNA molecule of the invention can comprise any contiguous ECGF1 and/or ECGF1r sequence (e.g., about 19 to about 25, or about 19, 20, 21, 22, 23, 24 or 25 contiguous ECGF1 and/or ECGF1r nucleotides).
  • the invention features a siNA molecule comprising a sequence, for example, the antisense sequence of the siNA construct, complementary to a sequence or portion of sequence comprising sequence represented by GenBank Accession Nos. shown in Table I. Chemical modifications in Tables III and IV and described herein can be applied to any siRNA costruct of the invention.
  • a siNA molecule comprises an antisense strand having about 19 to about 29 nucleotides, wherein the antisense strand is complementary to a RNA sequence encoding an ECGF1 and/or ECGF1r protein, and wherein said siNA further comprises a sense strand having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences with at least about 19 complementary nucleotides.
  • a siNA molecule of the invention comprises an antisense region having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, wherein the antisense region is complementary to a RNA sequence encoding an ECGF1 and/or ECGF1r protein, and wherein said siNA further comprises a sense region having about 19 to about 29 nucleotides, wherein said sense region and said antisense region comprise a linear molecule with at least about 19 complementary nucleotides.
  • a siNA molecule comprises an antisense strand comprising a nucleotide sequence that is complementary to a nucleotide sequence encoding an ECGF1 and/or ECGF1r protein or a portion thereof.
  • the siNA further comprises a sense strand, wherein said sense strand comprises a nucleotide sequence of an ECGF1 and/ 0 r ECGF1r gene or a portion thereof.
  • a siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence encoding an ECGF1 and/or ECGF1r protein or a portion thereof.
  • the siNA molecule further comprises a sense region, wherein said sense region comprises a nucleotide sequence of an ECGF1 and/or ECGF1r gene or a portion thereof.
  • a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by an ECGF1 gene. Because ECGF1 genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of ECGF1 genes (and associated receptor or ligand genes) or alternately specific ECGF1 genes by selecting sequences that are either shared amongst different ECGF1 targets or alternatively that are unique for a specific ECGF1 target.
  • the siNA molecule can be designed to target conserved regions of ECGF1 RNA sequence having homology between several ECGF1 genes so as to target several ECGF1 genes (e.g., different ECGF1 isoforms, splice variants, mutant genes etc.) with one siNA molecule.
  • the siNA molecule can be designed to target a sequence that is unique to a specific ECGF1 RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
  • a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by an ECGF1r gene. Because ECGF1r genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of ECGF1r genes (and associated receptor or ligand genes) or alternately specific ECGF1r genes by selecting sequences that are either shared amongst different ECGF1r targets or alternatively that are unique for a specific ECGF1r target.
  • the siNA molecule can be designed to target conserved regions of ECGF1r RNA sequence having homology between several ECGF1r genes so as to target several ECGF1r genes (e.g., different ECGF1r isoforms, splice variants, mutant genes, etc.) with one siNA molecule.
  • the siNA molecule can be designed to target a sequence that is unique to a specific ECGF1r RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
  • nucleic acid molecules of the invention that act as mediators of the RNA interference gene silencing response are double-stranded nucleic acid molecules.
  • the siNA molecules of the invention consist of duplexes containing about 19 base pairs between oligonucleotides comprising about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24 or 25) nucleotides.
  • siNA molecules of the invention comprise duplexes with overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21-nucleotide duplexes with about 19 base pairs and 3′-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
  • about 1 to about 3 e.g., about 1, 2, or 3
  • nucleotides for example, about 21-nucleotide duplexes with about 19 base pairs and 3′-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
  • the invention features one or more chemically-modified siNA constructs having specificity for ECGF1 and/or ECGF1r expressing nucleic acid molecules, such as RNA encoding an ECGF1 and/or ECGF1r protein.
  • Non-limiting examples of such chemical modifications include without limitation phosphorothioate internucleotide linkages, 2′-deoxyribonucleotides, 2′-O-methyl ribonucleotides, 2′-deoxy-2′-fluoro ribonucleotides, “universal base” nucleotides, “acyclic” nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation.
  • These chemical modifications when used in various siNA constructs, are shown to preserve RNAi activity in cells while at the same time, dramatically increasing the serum stability of these compounds. Furthermore, contrary to the data published by Parrish et al., supra, applicant demonstrates that multiple (greater than one) phosphorothioate substitutions are well-tolerated and confer substantial increases in serum stability for modified siNA constructs.
  • a siNA molecule of the invention comprises modified nucleotides while maintaining the ability to mediate RNAi.
  • the modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, and/or bioavailability.
  • a siNA molecule of the invention can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule.
  • a siNA molecule of the invention can generally comprise about 5% to about 100% modified nucleotides (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% modified nucleotides).
  • the actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single stranded, the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense strand, antisense strand, or both the sense and antisense strands.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • a siNA molecule of the invention does not contain any ribonucleotides. In another embodiment, a siNA molecule of the invention comprises one or more ribonucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof, and wherein the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein each strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof, and wherein the siNA further comprises a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof.
  • siNA double-stranded short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the antisense region and the sense region each comprise about 19 to about 23 nucleotides, and wherein the antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the ECGF1 and/or ECGF1r gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
  • siNA double-stranded short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
  • the sense region can be connected to the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the ECGF1 and/or ECGF1r gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region, wherein the siNA molecule has one or more modified pyrimidine and/or purine nucleotides.
  • siNA short interfering nucleic acid
  • the pyrimidine nucleotides in the sense region are 2′-O-methyl pyrimidine nucleotides, or 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-deoxy purine nucleotides.
  • the pyrimidine nucleotides in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides.
  • any nucleotides present in a non-complementary region of the sense strand are 2′-deoxy nucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense region includes a terminal cap moiety at the 5′-end, the 3′-end, or both of the 5′ and 3′ ends of the fragment comprising the sense region.
  • the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety.
  • each of the two fragments of the siNA molecule comprises about 21 nucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the ECGF1 and/or ECGF1r gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein the purine nucleotides present in the antisense region comprise 2′-deoxy-purine nucleotides.
  • siNA short interfering nucleic acid
  • the purine nucleotides present in the antisense region comprise 2′-O-methyl purine nucleotides.
  • the antisense region comprises a phosphorothioate internucleotide linkage at the 3′ end of the antisense region.
  • the antisense region comprises a glyceryl modification at the 3′ end of the antisense region.
  • any nucleotides present in a non-complementary region of the antisense strand are 2′-deoxy nucleotides.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments each comprising 21 nucleotides, wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherein at least two 3′ terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
  • siNA short interfering nucleic acid
  • each of the two 3′ terminal nucleotides of each fragment of the siNA molecule is a 2′-deoxy-pyrimidine, such as 2′-deoxy-thymidine.
  • all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
  • about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the ECGF1 and/or ECGF1r gene.
  • 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the ECGF1 and/or ECGF1r gene.
  • the 5′-end of the fragment comprising said antisense region can optionally include a phosphate group.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of an ECGF1 and/or ECGF1r RNA sequence (e.g., wherein said target RNA sequence is encoded by an ECGF1 and/or ECGF1r gene), wherein the siNA molecule does not contain any ribonucleotides and wherein each strand of the double-stranded siNA molecule is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • the invention features a medicament comprising a siNA molecule of the invention.
  • the invention features an active ingredient comprising a siNA molecule of the invention.
  • the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • siNA short interfering nucleic acid
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the nucleotide sequence of the antisense strand of the double-stranded siNA molecule is complementary to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA which encodes a protein or a portion thereof.
  • each strand of the siNA molecule comprises about 19 to about 29 nucleotides, and each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • the siNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense strand of the siNA molecule and a second fragment comprises nucleotide sequence of the sense region of the siNA molecule.
  • the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • the pyrimidine nucleotides present in the sense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-deoxy purine nucleotides.
  • the pyrimidine nucleotides present in the sense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides.
  • the sense strand comprises a 3′-end and a 5′-end
  • a terminal cap moiety e.g., an inverted deoxy abasic moiety
  • the antisense strand comprises one or more 2′-deoxy-2′-fluoro pyrimidine nucleotides and one or more 2′-O-methyl purine nucleotides.
  • the pyrimidine nucleotides present in the antisense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and any purine nucleotides present in the antisense strand are 2′-O-methyl purine nucleotides.
  • the antisense strand comprises a phosphorothioate internucleotide linkage at the 3′ end of the antisense strand.
  • the antisense strand comprises a glyceryl modification at the 3′ end.
  • the 5′-end of the antisense strand optionally includes a phosphate group.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand is complementary to a nucleotide sequence of the 5′-untranslated region or a portion thereof of the ECGF1 and/or ECGF1r RNA.
  • the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein each of the two strands of the siNA molecule comprises 21 nucleotides.
  • siNA short interfering nucleic acid
  • each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and at least two 3′ terminal nucleotides of each strand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule.
  • each of the two 3′ terminal nucleotides of each fragment of the siNA molecule are 2′-deoxy-pyrimidines, such as 2′-deoxy-thymidine.
  • each strand of the siNA molecule is base-paired to the complementary nucleotides of the other strand of the siNA molecule.
  • nucleotides of the antisense strand are base-paired to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA or a portion thereof. In another embodiment, 21 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA or a portion thereof.
  • the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
  • the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • siNA short interfering nucleic acid
  • the introduction of chemically-modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously.
  • the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in serum.
  • certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule.
  • the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule.
  • chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
  • the antisense region of a siNA molecule of the invention can comprise a phosphorothioate internucleotide linkage at the 3′-end of said antisense region. In any of the embodiments of siNA molecules described herein, the antisense region can comprise about one to about five phosphorothioate internucleotide linkages at the 5′-end of said antisense region.
  • the 3′-terminal nucleotide overhangs of a siNA molecule of the invention can comprise ribonucleotides or deoxyribonucleotides that are chemically-modified at a nucleic acid sugar, base, or backbone.
  • the 3′-terminal nucleotide overhangs can comprise one or more universal base ribonucleotides.
  • the 3′-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
  • One embodiment of the invention provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention in a manner that allows expression of the nucleic acid molecule.
  • Another embodiment of the invention provides a mammalian cell comprising such an expression vector.
  • the mammalian cell can be a human cell.
  • the siNA molecule of the expression vector can comprise a sense region and an antisense region.
  • the antisense region can comprise sequence complementary to an RNA or DNA sequence encoding ECGF1 and/or ECGF1r and the sense region can comprise sequence complementary to the antisense region.
  • the siNA molecule can comprise two distinct strands having complementary sense and antisense regions.
  • the siNA molecule can comprise a single strand having complementary sense and antisense regions.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising a backbone modified internucleotide linkage having Formula I:
  • siNA short interfering nucleic acid
  • the chemically-modified internucleotide linkages having Formula I can be present in one or both oligonucleotide strands of the siNA duplex, for example, in the sense strand, the antisense strand, or both strands.
  • the siNA molecules of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified internucleotide linkages having Formula I at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified internucleotide linkages having Formula I at the 5′-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine nucleotides with chemically-modified internucleotide linkages having Formula I in the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine nucleotides with chemically-modified internucleotide linkages having Formula I in the sense strand, the antisense strand, or both strands.
  • a siNA molecule of the invention having internucleotide linkage(s) of Formula I also comprises a chemically-modified nucleotide or non-nucleotide having any of Formulae I-VII.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula II: wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-OH, O
  • the chemically-modified nucleotide or non-nucleotide of Formula II can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands.
  • the siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula II at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 5′-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 3′-end of the sense strand, the antisense strand, or both strands.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula III: wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-OH, O
  • the chemically-modified nucleotide or non-nucleotide of Formula III can be present in one or both oligonucleotide strands of the siNA duplex, for example, in the sense strand, the antisense strand, or both strands.
  • the siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula III at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide(s) or non-nucleotide(s) of Formula III at the 5′-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide or non-nucleotide of Formula III at the 3′-end of the sense strand, the antisense strand, or both strands.
  • a siNA molecule of the invention comprises a nucleotide having Formula II or III, wherein the nucleotide having Formula II or III is in an inverted configuration.
  • the nucleotide having Formula II or III is connected to the siNA construct in a 3′-3′,3′-2′,2′-3′, or 5′-5′ configuration, such as at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of one or both siNA strands.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a 5′-terminal phosphate group having Formula IV: wherein each X and Y is independently O, S, N, alkyl, substituted alkyl, or alkylhalo; wherein each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or alkylhalo; and wherein W, X, Y and Z are not all 0.
  • siNA short interfering nucleic acid
  • the invention features a siNA molecule having a 5′-terminal phosphate group having Formula IV on the target-complementary strand, for example, a strand complementary to a target RNA, wherein the siNA molecule comprises an all RNA siNA molecule.
  • the invention features a siNA molecule having a 5′-terminal phosphate group having Formula IV on the target-complementary strand wherein the siNA molecule also comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide 3′-terminal nucleotide overhangs having about 1 to about 4 (e.g., about 1, 2, 3, or 4) deoxyribonucleotides on the 3′-end of one or both strands.
  • a 5′-terminal phosphate group having Formula IV is present on the target-complementary strand of a siNA molecule of the invention, for example a siNA molecule having chemical modifications having any of Formulae I-VII.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more phosphorothioate internucleotide linkages.
  • siNA short interfering nucleic acid
  • the invention features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in one siNA strand.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in both siNA strands.
  • the phosphorothioate internucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands.
  • the siNA molecules of the invention can comprise one or more phosphorothioate internucleotide linkages at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate internucleotide linkages at the 5′-end of the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
  • an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
  • the invention features a siNA molecule, wherein the sense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9,
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • the invention features a siNA molecule, wherein the sense strand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • the invention features a siNA molecule, wherein the antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7,
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends, being present in the same or different strand.
  • the invention features a siNA molecule, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-
  • one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule having about 1 to about 5, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages in each strand of the siNA molecule.
  • siNA short interfering nucleic acid
  • the invention features a siNA molecule comprising 2′-5′ internucleotide linkages.
  • the 2′-5′ internucleotide linkage(s) can be at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of one or both siNA sequence strands.
  • the 2′-5′ internucleotide linkage(s) can be present at various other positions within one or both siNA sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a pyrimidine nucleotide in one or both strands of the siNA molecule can comprise a 2′-5′ internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a purine nucleotide in one or both strands of the siNA molecule can comprise a 2′-5′ internucleotide linkage.
  • a chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified, wherein each strand is about 18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27) nucleotides in length, wherein the duplex has about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the chemical modification comprises a structure having any of Formulae I-VII.
  • an exemplary chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein each strand consists of about 21 nucleotides, each having a 2-nucleotide 3′-terminal nucleotide overhang, and wherein the duplex has about 19 base pairs.
  • a siNA molecule of the invention comprises a single stranded hairpin structure, wherein the siNA is about 36 to about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification comprising a structure having any of Formulae I-VII or any combination thereof.
  • an exemplary chemically-modified siNA molecule of the invention comprises a linear oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the linear oligonucleotide forms a hairpin structure having about 19 base pairs and a 2-nucleotide 3′-terminal nucleotide overhang.
  • a linear hairpin siNA molecule of the invention contains a stem loop motif, wherein the loop portion of the siNA molecule is biodegradable.
  • a linear hairpin siNA molecule of the invention is designed such that degradation of the loop portion of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3′-terminal overhangs, such as 3′-terminal nucleotide overhangs comprising about 2 nucleotides.
  • a siNA molecule of the invention comprises a circular nucleic acid molecule, wherein the siNA is about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification, which comprises a structure having any of Formulae I-VII or any combination thereof.
  • an exemplary chemically-modified siNA molecule of the invention comprises a circular oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the circular oligonucleotide forms a dumbbell shaped structure having about 19 base pairs and 2 loops.
  • a circular siNA molecule of the invention contains two loop motifs, wherein one or both loop portions of the siNA molecule is biodegradable.
  • a circular siNA molecule of the invention is designed such that degradation of the loop portions of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3′-terminal overhangs, such as 3′-terminal nucleotide overhangs comprising about 2 nucleotides.
  • a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) abasic moiety, for example a compound having Formula V: wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid,
  • a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) inverted abasic moiety, for example a compound having Formula VI: wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoa
  • a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) substituted polyalkyl moieties, for example a compound having Formula VII: wherein each n is independently an integer from 1 to 12, each R1, R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl,
  • This modification is referred to herein as “glyceryl” (for example modification 6 in FIG. 10 ).
  • a moiety having any of Formula V, VI or VII of the invention is at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of a siNA molecule of the invention.
  • a moiety having Formula V, VI or VII can be present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense strand, the sense strand, or both antisense and sense strands of the siNA molecule.
  • a moiety having Formula VII can be present at the 3′-end or the 5′-end of a hairpin siNA molecule as described herein.
  • a siNA molecule of the invention comprises an abasic residue having Formula V or VI, wherein the abasic residue having Formula VI or VI is connected to the siNA construct in a 3′-3′, 3′-2′, 2′-3′, or 5′-5′ configuration, such as at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of one or both siNA strands.
  • a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acid (LNA) nucleotides, for example at the 5′-end, the 3′-end, both of the 5′ and 3′-ends, or any combination thereof, of the siNA molecule.
  • LNA locked nucleic acid
  • a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example at the 5′-end, the 3′-end, both of the 5′ and 3′-ends, or any combination thereof, of the siNA molecule.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternate
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternate
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy
  • the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O
  • the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are purine ribonucleotides (e.g., wherein all purine nucleotides are purine ribonucleotides or alternate
  • the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and for example where one or more purine nucleotides present in the sense region are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides
  • the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • any modified nucleotides present in the siNA molecules of the invention preferably in the antisense strand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense strands, comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides.
  • the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure , Springer-Verlag ed., 1984).
  • chemically modified nucleotides present in the siNA molecules of the invention preferably in the antisense strand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense strands, are resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • Non-limiting examples of nucleotides having a northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2′-O, 4′-C-methylene-(D-ribofuranosyl) nucleotides); 2′-methoxyethoxy (MOE) nucleotides; 2′-methyl-thio-ethyl, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy-2′-chloro nucleotides, 2′-azido nucleotides, and 2′-O-methyl nucleotides.
  • LNA locked nucleic acid
  • MOE 2′-methoxyethoxy
  • the invention features a chemically-modified short interfering nucleic acid molecule (siNA) capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a conjugate covalently attached to the chemically-modified siNA molecule.
  • the conjugate is covalently attached to the chemically-modified siNA molecule via a biodegradable linker.
  • the conjugate molecule is attached at the 3′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule.
  • the conjugate molecule is attached at the 5′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In yet another embodiment, the conjugate molecule is attached both the 3′-end and 5′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule, or any combination thereof.
  • a conjugate molecule of the invention comprises a molecule that facilitates delivery of a chemically-modified siNA molecule into a biological system, such as a cell.
  • the conjugate molecule attached to the chemically-modified siNA molecule is a polyethylene glycol, human serum albumin, or a ligand for a cellular receptor that can mediate cellular uptake.
  • Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified siNA molecules are described in Vargeese et al., U.S. Ser. No. 10/201,394, incorporated by reference herein.
  • the type of conjugates used and the extent of conjugation of siNA molecules of the invention can be evaluated for improved pharmacokinetic profiles, bioavailability, and/or stability of siNA constructs while at the same time maintaining the ability of the siNA to mediate RNAi activity.
  • one skilled in the art can screen siNA constructs that are modified with various conjugates to determine whether the siNA conjugate complex possesses improved properties while maintaining the ability to mediate RNAi, for example, in animal models as are generally known in the art.
  • the invention features a short interfering nucleic acid (siNA) molecule of the invention, wherein the siNA further comprises a nucleotide, non-nucleotide, or mixed nucleotide/non-nucleotide linker that joins the sense region of the siNA to the antisense region of the siNA.
  • a nucleotide linker of the invention can be a linker of ⁇ 2 nucleotides in length, for example 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.
  • the nucleotide linker can be a nucleic acid aptamer.
  • aptamer or “nucleic acid aptamer” as used herein is meant a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that comprises a sequence recognized by the target molecule in its natural setting.
  • an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid.
  • the target molecule can be any molecule of interest.
  • the aptamer can be used to bind to a ligand-binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein.
  • a non-nucleotide linker of the invention comprises abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e.g. polyethylene glycols such as those having between 2 and 100 ethylene glycol units).
  • polyethylene glycols such as those having between 2 and 100 ethylene glycol units.
  • Specific examples include those described by Seela and Kaiser, Nucleic Acids Res. 1990, 18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am. Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res.
  • non-nucleotide further means any group or compound that can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity.
  • the group or compound can be abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine, for example at the C1 position of the sugar.
  • the invention features a short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) inside a cell or reconstituted in vitro system, wherein one or both strands of the siNA molecule that are assembled from two separate oligonucleotides do not comprise any ribonucleotides.
  • a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA comprise separate oligonucleotides that do not have any ribonucleotides (e.g., nucleotides having a 2′-OH group) present in the oligonucleotides.
  • a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA are linked or circularized by a nucleotide or non-nucleotide linker as desrcibed herein, wherein the oligonucleotide does not have any ribonucleotides (e.g., nucleotides having a 2′-OH group) present in the oligonucleotide.
  • ribonucleotides e.g., nucleotides having a 2′-OH group
  • all positions within the siNA can include chemically modified nucleotides and/or non-nucleotides such as nucleotides and or non-nucleotides having Formula I, II, III, IV, V, VI, or VII or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence.
  • the single stranded siNA molecule of the invention comprises a 5′-terminal phosphate group.
  • the single stranded siNA molecule of the invention comprises a 5′-terminal phosphate group and a 3′-terminal phosphate group (e.g., a 2′,3′-cyclic phosphate).
  • the single stranded siNA molecule of the invention comprises about 19 to about 29 nucleotides.
  • the single stranded siNA molecule of the invention comprises one or more chemically modified nucleotides or non-nucleotides described herein.
  • all the positions within the siNA molecule can include chemically-modified nucleotides such as nucleotides having any of Formulae I-VII, or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl
  • the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • a terminal phosphate group such as a 5′-terminal phosphate group.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine
  • the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • a terminal phosphate group such as a 5′-terminal phosphate group.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucle
  • the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • a terminal phosphate group such as a 5′-terminal phosphate group.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are locked nucleic acid (LNA) nucleotides (e.g., wherein all purine nucleotides are LNA nucleotides
  • the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • a terminal phosphate group such as a 5′-terminal phosphate group.
  • a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-methoxyethyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-me
  • the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • a terminal phosphate group such as a 5′-terminal phosphate group.
  • any modified nucleotides present in the single stranded siNA molecules of the invention comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides.
  • the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure , Springer-Verlag ed., 1984).
  • chemically modified nucleotides present in the single stranded siNA molecules of the invention are preferably resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • siNA molecules of the invention are used as reagents in ex vivo applications.
  • siNA reagents are intoduced into tissue or cells that are transplanted into a subject for therapeutic effect.
  • the cells and/or tissue can be derived from an organism or subject that later receives the explant, or can be derived from another organism or subject prior to transplantation.
  • the siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are able to perform a function when transplanted in vivo.
  • certain target cells from a patient are extracted.
  • These extracted cells are contacted with siNAs targeting a specific nucleotide sequence within the cells under conditions suitable for uptake of the siNAs by these cells (e.g. using delivery reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the delivery of siNAs into cells).
  • delivery reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the delivery of siNAs into cells.
  • the cells are then reintroduced back into the same patient or other patients.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in that organism.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) contacting the siNA molecule with a cell in vitro or in vivo under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) contacting the siNA molecule with a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the tissue explant.
  • the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in that organism.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising contacting the organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising contacting the organism with one or more siNA molecules of the invention under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • the siNA molecules of the invention can be designed to down-regulate or inhibit target (ECGF1 and/or ECGF1r) gene expression through RNAi targeting of a variety of RNA molecules.
  • the siNA molecules of the invention are used to target various RNAs corresponding to a target gene.
  • Non-limiting examples of such RNAs include messenger RNA (mRNA), alternate RNA splice variants of target gene(s), post-transcriptionally modified RNA of target gene(s), pre-mRNA of target gene(s), and/or RNA templates. If alternate splicing produces a family of transcripts that are distinguished by usage of appropriate exons, the instant invention can be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish among the functions of gene family members.
  • a protein that contains an alternatively spliced transmembrane domain can be expressed in both membrane bound and secreted forms.
  • Use of the invention to target the exon containing the transmembrane domain can be used to determine the functional consequences of pharmaceutical targeting of membrane bound as opposed to the secreted form of the protein.
  • Non-limiting examples of applications of the invention relating to targeting these RNA molecules include therapeutic pharmaceutical applications, pharmaceutical discovery applications, molecular diagnostic and gene function applications, and gene mapping, for example using single nucleotide polymorphism mapping with siNA molecules of the invention.
  • Such applications can be implemented using known gene sequences or from partial sequences available from an expressed sequence tag (EST).
  • the siNA molecules of the invention are used to target conserved sequences corresponding to a gene family or gene families such as ECGF1 and/or ECGF1r family genes.
  • siNA molecules targeting multiple ECGF1 and/or ECGF1r targets can provide increased therapeutic effect.
  • siNA can be used to characterize pathways of gene function in a variety of applications.
  • the present invention can be used to inhibit the activity of target gene(s) in a pathway to determine the function of uncharacterized gene(s) in gene function analysis, mRNA function analysis, or translational analysis.
  • the invention can be used to determine potential target gene pathways involved in various diseases and conditions toward pharmaceutical development.
  • the invention can be used to understand pathways of gene expression involved in, for example, the progression and/or maintenance of cancer.
  • siNA molecule(s) and/or methods of the invention are used to down-regulate the expression of gene(s) that encode RNA referred to by Genbank Accession, for example ECGF1 and/or ECGF1r genes encoding RNA sequence(s) referred to herein by Genbank Accession number, for example, Genbank Accession Nos. shown in Table I.
  • the invention features a method comprising: (a) generating a library of siNA constructs having a predetermined complexity; and (b) assaying the siNA constructs of (a) above, under conditions suitable to determine RNAi target sites within the target RNA sequence.
  • the siNA molecules of (a) have strands of a fixed length, for example, about 23 nucleotides in length.
  • the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described herein.
  • the assay can comprise a cell culture system in which target RNA is expressed.
  • fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence.
  • the target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by cellular expression in in vivo systems.
  • the invention features a method comprising: (a) generating a randomized library of siNA constructs having a predetermined complexity, such as of 4 N , where N represents the number of base paired nucleotides in each of the siNA construct strands (eg. for a siNA construct having 21 nucleotide sense and antisense strands with 19 base pairs, the complexity would be 4 19 ); and (b) assaying the siNA constructs of (a) above, under conditions suitable to determine RNAi target sites within the target ECGF1 and/or ECGF1r RNA sequence.
  • the siNA molecules of (a) have strands of a fixed length, for example about 23 nucleotides in length.
  • the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described in Example 7 herein.
  • the assay can comprise a cell culture system in which target RNA is expressed.
  • fragments of ECGF1 and/or ECGF1r RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target ECGF1 and/or ECGF1r RNA sequence.
  • the target ECGF1 and/or ECGF1r RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by cellular expression in in vivo systems.
  • the invention features a method comprising: (a) determining the sequence of a RNA target encoded by a target gene; (b) synthesizing one or more sets of siNA molecules having sequence complementary to one or more regions of the RNA of (a); and (c) assaying the siNA molecules of (b) under conditions suitable to determine RNAi targets within the target RNA sequence.
  • the siNA molecules of (b) have strands of a fixed length, for example about 23 nucleotides in length.
  • the siNA molecules of (b) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length.
  • the assay can comprise a reconstituted in vitro siNA assay as described herein.
  • the assay can comprise a cell culture system in which target RNA is expressed. Fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence.
  • the target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by expression in in vivo systems.
  • target site is meant a sequence within a target RNA that is “targeted” for cleavage mediated by a siNA construct which contains sequences within its antisense region that are complementary to the target sequence.
  • detecttable level of cleavage is meant cleavage of target RNA (and formation of cleaved product RNAs) to an extent sufficient to discern cleavage products above the background of RNAs produced by random degradation of the target RNA. Production of cleavage products from 1-5% of the target RNA is sufficient to detect above the background for most methods of detection.
  • the invention features a composition comprising a siNA molecule of the invention, which can be chemically-modified, in a pharmaceutically acceptable carrier or diluent.
  • the invention features a pharmaceutical composition comprising siNA molecules of the invention, which can be chemically-modified, targeting one or more genes in a pharmaceutically acceptable carrier or diluent.
  • the invention features a method for diagnosing a disease or condition in a subject comprising administering to the subject a composition of the invention under conditions suitable for the diagnosis of the disease or condition in the subject.
  • the invention features a method for treating or preventing a disease or condition in a subject, comprising administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds.
  • the invention features a method for reducing or preventing tissue rejection in a subject comprising administering to the subject a composition of the invention under conditions suitable for the reduction or prevention of tissue rejection in the subject.
  • the invention features a method for validating an ECGF1 and/or ECGF1r gene target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of an ECGF1 and/or ECGF1r target gene; (b) introducing the siNA molecule into a cell, tissue, or organism under conditions suitable for modulating expression of the ECGF1 and/or ECGF1r target gene in the cell, tissue, or organism; and (c) determining the function of the gene by assaying for any phenotypic change in the cell, tissue, or organism.
  • the invention features a method for validating an ECGF1 and/or ECGF1r target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of an ECGF1 and/or ECGF1r target gene; (b) introducing the siNA molecule into a biological system under conditions suitable for modulating expression of the ECGF1 and/or ECGF1r target gene in the biological system; and (c) determining the function of the gene by assaying for any phenotypic change in the biological system.
  • biological system is meant, material, in a purified or unpurified form, from biological sources, including but not limited to human, animal, plant, insect, bacterial, viral or other sources, wherein the system comprises the components required for RNAi acitivity.
  • biological system includes, for example, a cell, tissue, or organism, or extract thereof.
  • biological system also includes reconstituted RNAi systems that can be used in an in vitro setting.
  • phenotypic change is meant any detectable change to a cell that occurs in response to contact or treatment with a nucleic acid molecule of the invention (e.g., siNA).
  • detectable changes include, but are not limited to, changes in shape, size, proliferation, motility, protein expression or RNA expression or other physical or chemical changes as can be assayed by methods known in the art.
  • the detectable change can also include expression of reporter genes/molecules such as Green Florescent Protein (GFP) or various tags that are used to identify an expressed protein or any other cellular component that can be assayed.
  • GFP Green Florescent Protein
  • the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of an ECGF1 and/or ECGF1r target gene in a biological system, including, for example, in a cell, tissue, or organism.
  • the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one ECGF1 and/or ECGF1r target gene in a biological system, including, for example, in a cell, tissue, or organism.
  • the invention features a cell containing one or more siNA molecules of the invention, which can be chemically-modified.
  • the cell containing a siNA molecule of the invention is a mammalian cell.
  • the cell containing a siNA molecule of the invention is a human cell.
  • the synthesis of a siNA molecule of the invention comprises: (a) synthesis of two complementary strands of the siNA molecule; (b) annealing the two complementary strands together under conditions suitable to obtain a double-stranded siNA molecule.
  • synthesis of the two complementary strands of the siNA molecule is by solid phase oligonucleotide synthesis.
  • synthesis of the two complementary strands of the siNA molecule is by solid phase tandem oligonucleotide synthesis.
  • the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing a first oligonucleotide sequence strand of the siNA molecule, wherein the first oligonucleotide sequence strand comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of the second oligonucleotide sequence strand of the siNA; (b) synthesizing the second oligonucleotide sequence strand of siNA on the scaffold of the first oligonucleotide sequence strand, wherein the second oligonucleotide sequence strand further comprises a chemical moiety than can be used to purify the siNA duplex; (c) cleaving the linker molecule of (a) under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex; and (d) purifying the siNA duplex utilizing the chemical moiety of the second
  • cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example, under hydrolysis conditions using an alkylamine base such as methylamine.
  • the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold.
  • CPG controlled pore glass
  • a cleavable linker such as a succinyl linker
  • the cleavable linker in (a) used as a scaffold for synthesizing the second strand can comprise similar reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place concomitantly.
  • the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group, which can be employed in a trityl-on synthesis strategy as described herein.
  • the chemical moiety, such as a dimethoxytrityl group is removed during purification, for example, using acidic conditions.
  • the method for siNA synthesis is a solution phase synthesis or hybrid phase synthesis wherein both strands of the siNA duplex are synthesized in tandem using a cleavable linker attached to the first sequence which acts a scaffold for synthesis of the second sequence. Cleavage of the linker under conditions suitable for hybridization of the separate siNA sequence strands results in formation of the double-stranded siNA molecule.
  • the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing one oligonucleotide sequence strand of the siNA molecule, wherein the sequence comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of another oligonucleotide sequence; (b) synthesizing a second oligonucleotide sequence having complementarity to the first sequence strand on the scaffold of (a), wherein the second sequence comprises the other strand of the double-stranded siNA molecule and wherein the second sequence further comprises a chemical moiety than can be used to isolate the attached oligonucleotide sequence; (c) purifying the product of (b) utilizing the chemical moiety of the second oligonucleotide sequence strand under conditions suitable for isolating the full-length sequence comprising both siNA oligonucleotide strands connected by the cleavable linker and under conditions suitable for
  • cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions. In another embodiment, cleavage of the linker molecule in (c) above takes place after deprotection of the oligonucleotide.
  • the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold.
  • CPG controlled pore glass
  • cleavable linker such as a succinyl linker
  • the cleavable linker in (a) used as a scaffold for synthesizing the second strand can comprise similar reactivity or differing reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place either concomitantly or sequentially.
  • the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group.
  • the invention features a method for making a double-stranded siNA molecule in a single synthetic process comprising: (a) synthesizing an oligonucleotide having a first and a second sequence, wherein the first sequence is complementary to the second sequence, and the first oligonucleotide sequence is linked to the second sequence via a cleavable linker, and wherein a terminal 5′-protecting group, for example, a 5′-O-dimethoxytrityl group (5′-O-DMT) remains on the oligonucleotide having the second sequence; (b) deprotecting the oligonucleotide whereby the deprotection results in the cleavage of the linker joining the two oligonucleotide sequences; and (c) purifying the product of (b) under conditions suitable for isolating the double-stranded siNA molecule, for example using a trityl-on synthesis strategy as described herein.
  • the method of synthesis of siNA molecules of the invention comprises the teachings of Scaringe et al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086, incorporated by reference herein in their entirety.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications, for example, one or more chemical modifications having any of Formulae I-VII or any combination thereof that increases the nuclease resistance of the siNA construct.
  • the invention features a method for generating siNA molecules with increased nuclease resistance comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased nuclease resistance.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the sense and antisense strands of the siNA construct.
  • the invention features a method for generating siNA molecules with increased binding affinity between the sense and antisense strands of the siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the sense and antisense strands of the siNA molecule.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target RNA sequence within a cell.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target DNA sequence within a cell.
  • the invention features a method for generating siNA molecules with increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence.
  • the invention features a method for generating siNA molecules with increased binding affinity between the antisense strand of the siNA molecule and a complementary target DNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target DNA sequence.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA construct.
  • the invention features a method for generating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to a chemically-modified siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA molecule.
  • the invention features chemically-modified siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r in a cell, wherein the chemical modifications do not significantly effect the interaction of siNA with a target RNA molecule, DNA molecule and/or proteins or other factors that are essential for RNAi in a manner that would decrease the efficacy of RNAi mediated by such siNA constructs.
  • the invention features a method for generating siNA molecules with improved RNAi activity against ECGF1 and/or ECGF1r comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity.
  • the invention features a method for generating siNA molecules with improved RNAi activity against an ECGF1 and/or ECGF1r target RNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target RNA.
  • the invention features a method for generating siNA molecules with improved RNAi activity against an ECGF1 and/or ECGF1r target DNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target DNA.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the cellular uptake of the siNA construct.
  • the invention features a method for generating siNA molecules against ECGF1 and/or ECGF1r with improved cellular uptake comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved cellular uptake.
  • the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that increases the bioavailability of the siNA construct, for example, by attaching polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct, or by attaching conjugates that target specific tissue types or cell types in vivo.
  • polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct
  • conjugates that target specific tissue types or cell types in vivo are described in Vargeese et al., U.S. Ser. No. 10/201,394 incorporated by reference herein.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing a conjugate into the structure of a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • Such conjugates can include ligands for cellular receptors, such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZIP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others.
  • ligands for cellular receptors such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZIP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing an excipient formulation to a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • excipients include polymers such as cyclodextrins, lipids, cationic lipids, polyamines, phospholipids, and others.
  • the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing nucleotides having any of Formulae I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • polyethylene glycol can be covalently attached to siNA compounds of the present invention.
  • the attached PEG can be any molecular weight, preferably from about 2,000 to about 50,000 daltons (Da).
  • the present invention can be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of RNA to test samples and/or subjects.
  • preferred components of the kit include a siNA molecule of the invention and a vehicle that promotes introduction of the siNA into cells of interest as described herein (e.g., using lipids and other methods of transfection known in the art, see for example Beigelman et al, U.S. Pat. No. 6,395,713).
  • the kit can be used for target validation, such as in determining gene function and/or activity, or in drug optimization, and in drug discovery (see for example Usman et al., U.S. Ser. No. 60/402,996).
  • Such a kit can also include instructions to allow a user of the kit to practice the invention.
  • short interfering nucleic acid refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression, for example by mediating RNA interference “RNAi” or gene silencing in a sequence-specific manner; see for example Bass, 2001 , Nature, 411, 428-429; Elbashir et al., 2001 , Nature, 411, 494-498; and Kreutzer et al., International PCT Publication No.
  • the siNA can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e.
  • each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 19 base pairs); the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s).
  • the siNA can be a polynucleotide with a hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof.
  • the siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi.
  • the siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5′-phosphate (see for example Martinez et al., 2002 , Cell., 110, 563-574 and Schwarz et al., 2002 , Molecular Cell, 10, 537-568), or 5′,3′-diphosphate.
  • a 5′-phosphate see for example Martinez et al., 2002 , Cell., 110, 563-574 and Schwarz et al., 2002 , Molecular Cell, 10, 537-568
  • the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic intercations, and/or stacking interactions.
  • the siNA molecules of the invention comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene.
  • the siNA molecule of the invention interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene.
  • siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides.
  • the short interfering nucleic acid molecules of the invention lack 2′-hydroxy (2′-OH) containing nucleotides.
  • Applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2′-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group).
  • siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups.
  • siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions.
  • modified short interfering nucleic acid molecules of the invention can also be referred to as short interfering modified oligonucleotides “siMON.”
  • siNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others.
  • siRNA short interfering RNA
  • dsRNA double-stranded RNA
  • miRNA micro-RNA
  • shRNA short hairpin RNA
  • ptgsRNA post-transcriptional gene silencing RNA
  • RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.
  • siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level.
  • epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002 , Science, 297, 1833-1837; Jenuwein, 2002 , Science, 297, 2215-2218; and Hall et al., 2002 , Science, 297, 2232-2237).
  • modulate is meant that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator.
  • modulate can mean “inhibit,” but the use of the word “modulate” is not limited to this definition.
  • inhibitor By “inhibit”, “down-regulate”, or “reduce”, it is meant that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention.
  • inhibition, down-regulation or reduction with an siNA molecule is below that level observed in the presence of an inactive or attenuated molecule.
  • inhibition, down-regulation, or reduction with siNA molecules is below that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches.
  • inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
  • RNA nucleic acid that encodes an RNA
  • the target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes of a pathogen, for example a virus, which is present in the cell after infection thereof.
  • the cell containing the target gene can be derived from or contained in any organism, for example a plant, animal, protozoan, virus, bacterium, or fungus.
  • Non-limiting examples of plants include monocots, dicots, or gymnosperms.
  • Non-limiting examples of animals include vertebrates or invertebrates.
  • fungi include molds or yeasts.
  • ECGF1 as used herein is meant, any platelet-derived endothelial cell growth factor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor activity, such as encoded by ECGF1 Genbank Accession Nos. shown in Table I.
  • the term ECGF1 also refers to nucleic acid sequences encloding any platelet-derived endothelial cell growth factor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor activity.
  • ECGF1 is also meant to include other ECGF1 encoding sequence, such as mutant ECGF1 genes, splice variants of ECGF1 genes, and other ECGF1 ligands.
  • ECGF1r as used herein is meant, any platelet-derived endothelial cell growth factor receptor protein, peptide, or polypeptide (including both membrane bound and/or soluble forms thereof) having platelet-derived endothelial cell growth factor receptor activity, such as encoded by an ECGF1r gene.
  • the term ECGF1r also refers to nucleic acid sequences encloding any platelet-derived endothelial cell growth factor receptor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor receptor activity.
  • ECGF1r is also meant to include other ECGF1r encoding sequence, such as mutant ECGF1r genes, splice variants of ECGF1r genes, and other ECGF1 receptors.
  • highly conserved sequence region is meant a nucleotide sequence of one or more regions in a target gene does not vary significantly from one generation to the other or from one biological system to the other.
  • sense region is meant a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule.
  • the sense region of a siNA molecule can comprise a nucleic acid sequence having homology with a target nucleic acid sequence.
  • antisense region is meant a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence.
  • the antisense region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
  • target nucleic acid is meant any nucleic acid sequence whose expression or activity is to be modulated.
  • the target nucleic acid can be DNA or RNA.
  • nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types.
  • the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al., 1987 , CSH Symp. Quant. Biol . LII pp. 123-133; Frier et al., 1986 , Proc. Nat. Acad. Sci .
  • a percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary).
  • Perfectly complementary means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • the siRNA molecules of the invention represent a novel therapeutic approach to treat a variety of pathologic indications or other conditions, such as tumor angiogenesis and cancer, including but not limited to breast cancer, lung cancer (including non-small cell lung carcinoma), prostate cancer, colorectal cancer, brain cancer, esophageal cancer, bladder cancer, pancreatic cancer, cervical cancer, head and neck cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma, gallbladder adeno carcinoma, parotid adenocarcinoma, ovarian cancer, melanoma, lymphoma, glioma, endometrial sarcoma, multidrug resistant cancers, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis, psoriasis, endometriosis, female reproduction, verruca vulgaris, angiofibroma of tuberous sclerosis, pot
  • each sequence of a siNA molecule of the invention is independently about 18 to about 24 nucleotides in length, in specific embodiments about 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.
  • the siNA duplexes of the invention independently comprise about 17 to about 23 base pairs (e.g., about 17, 18, 19, 20, 21, 22 or 23).
  • siNA molecules of the invention comprising hairpin or circular structures are about 35 to about 55 (e.g., about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to about 44 (e.g., 38, 39, 40, 41, 42, 43 or 44) nucleotides in length and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs.
  • Exemplary siNA molecules of the invention are shown in Table II.
  • Exemplary synthetic siNA molecules of the invention are shown in Tables III and IV and/or FIGS. 4-5 .
  • cell is used in its usual biological sense, and does not refer to an entire multicellular organism, e.g., specifically does not refer to a human.
  • the cell can be present in an organism, e.g., birds, plants and mammals such as humans, cows, sheep, apes, monkeys, swine, dogs, and cats.
  • the cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell).
  • the cell can be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing.
  • the cell can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
  • the siNA molecules of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues.
  • the nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their incorporation in biopolymers.
  • the nucleic acid molecules of the invention comprise sequences shown in Tables II-III and/or FIGS. 4-5 . Examples of such nucleic acid molecules consist essentially of sequences defined in these tables and figures.
  • the chemically modified constructs described in Table IV can be applied to any siNA sequence of the invention.
  • the invention provides mammalian cells containing one or more siNA molecules of this invention.
  • the one or more siNA molecules can independently be targeted to the same or different sites.
  • RNA is meant a molecule comprising at least one ribonucleotide residue.
  • ribonucleotide is meant a nucleotide with a hydroxyl group at the 2′ position of a ⁇ -D-ribo-furanose moiety.
  • the terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
  • Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA.
  • Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • subject is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. “Subject” also refers to an organism to which the nucleic acid molecules of the invention can be administered.
  • a subject can be a mammal or mammalian cells, including a human or human cells.
  • phosphorothioate refers to an internucleotide linkage having Formula I, wherein Z and/or W comprise a sulfur atom. Hence, the term phosphorothioate refers to both phosphorothioate and phosphorodithioate internucleotide linkages.
  • universal base refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them.
  • Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art (see for example Loakes, 2001 , Nucleic Acids Research, 29, 2437-2447).
  • acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (C1, C2, C3, C4, or C5), are independently or in combination absent from the nucleotide.
  • the nucleic acid molecules of the instant invention can be used to treat diseases or conditions discussed herein (e.g., cancers and othe proliferative conditions).
  • diseases or conditions discussed herein e.g., cancers and othe proliferative conditions.
  • the siNA molecules can be administered to a subject or can be administered to other appropriate cells evident to those skilled in the art, individually or in combination with one or more drugs under conditions suitable for the treatment.
  • the siNA molecules can be used in combination with other known treatments to treat conditions or diseases discussed above.
  • the described molecules could be used in combination with one or more known therapeutic agents to treat a disease or condition.
  • Non-limiting examples of other therapeutic agents that can be readily combined with a siNA molecule of the invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention, in a manner which allows expression of the siNA molecule.
  • the vector can contain sequence(s) encoding both strands of a siNA molecule comprising a duplex.
  • the vector can also contain sequence(s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule.
  • Non-limiting examples of such expression vectors are described in Paul et al., 2002 , Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002 , Nature Biotechnology, 19, 497; Lee et al., 2002 , Nature Biotechnology, 19, 500; and Novina et al., 2002 , Nature Medicine, advance online publication doi: 10.1038/nm725.
  • the invention features a mammalian cell, for example, a human cell, including an expression vector of the invention.
  • the expression vector of the invention comprises a sequence for a siNA molecule having complementarity to a RNA molecule referred to by a Genbank Accession numbers, for example Genbank Accession Nos. shown in Table I.
  • an expression vector of the invention comprises a nucleic acid sequence encoding two or more siNA molecules, which can be the same or different.
  • siNA molecules that interact with target RNA molecules and down-regulate gene encoding target RNA molecules are expressed from transcription units inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells.
  • viral vectors can be used that provide for transient expression of siNA molecules. Such vectors can be repeatedly administered as necessary.
  • siNA molecules bind and down-regulate gene function or expression via RNA interference (RNAi).
  • Delivery of siNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell.
  • vectors any nucleic acid- and/or viral-based technique used to deliver a desired nucleic acid.
  • FIG. 1 shows a non-limiting example of a scheme for the synthesis of siNA molecules.
  • the complementary siNA sequence strands, strand 1 and strand 2 are synthesized in tandem and are connected by a cleavable linkage, such as a nucleotide succinate or abasic succinate, which can be the same or different from the cleavable linker used for solid phase synthesis on a solid support.
  • the synthesis can be either solid phase or solution phase, in the example shown, the synthesis is a solid phase synthesis.
  • the synthesis is performed such that a protecting group, such as a dimethoxytrityl group, remains intact on the terminal nucleotide of the tandem oligonucleotide.
  • the two siNA strands spontaneously hybridize to form a siNA duplex, which allows the purification of the duplex by utilizing the properties of the terminal protecting group, for example by applying a trityl on purification method wherein only duplexes/oligonucleotides with the terminal protecting group are isolated.
  • FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA duplex synthesized by a method of the invention.
  • the two peaks shown correspond to the predicted mass of the separate siNA sequence strands. This result demonstrates that the siNA duplex generated from tandem synthesis can be purified as a single entity using a simple trityl-on purification methodology.
  • FIG. 3 shows a non-limiting proposed mechanistic representation of target RNA degradation involved in RNAi.
  • Double-stranded RNA dsRNA
  • RdRP RNA-dependent RNA polymerase
  • siNA duplexes RNA-dependent RNA polymerase
  • synthetic or expressed siNA can be introduced directly into a cell by appropriate means.
  • An active siNA complex forms which recognizes a target RNA, resulting in degradation of the target RNA by the RISC endonuclease complex or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and result in additional siNA molecules, thereby amplifying the RNAi response.
  • RdRP RNA-dependent RNA polymerase
  • FIG. 4A -F shows non-limiting examples of chemically-modified siNA constructs of the present invention.
  • N stands for any nucleotide (adenosine, guanosine, cytosine, uridine, or optionally thymidine, for example thymidine can be substituted in the overhanging regions designated by parenthesis (N N).
  • Various modifications are shown for the sense and antisense strands of the siNA constructs.
  • FIG. 4A The sense strand comprises 21 nucleotides wherein the two terminal 3′-nucleotides are optionally base paired and wherein all nucleotides present are ribonucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all nucleotides present are ribonucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4B The sense strand comprises 21 nucleotides wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the sense and antisense strand.
  • FIG. 4C The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-O-methyl or 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • the sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein and all purine nucleotides that may be present are 2′-deoxy nucleotides.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4E The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4F The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein all purine nucleotides that may be present are 2′-deoxy nucleotides.
  • the antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-deoxy nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein.
  • a modified internucleotide linkage such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • the antisense strand of constructs A-F comprise sequence complementary to any target nucleic acid sequence of the invention. Furthermore, when a glyceryl moiety (L) is present at the 3′-end of the antisense strand for any construct shown in FIG. 4A -F, the modified internucleotide linkage is optional.
  • FIG. 5A -F shows non-limiting examples of specific chemically-modified siNA sequences of the invention.
  • A-F applies the chemical modifications described in FIG. 4A -F to an ECGF1 siNA sequence.
  • Such chemical modifications can be applied to any sequence herein, such as any ECGF1 or ECGF1r sequence.
  • FIG. 6 shows non-limiting examples of different siNA constructs of the invention.
  • the examples shown (constructs 1, 2, and 3) have 19 representative base pairs; however, different embodiments of the invention include any number of base pairs described herein.
  • Bracketed regions represent nucleotide overhangs, for example comprising about 1, 2, 3, or 4 nucleotides in length, preferably about 2 nucleotides.
  • Constructs 1 and 2 can be used independently for RNAi activity.
  • Construct 2 can comprise a polynucleotide or non-nucleotide linker, which can optionally be designed as a biodegradable linker.
  • the loop structure shown in construct 2 can comprise a biodegradable linker that results in the formation of construct 1 in vivo and/or in vitro.
  • construct 3 can be used to generate construct 2 under the same principle wherein a linker is used to generate the active siNA construct 2 in vivo and/or in vitro, which can optionally utilize another biodegradable linker to generate the active siNA construct 1 in vivo and/or in vitro.
  • the stability and/or activity of the siNA constructs can be modulated based on the design of the siNA construct for use in vivo or in vitro and/or in vitro.
  • FIG. 7A -C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate siNA hairpin constructs.
  • FIG. 7A A DNA oligomer is synthesized with a 5′-restriction site (R1) sequence followed by a region having sequence identical (sense region of siNA) to a predetermined ECGF1 and/or ECGF1r target sequence, wherein the sense region comprises, for example, about 19, 20, 21, or 22 nucleotides (N) in length, which is followed by a loop sequence of defined sequence (X), comprising, for example, about 3 to about 10 nucleotides.
  • R1 5′-restriction site
  • X loop sequence of defined sequence
  • FIG. 7B The synthetic construct is then extended by DNA polymerase to generate a hairpin structure having self-complementary sequence that will result in a siNA transcript having specificity for an ECGF1 and/or ECGF1r target sequence and having self-complementary sense and antisense regions.
  • FIG. 7C The construct is heated (for example to about 95° C.) to linearize the sequence, thus allowing extension of a complementary second DNA strand using a primer to the 3′-restriction sequence of the first strand.
  • the double-stranded DNA is then inserted into an appropriate vector for expression in cells.
  • the construct can be designed such that a 3′-terminal nucleotide overhang results from the transcription, for example by engineering restriction sites and/or utilizing a poly-U termination region as described in Paul et al., 2002 , Nature Biotechnology, 29, 505-508.
  • FIG. 8A -C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate double-stranded siNA constructs.
  • FIG. 8A A DNA oligomer is synthesized with a 5′-restriction (R1) site sequence followed by a region having sequence identical (sense region of siNA) to a predetermined ECGF1 and/or ECGF1r target sequence, wherein the sense region comprises, for example, about 19, 20, 21, or 22 nucleotides (N) in length, and which is followed by a 3′-restriction site (R2) which is adjacent to a loop sequence of defined sequence (X).
  • R1 5′-restriction
  • SNA sense region of siNA
  • FIG. 8B The synthetic construct is then extended by DNA polymerase to generate a hairpin structure having self-complementary sequence.
  • FIG. 8C The construct is processed by restriction enzymes specific to R1 and R2 to generate a double-stranded DNA which is then inserted into an appropriate vector for expression in cells.
  • the transcription cassette is designed such that a U6 promoter region flanks each side of the dsDNA which generates the separate sense and antisense strands of the siNA.
  • Poly T termination sequences can be added to the constructs to generate U overhangs in the resulting transcript.
  • FIG. 9A -E is a diagrammatic representation of a method used to determine target sites for siNA mediated RNAi within a particular target nucleic acid sequence, such as messenger RNA.
  • FIG. 9A A pool of siNA oligonucleotides are synthesized wherein the antisense region of the siNA constructs has complementarity to target sites across the target nucleic acid sequence, and wherein the sense region comprises sequence complementary to the antisense region of the siNA.
  • FIGS. 9 B&C ( FIG. 9B ) The sequences are pooled and are inserted into vectors such that ( FIG. 9C ) transfection of a vector into cells results in the expression of the siNA.
  • FIG. 9D Cells are sorted based on phenotypic change that is associated with modulation of the target nucleic acid sequence.
  • FIG. 9E The siNA is isolated from the sorted cells and is sequenced to identify efficacious target sites within the target nucleic acid sequence.
  • FIG. 10 shows non-limiting examples of different stabilization chemistries (1-10) that can be used, for example, to stabilize the 3′-end of siNA sequences of the invention, including (1) [3-3′]-inverted deoxyribose; (2) deoxyribonucleotide; (3) [5′-3′]-3′-deoxyribonucleotide; (4) [5′-3′]-ribonucleotide; (5) [5′-3′]-3′-O-methyl ribonucleotide; (6) 3′-glyceryl; (7) [3′-5′]-3′-deoxyribonucleotide; (8) [3′-3′]-deoxyribonucleotide; (9) [5′-2′]-deoxyribonucleotide; and (10) [5-3′]-dideoxyribonucleotide.
  • stabilization chemistries (1-10) that can be used, for example, to stabilize the 3′-end of siNA sequences of the invention
  • modified and unmodified backbone chemistries indicated in the figure can be combined with different backbone modifications as described herein, for example, backbone modifications having Formula I.
  • the 2′-deoxy nucleotide shown 5′ to the terminal modifications shown can be another modified or unmodified nucleotide or non-nucleotide described herein, for example modifications having any of Formulae I-VII or any combination thereof.
  • FIG. 11 shows a non-limiting example of a strategy used to identify chemically modified siNA constructs of the invention that are nuclease resistance while preserving the ability to mediate RNAi activity.
  • Chemical modifications are introduced into the siNA construct based on educated design parameters (e.g. introducing 2′-mofications, base modifications, backbone modifications, terminal cap modifications etc).
  • the modified construct in tested in an appropriate system (e.g. human serum for nuclease resistance, shown, or an animal model for PK/delivery parameters).
  • the siNA construct is tested for RNAi activity, for example in a cell culture system such as a luciferase reporter assay).
  • siNA constructs are then identified which possess a particular characteristic while maintaining RNAi activity, and can be further modified and assayed once again. This same approach can be used to identify siNA-conjugate molecules with improved pharmacokinetic profiles, delivery, and RNAi activity.
  • RNA interference mediated by short interfering RNA discusses the proposed mechanism of RNA interference mediated by short interfering RNA as is presently known, and is not meant to be limiting and is not an admission of prior art. Applicant demonstrates herein that chemically-modified short interfering nucleic acids possess similar or improved capacity to mediate RNAi as do siRNA molecules and are expected to possess improved stability and activity in vivo; therefore, this discussion is not meant to be limited to siRNA only and can be applied to siNA as a whole.
  • RNAi activity is meant to include RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention.
  • the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siRNA or a siNA containing a plurality of ribonucleotides.
  • the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
  • RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998 , Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi.
  • the process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et al., 1999 , Trends Genet., 15, 358).
  • Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA.
  • dsRNAs double-stranded RNAs
  • the presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2′,5′-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • Dicer a ribonuclease III enzyme referred to as Dicer.
  • Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., 2001 , Nature, 409, 363).
  • Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes.
  • Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001 , Science, 293, 834).
  • the RNAi response also features an endonuclease complex containing a siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex (Elbashir et al., 2001 , Genes Dev., 15, 188).
  • RISC RNA-induced silencing complex
  • RNA interference can also involve small RNA (e.g., micro-RNA or mRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see for example Allshire, 2002 , Science, 297, 1818-1819; Volpe et al., 2002 , Science, 297, 1833-1837; Jenuwein, 2002 , Science, 297, 2215-2218; and Hall et al., 2002 , Science, 297, 2232-2237).
  • siNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post-transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al., 1998 , Nature, 391, 806, were the first to observe RNAi in C. elegans . Wianny and Goetz, 1999 , Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000 , Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001 , Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.
  • small nucleic acid motifs (“small” refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery.
  • the simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure.
  • Exemplary molecules of the instant invention are chemically synthesized, and others can similarly be synthesized.
  • Oligonucleotides are synthesized using protocols known in the art, for example as described in Caruthers et al., 1992 , Methods in Enzymology 211, 3-19, Thompson et al., International PCT Publication No. WO 99/54459, Wincott et al., 1995 , Nucleic Acids Res. 23, 2677-2684, Wincott et al., 1997 , Methods Mol. Bio., 74, 59, Brennan et al., 1998 , Biotechnol Bioeng., 61, 33-45, and Brennan, U.S.
  • oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end.
  • small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 ⁇ mol scale protocol with a 2.5 minute coupling step for 2′-O-methylated nucleotides and a 45 second coupling step for 2′-deoxy nucleotides or 2′-deoxy-2′-fluoro nucleotides.
  • Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle.
  • syntheses at the 0.2 ⁇ mol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle.
  • Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%.
  • synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM I 2 , 49 mM pyridine, 9% water in THF (PERSEPTIVETM). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide, 0.05 M in acetonitrile) is used.
  • Deprotection of the DNA-based oligonucleotides is performed as follows: the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aqueous methylamine (1 mL) at 65° C. for 10 minutes. After cooling to ⁇ 20° C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder.
  • RNA including certain siNA molecules of the invention follows the procedure as described in Usman et al., 1987 , J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990 , Nucleic Acids Res., 18, 5433; and Wincott et al., 1995 , Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997 , Methods Mol. Bio., 74, 59, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end.
  • common nucleic acid protecting and coupling groups such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end.
  • small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 ⁇ mol scale protocol with a 7.5 minute coupling step for alkylsilyl protected nucleotides and a 2.5 minute coupling step for 2′-O-methylated nucleotides.
  • Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle.
  • syntheses at the 0.2 ⁇ mol scale can be done on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle.
  • Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%.
  • synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); oxidation solution is 16.9 mM I 2 , 49 mM pyridine, 9% water in THF (PERSEPTIVETM). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide0.05 M in acetonitrile) is used.
  • RNA deprotection of the RNA is performed using either a two-pot or one-pot protocol.
  • the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65° C. for 10 minutes. After cooling to ⁇ 20° C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant.
  • the combined supernatants, containing the oligoribonucleotide, are dried to a white powder.
  • the base deprotected oligoribonucleotide is resuspended in anhydrous TEA/HF/NMP solution (300 ⁇ L of a solution of 1.5 mL N-methylpyrrolidinone, 750 ⁇ L TEA and 1 mL TEA•3HF to provide a 1.4 M HF concentration) and heated to 65° C. After 1.5 hours, the oligomer is quenched with 1.5 M NH 4 HCO 3 .
  • the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 33% ethanolic methylamine/DMSO: 1/1 (0.8 mL) at 65° C. for 15 minutes.
  • the vial is brought to room temperature.
  • TEA•3HF 0.1 mL is added and the vial is heated at 65° C. for 15 minutes.
  • the sample is cooled at ⁇ 20° C. and then quenched with 1.5 M NH 4 HCO 3 .
  • the quenched NH 4 HCO 3 solution is loaded onto a C-18 containing cartridge that had been prewashed with acetonitrile followed by 50 mM TEAA. After washing the loaded cartridge with water, the RNA is detritylated with 0.5% TFA for 13 minutes. The cartridge is then washed again with water, salt exchanged with 1 M NaCl and washed with water again. The oligonucleotide is then eluted with 30% acetonitrile.
  • the average stepwise coupling yields are typically >98% (Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684).
  • the scale of synthesis can be adapted to be larger or smaller than the example described above including but not limited to 96-well format.
  • nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992 , Science 256, 9923; Draper et al., International PCT publication No. WO 93/23569; Shabarova et al., 1991 , Nucleic Acids Research 19, 4247; Bellon et al., 1997 , Nucleosides & Nucleotides, 16, 951; Bellon et al., 1997 , Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
  • siNA molecules of the invention can also be synthesized via a tandem synthesis methodology as described in Example I herein, wherein both siNA strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siNA fragments or strands that hybridize and permit purification of the siNA duplex.
  • the linker can be a polynucleotide linker or a non-nucleotide linker.
  • the tandem synthesis of siNA as described herein can be readily adapted to both multiwell/multiplate synthesis platforms such as 96 well or similarly larger multi-well platforms.
  • the tandem synthesis of siNA as described herein can also be readily adapted to large scale synthesis platforms employing batch reactors, synthesis columns and the like.
  • a siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the RNA molecule.
  • nucleic acid molecules of the present invention can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-H (for a review see Usman and Cedergren, 1992 , TIBS 17, 34; Usman et al., 1994 , Nucleic Acids Symp. Ser. 31, 163).
  • siNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al., supra, the totality of which is hereby incorporated herein by reference) and re-suspended in water.
  • siNA molecules of the invention are expressed from transcription units inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells.
  • viral vectors can be used that provide for transient expression of siNA molecules.
  • nucleic acid molecules with modifications can prevent their degradation by serum ribonucleases, which can increase their potency (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al., 1991 , Science 253, 314; Usman and Cedergren, 1992 , Trends in Biochem. Sci. 17, 334; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, U.S. Pat. No.
  • oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-O-allyl, 2′-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992 , TIBS. 17, 34; Usman et al., 1994 , Nucleic Acids Symp. Ser.
  • Short interfering nucleic acid (siNA) molecules having chemical modifications that maintain or enhance activity are provided.
  • Such a nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Accordingly, the in vitro and/or in vivo activity should not be significantly lowered.
  • therapeutic nucleic acid molecules delivered exogenously should optimally be stable within cells until translation of the target RNA has been modulated long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Improvements in the chemical synthesis of RNA and DNA (Wincott et al., 1995 , Nucleic Acids Res.
  • nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides.
  • a G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998 , J. Am. Chem. Soc., 120, 8531-8532.
  • a single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides.
  • nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA “locked nucleic acid” nucleotides such as a 2′,4′-C methylene bicyclo nucleotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).
  • the invention features conjugates and/or complexes of siNA molecules of the invention.
  • conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell.
  • the conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention.
  • the present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, cholosterol, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example, proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes.
  • the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers.
  • Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
  • biodegradable linker refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule to a siNA molecule of the invention or the sense and antisense strands of a siNA molecule of the invention.
  • the biodegradable linker is designed such that its stability can be modulated for a particular purpose, such as delivery to a particular tissue or cell type.
  • the stability of a nucleic acid-based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically-modified nucleotides, such as 2′-O-methyl, 2′-fluoro, 2′-amino, 2′-O-amino, 2′-C-allyl, 2′-O-allyl, and other 2′-modified or base modified nucleotides.
  • the biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage.
  • the biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
  • biodegradable refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
  • biologically active molecule refers to compounds or molecules that are capable of eliciting or modifying a biological response in a system.
  • biologically active siNA molecules either alone or in combination with other molecules contemplated by the instant invention include therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof.
  • Biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and/or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers.
  • phospholipid refers to a hydrophobic molecule comprising at least one phosphorus group.
  • a phospholipid can comprise a phosphorus-containing group and saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.
  • nucleic acid molecules e.g., siNA molecules
  • delivered exogenously optimally are stable within cells until reverse transcription of the RNA has been modulated long enough to reduce the levels of the RNA transcript.
  • the nucleic acid molecules are resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules described in the instant invention and in the art have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability as described above.
  • siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided.
  • Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.
  • nucleic acid-based molecules of the invention will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent treatment with combinations of molecules, including different motifs and/or other chemical or biological molecules).
  • combination therapies e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent treatment with combinations of molecules, including different motifs and/or other chemical or biological molecules.
  • the treatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys, and aptamers.
  • ribozymes enzymatic nucleic acid molecules
  • allozymes antisense
  • 2,5-A oligoadenylate 2,5-A oligoadenylate
  • a siNA molecule of the invention comprises one or more 5′ and/or a 3′-cap structure, for example on only the sense siNA strand, the antisense siNA strand, or both siNA strands.
  • cap structure is meant chemical modifications, which have been incorporated at either terminus of the oligonucleotide (see, for example, Adamic et al., U.S. Pat. No. 5,998,203, incorporated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and can help in delivery and/or localization within a cell.
  • the cap can be present at the 5′-terminus (5′-cap) or at the 3′-terminal (3′-cap) or can be present on both termini.
  • Non-limiting examples of the 5′-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety); 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4′-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3′-3′-inverted nucleotide moiety; 3′-3′-inverted abasic moiety; 3′-2
  • Non-limiting examples of the 3′-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety), 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4′-thio nucleotide, carbocyclic nucleotide; 5′-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco
  • non-nucleotide any group or compound which can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity.
  • the group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the 1′-position.
  • alkyl refers to a saturated aliphatic hydrocarbon, including straight-chain, branched-chain, and cyclic alkyl groups.
  • the alkyl group has 1 to 12 carbons. More preferably, it is a lower alkyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • the alkyl group can be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ⁇ O, ⁇ S, NO 2 or N(CH 3 ) 2 , amino, or SH.
  • alkenyl groups that are unsaturated hydrocarbon groups containing at least one carbon-carbon double bond, including straight-chain, branched-chain, and cyclic groups.
  • the alkenyl group has 1 to 12 carbons. More preferably, it is a lower alkenyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • the alkenyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ⁇ O, ⁇ S, NO 2 , halogen, N(CH 3 ) 2 , amino, or SH.
  • alkyl also includes alkynyl groups that have an unsaturated hydrocarbon group containing at least one carbon-carbon triple bond, including straight-chain, branched-chain, and cyclic groups.
  • the alkynyl group has 1 to 12 carbons. More preferably, it is a lower alkynyl of from 1 to 7 carbons, more preferably 1 to 4 carbons.
  • the alkynyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ⁇ O, ⁇ S, NO 2 or N(CH 3 ) 2 , amino or SH.
  • alkyl groups can also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups.
  • An “aryl” group refers to an aromatic group that has at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which may be optionally substituted.
  • the preferred substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups.
  • alkylaryl refers to an alkyl group (as described above) covalently joined to an aryl group (as described above).
  • Carbocyclic aryl groups are groups wherein the ring atoms on the aromatic ring are all carbon atoms. The carbon atoms are optionally substituted.
  • Heterocyclic aryl groups are groups having from 1 to 3 heteroatoms as ring atoms in the aromatic ring and the remainder of the ring atoms are carbon atoms.
  • Suitable heteroatoms include oxygen, sulfur, and nitrogen, and include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted.
  • An “amide” refers to an —C(O)—NH—R, where R is either alkyl, aryl, alkylaryl or hydrogen.
  • An “ester” refers to an —C(O)—OR′, where R is either alkyl, aryl, alkylaryl or hydrogen.
  • nucleotide as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1′ position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see, for example, Usman and McSwiggen, supra; Eckstein et al., International PCT Publication No.
  • base modifications that can be introduced into nucleic acid molecules include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g.
  • modified bases in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1′ position or their equivalents.
  • the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
  • phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions.
  • abasic sugar moieties lacking a base or having other chemical groups in place of a base at the 1′ position, see for example Adamic et al., U.S. Pat. No. 5,998,203.
  • unmodified nucleoside is meant one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1′ carbon of ⁇ -D-ribo-furanose.
  • modified nucleoside is meant any nucleotide base which contains a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate.
  • modified nucleotides are shown by Formulae I-VII and/or other modifications described herein.
  • amino is meant 2′-NH 2 or 2′-O—NH 2 , which can be modified or unmodified.
  • modified groups are described, for example, in Eckstein et al., U.S. Pat. No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878, which are both incorporated by reference in their entireties.
  • nucleic acid siNA structure can be made to enhance the utility of these molecules. Such modifications will enhance shelf-life, half-life in vitro, stability, and ease of introduction of such oligonucleotides to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
  • a siNA molecule of the invention can be adapted for use to treat, for example, tumor angiogenesis and cancer, including but not limited to breast cancer, lung cancer (including non-small cell lung carcinoma), prostate cancer, colorectal cancer, brain cancer, esophageal cancer, bladder cancer, pancreatic cancer, cervical cancer, head and neck cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma, gallbladder adeno carcinoma, parotid adenocarcinoma, ovarian cancer, melanoma, lymphoma, glioma, endometrial sarcoma, multidrug resistant cancers, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis, psoriasis, endometriosis, female reproduction, verruca vulgaris, angiofibroma of tuberous sclerosis, pot-wine stains, Sturge
  • Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins (see for example Gonzalez et al., 1999 , Bioconjugate Chem., 10, 1068-1074), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example U.S.
  • nucleic acid/vehicle combination is locally delivered by direct injection or by use of an infusion pump.
  • Direct injection of the nucleic acid molecules of the invention, whether subcutaneous, intramuscular, or intradermal, can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al., 1999 , Clin.
  • the molecules of the instant invention can be used as pharmaceutical agents.
  • Pharmaceutical agents prevent, modulate the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.
  • the invention features a pharmaceutical composition
  • a pharmaceutical composition comprising one or more nucleic acid(s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like.
  • the polynucleotides of the invention can be administered (e.g., RNA, DNA or protein) and introduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition.
  • a liposome delivery mechanism standard protocols for formation of liposomes can be followed.
  • the compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
  • the present invention also includes pharmaceutically acceptable formulations of the compounds described.
  • formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
  • a pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
  • systemic administration in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body.
  • Administration routes that lead to systemic absorption include, without limitation: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular.
  • Each of these administration routes exposes the siNA molecules of the invention to an accessible diseased tissue.
  • the rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size.
  • the use of a liposome or other drug carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES).
  • RES reticular endothelial system
  • a liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drug to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cells producing excess ECGF1 and/or ECGF1r.
  • compositions or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity.
  • agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999 , Fundam. Clin.
  • biodegradable polymers such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, D F et al, 1999 , Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.); and loaded nanoparticles, such as those made of polybutylcyanoacrylate, which can deliver drugs across the blood brain barrier and can alter neuronal uptake mechanisms ( Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999).
  • Other non-limiting examples of delivery strategies for the nucleic acid molecules of the instant invention include material described in Boado et al., 1998 , J. Pharm.
  • the invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes).
  • PEG-modified, or long-circulating liposomes or stealth liposomes These formulations offer a method for increasing the accumulation of drugs in target tissues.
  • This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011).
  • liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995 , Biochim. Biophys. Acta, 1238, 86-90).
  • the long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International PCT Publication No.
  • WO 96/10391 Ansell et al., International PCT Publication No. WO 96/10390; Holland et al., International PCT Publication No. WO 96/10392).
  • Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
  • compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent.
  • Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences , Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein.
  • preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
  • antioxidants and suspending agents can be used.
  • a pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state.
  • the pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
  • nucleic acid molecules of the invention and formulations thereof can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles.
  • parenteral as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like.
  • a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier.
  • One or more nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients.
  • compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations.
  • Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets.
  • excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
  • the tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
  • a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
  • Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
  • an inert solid diluent for example, calcium carbonate, calcium phosphate or kaolin
  • water or an oil medium for example peanut oil, liquid paraffin or olive oil.
  • Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions.
  • excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate
  • the aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • preservatives for example ethyl, or n-propyl p-hydroxybenzoate
  • coloring agents for example ethyl, or n-propyl p-hydroxybenzoate
  • flavoring agents for example ethyl, or n-propyl p-hydroxybenzoate
  • sweetening agents such as sucrose or saccharin.
  • Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
  • the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol.
  • Sweetening agents and flavoring agents can be added to provide palatable oral preparations.
  • These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
  • a dispersing or wetting agent e.g., glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerin, glycerin, glycerin, glycerin, glycerin, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol, glycerol
  • compositions of the invention can also be in the form of oil-in-water emulsions.
  • the oily phase can be a vegetable oil or a mineral oil or mixtures of these.
  • Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
  • the emulsions can also contain sweetening and flavoring agents.
  • Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents.
  • the pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above.
  • the sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol.
  • Suitable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution.
  • sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono-or diglycerides.
  • fatty acids such as oleic acid find use in the preparation of injectables.
  • the nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drug.
  • suppositories e.g., for rectal administration of the drug.
  • These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug.
  • Such materials include cocoa butter and polyethylene glycols.
  • Nucleic acid molecules of the invention can be administered parenterally in a sterile medium.
  • the drug depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle.
  • adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
  • Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per subject per day).
  • the amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host treated and the particular mode of administration.
  • Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient.
  • the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
  • the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
  • nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect.
  • the use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
  • the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types.
  • ASGPr asialoglycoprotein receptor
  • ASOR asialoorosomucoid
  • the folate receptor is overexpressed in many cancer cells.
  • Binding of such glycoproteins, synthetic glycoconjugates, or folates to the receptor takes place with an affinity that strongly depends on the degree of branching of the oligosaccharide chain, for example, triatennary structures are bound with greater affinity than biatenarry or monoatennary chains (Baenziger and Fiete, 1980 , Cell, 22, 611-620; Connolly et al., 1982 , J. Biol. Chem., 257, 939-945).
  • the use of galactose, galactosamine, or folate based conjugates to transport exogenous compounds across cell membranes can provide a targeted delivery approach to, for example, the treatment of liver disease, cancers of the liver, or other cancers.
  • the use of bioconjugates can also provide a reduction in the required dose of therapeutic compounds required for treatment.
  • therapeutic bioavialability, pharmacodynamics, and pharmacokinetic parameters can be modulated through the use of nucleic acid bioconjugates of the invention.
  • Non-limiting examples of such bioconjugates are described in Vargeese et al, U.S. Ser. No. 10/201,394, filed Aug. 13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 60/362,016, filed Mar. 6, 2002.
  • siNA molecules of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, 1985 , Science, 229, 345; McGarry and Lindquist, 1986 , Proc. Natl. Acad. Sci ., USA 83, 399; Scanlon et al, 1991 , Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992 , Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992 , J. Virol., 66, 1432-41; Weerasinghe et al., 1991 , J.
  • eukaryotic promoters e.g., Izant and Weintraub, 1985 , Science, 229, 345; McGarry and Lindquist, 1986 , Proc. Natl. Acad. Sci ., USA 83, 399
  • nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., 1992 , Nucleic Acids Symp. Ser., 27, 15-6; Taira et al., 1991 , Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993 , Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994 , J. Biol. Chem., 269, 25856.
  • RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., 1996 , TIG., 12, 510) inserted into DNA or RNA vectors.
  • the recombinant vectors can be DNA plasmids or viral vectors.
  • siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus.
  • pol III based constructs are used to express nucleic acid molecules of the invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886).
  • the recombinant vectors capable of expressing the siNA molecules can be delivered as described above, and persist in target cells.
  • viral vectors can be used that provide for transient expression of nucleic acid molecules.
  • Such vectors can be repeatedly administered as necessary.
  • the siNA molecule interacts with the target mRNA and generates an RNAi response.
  • Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., 1996 , TIG., 12, 510).
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the instant invention.
  • the expression vector can encode one or both strands of a siNA duplex, or a single self-complementary strand that self hybridizes into a siNA duplex.
  • the nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al., 2002 , Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002 , Nature Biotechnology, 19, 497; Lee et al., 2002 , Nature Biotechnology, 19, 500; and Novina et al., 2002 , Nature Medicine , advance online publication doi: 10.1038/nm725).
  • the invention features an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a transcription termination region (e.g., eukaryotic pol I, II or III termination region); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the instant invention, wherein said sequence is operably linked to said initiation region and said termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • the vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5′ side or the 3′-side of the sequence encoding the siNA of the invention and/or an intron (intervening sequences).
  • ORF open reading frame
  • RNA polymerase I RNA polymerase I
  • RNA polymerase II RNA polymerase II
  • RNA polymerase III RNA polymerase III
  • Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby.
  • Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990 , Proc. Natl. Acad. Sci.
  • nucleic acid molecules expressed from such promoters can function in mammalian cells (e.g. Kashani-Sabet et al., 1992 , Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992 , Proc. Natl. Acad. Sci.
  • transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells (Thompson et al., supra; Couture and Stinchcomb, 1996, supra; Noonberg et al., 1994 , Nucleic Acid Res., 22, 2830; Noonberg et al., U.S. Pat. No. 5,624,803; Good et al., 1997 , Gene Ther., 4, 45; Beigelman et al., International PCT Publication No. WO 96/18736.
  • siNA transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Couture and Stinchcomb, 1996, supra).
  • plasmid DNA vectors such as adenovirus or adeno-associated virus vectors
  • viral RNA vectors such as retroviral or alphavirus vectors
  • the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the siNA molecules of the invention in a manner that allows expression of that siNA molecule.
  • the expression vector comprises in one embodiment; a) a transcription initiation region; b) a transcription termination region; and c) a nucleic acid sequence encoding at least one strand of the siNA molecule, wherein the sequence is operably linked to the initiation region and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an open reading frame; and d) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3′-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the open reading frame and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; and d) a nucleic acid sequence encoding at least one siNA molecule, wherein the sequence is operably linked to the initiation region, the intron and the termination region in a manner which allows expression and/or delivery of the nucleic acid molecule.
  • the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; d) an open reading frame; and e) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3′-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the intron, the open reading frame and the termination region in a manner which allows expression and/or delivery of the siNA molecule.
  • Platelet-derived endothelial cell growth factor (ECGF1), Copyright ⁇ 2002 R&D Systems.
  • PD-ECGF Platelet-derived endothelial cell growth factor
  • placental derived growth factor was originally isolated from platelets based on its ability to induce mitosis in endothelial cells. Following the production of antibodies against this factor, the placenta was also found to produce PD-ECGF. Given the relative abundance of this particular tissue, the placenta was subsequently used both to produce large amounts of purified protein and to construct a cDNA library for the PD-ECGF clone.
  • PD-ECGF growth factor activities are attributed to secondary effects related to its identity with thymidine phosphorylase.
  • PD-ECGF has also been investigated as an inhibitor of glial cell proliferation. Originally named gliostatin, it was found to act on glial cell tumors and astroblasts but not neuronal cells.
  • gliostatin it was found to act on glial cell tumors and astroblasts but not neuronal cells.
  • PD-ECGF was originally purified as a polypeptide with an apparent mass of about 45 kDa. On SDS-PAGE, the purified protein appears as a doublet, and it is now accepted that it occurs naturally as a non-disulfide liked homodimer.
  • PD-ECGF is heat and acid labile, has a pI of 4.6, does not bind to heparin and does not appear to be glycosylated.
  • the cloned cDNA for PD-ECGF predicts an amino acid (aa) sequence of 482 aa, which gives a calculated molecular weight of 49 kDa, a value consistent with a nonglycosylated molecule.
  • the predicted aa sequence contains no leader peptide and most of the protein remains localized within the producer cell. This suggests the protein utilizes a non-classical protein secretion pathway, or that it is simply released following cell death.
  • N-terminal sequence studies using purified protein indicates that PD-ECGF from placenta begins with aa residue #6 (threonine), while that from platelets begins with aa residue #11 (alanine). It is unclear whether this difference results from physiological processing or from proteolysis during purification. The mitogenic activity however remains the same for each of the N-terminally-modified proteins.
  • PD-ECGF contains two nucleotide-binding sequence motifs (-G-X-G-X-X-G-) and a consensus sequence for a protein kinase C phosphorylation site (-S/T-X-K/R-).
  • PD-ECGF When PD-ECGF is expressed in cells incubated with labeled nucleotides, it is found to contain a nucleotide covalently bound to a serine. The significance of this nucleotidylation is unkown, though it may be related to the nucleoside- and phosphate-binding aspects of PD-ECGF/thymidine phosphorylase.
  • TP activity in PD-ECGF found that PD-ECGF indeed possessed thymidine phosphorylase activity, an activity that occurs when PD-ECGF serves as a catalyst in the inter-conversion of thymidine (plus orthophosphate) to the nucleic acid thymine plus 2-deoxy-d-ribose 1-phosphate.
  • hPD-ECGF human PD-ECGF
  • hTP human TP
  • PD-ECGF in vitro, PD-ECGF will not stimulate endothelial cell mitosis, but will promote endothelial cell thymidine uptake from culture media.
  • PD-ECGF/TP is not a classic growth factor acting through a receptor/signal transduction cascade, but instead represents an enzyme whose enzymatic byproducts have a biological action. This has raised questions about the use of tritiated thymidine uptake as a measure of cell proliferation (mitosis) in the absence of an actual cell count.
  • Cells known to express PD- ECGF include fibroblasts, peripheral blood lymphocytes, macrophages, platelets, vascular smooth muscle, type B synovial cells, decidual cells, sensory and autonomic neurons, and numerous primary tumor and tumor cell lines. Additionally, human PD-ECGF has marked activity in all cross-species studies reported.
  • PD-ECGF has been shown to play a role in the uptake of labeled thymidine by endothelial cells. This activity is seen in human, porcine, and murine endothelial cells derived from umbilical vein, aorta and capillaries. Although this activity tends to be most pronounced for endothelial cells, some activity for other cells, including epithelial cells, kidney cells and choriocarcinoma cells has also been reported. PD-ECGF has also been reported to be a chemotactic agent for aortic endothelial cells, monocytes and neutrophils.
  • chemotactic activity appears to be mediated by PD-ECGF enzymatic degradation products, which are subsequently converted to a chemotactically/angiogenically active 2-deoxy-ribose molecule.
  • TP/PD-ECGF The expression of TP/PD-ECGF by various cell types has been correlated with increased vascularization.
  • TP is increased in mesenchymal (embryonic connective tissue)-like stromal cells. This is rapidly followed by an ingrowth of blood vessels, an event necessary to a successful pregnancy.
  • mesenchymal epidermal growth factor
  • vascularization In a study of ovarian carcinomas, increased blood flow (vascularization) was also correlated with TP/PD-ECGF expression, reinforcing the conclusion that tumor-derived TP may contribute to an increased vascularization necessary for some tumor types. Finally, elevated levels of gliostatin/PD-ECGF have also been found in the serum and synovial fluid of rheumatoid arthritis (RA) patients, suggesting that this factor might play a role in the aberrant neovascularization of the synovium associated with RA.
  • RA rheumatoid arthritis
  • small interfering nucleic acid molecules targeting ECGF1 and corresponding receptors and ligands therefore provides a class of novel therapeutic agents that can be used in the diagnosis of and the treatment of cancer, proliferative diseases, ocular conditions or any other disease or condition that responds to modulation of ECGF1 and/or ECGF1r genes.
  • siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl-based linker. Tandem synthesis as described herein is followed by a one-step purification process that provides RNAi molecules in high yield. This approach is highly amenable to siNA synthesis in support of high throughput RNAi screening, and can be readily adapted to multi-column or multi-well synthesis platforms.
  • a cleavable linker for example, a succinyl-based linker.
  • the oligonucleotides are deprotected as described above. Following deprotection, the siNA sequence strands are allowed to spontaneously hybridize. This hybridization yields a duplex in which one strand has retained the 5′-O-DMT group while the complementary strand comprises a terminal 5′-hydroxyl. The newly formed duplex behaves as a single molecule during routine solid-phase extraction purification (Trityl-On purification) even though only one molecule has a dimethoxytrityl group.
  • this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is required to purify the pair of oligos, for example, by using a C18 cartridge.
  • Standard phosphoramidite synthesis chemistry is used up to the point of introducing a tandem linker, such as an inverted deoxy abasic succinate or glyceryl succinate linker (see FIG. 1 ) or an equivalent cleavable linker.
  • linker coupling conditions includes a hindered base such as diisopropylethylamine (DIPA) and/or DMAP in the presence of an activator reagent such as Bromotripyrrolidinophosphoniumhexaflurorophosphate (PyBrOP).
  • DIPA diisopropylethylamine
  • PyBrOP Bromotripyrrolidinophosphoniumhexaflurorophosphate
  • standard synthesis chemistry is utilized to complete synthesis of the second sequence leaving the terminal the 5′-O-DMT intact.
  • the resulting oligonucleotide is deprotected according to the procedures described herein and quenched with a suitable buffer, for example with 50 m
  • siNA duplex Purification of the siNA duplex can be readily accomplished using solid phase extraction, for example using a Waters C18 SepPak 1 g cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV H2O, and 2 CV 50 mM NaOAc. The sample is loaded and then washed with 1 CV H2O or 50 mM NaOAc. Failure sequences are eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 5 mM NaCl).
  • CV column volume
  • the column is then washed, for example with 1 CV H2O followed by on-column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the column, then adding a second CV of 1% aqueous TFA to the column and allowing to stand for approximately 10 minutes.
  • TFA trifluoroacetic acid
  • the remaining TFA solution is removed and the column washed with H2O followed by 1 CV 1M NaCl and additional H2O.
  • the siNA duplex product is then eluted, for example, using 1 CV 20% aqueous CAN.
  • FIG. 2 provides an example of MALDI-TOF mass spectrometry analysis of a purified siNA construct in which each peak corresponds to the calculated mass of an individual siNA strand of the siNA duplex.
  • the same purified siNA provides three peaks when analyzed by capillary gel electrophoresis (CGE), one peak presumably corresponding to the duplex siNA, and two peaks presumably corresponding to the separate siNA sequence strands. Ion exchange HPLC analysis of the same siNA contract only shows a single peak.
  • Testing of the purified siNA construct using a luciferase reporter assay described below demonstrated the same RNAi activity compared to siNA constructs generated from separately synthesized oligonucleotide sequence strands.
  • RNA target of interest such as a viral or human mRNA transcript
  • sequence of a gene or RNA gene transcript derived from a database is used to generate siNA targets having complementarity to the target.
  • a database such as Genbank
  • siNA targets having complementarity to the target.
  • Such sequences can be obtained from a database, or can be determined experimentally as known in the art.
  • Target sites that are known, for example, those target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siNA molecules targeting those sites.
  • RNA transcripts can be chosen to screen siNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models. In a non-limiting example, anywhere from 1 to 1000 target sites are chosen within the transcript based on the size of the siNA construct to be used.
  • High throughput screening assays can be developed for screening siNA molecules using methods known in the art, such as with multi-well or multi-plate assays to determine efficient reduction in target gene expression.
  • the following non-limiting steps can be used to carry out the selection of siNAs targeting a given gene sequence or transcript.
  • a pool of siNA constructs specific to an ECGF1 and/or ECGF1r target sequence is used to screen for target sites in cells expressing ECGF1 and/or ECGF1r RNA, such as HUVEC, HMVEC, or A375 cells.
  • the general strategy used in this approach is shown in FIG. 9 .
  • a non-limiting example of such is a pool comprising sequences having any of SEQ ID NOS 1-224.
  • Cells expressing ECGF1 and/or ECGF1r e.g., HUVEC, HMVEC, or A375 cells
  • are transfected with the pool of siNA constructs and cells that demonstrate a phenotype associated with ECGF1 and/or ECGF1r inhibition are sorted.
  • the pool of siNA constructs can be expressed from transcription cassettes inserted into appropriate vectors (see for example FIG. 7 and FIG. 8 ).
  • the siNA from cells demonstrating a positive phenotypic change e.g., decreased proliferation, decreased ECGF1 and/or ECGF1r mRNA levels or decreased ECGF1 and/or ECGF1r protein expression, are sequenced to determine the most suitable target site(s) within the target ECGF1 and/or ECGF1r RNA sequence.
  • siNA target sites were chosen by analyzing sequences of the ECGF1 and/or ECGF1r RNA target and optionally prioritizing the target sites on the basis of folding (structure of any given sequence analyzed to determine siNA accessibility to the target), by using a library of siNA molecules as described in Example 3, or alternately by using an in vitro siNA system as described in Example 6 herein.
  • siNA molecules were designed that could bind each target and are optionally individually analyzed by computer folding to assess whether the siNA molecule can interact with the target sequence. Varying the length of the siNA molecules can be chosen to optimize activity.
  • siNA molecules can be designed to target sites within any known RNA sequence, for example those RNA sequences corresponding to the any gene transcript.
  • Chemically modified siNA constructs are designed to provide nuclease stability for systemic administration in vivo and/or improved pharmacokinetic, localization, and delivery properties while preserving the ability to mediate RNAi activity. Chemical modifications as described herein are introduced synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then assayed for nuclease stability in serum and/or cellular/tissue extracts (e.g. liver extracts). The synthetic siNA constructs are also tested in parallel for RNAi activity using an appropriate assay, such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity.
  • an appropriate assay such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity.
  • Synthetic siNA constructs that possess both nuclease stability and RNAi activity can be further modified and re-evaluated in stability and activity assays.
  • the chemical modifications of the stabilized active siNA constructs can then be applied to any siNA sequence targeting any chosen RNA and used, for example, in target screening assays to pick lead siNA compounds for therapeutic development (see for example FIG. 11 ).
  • siNA molecules can be designed to interact with various sites in the RNA message, for example, target sequences within the RNA sequences described herein.
  • the sequence of one strand of the siNA molecule(s) is complementary to the target site sequences described above.
  • the siNA molecules can be chemically synthesized using methods described herein.
  • Inactive siNA molecules that are used as control sequences can be synthesized by scrambling the sequence of the siNA molecules such that it is not complementary to the target sequence.
  • siNA constructs can by synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al., U.S. Pat. Nos.
  • RNA oligonucleotides are synthesized in a stepwise fashion using the phosphoramidite chemistry as is known in the art.
  • Standard phosphoramidite chemistry involves the use of nucleosides comprising any of 5′-O-dimethoxytrityl, 2′-O-tert-butyldimethylsilyl, 3′-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2-isobutyryl guanosine).
  • exocyclic amine protecting groups e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2-isobutyryl guanosine.
  • 2′-O-Silyl Ethers can be used in conjunction with acid-labile 2′-O-orthoester protecting groups in the synthesis of RNA as described by Scaringe supra.
  • Differing 2′ chemistries can require different protecting groups, for example 2′-deoxy-2′-amino nucleosides can utilize N-phthaloyl protection as described by Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference herein in its entirety).
  • each nucleotide is added sequentially (3′- to 5′-direction) to the solid support-bound oligonucleotide.
  • the first nucleoside at the 3′-end of the chain is covalently attached to a solid support (e.g., controlled pore glass or polystyrene) using various linkers.
  • the nucleotide precursor, a ribonucleoside phosphoramidite, and activator are combined resulting in the coupling of the second nucleoside phosphoramidite onto the 5′-end of the first nucleoside.
  • the support is then washed and any unreacted 5′-hydroxyl groups are capped with a capping reagent such as acetic anhydride to yield inactive 5′-acetyl moieties.
  • a capping reagent such as acetic anhydride to yield inactive 5′-acetyl moieties.
  • the trivalent phosphorus linkage is then oxidized to a more stable phosphate linkage.
  • the 5′-O-protecting group is cleaved under suitable conditions (e.g., acidic conditions for trityl-based groups and Fluoride for silyl-based groups). The cycle is repeated for each subsequent nucleotide.
  • Modification of synthesis conditions can be used to optimize coupling efficiency, for example by using differing coupling times, differing reagent/phosphoramidite concentrations, differing contact times, differing solid supports and solid support linker chemistries depending on the particular chemical composition of the siNA to be synthesized.
  • Deprotection and purification of the siNA can be performed as is generally described in Deprotection and purification of the siNA can be performed as is generally described in Usman et al., U.S. Pat. No. 5,831,071, U.S. Pat. No. 6,353,098, U.S. Pat. No. 6,437,117, and Bellon et al., U.S. Pat. No. 6,054,576, U.S. Pat. No.
  • oligonucleotides comprising 2′-deoxy-2′-fluoro nucleotides can degrade under inappropriate deprotection conditions.
  • Such oligonucleotides are deprotected using aqueous methylamine at about 35° C. for 30 minutes.
  • the 2′-deoxy-2′-fluoro containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35° C. for 30 minutes, TEA-HF is added and the reaction maintained at about 65° C. for an additional 15 minutes.
  • RNAi activity in vitro is used to evaluate siNA constructs targeting ECGF1 and/or ECGF1r RNA targets.
  • the assay comprises the system described by Tuschl et al., 1999 , Genes and Development, 13, 3191-3197 and Zamore et al., 2000 , Cell, 101, 25-33 adapted for use with ECGF1 and/or ECGF1r target RNA.
  • a Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro.
  • Target RNA is generated via in vitro transcription from an appropriate ECGF1 and/or ECGF1r expressing plasmid using T7 RNA polymerase or via chemical synthesis as described herein.
  • Sense and antisense siNA strands (for example 20 uM each) are annealed by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at 90° C. followed by 1 hour at 37° C., then diluted in lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate).
  • buffer such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate
  • Annealing can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide.
  • the Drosophila lysate is prepared using zero to two-hour-old embryos from Oregon R flies collected on yeasted molasses agar that are dechorionated and lysed. The lysate is centrifuged and the supernatant isolated.
  • the assay comprises a reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM final concentration), and 10% [vol/vol] lysis buffer containing siNA (10 nM final concentration).
  • the reaction mixture also contains 10 mM creatine phosphate, 10 ug.ml creatine phosphokinase, 100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid.
  • the final concentration of potassium acetate is adjusted to 100 mM.
  • the reactions are pre-assembled on ice and preincubated at 25° C. for 10 minutes before adding RNA, then incubated at 25° C. for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25 ⁇ Passive Lysis Buffer (Promega).
  • Target RNA cleavage is assayed by RT-PCR analysis or other methods known in the art and are compared to control reactions in which siNA is omitted from the reaction.
  • target RNA for the assay is prepared by in vitro transcription in the presence of [alpha- 32 p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification.
  • target RNA is 5′- 32 P-end labeled using T4 polynucleotide kinase enzyme. Assays are performed as described above and target RNA and the specific RNA cleavage products generated by RNAi are visualized on an autoradiograph of a gel. The percentage of cleavage is determined by Phosphor Imager® quantitation of bands representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay.
  • this assay is used to determine target sites the ECGF1 and/or ECGF1r RNA target for siNA mediated RNAi cleavage, wherein a plurality of siNA constructs are screened for RNAi mediated cleavage of the ECGF1 and/or ECGF1r RNA target, for example, by analyzing the assay reaction by electrophoresis of labeled target RNA, or by northern blotting, as well as by other methodology well known in the art.
  • siNA molecules targeted to the human ECGF1 and/or ECGF1r RNA are designed and synthesized as described above. These nucleic acid molecules can be tested for cleavage activity in vivo, for example, using the following procedure.
  • the target sequences and the nucleotide location within the ECGF1 RNA are given in Table II and III.
  • siNAs targeting ECGF1 and/or ECGF1r Two formats are used to test the efficacy of siNAs targeting ECGF1 and/or ECGF1r.
  • the reagents are tested in cell culture using, for example, HUVEC, HMVEC, or A375 cells to determine the extent of RNA and protein inhibition.
  • siNA reagents e.g.; see for example Tables II and III
  • RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to, for example, HUVEC, HMVEC, or A375 cells.
  • Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman®).
  • a comparison is made to a mixture of oligonucleotide sequences made to unrelated targets or to a randomized siNA control with the same overall length and chemistry, but randomly substituted at each position.
  • Primary and secondary lead reagents are chosen for the target and optimization performed. After an optimal transfection agent concentration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule.
  • a cell-plating format can be used to determine RNA inhibition.
  • Cells e.g., HUVEC, HMVEC, or A375 cells
  • EGM-2 BioWhittaker
  • siNA final concentration, for example 20 nM
  • cationic lipid e.g., final concentration 2 ⁇ g/ml
  • EGM basal media Biowhittaker
  • the complexed siNA is added to each well and incubated for the times indicated.
  • cells are seeded, for example, at 1 ⁇ 10 3 in 96 well plates and siNA complex added as described.
  • Efficiency of delivery of siNA to cells is determined using a fluorescent siNA complexed with lipid.
  • Cells in 6-well dishes are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. Uptake of siNA is visualized using a fluorescent microscope.
  • Total RNA is prepared from cells following siNA delivery, for example, using Qiagen RNA purification kits for 6-well or Rneasy extraction kits for 96-well assays.
  • dual-labeled probes are synthesized with the reporter dye, FAM or JOE, covalently linked at the 5′-end and the quencher dye TAMRA conjugated to the 3′-end.
  • RT-PCR amplifications are performed on, for example, an ABI PRISM 7700 Sequence Detector using 50 ⁇ l reactions consisting of 10 ⁇ l total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, 1 ⁇ TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM MgCl 2 , 300 ⁇ M each dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega), 1.25 U AmpliTaq Gold (PE-Applied Biosystems) and 10 U M-MLV Reverse Transcriptase (Promega).
  • the thermal cycling conditions can consist of 30 minutes at 48° C., 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and 1 minute at 60° C.
  • Quantitation of mRNA levels is determined relative to standards generated from serially diluted total cellular RNA (300, 100, 33, 11 ng/rxn) and normalizing to ⁇ -actin or GAPDH mRNA in parallel TaqMan reactions.
  • an upper and lower primer and a fluorescently labeled probe are designed.
  • Real time incorporation of SYBR Green I dye into a specific PCR product can be measured in glass capillary tubes using a lightcyler.
  • a standard curve is generated for each primer pair using control cRNA. Values are represented as relative expression to GAPDH in each sample.
  • Nuclear extracts can be prepared using a standard micro preparation technique (see for example Andrews and Faller, 1991 , Nucleic Acids Research, 19, 2499). Protein extracts from supernatants are prepared, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. Pellets are washed in acetone, dried and resuspended in water. Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear extracts) or 4-12% Tris-Glycine (supernatant extracts) polyacrylamide gel and transferred onto nitro-cellulose membranes.
  • Non-specific binding can be blocked by incubation, for example, with 5% non- fat milk for 1 hour followed by primary antibody for 16 hour at 4° C. Following washes, the secondary antibody is applied, for example (1:10,000 dilution) for 1 hour at room temperature and the signal detected with SuperSignal reagent (Pierce).
  • nucleic acids of the present invention such as siRNA
  • ECGF1 and/or ECGF1r mRNAs there are several animal models in which the anti-angiogenesis effect of nucleic acids of the present invention, such as siRNA, directed against ECGF1 and/or ECGF1r mRNAs can be tested.
  • a corneal model has been used to study angiogenesis in rat and rabbit since recruitment of vessels can easily be followed in this normally avascular tissue (Pandey et al., 1995 Science 268: 567-569).
  • angiogenesis factor e.g. bFGF, VEGF or ECGF1
  • siRNA directed against ECGF1 and/or ECGF1r mRNAs are delivered in the disk as well, or dropwise to the eye over the time course of the experiment.
  • hypoxia has been shown to cause both increased expression of VEGF and neovascularization in the retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909; Shweiki et al., 1992 J. Clin. Invest. 91: 2235-2243).
  • This model could likewise be used to evaluate modulation of ECGF1 and/or ECGF1r using siNA molecules of the invention.
  • ECGF1 is at least partially responsible for tumor angiogenesis (Plate et al., 1992 Nature 359, 845).
  • Animal models have been developed in which glioblastoma cells are implanted subcutaneously into nude mice and the progress of tumor growth and angiogenesism is studied (Kim et al., 1993 supra; Millauer et al., 1994 supra).
  • Matrigel matrix an extract of basement membrane that becomes a solid gel when injected subcutaneously (Passaniti et al., 1992 Lab. Invest. 67: 519-528).
  • angiogenesis factors such as VEGF
  • vessels grow into the Matrigel over a period of 3 to 5 days and angiogenesis can be assessed.
  • nucleic acids directed against ECGF1r and/or ECGF1r mRNAs are delivered in the Matrigel and evaluated for efficacy.
  • corneal vessel formation following corneal injury (Burger et al., 1985 Cornea 4: 35-41; Lepri, et al., 1994 J. Ocular Pharmacol. 10: 273-280; Ormerod et al., 1990 Am. J. Pathol. 137: 1243-1252) or intracorneal growth factor implant (Grant et al., 1993 Diabetologia 36: 282-291; Pandey et al. 1995 supra; Zieche et al., 1992 Lab. Invest.
  • the cornea model is the most common and well characterized model for screening anti-angiogenic agent efficacy.
  • This model involves an avascular tissue into which vessels are recruited by a stimulating agent (growth factor, thermal or alkalai burn, endotoxin).
  • the corneal model utilizes the intrastromal corneal implantation of a Teflon pellet soaked in an VEGF or ECGF1-Hydron solution to recruit blood vessels toward the pellet, which can be quantitated using standard microscopic and image analysis techniques.
  • nucleic acids are applied topically to the eye or bound within Hydron on the Teflon pellet itself.
  • This avascular cornea as well as the Matrigel provide for low background assays. While the corneal model has been performed extensively in the rabbit, studies in the rat have also been conducted.
  • the mouse model (Passaniti et al., supra) is a non-tissue model that utilizes Matrigel, an extract of basement membrane (Kleinman et al., 1986) or Millipore® filter disk, which can be impregnated with growth factors and anti-angiogenic agents in a liquid form prior to injection. Upon subcutaneous administration at body temperature, the Matrigel or Millipore® filter disk forms a solid implant.
  • ECGF1 or VEGF embedded in the Matrigel or Millipore® filter disk is used to recruit vessels within the matrix of the Matrigel or Millipore® filter disk which can be processed histologically for endothelial cell specific vWF (factor VIII antigen) immunohistochemistry, Trichrome-Masson stain, or hemoglobin content.
  • vWF factor VIII antigen
  • the Matrigel or Millipore® filter disk is avascular; however, it is not tissue.
  • nucleic acids are administered within the matrix of the Matrigel or Millipore® filter disk to test their anti-angiogenic efficacy.
  • delivery issues in this model as with delivery of nucleic acids by Hydron-coated Teflon pellets in the rat cornea model, may be less problematic due to the homogeneous presence of the nucleic acid within the respective matrix.
  • siRNA For a typical systemic study involving 10 mice (20 g each) per dose group, 5 doses (1, 3, 10, 30 and 100 mg/kg daily over 14 days continuous administration), approximately 400 mg of siRNA, formulated in saline is used. A similar study in young adult rats (200 g) requires over 4 g. Parallel pharmacokinetic studies involve the use of similar quantities of siRNA further justifying the use of murine models.
  • Identifying a common animal model for systemic efficacy testing of nucleic acids is an efficient way of screening siRNA for systemic efficacy.
  • the Lewis lung carcinoma and B-16 murine melanoma models are well accepted models of primary and metastatic cancer and are used for initial screening of anti-cancer agents. These murine models are not dependent upon the use of immunodeficient mice, are relatively inexpensive, and minimize housing concerns. Both the Lewis lung and B-16 melanoma models involve subcutaneous implantation of approximately 10 6 tumor cells from metastatically aggressive tumor cell lines (Lewis lung lines 3LL or D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice. Alternatively, the Lewis lung model can be produced by the surgical implantation of tumor spheres (approximately 0.8 mm in diameter). Metastasis also can be modeled by injecting the tumor cells directly intravenously.
  • systemic pharmacotherapy with a wide variety of agents usually begins 1-7 days following tumor implantation/inoculation with either continuous or multiple administration regimens.
  • Concurrent pharmacokinetic studies can be performed to determine whether sufficient tissue levels of siRNA can be achieved for pharmacodynamic effect to be expected.
  • primary tumors and secondary lung metastases can be removed and subjected to a variety of in vitro studies (i.e. target RNA reduction).
  • animal models are useful in screening compounds, eg. siRNA molecules, for efficacy in treating renal failure, such as a result of autosomal dominant polycystic kidney disease (ADPKD).
  • ADPKD autosomal dominant polycystic kidney disease
  • the Han:SPRD rat model mice with a targeted mutation in the Pkd2 gene and congenital polycystic kidney (cpk) mice, closely resemble human ADPKD and provide animal models to evaluate the therapeutic effect of siRNA constructs that have the potential to interfere with one or more of the pathogenic elements of ADPKD mediated renal failure, such as angiogenesis.
  • Angiogenesis may be necessary in the progression of ADPKD for growth of cyst cells as well as increased vascular permeability promoting fluid secretion into cysts.
  • anti-ECGF1 or ECGF1r siRNA molecules would attenuate cystic epithelial cell proliferation and apoptosis which would in turn lead to less cyst formation. Further, it is proposed that ECGF1 may be a stimulus for angiogenesis as well as epithelial cell proliferation and apoptosis.
  • Han:SPRD rats see for eaxmple Kaspareit-Rittinghausen et al., 1991 , Am. J. Pathol. 139, 693-696
  • mice with a targeted mutation in the Pkd2 gene Pkd2 ⁇ / ⁇ mice, see for example Wu et al., 2000 , Nat. Genet.
  • mice see for example Woo et al., 1994 , Nature, 368, 750-753 all provide animal models to study the efficacy of siNA molecles of the invention against ECGF1 and ECGF1r mediated renal failure.
  • ECGF1 and/or ECGF1r protein levels can be measured clinically or experimentally by FACS analysis. ECGF1 and/or ECGF1r encoded mRNA levels are assessed by Northern analysis, RNase-protection, primer extension analysis and/or quantitative RT-PCR. siNA nucleic acids that block ECGF1 and/or ECGF1r protein encoding mRNAs and therefore result in decreased levels of ECGF1 and/or ECGF1r activity by more than 20% in vitro can be identified.
  • the purpose of this study is to assess the anti-angiogenic activity of siNA targeted against ECGF1r in the rat cornea model of ECGF1 induced angiogenesis (see above).
  • the siNA molecules have matched inverted controls, which are inactive since they are not able to interact with the RNA target.
  • the siNA molecules and ECGF1 are co-delivered using the filter disk method: Nitrocellulose filter disks (Millipore®) of 0.057 diameter are immersed in appropriate solutions and are surgically implanted in rat cornea as described by Pandey et al., supra.
  • the stimulus for angiogenesis in this study is the treatment of the filter disk with 30 ⁇ M ECGF1, which is implanted within the cornea's stroma.
  • This dose yields reproducible neovascularization stemming from the pericorneal vascular plexus growing toward the disk in a dose-response study 5 days following implant.
  • Filter disks treated only with the vehicle for ECGF1 show no angiogenic response.
  • the siNA are co-adminstered with ECGF1 on a disk in two different siNA concentrations. Blocking the production of ECGF1 or ECGF1r using simultaneous administration of anti-ECGF1 or ECGF1r mRNA siNA could attenuate the normal neovascularization induced by the filter disk treated with ECGF1.
  • Animals are housed in groups of two. Feed, water, temperature and humidity are determined according to Pharmacology Testing Facility performance standards (SOP's) which are in accordance with the 1996 Guide for the Care and Use of Laboratory Animals (NRC). Animals are acclimated to the facility for at least 7 days prior to experimentation. During this time, animals are observed for overall health and sentinels are bled for baseline serology.
  • SOP's Pharmacology Testing Facility performance standards
  • NRC Laboratory Animals
  • Each solution (ECGF1 and siNAs) is prepared as a 1 ⁇ solution for final concentrations shown in the experimental groups described in Table III.
  • siNA sense and antisense strands are annealed for 1 minute in H2O at 1.67 mg/mL/strand followed by a 1 hour incubation at 37° C. producing 3.34 mg/mL of duplexed siNA.
  • 334 mg/mL duplex siNA For the 20 ⁇ g/eye treatment, 6 ⁇ Ls of the 3.34 mg/mL duplex is injected into the eye (see below). The 3.34 mg/mL duplex siNA can then be serially diluted for dose response assays.
  • nitrocellulose disks prepared from 0.45 ⁇ m pore diameter nitrocellulose filter membranes (Millipore Corporation), are soaked for 30 min in 1 ⁇ L of 75 ⁇ M ECGF1 in 82 mM Tris HCl (pH 6.9) in covered petri dishes on ice. Filter disks soaked only with the vehicle for ECGF1 (83 mM Tris-Cl pH 6.9) elicit no angiogenic response.
  • the rat corneal model used in this study is a modified from Koch et al. Supra and Pandey et al., supra. Briefly, corneas were irrigated with 0.5% povidone iodine solution followed by normal saline and two drops of 2% lidocaine. Under a dissecting microscope (Leica MZ-6), a stromal pocket is created and a presoaked filter disk (see above) is inserted into the pocket such that its edge is 1 mm from the corneal limbus.
  • a 40-50 ⁇ m OD injector (constructed in our laboratory) is inserted within the conjunctival tissue 1 mm away from the edge of the corneal limbus that is directly adjacent to the ECGF1-soaked filter disk.
  • test solution siNA, inverted control or sterile water vehicle
  • the injector is then removed, serially rinsed in 70% ethanol and sterile water and immersed in sterile water between each injection.
  • closure of the eyelid is maintained using microaneurism clips until the animal begins to recover gross motor activity. Following treatment, animals are warmed on a heating pad at 37° C.
  • NSA neovascular surface area
  • the individual mean NSA is determined in triplicate from three regions of identical size in the area of maximal neovascularization between the filter disk and the limbus. The number of pixels corresponding to the blood-filled corneal vessels in these regions is summated to produce an index of NSA.
  • a group mean NSA is then calculated. Data from each treatment group were normalized to ECGF1/siNA vehicle-treated control NSA and finally expressed as percent inhibition of ECGF1-induced angiogenesis.
  • Statistical analyses are performed using JMP v.3.1.6 (SAS Institute).
  • RNAi Mediated Inhibition of ECGF1 and/or ECGF1r RNA Expression
  • siNA constructs (Table III) are tested for efficacy in reducing ECGF1 and/or ECGF1r RNA expression in, for example, HUVEC, HMVEC, or A375 cells.
  • Cells are plated approximately 24 h before transfection in 96-well plates at 5,000-7,500 cells/well, 100 ⁇ l/well, such that at the time of transfection cells are 70-90% confluent.
  • annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 501 ⁇ l/well and incubated for 20 minutes at room temperature.
  • siNA transfection mixtures are added to cells to give a final siNA concentration of 25 nM in a volume of 150 ⁇ l.
  • Each siNA transfection mixture is added to 3 wells for triplicate siNA treatments. Cells are incubated at 37° for 24 hours in the continued presence of the siNA transfection mixture. At 24 hours, RNA is prepared from each well of treated cells. The supernatants with the transfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well.
  • Target gene expression following treatment is evaluated by RT-PCR for the target gene and for a control gene (36B4, an RNA polymerase subunit) for normalization. The triplicate data is averaged and the standard deviations determined for each treatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs is determined.
  • nucleic acid molecules of the present invention can be used in assays to diagnose disease state related of ECGF1 and/or ECGF1r levels.
  • nucleic acid molecules can be used to treat disease state related to ECGF1 and/or ECGF1r levels.
  • ECGF1 and/or ECGF1r expression modulation include, but are not limited to:
  • Tumor angiogenesis Angiogenesis has been shown to be necessary for tumors to grow into pathological size (Folkman, 1971 , PNAS 76, 5217-5221; Wellstein & Czubayko, 1996 , Breast Cancer Res and Treatment 38, 109-119). In addition, it allows tumor cells to travel through the circulatory system during metastasis. Increased levels of gene expression of a number of angiogenic factors have been reported in vascularized and edema-associated brain tumors (Berkman et al., 1993 J. Clini. Invest. 91, 153).
  • Neovascularization has been shown to cause or exacerbate ocular diseases including, but not limited to, macular degeneration, neovascular glaucoma, diabetic retinopathy, myopic degeneration, and trachoma (Norrby, 1997 , APMIS 105, 417-437). These observations support a direct role for angiogenesis in ocular diseases. Angiogenic factors, including factors that can stimulate ECGF1 synthesis, may also contribute to these indications. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating a variety of ocular diseases and conditions.
  • Dermatological Disorders Many indications have been identified which may beangiogenesis dependent, including but not limited to, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, pot-wine stains, Sturge Weber syndrome, Kippel-Trenaunay-Weber syndrome, and Osler-Weber-Rendu syndrome (Norrby, supra).
  • Intradermal injection of the angiogenic factor b-FGF demonstrated angiogenesis in nude mice (Weckbecker et al., 1992 , Angiogenesis: Key principles - Science - Technology - Medicine , ed R. Steiner). Detmar et al., 1994 J. Exp. Med.
  • angiogenesis plays a significant role in psoriasis.
  • Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating psoriasis and other dermatological disorders.
  • Rheumatoid arthritis Immunohistochemistry and in situ hybridization studies on tissues from the joints of patients suffering from rheumatoid arthritis show an increased level of angiogenic factors (Fava et al., 1994 J. Exp. Med. 180, 341). Additionally, Koch et al., 1994 J. Immunol. 152, 4149, found that certain antibodies targeting angioenic factors were able to significantly reduce the mitogenic activity of synovial tissues from patients suffering from rheumatoid arthritis. Other angiogenic factors including those of the present invention may also be involved in arthritis. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating arthritis.
  • Endometriosis Various studies indicate that angiogenesis is directly implicated in endometriosis. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating endometriosis.
  • Kidney disease Autosomal dominant polycystic kidney disease (ADPKD) is the most common life threatening hereditary disease in the USA. It affects about 1:400 to 1:1000 people and approximately 50% of people with ADPKD develop renal failure. ADPKD accounts for about 5-10% of end-stage renal failure in the USA, requiring dialysis and renal transplantation. Angiogenesis is implicated in the progression of ADPKD for growth of cyst cells, as well as increased vascular permeability promoting fluid secretion into cysts. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating polycystic kidney disease.
  • chemotherapeutic agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention.
  • combination treatments comprising anti-VEGF/VEGFr molecules (such as siNAs targeting VEGF and VEGF receptor RNA), may provide improved efficacy in treating angiogenesis related diseases and conditions.
  • anti-cancer compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g. siNA molecules) and are hence within the scope of the instant invention.
  • Lippincott Company Philadelphia, USA; incorporated herein by reference) and include, without limitation, folates, antifolates, pyrimidine analogs, fluoropyrimidines, purine analogs, adenosine analogs, topoisomerase I inhibitors, anthrapyrazoles, retinoids, antibiotics, anthacyclins, platinum analogs, alkylating agents, nitrosoureas, plant derived compounds such as vinca alkaloids, epipodophyllotoxins, tyrosine kinase inhibitors, taxols, radiation therapy, surgery, nutritional supplements, gene therapy, radiotherapy, for example 3D-CRT, immunotoxin therapy, for example ricin, and monoclonal antibodies.
  • chemotherapeutic compounds that can be combined with or used in conjuction with the nucleic acid molecules of the invention include, but are not limited to, Paclitaxel; Docetaxel; Methotrexate; Doxorubin; Edatrexate; Vinorelbine; Tomaxifen; Leucovorin; 5-fluoro uridine (5-FU); Ionotecan; Cisplatin; Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C; Dactinomycin; Mithramycin; Hexamethylmelamine; dacarbazine; L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan; Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan (CAMPTOSAR®, CPT-11, Camptothecin-11, Campto) Tamoxifen; Herceptin; IMC C225; ABX-EGF
  • nucleic acid molecules e.g. siNA
  • other drug compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g., siNA molecules) are hence within the scope of the instant invention.
  • siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, for example, in clinical, industrial, environmental, agricultural and/or research settings.
  • diagnostic use of siNA molecules involves utilizing reconstituted RNAi systems, for example, using cellular lysates or partially purified cellular lysates.
  • siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of endogenous or exogenous, for example viral, RNA in a cell.
  • siNA activity allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA.
  • siNA molecules described in this invention one can map nucleotide changes, which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with siNA molecules can be used to inhibit gene expression and define the role of specified gene products in the progression of disease or infection. In this manner, other genetic targets can be defined as important mediators of the disease.
  • siNA molecules of this invention include detection of the presence of mRNAs associated with a disease, infection, or related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET).
  • FRET fluorescence resonance emission transfer
  • siNA molecules that cleave only wild-type or mutant forms of the target RNA are used for the assay.
  • the first siNA molecules i.e., those that cleave only wild-type forms of target RNA
  • the second siNA molecules i.e., those that cleave only mutant forms of target RNA
  • synthetic substrates of both wild-type and mutant RNA are cleaved by both siNA molecules to demonstrate the relative siNA efficiencies in the reactions and the absence of cleavage of the “non-targeted” RNA species.
  • the cleavage products from the synthetic substrates also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population.
  • each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined into six reactions.
  • the presence of cleavage products is determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells.
  • the expression of mRNA whose protein product is implicated in the development of the phenotype i.e., disease related or infection related
  • a qualitative comparison of RNA levels is adequate and decreases the cost of the initial diagnosis. Higher mutant form to wild-type ratios are correlated with higher risk whether RNA levels are compared qualitatively or quantitatively.
  • ECGF1 Synthetic Modified siNA constructs Target Seq Seq Pos Target ID Aliases Sequence ID 591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:593U21 siRNA sense ACCUUGGAUAAGCUGGAGUTT 183 683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:685U21 siRNA sense CGUGGGUCAGAGUGAGCAGTT 184 690 GUCAGAGUGAGCAGCUGGUUCCU 181 ECGF1:692U21 siRNA sense CAGAGUGAGCAGCUGGUUCTT 185 1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1033U21 siRNA sense AGACUUAAGGGACCUGGUCTT 186 591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:611L21 siRNA (593C) antisense ACUCCAGCUUAUCCAAGGUTT 187 683 AUCGUGGGUCAGAGUGAGCAGCU
  • All Stab 1-11 chemistries can comprise 3′-terminal thymidine (TT) residues All Stab 1-11 chemistries typically comprise 21 nucleotides, but can vary as described herein.
  • S sense strand
  • AS antisense strand

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Botany (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention concerns methods and reagents useful in modulating platelet-derived endothelial cell growth factor (ECGF1) and/or platelet-derived endothelial cell growth factor receptor (e.g., ECGF1r) gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against ECGF1 and/or ECGF1r gene expression and/or activity. The small nucleic acid molecules are useful in the diagnosis and treatment of cancer, proliferative diseases, macular degeneration, diabetic retinopathy, and any other disease or condition that responds to modulation of ECGF1 and/or ECGF1r expression or activity.

Description

  • This application is a continuation of U.S. application Ser. No. 10/422,704 filed Apr. 24, 2003, which is a continuation of U.S. application Ser. No. 10/417,012 filed Apr. 16, 2003, which is a continuation-in-part of International Patent Application No. PCT/US03/05346 filed Feb. 20, 2003, and a continuation-in-part of International Patent Application No. PCT/US03/05028 filed Feb. 20, 2003, which claim the benefit of U.S. Provisional Application No. 60/358,580 filed Feb. 20, 2002, U.S. Provisional Application No. 60/363,124 filed Mar. 11, 2002, U.S. Provisional Application No. 60/386,782 filed Jun. 6, 2002, U.S. Provisional Application No. 60/406,784 filed Aug. 29, 2002, U.S. Provisional Application No. 60/408,378 filed Sep. 5, 2002, U.S. Provisional Application No. 60/409,293 filed Sep. 9, 2002, and U.S. Provisional Application No. 60/440,129 filed Jan. 15, 2003. All of the applications are incorporated by reference herein in their entireties, including the drawings.
  • FIELD OF THE INVENTION
  • The present invention concerns compounds, compositions, and methods for the study, diagnosis, and treatment of conditions and diseases that respond to the modulation of platelet-derived endothelial cell growth factor (ECGF1) and platelet-derived endothelial cell growth factor receptor (ECGF1r) gene expression and/or activity. The present invention also concerns compounds, compositions, and methods relating to conditions and diseases that respond to the modulation of expression and/or activity of genes involved in ECGF1 and ECGF1 receptor pathways. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against ECGF1 and ECGF1 receptor gene expression.
  • BACKGROUND OF THE INVENTION
  • The following is a discussion of relevant art pertaining to RNAi. The discussion is provided only for understanding of the invention that follows. The summary is not an admission that any of the work described below is prior art to the claimed invention.
  • RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2′,5′-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., 2001, Nature, 409, 363). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al., 2001, Genes Dev., 15, 188). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science, 293, 834). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex (Elbashir et al., 2001, Genes Dev., 15, 188).
  • RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates (Elbashir et al., 2001, EMBO J., 20, 6877) has revealed certain requirements for siRNA length, structure, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21-nucleotide siRNA duplexes are most active when containing 3′-terminal dinucleotide overhangs. Furthermore, complete substitution of one or both siRNA strands with 2′-deoxy (2′-H) or 2′-O-methyl nucleotides abolishes RNAi activity, whereas substitution of the 3′-terminal siRNA overhang nucleotides with 2′-deoxy nucleotides (2′-H) was shown to be tolerated. Single mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5′-end of the siRNA guide sequence rather than the 3′-end of the guide sequence (Elbashir et al., 2001, EMBO J., 20, 6877). Other studies have indicated that a 5′-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5′-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell, 107, 309).
  • Studies have shown that replacing the 3′-terminal nucleotide overhanging segments of a 21-mer siRNA duplex having two-nucleotide 3′-overhangs with deoxyribonucleotides does not have an adverse effect on RNAi activity. Replacing up to four nucleotides on each end of the siRNA with deoxyribonucleotides has been reported to be well tolerated, whereas complete substitution with deoxyribonucleotides results in no RNAi activity (Elbashir et al., 2001, EMBO J., 20, 6877). In addition, Elbashir et al., supra, also report that substitution of siRNA with 2′-O-methyl nucleotides completely abolishes RNAi activity. Li et al., International PCT Publication No. WO 00/44914, and Beach et al., International PCT Publication No. WO 01/68836 preliminarily suggest that siRNA may include modifications to either the phosphate-sugar backbone or the nucleoside to include at least one of a nitrogen or sulfur heteroatom, however, neither application postulates to what extent such modifications would be tolerated in siRNA molecules, nor provides any further guidance or examples of such modified siRNA. Kreutzer et al., Canadian Patent Application No. 2,359,180, also describe certain chemical modifications for use in dsRNA constructs in order to counteract activation of double-stranded RNA-dependent protein kinase PKR, specifically 2′-amino or 2′-O-methyl nucleotides, and nucleotides containing a 2′-O or 4′-C methylene bridge. However, Kreutzer et al. similarly fails to provide examples or guidance as to what extent these modifications would be tolerated in siRNA molecules.
  • Parrish et al., 2000, Molecular Cell, 6, 1977-1087, tested certain chemical modifications targeting the unc-22 gene in C. elegans using long (>25 nt) siRNA transcripts. The authors describe the introduction of thiophosphate residues into these siRNA transcripts by incorporating thiophosphate nucleotide analogs with T7 and T3 RNA polymerase and observed that RNAs with two phosphorothioate modified bases also had substantial decreases in effectiveness as RNAi. Further, Parrish et al. reported that phosphorothioate modification of more than two residues greatly destabilized the RNAs in vitro such that interference activities could not be assayed. Id. at 1081. The authors also tested certain modifications at the 2′-position of the nucleotide sugar in the long siRNA transcripts and found that substituting deoxynucleotides for ribonucleotides produced a substantial decrease in interference activity, especially in the case of Uridine to Thymidine and/or Cytidine to deoxy-Cytidine substitutions. Id. In addition, the authors tested certain base modifications, including substituting, in sense and antisense strands of the siRNA, 4-thiouracil, 5-bromouracil, 5-iodouracil, and 3-(aminoallyl)uracil for uracil, and inosine for guanosine. Whereas 4-thiouracil and 5-bromouracil substitution appeared to be tolerated, Parrish reported that inosine produced a substantial decrease in interference activity when incorporated in either strand. Parrish also reported that incorporation of 5-iodouracil and 3-(aminoallyl)uracil in the antisense strand resulted in a substantial decrease in RNAi activity as well.
  • The use of longer dsRNA has been described. For example, Beach et al., International PCT Publication No. WO 01/68836, describes specific methods for attenuating gene expression using endogenously-derived dsRNA. Tuschl et al., International PCT Publication No. WO 01/75164, describe a Drosophila in vitro RNAi system and the use of specific siRNA molecules for certain functional genomic and certain therapeutic applications; although Tuschl, 2001, Chem. Biochem., 2, 239-245, doubts that RNAi can be used to cure genetic diseases or viral infection due to the danger of activating interferon response. Li et al, International PCT Publication No. WO 00/44914, describe the use of specific dsRNAs for attenuating the expression of certain target genes. Zernicka-Goetz et al., International PCT Publication No. WO 01/36646, describe certain methods for inhibiting the expression of particular genes in mammalian cells using certain dsRNA molecules. Fire et al., International PCT Publication No. WO 99/32619, describe particular methods for introducing certain dsRNA molecules into cells for use in inhibiting gene expression. Plaetinck et al., International PCT Publication No. WO 00/01846, describe certain methods for identifying specific genes responsible for conferring a particular phenotype in a cell using specific dsRNA molecules. Mello et al., International PCT Publication No. WO 01/29058, describe the identification of specific genes involved in dsRNA-mediated RNAi. Deschamps Depaillette et al., International PCT Publication No. WO 99/07409, describe specific compositions consisting of particular dsRNA molecules combined with certain anti-viral agents. Waterhouse et al., International PCT Publication No. 99/53050, describe certain methods for decreasing the phenotypic expression of a nucleic acid in plant cells using certain dsRNAs. Driscoll et al., International PCT Publication No. WO 01/49844, describe specific DNA constructs for use in facilitating gene silencing in targeted organisms.
  • Others have reported on various RNAi and gene-silencing systems. For example, Parrish et al., 2000, Molecular Cell, 6, 1977-1087, describe specific chemically-modified siRNA constructs targeting the unc-22 gene of C. elegans. Grossniklaus, International PCT Publication No. WO 01/38551, describes certain methods for regulating polycomb gene expression in plants using certain dsRNAs. Churikov et al., International PCT Publication No. WO 01/42443, describe certain methods for modifying genetic characteristics of an organism using certain dsRNAs. Cogoni et al., International PCT Publication No. WO 01/53475, describe certain methods for isolating a Neurospora silencing gene and uses thereof. Reed et al., International PCT Publication No. WO 01/68836, describe certain methods for gene silencing in plants. Honer et al., International PCT Publication No. WO 01/70944, describe certain methods of drug screening using transgenic nematodes as Parkinson's Disease models using certain dsRNAs. Deak et al., International PCT Publication No. WO 01/72774, describe certain Drosophila-derived gene products that may be related to RNAi in Drosophila. Arndt et al., International PCT Publication No. WO 01/92513 describe certain methods for mediating gene suppression by using factors that enhance RNAi. Tuschl et al., International PCT Publication No. WO 02/44321, describe certain synthetic siRNA constructs. Pachuk et al., International PCT Publication No. WO 00/63364, and Satishchandran et al., International PCT Publication No. WO 01/04313, describe certain methods and compositions for inhibiting the function of certain polynucleotide sequences using certain dsRNAs. Echeverri et al., International PCT Publication No. WO 02/38805, describe certain C. elegans genes identified via RNAi. Kreutzer et al., International PCT Publications Nos. WO 02/055692, WO 02/055693, and EP 1144623 B1 describes certain methods for inhibiting gene expression using RNAi. Graham et al., International PCT Publications Nos. WO 99/49029 and WO 01/70949, and AU 4037501 describe certain vector expressed siRNA molecules. Fire et al., U.S. Pat. No. 6,506,559, describe certain methods for inhibiting gene expression in vitro using certain long dsRNA (greater than 25 nucleotide) constructs that mediate RNAi.
  • SUMMARY OF THE INVENTION
  • This invention relates to compounds, compositions, and methods useful for modulating the expression of genes, such as those genes associated with angiogenesis and proliferation, using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of platelet-derived endothelial cell growth factor (e.g., ECGF1) and/or platelet-derived endothelial cell growth factor receptor (e.g., ECGF1r) genes. The invention further relates to compounds, compositions, and methods useful for modulating the expression and activity of genes involved in ECGF1 and/or ECGF1r pathways of gene expression and/or ECGF1 activity by RNA interference (RNAi) using small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (mRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of ECGF1 and/or ECGF1r genes. A siNA of the invention can be unmodified or chemically-modified. A siNA of the instant invention can be chemically synthesized, expressed from a vector or enzymatically synthesized. The instant invention also features various chemically-modified synthetic short interfering nucleic acid (siNA) molecules capable of modulating ECGF1 and/or ECGF1r gene expression or activity in cells by RNA interference (RNAi). The use of chemically-modified siNA improves various properties of native siNA molecules through increased resistance to nuclease degradation in vivo and/or through improved cellular uptake. Further, contrary to earlier published studies, siNA having multiple chemical modifications retains its RNAi activity. The siNA molecules of the instant invention provide useful reagents and methods for a variety of therapeutic, diagnostic, target validation, genomic discovery, genetic engineering, and pharmacogenomic applications.
  • In one embodiment, the invention features one or more siNA molecules and methods that independently or in combination modulate the expression of gene(s) encoding proteins, such as platelet-derived endothelial cell growth factor (ECGF1) and/or platelet-derived endothelial cell growth factor receptors (e.g., ECGF1r), associated with the maintenance and/or development of cancer and other proliferative diseases, such as genes encoding sequences comprising those sequences referred to by GenBank Accession Nos. shown in Table I, referred to herein generally as ECGF1 and/or ECGF1r. The description below of the various aspects and embodiments of the invention is provided with reference to exemplary platelet-derived endothelial cell growth factor (ECGF1) and platelet-derived endothelial cell growth factor receptor genes referred to herein as ECGF1 and ECGF1r respectively, however, the invention is not meant to be limited to the referenced molecules. In addition, the various aspects and embodiments of the invention are meant to include other related ECGF1 and/or ECGF1r genes, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors. The various aspects and embodiments are also directed to other genes that are involved in ECGF1 and/or ECGF1r mediated pathways of signal transduction or gene expression that are involved in the progression, development, and/or maintenance of disease (e.g., cancer or macular degeneration). Those additional genes can be analyzed for target sites using the methods described for ECGF1 and/or ECGF1r genes herein. Thus, the inhibition and the effects of such inhibition of the other genes can be performed as described herein.
  • In one embodiment, the invention features a siNA molecule that down-regulates expression of an ECGF1 gene, for example, wherein the ECGF1 gene comprises ECGF1 encoding sequence.
  • In one embodiment, the invention features a siNA molecule that down-regulates expression of an ECGF1r gene, for example, wherein the ECGF1r gene comprises ECGF1r encoding sequence.
  • In one embodiment, the invention features a siNA molecule having RNAi activity against ECGF1 and/or ECGF1r RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having ECGF1 and/or ECGF1r encoding sequence, such as those sequences having ECGF1 and/or ECGF1r GenBank Accession Nos. shown in Table I. In another embodiment, the invention features a siNA molecule having RNAi activity against ECGF1 and/or ECGF1r RNA, wherein the siNA molecule comprises a sequence complementary to an RNA having other ECGF1 and/or ECGF1r encoding sequence, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors. Chemical modifications as shown in Tables III and IV or otherwise described herein can be applied to any siNA construct of the invention.
  • In another embodiment, the invention features a siNA molecule having RNAi activity against an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises nucleotide sequence complementary to nucleotide sequence of an ECGF1 and/or ECGF1r gene, such as those ECGF1 and/or ECGF1r sequences having GenBank Accession Nos. shown in Table I or other ECGF1 and/or ECGF1r encoding sequence, such as mutant ECGF1 and/or ECGF1r genes, splice variants of ECGF1 and/or ECGF1r genes, and other ECGF1 and/or ECGF1r ligands and receptors. In another embodiment, a siNA molecule of the invention includes nucleotide sequence that can interact with nucleotide sequence of an ECGF1 and/or ECGF1r gene and thereby mediate silencing of ECGF1 and/or ECGF1r gene expression, for example, wherein the siNA mediates regulation of ECGF1 and/or ECGF1r gene expression by cellular processes that modulate the chromatin structure of the ECGF1 and/or ECGF1r gene and prevent transcription of the ECGF1 and/or ECGF1 r gene.
  • In another embodiment, the invention features a siNA molecule comprising nucleotide sequence, for example, nucleotide sequence in the antisense region of the siNA molecule, that is complementary to a nucleotide sequence or portion of sequence of an ECGF1 and/or ECGF1r gene. In another embodiment, the invention features a siNA molecule comprising a region, for example, the antisense region of the siNA construct, complementary to a sequence or portion of sequence comprising an ECGF1 and/or ECGF1r gene sequence.
  • In one embodiment, the antisense region of ECGF1 siNA constructs can comprise a sequence complementary to sequence having any of SEQ ID NOs. 1-89 or 179-186. In one embodiment, the antisense region can also comprise sequence having any of SEQ ID NOs. 90-178, 187-190, 195-198, 203-206, 208, 210, 212, 215, 217, 219, 221, or 224. In another embodiment, the sense region of ECGF1 constructs can comprise sequence having any of SEQ ID NOs. 1-89, 179-186, 191-194, 199-202, 207, 209, 211, 213, 214, 216, 218, 220, 222, or 223.
  • In one embodiment, a siNA molecule of the invention comprises any of SEQ ID NOs. 1-224. The sequences shown in SEQ ID NOs: 1-224 are not limiting. A siNA molecule of the invention can comprise any contiguous ECGF1 and/or ECGF1r sequence (e.g., about 19 to about 25, or about 19, 20, 21, 22, 23, 24 or 25 contiguous ECGF1 and/or ECGF1r nucleotides).
  • In yet another embodiment, the invention features a siNA molecule comprising a sequence, for example, the antisense sequence of the siNA construct, complementary to a sequence or portion of sequence comprising sequence represented by GenBank Accession Nos. shown in Table I. Chemical modifications in Tables III and IV and described herein can be applied to any siRNA costruct of the invention.
  • In one embodiment of the invention a siNA molecule comprises an antisense strand having about 19 to about 29 nucleotides, wherein the antisense strand is complementary to a RNA sequence encoding an ECGF1 and/or ECGF1r protein, and wherein said siNA further comprises a sense strand having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, and wherein said sense strand and said antisense strand are distinct nucleotide sequences with at least about 19 complementary nucleotides.
  • In another embodiment of the invention a siNA molecule of the invention comprises an antisense region having about 19 to about 29 (e.g., about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29) nucleotides, wherein the antisense region is complementary to a RNA sequence encoding an ECGF1 and/or ECGF1r protein, and wherein said siNA further comprises a sense region having about 19 to about 29 nucleotides, wherein said sense region and said antisense region comprise a linear molecule with at least about 19 complementary nucleotides.
  • In one embodiment of the invention a siNA molecule comprises an antisense strand comprising a nucleotide sequence that is complementary to a nucleotide sequence encoding an ECGF1 and/or ECGF1r protein or a portion thereof. The siNA further comprises a sense strand, wherein said sense strand comprises a nucleotide sequence of an ECGF1 and/0r ECGF1r gene or a portion thereof.
  • In another embodiment, a siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence encoding an ECGF1 and/or ECGF1r protein or a portion thereof. The siNA molecule further comprises a sense region, wherein said sense region comprises a nucleotide sequence of an ECGF1 and/or ECGF1r gene or a portion thereof.
  • In one embodiment, a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by an ECGF1 gene. Because ECGF1 genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of ECGF1 genes (and associated receptor or ligand genes) or alternately specific ECGF1 genes by selecting sequences that are either shared amongst different ECGF1 targets or alternatively that are unique for a specific ECGF1 target. Therefore, in one embodiment, the siNA molecule can be designed to target conserved regions of ECGF1 RNA sequence having homology between several ECGF1 genes so as to target several ECGF1 genes (e.g., different ECGF1 isoforms, splice variants, mutant genes etc.) with one siNA molecule. In another embodiment, the siNA molecule can be designed to target a sequence that is unique to a specific ECGF1 RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
  • In one embodiment, a siNA molecule of the invention has RNAi activity that modulates expression of RNA encoded by an ECGF1r gene. Because ECGF1r genes can share some degree of sequence homology with each other, siNA molecules can be designed to target a class of ECGF1r genes (and associated receptor or ligand genes) or alternately specific ECGF1r genes by selecting sequences that are either shared amongst different ECGF1r targets or alternatively that are unique for a specific ECGF1r target. Therefore, in one embodiment, the siNA molecule can be designed to target conserved regions of ECGF1r RNA sequence having homology between several ECGF1r genes so as to target several ECGF1r genes (e.g., different ECGF1r isoforms, splice variants, mutant genes, etc.) with one siNA molecule. In another embodiment, the siNA molecule can be designed to target a sequence that is unique to a specific ECGF1r RNA sequence due to the high degree of specificity that the siNA molecule requires to mediate RNAi activity.
  • In one embodiment, nucleic acid molecules of the invention that act as mediators of the RNA interference gene silencing response are double-stranded nucleic acid molecules. In another embodiment, the siNA molecules of the invention consist of duplexes containing about 19 base pairs between oligonucleotides comprising about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24 or 25) nucleotides. In yet another embodiment, siNA molecules of the invention comprise duplexes with overhanging ends of about 1 to about 3 (e.g., about 1, 2, or 3) nucleotides, for example, about 21-nucleotide duplexes with about 19 base pairs and 3′-terminal mononucleotide, dinucleotide, or trinucleotide overhangs.
  • In one embodiment, the invention features one or more chemically-modified siNA constructs having specificity for ECGF1 and/or ECGF1r expressing nucleic acid molecules, such as RNA encoding an ECGF1 and/or ECGF1r protein. Non-limiting examples of such chemical modifications include without limitation phosphorothioate internucleotide linkages, 2′-deoxyribonucleotides, 2′-O-methyl ribonucleotides, 2′-deoxy-2′-fluoro ribonucleotides, “universal base” nucleotides, “acyclic” nucleotides, 5-C-methyl nucleotides, and terminal glyceryl and/or inverted deoxy abasic residue incorporation. These chemical modifications, when used in various siNA constructs, are shown to preserve RNAi activity in cells while at the same time, dramatically increasing the serum stability of these compounds. Furthermore, contrary to the data published by Parrish et al., supra, applicant demonstrates that multiple (greater than one) phosphorothioate substitutions are well-tolerated and confer substantial increases in serum stability for modified siNA constructs.
  • In one embodiment, a siNA molecule of the invention comprises modified nucleotides while maintaining the ability to mediate RNAi. The modified nucleotides can be used to improve in vitro or in vivo characteristics such as stability, activity, and/or bioavailability. For example, a siNA molecule of the invention can comprise modified nucleotides as a percentage of the total number of nucleotides present in the siNA molecule. As such, a siNA molecule of the invention can generally comprise about 5% to about 100% modified nucleotides (e.g., 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% modified nucleotides). The actual percentage of modified nucleotides present in a given siNA molecule will depend on the total number of nucleotides present in the siNA. If the siNA molecule is single stranded, the percent modification can be based upon the total number of nucleotides present in the single stranded siNA molecules. Likewise, if the siNA molecule is double stranded, the percent modification can be based upon the total number of nucleotides present in the sense strand, antisense strand, or both the sense and antisense strands.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • In one embodiment, a siNA molecule of the invention does not contain any ribonucleotides. In another embodiment, a siNA molecule of the invention comprises one or more ribonucleotides.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof, and wherein the second strand of the double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein each strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof, and wherein the siNA further comprises a sense region, wherein the sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence of the ECGF1 and/or ECGF1r gene or a portion thereof.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the antisense region and the sense region each comprise about 19 to about 23 nucleotides, and wherein the antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the ECGF1 and/or ECGF1r gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule. The sense region can be connected to the antisense region via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by the ECGF1 and/or ECGF1r gene or a portion thereof and the sense region comprises a nucleotide sequence that is complementary to the antisense region, wherein the siNA molecule has one or more modified pyrimidine and/or purine nucleotides. In one embodiment, the pyrimidine nucleotides in the sense region are 2′-O-methyl pyrimidine nucleotides, or 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-deoxy purine nucleotides. In another embodiment, the pyrimidine nucleotides in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides. In another embodiment of any of the above described siNA molecules, any nucleotides present in a non-complementary region of the sense strand (e.g. overhang region) are 2′-deoxy nucleotides.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein the fragment comprising the sense region includes a terminal cap moiety at the 5′-end, the 3′-end, or both of the 5′ and 3′ ends of the fragment comprising the sense region. In one embodiment, the terminal cap moiety is an inverted deoxy abasic moiety or glyceryl moiety. In one embodiment, each of the two fragments of the siNA molecule comprises about 21 nucleotides.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises a sense region and an antisense region and wherein the antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence or a portion thereof of RNA encoded by the ECGF1 and/or ECGF1r gene and the sense region comprises a nucleotide sequence that is complementary to the antisense region, and wherein the purine nucleotides present in the antisense region comprise 2′-deoxy-purine nucleotides. In another embodiment, the purine nucleotides present in the antisense region comprise 2′-O-methyl purine nucleotides. In either of the above embodiments, the antisense region comprises a phosphorothioate internucleotide linkage at the 3′ end of the antisense region. In an alternative embodiment, the antisense region comprises a glyceryl modification at the 3′ end of the antisense region. In another embodiment of any of the above described siNA molecules, any nucleotides present in a non-complementary region of the antisense strand (e.g. overhang region) are 2′-deoxy nucleotides.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments each comprising 21 nucleotides, wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule, and wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherein at least two 3′ terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule. In one embodiment, each of the two 3′ terminal nucleotides of each fragment of the siNA molecule is a 2′-deoxy-pyrimidine, such as 2′-deoxy-thymidine. In another embodiment, all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule. In another embodiment, about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the ECGF1 and/or ECGF1r gene. In another embodiment, 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the ECGF1 and/or ECGF1r gene. In any of the above embodiments, the 5′-end of the fragment comprising said antisense region can optionally include a phosphate group.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits the expression of an ECGF1 and/or ECGF1r RNA sequence (e.g., wherein said target RNA sequence is encoded by an ECGF1 and/or ECGF1r gene), wherein the siNA molecule does not contain any ribonucleotides and wherein each strand of the double-stranded siNA molecule is about 21 nucleotides long.
  • In one embodiment, the invention features a medicament comprising a siNA molecule of the invention.
  • In one embodiment, the invention features an active ingredient comprising a siNA molecule of the invention.
  • In one embodiment, the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of an ECGF1 and/or ECGF1r gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double-stranded siNA is about 21 nucleotides long.
  • The invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification. In one embodiment, the nucleotide sequence of the antisense strand of the double-stranded siNA molecule is complementary to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA which encodes a protein or a portion thereof. In one embodiment, each strand of the siNA molecule comprises about 19 to about 29 nucleotides, and each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand. In one embodiment, the siNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense strand of the siNA molecule and a second fragment comprises nucleotide sequence of the sense region of the siNA molecule. In another embodiment, the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker. In one embodiment, the pyrimidine nucleotides present in the sense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-deoxy purine nucleotides. In another embodiment, the pyrimidine nucleotides present in the sense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides. In one embodiment, wherein the sense strand comprises a 3′-end and a 5′-end, a terminal cap moiety (e.g., an inverted deoxy abasic moiety) is present at the 5′-end, the 3′-end, or both of the 5′ and 3′ ends of the sense strand. In one embodiment, the antisense strand comprises one or more 2′-deoxy-2′-fluoro pyrimidine nucleotides and one or more 2′-O-methyl purine nucleotides. In one embodiment, the pyrimidine nucleotides present in the antisense strand are 2′-deoxy-2′-fluoro pyrimidine nucleotides and any purine nucleotides present in the antisense strand are 2′-O-methyl purine nucleotides. In one embodiment, the antisense strand comprises a phosphorothioate internucleotide linkage at the 3′ end of the antisense strand. In another embodiment, the antisense strand comprises a glyceryl modification at the 3′ end. In another embodiment, the 5′-end of the antisense strand optionally includes a phosphate group. In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein the nucleotide sequence of the antisense strand is complementary to a nucleotide sequence of the 5′-untranslated region or a portion thereof of the ECGF1 and/or ECGF1r RNA. In another embodiment, the nucleotide sequence of the antisense strand is complementary to a nucleotide sequence of the ECGF1 and/or ECGF1r RNA or a portion thereof.
  • In one embodiment, the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification, and wherein each of the two strands of the siNA molecule comprises 21 nucleotides. In one embodiment, about 19 nucleotides of each strand of the siNA molecule are base-paired to the complementary nucleotides of the other strand of the siNA molecule and at least two 3′ terminal nucleotides of each strand of the siNA molecule are not base-paired to the nucleotides of the other strand of the siNA molecule. In one embodiment, each of the two 3′ terminal nucleotides of each fragment of the siNA molecule are 2′-deoxy-pyrimidines, such as 2′-deoxy-thymidine. In another embodiment, each strand of the siNA molecule is base-paired to the complementary nucleotides of the other strand of the siNA molecule. In one embodiment, about 19 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA or a portion thereof. In another embodiment, 21 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the ECGF1 and/or ECGF1r RNA or a portion thereof.
  • In one embodiment, the invention features a pharmaceutical composition comprising a siNA molecule of the invention in an acceptable carrier or diluent.
  • In one embodiment, the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of an ECGF1 and/or ECGF1r gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of ECGF1 and/or ECGF1r RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
  • In a non-limiting example, the introduction of chemically-modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously. For example, the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in serum. Furthermore, certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule. Therefore, even if the activity of a chemically-modified nucleic acid molecule is reduced as compared to a native nucleic acid molecule, for example, when compared to an all-RNA nucleic acid molecule, the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule. Unlike native unmodified siNA, chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
  • In any of the embodiments of siNA molecules described herein, the antisense region of a siNA molecule of the invention can comprise a phosphorothioate internucleotide linkage at the 3′-end of said antisense region. In any of the embodiments of siNA molecules described herein, the antisense region can comprise about one to about five phosphorothioate internucleotide linkages at the 5′-end of said antisense region. In any of the embodiments of siNA molecules described herein, the 3′-terminal nucleotide overhangs of a siNA molecule of the invention can comprise ribonucleotides or deoxyribonucleotides that are chemically-modified at a nucleic acid sugar, base, or backbone. In any of the embodiments of siNA molecules described herein, the 3′-terminal nucleotide overhangs can comprise one or more universal base ribonucleotides. In any of the embodiments of siNA molecules described herein, the 3′-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
  • One embodiment of the invention provides an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention in a manner that allows expression of the nucleic acid molecule. Another embodiment of the invention provides a mammalian cell comprising such an expression vector. The mammalian cell can be a human cell. The siNA molecule of the expression vector can comprise a sense region and an antisense region. The antisense region can comprise sequence complementary to an RNA or DNA sequence encoding ECGF1 and/or ECGF1r and the sense region can comprise sequence complementary to the antisense region. The siNA molecule can comprise two distinct strands having complementary sense and antisense regions. The siNA molecule can comprise a single strand having complementary sense and antisense regions.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides comprising a backbone modified internucleotide linkage having Formula I:
    Figure US20050106726A1-20050519-C00001
      • wherein each R1 and R2 is independently any nucleotide, non-nucleotide, or polynucleotide which can be naturally-occurring or chemically-modified, each X and Y is independently O, S, N, alkyl, or substituted alkyl, each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, or aralkyl, and wherein W, X, Y, and Z are optionally not all O.
  • The chemically-modified internucleotide linkages having Formula I, for example, wherein any Z, W, X, and/or Y independently comprises a sulphur atom, can be present in one or both oligonucleotide strands of the siNA duplex, for example, in the sense strand, the antisense strand, or both strands. The siNA molecules of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) chemically-modified internucleotide linkages having Formula I at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified internucleotide linkages having Formula I at the 5′-end of the sense strand, the antisense strand, or both strands. In another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine nucleotides with chemically-modified internucleotide linkages having Formula I in the sense strand, the antisense strand, or both strands. In yet another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine nucleotides with chemically-modified internucleotide linkages having Formula I in the sense strand, the antisense strand, or both strands. In another embodiment, a siNA molecule of the invention having internucleotide linkage(s) of Formula I also comprises a chemically-modified nucleotide or non-nucleotide having any of Formulae I-VII.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula II:
    Figure US20050106726A1-20050519-C00002

    wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S═O, CHF, or CF2, and B is a nucleosidic base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-naturally occurring base that can be complementary or non-complementary to target RNA or a non-nucleosidic base such as phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine, pyridone, pyridinone, or any other non-naturally occurring universal base that can be complementary or non-complementary to target RNA.
  • The chemically-modified nucleotide or non-nucleotide of Formula II can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands. The siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula II at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 5′-end of the sense strand, the antisense strand, or both strands. In anther non-limiting example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotides or non-nucleotides of Formula II at the 3′-end of the sense strand, the antisense strand, or both strands.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) nucleotides or non-nucleotides having Formula III:
    Figure US20050106726A1-20050519-C00003

    wherein each R3, R4, R5, R6, R7, R8, R10, R11 and R12 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S═O, CHF, or CF2, and B is a nucleosidic base such as adenine, guanine, uracil, cytosine, thymine, 2-aminoadenosine, 5-methylcytosine, 2,6-diaminopurine, or any other non-naturally occurring base that can be employed to be complementary or non-complementary to target RNA or a non-nucleosidic base such as phenyl, naphthyl, 3-nitropyrrole, 5-nitroindole, nebularine, pyridone, pyridinone, or any other non-naturally occurring universal base that can be complementary or non-complementary to target RNA.
  • The chemically-modified nucleotide or non-nucleotide of Formula III can be present in one or both oligonucleotide strands of the siNA duplex, for example, in the sense strand, the antisense strand, or both strands. The siNA molecules of the invention can comprise one or more chemically-modified nucleotide or non-nucleotide of Formula III at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense strand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide(s) or non-nucleotide(s) of Formula III at the 5′-end of the sense strand, the antisense strand, or both strands. In anther non-limiting example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) chemically-modified nucleotide or non-nucleotide of Formula III at the 3′-end of the sense strand, the antisense strand, or both strands.
  • In another embodiment, a siNA molecule of the invention comprises a nucleotide having Formula II or III, wherein the nucleotide having Formula II or III is in an inverted configuration. For example, the nucleotide having Formula II or III is connected to the siNA construct in a 3′-3′,3′-2′,2′-3′, or 5′-5′ configuration, such as at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of one or both siNA strands.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a 5′-terminal phosphate group having Formula IV:
    Figure US20050106726A1-20050519-C00004

    wherein each X and Y is independently O, S, N, alkyl, substituted alkyl, or alkylhalo; wherein each Z and W is independently O, S, N, alkyl, substituted alkyl, O-alkyl, S-alkyl, alkaryl, aralkyl, or alkylhalo; and wherein W, X, Y and Z are not all 0.
  • In one embodiment, the invention features a siNA molecule having a 5′-terminal phosphate group having Formula IV on the target-complementary strand, for example, a strand complementary to a target RNA, wherein the siNA molecule comprises an all RNA siNA molecule. In another embodiment, the invention features a siNA molecule having a 5′-terminal phosphate group having Formula IV on the target-complementary strand wherein the siNA molecule also comprises about 1 to about 3 (e.g., about 1, 2, or 3) nucleotide 3′-terminal nucleotide overhangs having about 1 to about 4 (e.g., about 1, 2, 3, or 4) deoxyribonucleotides on the 3′-end of one or both strands. In another embodiment, a 5′-terminal phosphate group having Formula IV is present on the target-complementary strand of a siNA molecule of the invention, for example a siNA molecule having chemical modifications having any of Formulae I-VII.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises one or more phosphorothioate internucleotide linkages. For example, in a non-limiting example, the invention features a chemically-modified short interfering nucleic acid (siNA) having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in one siNA strand. In yet another embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) individually having about 1, 2, 3, 4, 5, 6, 7, 8 or more phosphorothioate internucleotide linkages in both siNA strands. The phosphorothioate internucleotide linkages can be present in one or both oligonucleotide strands of the siNA duplex, for example in the sense strand, the antisense strand, or both strands. The siNA molecules of the invention can comprise one or more phosphorothioate internucleotide linkages at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand, the antisense strand, or both strands. For example, an exemplary siNA molecule of the invention can comprise about 1 to about 5 or more (e.g., about 1, 2, 3, 4, 5, or more) consecutive phosphorothioate internucleotide linkages at the 5′-end of the sense strand, the antisense strand, or both strands. In another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) pyrimidine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands. In yet another non-limiting example, an exemplary siNA molecule of the invention can comprise one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) purine phosphorothioate internucleotide linkages in the sense strand, the antisense strand, or both strands.
  • In one embodiment, the invention features a siNA molecule, wherein the sense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • In another embodiment, the invention features a siNA molecule, wherein the sense strand comprises about 1 to about 5, specifically about 1, 2, 3, 4, or 5 phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without about 1 to about 5 or more, for example about 1, 2, 3, 4, 5, or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • In one embodiment, the invention features a siNA molecule, wherein the antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more phosphorothioate internucleotide linkages, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 10 or more, specifically about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends, being present in the same or different strand.
  • In another embodiment, the invention features a siNA molecule, wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the sense strand; and wherein the antisense strand comprises about 1 to about 5 or more, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) 2′-deoxy, 2′-O-methyl, 2′-deoxy-2′-fluoro, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) universal base modified nucleotides, and optionally a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of the antisense strand. In another embodiment, one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2′-deoxy, 2′-O-methyl and/or 2′-deoxy-2′-fluoro nucleotides, with or without about 1 to about 5, for example about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends, being present in the same or different strand.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule having about 1 to about 5, specifically about 1, 2, 3, 4, 5 or more phosphorothioate internucleotide linkages in each strand of the siNA molecule.
  • In another embodiment, the invention features a siNA molecule comprising 2′-5′ internucleotide linkages. The 2′-5′ internucleotide linkage(s) can be at the 3′-end, the 5′-end, or both of the 3′- and 5′-ends of one or both siNA sequence strands. In addition, the 2′-5′ internucleotide linkage(s) can be present at various other positions within one or both siNA sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a pyrimidine nucleotide in one or both strands of the siNA molecule can comprise a 2′-5′ internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a purine nucleotide in one or both strands of the siNA molecule can comprise a 2′-5′ internucleotide linkage.
  • In another embodiment, a chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified, wherein each strand is about 18 to about 27 (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, or 27) nucleotides in length, wherein the duplex has about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the chemical modification comprises a structure having any of Formulae I-VII. For example, an exemplary chemically-modified siNA molecule of the invention comprises a duplex having two strands, one or both of which can be chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein each strand consists of about 21 nucleotides, each having a 2-nucleotide 3′-terminal nucleotide overhang, and wherein the duplex has about 19 base pairs. In another embodiment, a siNA molecule of the invention comprises a single stranded hairpin structure, wherein the siNA is about 36 to about 70 (e.g., about 36, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification comprising a structure having any of Formulae I-VII or any combination thereof. For example, an exemplary chemically-modified siNA molecule of the invention comprises a linear oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the linear oligonucleotide forms a hairpin structure having about 19 base pairs and a 2-nucleotide 3′-terminal nucleotide overhang. In another embodiment, a linear hairpin siNA molecule of the invention contains a stem loop motif, wherein the loop portion of the siNA molecule is biodegradable. For example, a linear hairpin siNA molecule of the invention is designed such that degradation of the loop portion of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3′-terminal overhangs, such as 3′-terminal nucleotide overhangs comprising about 2 nucleotides.
  • In another embodiment, a siNA molecule of the invention comprises a circular nucleic acid molecule, wherein the siNA is about 38 to about 70 (e.g., about 38, 40, 45, 50, 55, 60, 65, or 70) nucleotides in length having about 18 to about 23 (e.g., about 18, 19, 20, 21, 22, or 23) base pairs, and wherein the siNA can include a chemical modification, which comprises a structure having any of Formulae I-VII or any combination thereof. For example, an exemplary chemically-modified siNA molecule of the invention comprises a circular oligonucleotide having about 42 to about 50 (e.g., about 42, 43, 44, 45, 46, 47, 48, 49, or 50) nucleotides that is chemically-modified with a chemical modification having any of Formulae I-VII or any combination thereof, wherein the circular oligonucleotide forms a dumbbell shaped structure having about 19 base pairs and 2 loops.
  • In another embodiment, a circular siNA molecule of the invention contains two loop motifs, wherein one or both loop portions of the siNA molecule is biodegradable. For example, a circular siNA molecule of the invention is designed such that degradation of the loop portions of the siNA molecule in vivo can generate a double-stranded siNA molecule with 3′-terminal overhangs, such as 3′-terminal nucleotide overhangs comprising about 2 nucleotides.
  • In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) abasic moiety, for example a compound having Formula V:
    Figure US20050106726A1-20050519-C00005

    wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S═O, CHF, or CF2.
  • In one embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) inverted abasic moiety, for example a compound having Formula VI:
    Figure US20050106726A1-20050519-C00006

    wherein each R3, R4, R5, R6, R7, R8, R10, R11, R12, and R13 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or group having Formula I; R9 is O, S, CH2, S═O, CHF, or CF2, and either R2, R3, R8 or R13 serve as points of attachment to the siNA molecule of the invention.
  • In another embodiment, a siNA molecule of the invention comprises at least one (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) substituted polyalkyl moieties, for example a compound having Formula VII:
    Figure US20050106726A1-20050519-C00007

    wherein each n is independently an integer from 1 to 12, each R1, R2 and R3 is independently H, OH, alkyl, substituted alkyl, alkaryl or aralkyl, F, Cl, Br, CN, CF3, OCF3, OCN, O-alkyl, S-alkyl, N-alkyl, O-alkenyl, S-alkenyl, N-alkenyl, SO-alkyl, alkyl-OSH, alkyl-OH, O-alkyl-OH, O-alkyl-SH, S-alkyl-OH, S-alkyl-SH, alkyl-S-alkyl, alkyl-O-alkyl, ONO2, NO2, N3, NH2, aminoalkyl, aminoacid, aminoacyl, ONH2, O-aminoalkyl, O-aminoacid, O-aminoacyl, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalklylamino, substituted silyl, or a group having Formula I, and R1, R2 or R3 serves as points of attachment to the siNA molecule of the invention.
  • In another embodiment, the invention features a compound having Formula VII, wherein R1 and R2 are hydroxyl (OH) groups, n=1, and R3 comprises 0 and is the point of attachment to the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of one or both strands of a double-stranded siNA molecule of the invention or to a single-stranded siNA molecule of the invention. This modification is referred to herein as “glyceryl” (for example modification 6 in FIG. 10).
  • In another embodiment, a moiety having any of Formula V, VI or VII of the invention is at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of a siNA molecule of the invention. For example, a moiety having Formula V, VI or VII can be present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense strand, the sense strand, or both antisense and sense strands of the siNA molecule. In addition, a moiety having Formula VII can be present at the 3′-end or the 5′-end of a hairpin siNA molecule as described herein.
  • In another embodiment, a siNA molecule of the invention comprises an abasic residue having Formula V or VI, wherein the abasic residue having Formula VI or VI is connected to the siNA construct in a 3′-3′, 3′-2′, 2′-3′, or 5′-5′ configuration, such as at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of one or both siNA strands.
  • In one embodiment, a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acid (LNA) nucleotides, for example at the 5′-end, the 3′-end, both of the 5′ and 3′-ends, or any combination thereof, of the siNA molecule.
  • In another embodiment, a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example at the 5′-end, the 3′-end, both of the 5′ and 3′-ends, or any combination thereof, of the siNA molecule.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2′-deoxy purine nucleotides).
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2′-deoxy purine nucleotides), wherein any nucleotides comprising a 3′-terminal nucleotide overhang that are present in said sense region are 2′-deoxy nucleotides.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides).
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises a sense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), wherein any nucleotides comprising a 3′-terminal nucleotide overhang that are present in said sense region are 2′-deoxy nucleotides.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides).
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), wherein any nucleotides comprising a 3′-terminal nucleotide overhang that are present in said antisense region are 2′-deoxy nucleotides.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2′-deoxy purine nucleotides).
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein the chemically-modified siNA comprises an antisense region, where any (e.g., one or more or all) pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where any (e.g., one or more or all) purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides).
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2′-deoxy purine nucleotides), and inverted deoxy abasic modifications that are optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense region, the sense region optionally further comprising a 3′-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxyribonucleotides; and wherein the chemically-modified short interfering nucleic acid molecule comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein one or more purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting examples of these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and inverted deoxy abasic modifications that are optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense region, the sense region optionally further comprising a 3′-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxyribonucleotides; and wherein the chemically-modified short interfering nucleic acid molecule comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein one or more purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting examples of these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and where one or more purine nucleotides present in the sense region are purine ribonucleotides (e.g., wherein all purine nucleotides are purine ribonucleotides or alternately a plurality of purine nucleotides are purine ribonucleotides), and inverted deoxy abasic modifications that are optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense region, the sense region optionally further comprising a 3′-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxyribonucleotides; and wherein the siNA comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages. Non-limiting examples of these chemically-modified siNAs are shown in FIGS. 4 and 5 and Tables III and IV herein.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemically-modified siNA comprises a sense region, where one or more pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and for example where one or more purine nucleotides present in the sense region are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides (e.g., wherein all purine nucleotides are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides or alternately a plurality of purine nucleotides are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides), and wherein inverted deoxy abasic modifications are optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the sense region, the sense region optionally further comprising a 3′-terminal overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxyribonucleotides; and wherein the chemically-modified short interfering nucleic acid molecule comprises an antisense region, where one or more pyrimidine nucleotides present in the antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein one or more purine nucleotides present in the antisense region are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides (e.g., wherein all purine nucleotides are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides or alternately a plurality of purine nucleotides are selected from the group consisting of 2′-deoxy nucleotides, locked nucleic acid (LNA) nucleotides, 2′-methoxyethyl nucleotides, 4′-thionucleotides, and 2′-O-methyl nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the antisense region optionally further comprising a 3′-terminal nucleotide overhang having about 1 to about 4 (e.g., about 1, 2, 3, or 4) 2′-deoxynucleotides, wherein the overhang nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages.
  • In another embodiment, any modified nucleotides present in the siNA molecules of the invention, preferably in the antisense strand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense strands, comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides. For example, the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984). As such, chemically modified nucleotides present in the siNA molecules of the invention, preferably in the antisense strand of the siNA molecules of the invention, but also optionally in the sense and/or both antisense and sense strands, are resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi. Non-limiting examples of nucleotides having a northern configuration include locked nucleic acid (LNA) nucleotides (e.g., 2′-O, 4′-C-methylene-(D-ribofuranosyl) nucleotides); 2′-methoxyethoxy (MOE) nucleotides; 2′-methyl-thio-ethyl, 2′-deoxy-2′-fluoro nucleotides, 2′-deoxy-2′-chloro nucleotides, 2′-azido nucleotides, and 2′-O-methyl nucleotides.
  • In one embodiment, the invention features a chemically-modified short interfering nucleic acid molecule (siNA) capable of mediating RNA interference (RNAi) against an ECGF1 and/or ECGF1r inside a cell or reconstituted in vitro system, wherein the chemical modification comprises a conjugate covalently attached to the chemically-modified siNA molecule. In another embodiment, the conjugate is covalently attached to the chemically-modified siNA molecule via a biodegradable linker. In one embodiment, the conjugate molecule is attached at the 3′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In another embodiment, the conjugate molecule is attached at the 5′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule. In yet another embodiment, the conjugate molecule is attached both the 3′-end and 5′-end of either the sense strand, the antisense strand, or both strands of the chemically-modified siNA molecule, or any combination thereof. In one embodiment, a conjugate molecule of the invention comprises a molecule that facilitates delivery of a chemically-modified siNA molecule into a biological system, such as a cell. In another embodiment, the conjugate molecule attached to the chemically-modified siNA molecule is a polyethylene glycol, human serum albumin, or a ligand for a cellular receptor that can mediate cellular uptake. Examples of specific conjugate molecules contemplated by the instant invention that can be attached to chemically-modified siNA molecules are described in Vargeese et al., U.S. Ser. No. 10/201,394, incorporated by reference herein. The type of conjugates used and the extent of conjugation of siNA molecules of the invention can be evaluated for improved pharmacokinetic profiles, bioavailability, and/or stability of siNA constructs while at the same time maintaining the ability of the siNA to mediate RNAi activity. As such, one skilled in the art can screen siNA constructs that are modified with various conjugates to determine whether the siNA conjugate complex possesses improved properties while maintaining the ability to mediate RNAi, for example, in animal models as are generally known in the art.
  • In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule of the invention, wherein the siNA further comprises a nucleotide, non-nucleotide, or mixed nucleotide/non-nucleotide linker that joins the sense region of the siNA to the antisense region of the siNA. In one embodiment, a nucleotide linker of the invention can be a linker of ≧2 nucleotides in length, for example 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In another embodiment, the nucleotide linker can be a nucleic acid aptamer. By “aptamer” or “nucleic acid aptamer” as used herein is meant a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that comprises a sequence recognized by the target molecule in its natural setting. Alternately, an aptamer can be a nucleic acid molecule that binds to a target molecule where the target molecule does not naturally bind to a nucleic acid. The target molecule can be any molecule of interest. For example, the aptamer can be used to bind to a ligand-binding domain of a protein, thereby preventing interaction of the naturally occurring ligand with the protein. This is a non-limiting example and those in the art will recognize that other embodiments can be readily generated using techniques generally known in the art. (See, for example, Gold et al., 1995, Annu. Rev. Biochem., 64, 763; Brody and Gold, 2000, J. Biotechnol., 74, 5; Sun, 2000, Curr. Opin. Mol. Ther., 2, 100; Kusser, 2000, J. Biotechnol., 74, 27; Hermann and Patel, 2000, Science, 287, 820; and Jayasena, 1999, Clinical Chemistry, 45, 1628.)
  • In yet another embodiment, a non-nucleotide linker of the invention comprises abasic nucleotide, polyether, polyamine, polyamide, peptide, carbohydrate, lipid, polyhydrocarbon, or other polymeric compounds (e.g. polyethylene glycols such as those having between 2 and 100 ethylene glycol units). Specific examples include those described by Seela and Kaiser, Nucleic Acids Res. 1990, 18:6353 and Nucleic Acids Res. 1987, 15:3113; Cload and Schepartz, J. Am. Chem. Soc. 1991, 113:6324; Richardson and Schepartz, J. Am. Chem. Soc. 1991, 113:5109; Ma et al., Nucleic Acids Res. 1993, 21:2585 and Biochemistry 1993, 32:1751; Durand et al., Nucleic Acids Res. 1990, 18:6353; McCurdy et al., Nucleosides &Nucleotides 1991, 10:287; Jschke et al., Tetrahedron Lett. 1993, 34:301; Ono et al., Biochemistry 1991, 30:9914; Arnold et al., International Publication No. WO 89/02439; Usman et al., International Publication No. WO 95/06731; Dudycz et al., International Publication No. WO 95/11910 and Ferentz and Verdine, J. Am. Chem. Soc. 1991, 113:4000, all hereby incorporated by reference herein. A “non-nucleotide” further means any group or compound that can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound can be abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine, for example at the C1 position of the sugar.
  • In one embodiment, the invention features a short interfering nucleic acid (siNA) molecule capable of mediating RNA interference (RNAi) inside a cell or reconstituted in vitro system, wherein one or both strands of the siNA molecule that are assembled from two separate oligonucleotides do not comprise any ribonucleotides. For example, a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA comprise separate oligonucleotides that do not have any ribonucleotides (e.g., nucleotides having a 2′-OH group) present in the oligonucleotides. In another example, a siNA molecule can be assembled from a single oligonculeotide where the sense and antisense regions of the siNA are linked or circularized by a nucleotide or non-nucleotide linker as desrcibed herein, wherein the oligonucleotide does not have any ribonucleotides (e.g., nucleotides having a 2′-OH group) present in the oligonucleotide. Applicant has surprisingly found that the presense of ribonucleotides (e.g., nucleotides having a 2′-hydroxyl group) within the siNA molecule is not required or essential to support RNAi activity. As such, in one embodiment, all positions within the siNA can include chemically modified nucleotides and/or non-nucleotides such as nucleotides and or non-nucleotides having Formula I, II, III, IV, V, VI, or VII or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence. In another embodiment, the single stranded siNA molecule of the invention comprises a 5′-terminal phosphate group. In another embodiment, the single stranded siNA molecule of the invention comprises a 5′-terminal phosphate group and a 3′-terminal phosphate group (e.g., a 2′,3′-cyclic phosphate). In another embodiment, the single stranded siNA molecule of the invention comprises about 19 to about 29 nucleotides. In yet another embodiment, the single stranded siNA molecule of the invention comprises one or more chemically modified nucleotides or non-nucleotides described herein. For example, all the positions within the siNA molecule can include chemically-modified nucleotides such as nucleotides having any of Formulae I-VII, or any combination thereof to the extent that the ability of the siNA molecule to support RNAi activity in a cell is maintained.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the antisense region are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-O-methyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-O-methyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-O-methyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-deoxy purine nucleotides (e.g., wherein all purine nucleotides are 2′-deoxy purine nucleotides or alternately a plurality of purine nucleotides are 2′-deoxy purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are locked nucleic acid (LNA) nucleotides (e.g., wherein all purine nucleotides are LNA nucleotides or alternately a plurality of purine nucleotides are LNA nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • In one embodiment, a siNA molecule of the invention is a single stranded siNA molecule that mediates RNAi activity in a cell or reconstituted in vitro system, wherein the siNA molecule comprises a single stranded polynucleotide having complementarity to a target nucleic acid sequence, and wherein one or more pyrimidine nucleotides present in the siNA are 2′-deoxy-2′-fluoro pyrimidine nucleotides (e.g., wherein all pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides or alternately a plurality of pyrimidine nucleotides are 2′-deoxy-2′-fluoro pyrimidine nucleotides), and wherein any purine nucleotides present in the siNA are 2′-methoxyethyl purine nucleotides (e.g., wherein all purine nucleotides are 2′-methoxyethyl purine nucleotides or alternately a plurality of purine nucleotides are 2′-methoxyethyl purine nucleotides), and a terminal cap modification, such as any modification described herein or shown in FIG. 10, that is optionally present at the 3′-end, the 5′-end, or both of the 3′ and 5′-ends of the antisense sequence, the siNA optionally further comprising about 1 to about 4 (e.g., about 1, 2, 3, or 4) terminal 2′-deoxynucleotides at the 3′-end of the siNA molecule, wherein the terminal nucleotides can further comprise one or more (e.g., 1, 2, 3, or 4) phosphorothioate internucleotide linkages, and wherein the siNA optionally further comprises a terminal phosphate group, such as a 5′-terminal phosphate group.
  • In another embodiment, any modified nucleotides present in the single stranded siNA molecules of the invention comprise modified nucleotides having properties or characteristics similar to naturally occurring ribonucleotides. For example, the invention features siNA molecules including modified nucleotides having a Northern conformation (e.g., Northern pseudorotation cycle, see for example Saenger, Principles of Nucleic Acid Structure, Springer-Verlag ed., 1984). As such, chemically modified nucleotides present in the single stranded siNA molecules of the invention are preferably resistant to nuclease degradation while at the same time maintaining the capacity to mediate RNAi.
  • In one embodiment, the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • In one embodiment, the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • In another embodiment, the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • In another embodiment, the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecules into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • In one embodiment, siNA molecules of the invention are used as reagents in ex vivo applications. For example, siNA reagents are intoduced into tissue or cells that are transplanted into a subject for therapeutic effect. The cells and/or tissue can be derived from an organism or subject that later receives the explant, or can be derived from another organism or subject prior to transplantation. The siNA molecules can be used to modulate the expression of one or more genes in the cells or tissue, such that the cells or tissue obtain a desired phenotype or are able to perform a function when transplanted in vivo. In one embodiment, certain target cells from a patient are extracted. These extracted cells are contacted with siNAs targeting a specific nucleotide sequence within the cells under conditions suitable for uptake of the siNAs by these cells (e.g. using delivery reagents such as cationic lipids, liposomes and the like or using techniques such as electroporation to facilitate the delivery of siNAs into cells). The cells are then reintroduced back into the same patient or other patients. In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene and wherein the sense strand sequence of the siNA comprises a sequence identical to the sequence of the target RNA; and (b) introducing the siNA molecule into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • In another embodiment, the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in that organism.
  • In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • In another embodiment, the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the ECGF1 and/or ECGF1r genes; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • In one embodiment, the invention features a method for modulating the expression of an ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the cell.
  • In another embodiment, the invention features a method for modulating the expression of more than one ECGF1 and/or ECGF1r gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) contacting the siNA molecule with a cell in vitro or in vivo under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the cell.
  • In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) contacting the siNA molecule with a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in that organism.
  • In another embodiment, the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in a tissue explant comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecules into a cell of the tissue explant derived from a particular organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the tissue explant. In another embodiment, the method further comprises introducing the tissue explant back into the organism the tissue was derived from or into another organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in that organism.
  • In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecule into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • In another embodiment, the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the ECGF1 and/or ECGF1r gene; and (b) introducing the siNA molecules into the organism under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • In one embodiment, the invention features a method of modulating the expression of an ECGF1 and/or ECGF1r gene in an organism comprising contacting the organism with a siNA molecule of the invention under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r gene in the organism.
  • In another embodiment, the invention features a method of modulating the expression of more than one ECGF1 and/or ECGF1r gene in an organism comprising contacting the organism with one or more siNA molecules of the invention under conditions suitable to modulate the expression of the ECGF1 and/or ECGF1r genes in the organism.
  • The siNA molecules of the invention can be designed to down-regulate or inhibit target (ECGF1 and/or ECGF1r) gene expression through RNAi targeting of a variety of RNA molecules. In one embodiment, the siNA molecules of the invention are used to target various RNAs corresponding to a target gene. Non-limiting examples of such RNAs include messenger RNA (mRNA), alternate RNA splice variants of target gene(s), post-transcriptionally modified RNA of target gene(s), pre-mRNA of target gene(s), and/or RNA templates. If alternate splicing produces a family of transcripts that are distinguished by usage of appropriate exons, the instant invention can be used to inhibit gene expression through the appropriate exons to specifically inhibit or to distinguish among the functions of gene family members. For example, a protein that contains an alternatively spliced transmembrane domain can be expressed in both membrane bound and secreted forms. Use of the invention to target the exon containing the transmembrane domain can be used to determine the functional consequences of pharmaceutical targeting of membrane bound as opposed to the secreted form of the protein. Non-limiting examples of applications of the invention relating to targeting these RNA molecules include therapeutic pharmaceutical applications, pharmaceutical discovery applications, molecular diagnostic and gene function applications, and gene mapping, for example using single nucleotide polymorphism mapping with siNA molecules of the invention. Such applications can be implemented using known gene sequences or from partial sequences available from an expressed sequence tag (EST).
  • In another embodiment, the siNA molecules of the invention are used to target conserved sequences corresponding to a gene family or gene families such as ECGF1 and/or ECGF1r family genes. As such, siNA molecules targeting multiple ECGF1 and/or ECGF1r targets can provide increased therapeutic effect. In addition, siNA can be used to characterize pathways of gene function in a variety of applications. For example, the present invention can be used to inhibit the activity of target gene(s) in a pathway to determine the function of uncharacterized gene(s) in gene function analysis, mRNA function analysis, or translational analysis. The invention can be used to determine potential target gene pathways involved in various diseases and conditions toward pharmaceutical development. The invention can be used to understand pathways of gene expression involved in, for example, the progression and/or maintenance of cancer.
  • In one embodiment, siNA molecule(s) and/or methods of the invention are used to down-regulate the expression of gene(s) that encode RNA referred to by Genbank Accession, for example ECGF1 and/or ECGF1r genes encoding RNA sequence(s) referred to herein by Genbank Accession number, for example, Genbank Accession Nos. shown in Table I.
  • In one embodiment, the invention features a method comprising: (a) generating a library of siNA constructs having a predetermined complexity; and (b) assaying the siNA constructs of (a) above, under conditions suitable to determine RNAi target sites within the target RNA sequence. In one embodiment, the siNA molecules of (a) have strands of a fixed length, for example, about 23 nucleotides in length. In another embodiment, the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. In another embodiment, fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by cellular expression in in vivo systems.
  • In one embodiment, the invention features a method comprising: (a) generating a randomized library of siNA constructs having a predetermined complexity, such as of 4N, where N represents the number of base paired nucleotides in each of the siNA construct strands (eg. for a siNA construct having 21 nucleotide sense and antisense strands with 19 base pairs, the complexity would be 419); and (b) assaying the siNA constructs of (a) above, under conditions suitable to determine RNAi target sites within the target ECGF1 and/or ECGF1r RNA sequence. In another embodiment, the siNA molecules of (a) have strands of a fixed length, for example about 23 nucleotides in length. In yet another embodiment, the siNA molecules of (a) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described in Example 7 herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. In another embodiment, fragments of ECGF1 and/or ECGF1r RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target ECGF1 and/or ECGF1r RNA sequence. The target ECGF1 and/or ECGF1r RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by cellular expression in in vivo systems.
  • In another embodiment, the invention features a method comprising: (a) determining the sequence of a RNA target encoded by a target gene; (b) synthesizing one or more sets of siNA molecules having sequence complementary to one or more regions of the RNA of (a); and (c) assaying the siNA molecules of (b) under conditions suitable to determine RNAi targets within the target RNA sequence. In one embodiment, the siNA molecules of (b) have strands of a fixed length, for example about 23 nucleotides in length. In another embodiment, the siNA molecules of (b) are of differing length, for example having strands of about 19 to about 25 (e.g., about 19, 20, 21, 22, 23, 24, or 25) nucleotides in length. In one embodiment, the assay can comprise a reconstituted in vitro siNA assay as described herein. In another embodiment, the assay can comprise a cell culture system in which target RNA is expressed. Fragments of target RNA are analyzed for detectable levels of cleavage, for example by gel electrophoresis, northern blot analysis, or RNAse protection assays, to determine the most suitable target site(s) within the target RNA sequence. The target RNA sequence can be obtained as is known in the art, for example, by cloning and/or transcription for in vitro systems, and by expression in in vivo systems.
  • By “target site” is meant a sequence within a target RNA that is “targeted” for cleavage mediated by a siNA construct which contains sequences within its antisense region that are complementary to the target sequence.
  • By “detectable level of cleavage” is meant cleavage of target RNA (and formation of cleaved product RNAs) to an extent sufficient to discern cleavage products above the background of RNAs produced by random degradation of the target RNA. Production of cleavage products from 1-5% of the target RNA is sufficient to detect above the background for most methods of detection.
  • In one embodiment, the invention features a composition comprising a siNA molecule of the invention, which can be chemically-modified, in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a pharmaceutical composition comprising siNA molecules of the invention, which can be chemically-modified, targeting one or more genes in a pharmaceutically acceptable carrier or diluent. In another embodiment, the invention features a method for diagnosing a disease or condition in a subject comprising administering to the subject a composition of the invention under conditions suitable for the diagnosis of the disease or condition in the subject. In another embodiment, the invention features a method for treating or preventing a disease or condition in a subject, comprising administering to the subject a composition of the invention under conditions suitable for the treatment or prevention of the disease or condition in the subject, alone or in conjunction with one or more other therapeutic compounds. In yet another embodiment, the invention features a method for reducing or preventing tissue rejection in a subject comprising administering to the subject a composition of the invention under conditions suitable for the reduction or prevention of tissue rejection in the subject.
  • In another embodiment, the invention features a method for validating an ECGF1 and/or ECGF1r gene target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of an ECGF1 and/or ECGF1r target gene; (b) introducing the siNA molecule into a cell, tissue, or organism under conditions suitable for modulating expression of the ECGF1 and/or ECGF1r target gene in the cell, tissue, or organism; and (c) determining the function of the gene by assaying for any phenotypic change in the cell, tissue, or organism.
  • In another embodiment, the invention features a method for validating an ECGF1 and/or ECGF1r target comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands includes a sequence complementary to RNA of an ECGF1 and/or ECGF1r target gene; (b) introducing the siNA molecule into a biological system under conditions suitable for modulating expression of the ECGF1 and/or ECGF1r target gene in the biological system; and (c) determining the function of the gene by assaying for any phenotypic change in the biological system.
  • By “biological system” is meant, material, in a purified or unpurified form, from biological sources, including but not limited to human, animal, plant, insect, bacterial, viral or other sources, wherein the system comprises the components required for RNAi acitivity. The term “biological system” includes, for example, a cell, tissue, or organism, or extract thereof. The term biological system also includes reconstituted RNAi systems that can be used in an in vitro setting.
  • By “phenotypic change” is meant any detectable change to a cell that occurs in response to contact or treatment with a nucleic acid molecule of the invention (e.g., siNA). Such detectable changes include, but are not limited to, changes in shape, size, proliferation, motility, protein expression or RNA expression or other physical or chemical changes as can be assayed by methods known in the art. The detectable change can also include expression of reporter genes/molecules such as Green Florescent Protein (GFP) or various tags that are used to identify an expressed protein or any other cellular component that can be assayed.
  • In one embodiment, the invention features a kit containing a siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of an ECGF1 and/or ECGF1r target gene in a biological system, including, for example, in a cell, tissue, or organism. In another embodiment, the invention features a kit containing more than one siNA molecule of the invention, which can be chemically-modified, that can be used to modulate the expression of more than one ECGF1 and/or ECGF1r target gene in a biological system, including, for example, in a cell, tissue, or organism.
  • In one embodiment, the invention features a cell containing one or more siNA molecules of the invention, which can be chemically-modified. In another embodiment, the cell containing a siNA molecule of the invention is a mammalian cell. In yet another embodiment, the cell containing a siNA molecule of the invention is a human cell.
  • In one embodiment, the synthesis of a siNA molecule of the invention, which can be chemically-modified, comprises: (a) synthesis of two complementary strands of the siNA molecule; (b) annealing the two complementary strands together under conditions suitable to obtain a double-stranded siNA molecule. In another embodiment, synthesis of the two complementary strands of the siNA molecule is by solid phase oligonucleotide synthesis. In yet another embodiment, synthesis of the two complementary strands of the siNA molecule is by solid phase tandem oligonucleotide synthesis.
  • In one embodiment, the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing a first oligonucleotide sequence strand of the siNA molecule, wherein the first oligonucleotide sequence strand comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of the second oligonucleotide sequence strand of the siNA; (b) synthesizing the second oligonucleotide sequence strand of siNA on the scaffold of the first oligonucleotide sequence strand, wherein the second oligonucleotide sequence strand further comprises a chemical moiety than can be used to purify the siNA duplex; (c) cleaving the linker molecule of (a) under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex; and (d) purifying the siNA duplex utilizing the chemical moiety of the second oligonucleotide sequence strand. In one embodiment, cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example, under hydrolysis conditions using an alkylamine base such as methylamine. In one embodiment, the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold. The cleavable linker in (a) used as a scaffold for synthesizing the second strand can comprise similar reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place concomitantly. In another embodiment, the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group, which can be employed in a trityl-on synthesis strategy as described herein. In yet another embodiment, the chemical moiety, such as a dimethoxytrityl group, is removed during purification, for example, using acidic conditions.
  • In a further embodiment, the method for siNA synthesis is a solution phase synthesis or hybrid phase synthesis wherein both strands of the siNA duplex are synthesized in tandem using a cleavable linker attached to the first sequence which acts a scaffold for synthesis of the second sequence. Cleavage of the linker under conditions suitable for hybridization of the separate siNA sequence strands results in formation of the double-stranded siNA molecule.
  • In another embodiment, the invention features a method for synthesizing a siNA duplex molecule comprising: (a) synthesizing one oligonucleotide sequence strand of the siNA molecule, wherein the sequence comprises a cleavable linker molecule that can be used as a scaffold for the synthesis of another oligonucleotide sequence; (b) synthesizing a second oligonucleotide sequence having complementarity to the first sequence strand on the scaffold of (a), wherein the second sequence comprises the other strand of the double-stranded siNA molecule and wherein the second sequence further comprises a chemical moiety than can be used to isolate the attached oligonucleotide sequence; (c) purifying the product of (b) utilizing the chemical moiety of the second oligonucleotide sequence strand under conditions suitable for isolating the full-length sequence comprising both siNA oligonucleotide strands connected by the cleavable linker and under conditions suitable for the two siNA oligonucleotide strands to hybridize and form a stable duplex. In one embodiment, cleavage of the linker molecule in (c) above takes place during deprotection of the oligonucleotide, for example under hydrolysis conditions. In another embodiment, cleavage of the linker molecule in (c) above takes place after deprotection of the oligonucleotide. In another embodiment, the method of synthesis comprises solid phase synthesis on a solid support such as controlled pore glass (CPG) or polystyrene, wherein the first sequence of (a) is synthesized on a cleavable linker, such as a succinyl linker, using the solid support as a scaffold. The cleavable linker in (a) used as a scaffold for synthesizing the second strand can comprise similar reactivity or differing reactivity as the solid support derivatized linker, such that cleavage of the solid support derivatized linker and the cleavable linker of (a) takes place either concomitantly or sequentially. In one embodiment, the chemical moiety of (b) that can be used to isolate the attached oligonucleotide sequence comprises a trityl group, for example a dimethoxytrityl group.
  • In another embodiment, the invention features a method for making a double-stranded siNA molecule in a single synthetic process comprising: (a) synthesizing an oligonucleotide having a first and a second sequence, wherein the first sequence is complementary to the second sequence, and the first oligonucleotide sequence is linked to the second sequence via a cleavable linker, and wherein a terminal 5′-protecting group, for example, a 5′-O-dimethoxytrityl group (5′-O-DMT) remains on the oligonucleotide having the second sequence; (b) deprotecting the oligonucleotide whereby the deprotection results in the cleavage of the linker joining the two oligonucleotide sequences; and (c) purifying the product of (b) under conditions suitable for isolating the double-stranded siNA molecule, for example using a trityl-on synthesis strategy as described herein.
  • In another embodiment, the method of synthesis of siNA molecules of the invention comprises the teachings of Scaringe et al., U.S. Pat. Nos. 5,889,136; 6,008,400; and 6,111,086, incorporated by reference herein in their entirety.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications, for example, one or more chemical modifications having any of Formulae I-VII or any combination thereof that increases the nuclease resistance of the siNA construct.
  • In another embodiment, the invention features a method for generating siNA molecules with increased nuclease resistance comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased nuclease resistance.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the sense and antisense strands of the siNA construct.
  • In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the sense and antisense strands of the siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the sense and antisense strands of the siNA molecule.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target RNA sequence within a cell.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the binding affinity between the antisense strand of the siNA construct and a complementary target DNA sequence within a cell.
  • In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target RNA sequence.
  • In another embodiment, the invention features a method for generating siNA molecules with increased binding affinity between the antisense strand of the siNA molecule and a complementary target DNA sequence comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having increased binding affinity between the antisense strand of the siNA molecule and a complementary target DNA sequence.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulate the polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA construct.
  • In another embodiment, the invention features a method for generating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to a chemically-modified siNA molecule comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules capable of mediating increased polymerase activity of a cellular polymerase capable of generating additional endogenous siNA molecules having sequence homology to the chemically-modified siNA molecule.
  • In one embodiment, the invention features chemically-modified siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r in a cell, wherein the chemical modifications do not significantly effect the interaction of siNA with a target RNA molecule, DNA molecule and/or proteins or other factors that are essential for RNAi in a manner that would decrease the efficacy of RNAi mediated by such siNA constructs.
  • In another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against ECGF1 and/or ECGF1r comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity.
  • In yet another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against an ECGF1 and/or ECGF1r target RNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target RNA.
  • In yet another embodiment, the invention features a method for generating siNA molecules with improved RNAi activity against an ECGF1 and/or ECGF1r target DNA comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved RNAi activity against the target DNA.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that modulates the cellular uptake of the siNA construct.
  • In another embodiment, the invention features a method for generating siNA molecules against ECGF1 and/or ECGF1r with improved cellular uptake comprising (a) introducing nucleotides having any of Formula I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved cellular uptake.
  • In one embodiment, the invention features siNA constructs that mediate RNAi against an ECGF1 and/or ECGF1r, wherein the siNA construct comprises one or more chemical modifications described herein that increases the bioavailability of the siNA construct, for example, by attaching polymeric conjugates such as polyethyleneglycol or equivalent conjugates that improve the pharmacokinetics of the siNA construct, or by attaching conjugates that target specific tissue types or cell types in vivo. Non-limiting examples of such conjugates are described in Vargeese et al., U.S. Ser. No. 10/201,394 incorporated by reference herein.
  • In one embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing a conjugate into the structure of a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability. Such conjugates can include ligands for cellular receptors, such as peptides derived from naturally occurring protein ligands; protein localization sequences, including cellular ZIP code sequences; antibodies; nucleic acid aptamers; vitamins and other co-factors, such as folate and N-acetylgalactosamine; polymers, such as polyethyleneglycol (PEG); phospholipids; polyamines, such as spermine or spermidine; and others.
  • In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing an excipient formulation to a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability. Such excipients include polymers such as cyclodextrins, lipids, cationic lipids, polyamines, phospholipids, and others.
  • In another embodiment, the invention features a method for generating siNA molecules of the invention with improved bioavailability comprising (a) introducing nucleotides having any of Formulae I-VII or any combination thereof into a siNA molecule, and (b) assaying the siNA molecule of step (a) under conditions suitable for isolating siNA molecules having improved bioavailability.
  • In another embodiment, polyethylene glycol (PEG) can be covalently attached to siNA compounds of the present invention. The attached PEG can be any molecular weight, preferably from about 2,000 to about 50,000 daltons (Da).
  • The present invention can be used alone or as a component of a kit having at least one of the reagents necessary to carry out the in vitro or in vivo introduction of RNA to test samples and/or subjects. For example, preferred components of the kit include a siNA molecule of the invention and a vehicle that promotes introduction of the siNA into cells of interest as described herein (e.g., using lipids and other methods of transfection known in the art, see for example Beigelman et al, U.S. Pat. No. 6,395,713). The kit can be used for target validation, such as in determining gene function and/or activity, or in drug optimization, and in drug discovery (see for example Usman et al., U.S. Ser. No. 60/402,996). Such a kit can also include instructions to allow a user of the kit to practice the invention.
  • The term “short interfering nucleic acid”, “siNA”, “short interfering RNA”, “siRNA”, “short interfering nucleic acid molecule”, “short interfering oligonucleotide molecule”, or “chemically-modified short interfering nucleic acid molecule” as used herein refers to any nucleic acid molecule capable of inhibiting or down regulating gene expression, for example by mediating RNA interference “RNAi” or gene silencing in a sequence-specific manner; see for example Bass, 2001, Nature, 411, 428-429; Elbashir et al., 2001, Nature, 411, 494-498; and Kreutzer et al., International PCT Publication No. WO 00/44895; Zernicka-Goetz et al., International PCT Publication No. WO 01/36646; Fire, International PCT Publication No. WO 99/32619; Plaetinck et al., International PCT Publication No. WO 00/01846; Mello and Fire, International PCT Publication No. WO 01/29058; Deschamps-Depaillette, International PCT Publication No. WO 99/07409; and Li et al., International PCT Publication No. WO 00/44914; Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237; Hutvagner and Zamore, 2002, Science, 297, 2056-60; McManus et al., 2002, RNA, 8, 842-850; Reinhart et al., 2002, Gene &Dev., 16, 1616-1626; and Reinhart & Bartel, 2002, Science, 297, 1831). Non limiting examples of siNA molecules of the invention are shown in FIGS. 4-6, and Tables II, III, and IV herein. For example the siNA can be a double-stranded polynucleotide molecule comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e. each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure, for example wherein the double stranded region is about 19 base pairs); the antisense strand comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, the siNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions of the siNA are linked by means of a nucleic acid based or non-nucleic acid-based linker(s). The siNA can be a polynucleotide with a hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The siNA can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siNA molecule capable of mediating RNAi. The siNA can also comprise a single stranded polynucleotide having nucleotide sequence complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof (for example, where such siNA molecule does not require the presence within the siNA molecule of nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof), wherein the single stranded polynucleotide can further comprise a terminal phosphate group, such as a 5′-phosphate (see for example Martinez et al., 2002, Cell., 110, 563-574 and Schwarz et al., 2002, Molecular Cell, 10, 537-568), or 5′,3′-diphosphate. In certain embodiment, the siNA molecule of the invention comprises separate sense and antisense sequences or regions, wherein the sense and antisense regions are covalently linked by nucleotide or non-nucleotide linkers molecules as is known in the art, or are alternately non-covalently linked by ionic interactions, hydrogen bonding, van der waals interactions, hydrophobic intercations, and/or stacking interactions. In certain embodiments, the siNA molecules of the invention comprise nucleotide sequence that is complementary to nucleotide sequence of a target gene. In another embodiment, the siNA molecule of the invention interacts with nucleotide sequence of a target gene in a manner that causes inhibition of expression of the target gene. As used herein, siNA molecules need not be limited to those molecules containing only RNA, but further encompasses chemically-modified nucleotides and non-nucleotides. In certain embodiments, the short interfering nucleic acid molecules of the invention lack 2′-hydroxy (2′-OH) containing nucleotides. Applicant describes in certain embodiments short interfering nucleic acids that do not require the presence of nucleotides having a 2′-hydroxy group for mediating RNAi and as such, short interfering nucleic acid molecules of the invention optionally do not include any ribonucleotides (e.g., nucleotides having a 2′-OH group). Such siNA molecules that do not require the presence of ribonucleotides within the siNA molecule to support RNAi can however have an attached linker or linkers or other attached or associated groups, moieties, or chains containing one or more nucleotides with 2′-OH groups. Optionally, siNA molecules can comprise ribonucleotides at about 5, 10, 20, 30, 40, or 50% of the nucleotide positions. The modified short interfering nucleic acid molecules of the invention can also be referred to as short interfering modified oligonucleotides “siMON.” As used herein, the term siNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics. For example, siNA molecules of the invention can be used to epigenetically silence genes at both the post-transcriptional level or the pre-transcriptional level. In a non-limiting example, epigenetic regulation of gene expression by siNA molecules of the invention can result from siNA mediated modification of chromatin structure to alter gene expression (see, for example, Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237).
  • By “modulate” is meant that the expression of the gene, or level of RNA molecule or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits is up regulated or down regulated, such that expression, level, or activity is greater than or less than that observed in the absence of the modulator. For example, the term “modulate” can mean “inhibit,” but the use of the word “modulate” is not limited to this definition.
  • By “inhibit”, “down-regulate”, or “reduce”, it is meant that the expression of the gene, or level of RNA molecules or equivalent RNA molecules encoding one or more proteins or protein subunits, or activity of one or more proteins or protein subunits, is reduced below that observed in the absence of the nucleic acid molecules (e.g., siNA) of the invention. In one embodiment, inhibition, down-regulation or reduction with an siNA molecule is below that level observed in the presence of an inactive or attenuated molecule. In another embodiment, inhibition, down-regulation, or reduction with siNA molecules is below that level observed in the presence of, for example, an siNA molecule with scrambled sequence or with mismatches. In another embodiment, inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
  • By “gene” or “target gene” is meant, a nucleic acid that encodes an RNA, for example, nucleic acid sequences including, but not limited to, structural genes encoding a polypeptide. The target gene can be a gene derived from a cell, an endogenous gene, a transgene, or exogenous genes such as genes of a pathogen, for example a virus, which is present in the cell after infection thereof. The cell containing the target gene can be derived from or contained in any organism, for example a plant, animal, protozoan, virus, bacterium, or fungus. Non-limiting examples of plants include monocots, dicots, or gymnosperms. Non-limiting examples of animals include vertebrates or invertebrates. Non-limiting examples of fungi include molds or yeasts.
  • By “ECGF1” as used herein is meant, any platelet-derived endothelial cell growth factor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor activity, such as encoded by ECGF1 Genbank Accession Nos. shown in Table I. The term ECGF1 also refers to nucleic acid sequences encloding any platelet-derived endothelial cell growth factor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor activity. The term “ECGF1” is also meant to include other ECGF1 encoding sequence, such as mutant ECGF1 genes, splice variants of ECGF1 genes, and other ECGF1 ligands.
  • By “ECGF1r” as used herein is meant, any platelet-derived endothelial cell growth factor receptor protein, peptide, or polypeptide (including both membrane bound and/or soluble forms thereof) having platelet-derived endothelial cell growth factor receptor activity, such as encoded by an ECGF1r gene. The term ECGF1r also refers to nucleic acid sequences encloding any platelet-derived endothelial cell growth factor receptor protein, peptide, or polypeptide having platelet-derived endothelial cell growth factor receptor activity. The term “ECGF1r” is also meant to include other ECGF1r encoding sequence, such as mutant ECGF1r genes, splice variants of ECGF1r genes, and other ECGF1 receptors.
  • By “highly conserved sequence region” is meant a nucleotide sequence of one or more regions in a target gene does not vary significantly from one generation to the other or from one biological system to the other.
  • By “sense region” is meant a nucleotide sequence of a siNA molecule having complementarity to an antisense region of the siNA molecule. In addition, the sense region of a siNA molecule can comprise a nucleic acid sequence having homology with a target nucleic acid sequence.
  • By “antisense region” is meant a nucleotide sequence of a siNA molecule having complementarity to a target nucleic acid sequence. In addition, the antisense region of a siNA molecule can optionally comprise a nucleic acid sequence having complementarity to a sense region of the siNA molecule.
  • By “target nucleic acid” is meant any nucleic acid sequence whose expression or activity is to be modulated. The target nucleic acid can be DNA or RNA.
  • By “complementarity” is meant that a nucleic acid can form hydrogen bond(s) with another nucleic acid sequence by either traditional Watson-Crick or other non-traditional types. In reference to the nucleic molecules of the present invention, the binding free energy for a nucleic acid molecule with its complementary sequence is sufficient to allow the relevant function of the nucleic acid to proceed, e.g., RNAi activity. Determination of binding free energies for nucleic acid molecules is well known in the art (see, e.g., Turner et al., 1987, CSH Symp. Quant. Biol. LII pp. 123-133; Frier et al., 1986, Proc. Nat. Acad. Sci. USA 83:9373-9377; Turner et al., 1987, J. Am. Chem. Soc. 109:3783-3785). A percent complementarity indicates the percentage of contiguous residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary). “Perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence.
  • The siRNA molecules of the invention represent a novel therapeutic approach to treat a variety of pathologic indications or other conditions, such as tumor angiogenesis and cancer, including but not limited to breast cancer, lung cancer (including non-small cell lung carcinoma), prostate cancer, colorectal cancer, brain cancer, esophageal cancer, bladder cancer, pancreatic cancer, cervical cancer, head and neck cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma, gallbladder adeno carcinoma, parotid adenocarcinoma, ovarian cancer, melanoma, lymphoma, glioma, endometrial sarcoma, multidrug resistant cancers, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis, psoriasis, endometriosis, female reproduction, verruca vulgaris, angiofibroma of tuberous sclerosis, pot-wine stains, Sturge Weber syndrome, Kippel-Trenaunay-Weber syndrome, Osler-Weber-Rendu syndrome, renal disease such as Autosomal dominant polycystic kidney disease (ADPKD), and any other diseases or conditions that are related to or will respond to the levels of ECGF1 and/or ECGF1r in a cell or tissue, alone or in combination with other therapies. The reduction of ECGF1 and/or ECGF1r expression (specifically ECGF1 and/or ECGF1r gene RNA levels) and thus reduction in the level of the respective protein relieves, to some extent, the symptoms of the disease or condition.
  • In one embodiment of the present invention, each sequence of a siNA molecule of the invention is independently about 18 to about 24 nucleotides in length, in specific embodiments about 18, 19, 20, 21, 22, 23, or 24 nucleotides in length. In another embodiment, the siNA duplexes of the invention independently comprise about 17 to about 23 base pairs (e.g., about 17, 18, 19, 20, 21, 22 or 23). In yet another embodiment, siNA molecules of the invention comprising hairpin or circular structures are about 35 to about 55 (e.g., about 35, 40, 45, 50 or 55) nucleotides in length, or about 38 to about 44 (e.g., 38, 39, 40, 41, 42, 43 or 44) nucleotides in length and comprising about 16 to about 22 (e.g., about 16, 17, 18, 19, 20, 21 or 22) base pairs. Exemplary siNA molecules of the invention are shown in Table II. Exemplary synthetic siNA molecules of the invention are shown in Tables III and IV and/or FIGS. 4-5.
  • As used herein “cell” is used in its usual biological sense, and does not refer to an entire multicellular organism, e.g., specifically does not refer to a human. The cell can be present in an organism, e.g., birds, plants and mammals such as humans, cows, sheep, apes, monkeys, swine, dogs, and cats. The cell can be prokaryotic (e.g., bacterial cell) or eukaryotic (e.g., mammalian or plant cell). The cell can be of somatic or germ line origin, totipotent or pluripotent, dividing or non-dividing. The cell can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
  • The siNA molecules of the invention are added directly, or can be complexed with cationic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues. The nucleic acid or nucleic acid complexes can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their incorporation in biopolymers. In particular embodiments, the nucleic acid molecules of the invention comprise sequences shown in Tables II-III and/or FIGS. 4-5. Examples of such nucleic acid molecules consist essentially of sequences defined in these tables and figures. Furthermore, the chemically modified constructs described in Table IV can be applied to any siNA sequence of the invention.
  • In another aspect, the invention provides mammalian cells containing one or more siNA molecules of this invention. The one or more siNA molecules can independently be targeted to the same or different sites.
  • By “RNA” is meant a molecule comprising at least one ribonucleotide residue. By “ribonucleotide” is meant a nucleotide with a hydroxyl group at the 2′ position of a β-D-ribo-furanose moiety. The terms include double-stranded RNA, single-stranded RNA, isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siNA or internally, for example at one or more nucleotides of the RNA. Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naturally occurring nucleotides or chemically synthesized nucleotides or deoxynucleotides. These altered RNAs can be referred to as analogs or analogs of naturally-occurring RNA.
  • By “subject” is meant an organism, which is a donor or recipient of explanted cells or the cells themselves. “Subject” also refers to an organism to which the nucleic acid molecules of the invention can be administered. A subject can be a mammal or mammalian cells, including a human or human cells.
  • The term “phosphorothioate” as used herein refers to an internucleotide linkage having Formula I, wherein Z and/or W comprise a sulfur atom. Hence, the term phosphorothioate refers to both phosphorothioate and phosphorodithioate internucleotide linkages.
  • The term “universal base” as used herein refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them. Non-limiting examples of universal bases include C-phenyl, C-naphthyl and other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole as known in the art (see for example Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).
  • The term “acyclic nucleotide” as used herein refers to any nucleotide having an acyclic ribose sugar, for example where any of the ribose carbons (C1, C2, C3, C4, or C5), are independently or in combination absent from the nucleotide.
  • The nucleic acid molecules of the instant invention, individually, or in combination or in conjunction with other drugs, can be used to treat diseases or conditions discussed herein (e.g., cancers and othe proliferative conditions). For example, to treat a particular disease or condition, the siNA molecules can be administered to a subject or can be administered to other appropriate cells evident to those skilled in the art, individually or in combination with one or more drugs under conditions suitable for the treatment.
  • In a further embodiment, the siNA molecules can be used in combination with other known treatments to treat conditions or diseases discussed above. For example, the described molecules could be used in combination with one or more known therapeutic agents to treat a disease or condition. Non-limiting examples of other therapeutic agents that can be readily combined with a siNA molecule of the invention are enzymatic nucleic acid molecules, allosteric nucleic acid molecules, antisense, decoy, or aptamer nucleic acid molecules, antibodies such as monoclonal antibodies, small molecules, and other organic and/or inorganic compounds including metals, salts and ions.
  • In one embodiment, the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the invention, in a manner which allows expression of the siNA molecule. For example, the vector can contain sequence(s) encoding both strands of a siNA molecule comprising a duplex. The vector can also contain sequence(s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule. Non-limiting examples of such expression vectors are described in Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, advance online publication doi:10.1038/nm725.
  • In another embodiment, the invention features a mammalian cell, for example, a human cell, including an expression vector of the invention.
  • In yet another embodiment, the expression vector of the invention comprises a sequence for a siNA molecule having complementarity to a RNA molecule referred to by a Genbank Accession numbers, for example Genbank Accession Nos. shown in Table I.
  • In one embodiment, an expression vector of the invention comprises a nucleic acid sequence encoding two or more siNA molecules, which can be the same or different.
  • In another aspect of the invention, siNA molecules that interact with target RNA molecules and down-regulate gene encoding target RNA molecules (for example target RNA molecules referred to by Genbank Accession numbers herein) are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siNA molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siNA molecules bind and down-regulate gene function or expression via RNA interference (RNAi). Delivery of siNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell.
  • By “vectors” is meant any nucleic acid- and/or viral-based technique used to deliver a desired nucleic acid.
  • Other features and advantages of the invention will be apparent from the following description of the preferred embodiments thereof, and from the claims.
  • BRIEF DESCRIPTION OF THE DRAWINGS
  • FIG. 1 shows a non-limiting example of a scheme for the synthesis of siNA molecules. The complementary siNA sequence strands, strand 1 and strand 2, are synthesized in tandem and are connected by a cleavable linkage, such as a nucleotide succinate or abasic succinate, which can be the same or different from the cleavable linker used for solid phase synthesis on a solid support. The synthesis can be either solid phase or solution phase, in the example shown, the synthesis is a solid phase synthesis. The synthesis is performed such that a protecting group, such as a dimethoxytrityl group, remains intact on the terminal nucleotide of the tandem oligonucleotide. Upon cleavage and deprotection of the oligonucleotide, the two siNA strands spontaneously hybridize to form a siNA duplex, which allows the purification of the duplex by utilizing the properties of the terminal protecting group, for example by applying a trityl on purification method wherein only duplexes/oligonucleotides with the terminal protecting group are isolated.
  • FIG. 2 shows a MALDI-TOF mass spectrum of a purified siNA duplex synthesized by a method of the invention. The two peaks shown correspond to the predicted mass of the separate siNA sequence strands. This result demonstrates that the siNA duplex generated from tandem synthesis can be purified as a single entity using a simple trityl-on purification methodology.
  • FIG. 3 shows a non-limiting proposed mechanistic representation of target RNA degradation involved in RNAi. Double-stranded RNA (dsRNA), which is generated by RNA-dependent RNA polymerase (RdRP) from foreign single-stranded RNA, for example viral, transposon, or other exogenous RNA, activates the DICER enzyme that in turn generates siNA duplexes. Alternately, synthetic or expressed siNA can be introduced directly into a cell by appropriate means. An active siNA complex forms which recognizes a target RNA, resulting in degradation of the target RNA by the RISC endonuclease complex or in the synthesis of additional RNA by RNA-dependent RNA polymerase (RdRP), which can activate DICER and result in additional siNA molecules, thereby amplifying the RNAi response.
  • FIG. 4A-F shows non-limiting examples of chemically-modified siNA constructs of the present invention. In the figure, N stands for any nucleotide (adenosine, guanosine, cytosine, uridine, or optionally thymidine, for example thymidine can be substituted in the overhanging regions designated by parenthesis (N N). Various modifications are shown for the sense and antisense strands of the siNA constructs.
  • FIG. 4A: The sense strand comprises 21 nucleotides wherein the two terminal 3′-nucleotides are optionally base paired and wherein all nucleotides present are ribonucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all nucleotides present are ribonucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4B: The sense strand comprises 21 nucleotides wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the sense and antisense strand.
  • FIG. 4C: The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-O-methyl or 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4D: The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein and all purine nucleotides that may be present are 2′-deoxy nucleotides. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4E: The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-O-methyl modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand.
  • FIG. 4F: The sense strand comprises 21 nucleotides having 5′- and 3′-terminal cap moieties wherein the two terminal 3′-nucleotides are optionally base paired and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein and wherein all purine nucleotides that may be present are 2′-deoxy nucleotides. The antisense strand comprises 21 nucleotides, optionally having a 3′-terminal glyceryl moiety and wherein the two terminal 3′-nucleotides are optionally complementary to the target RNA sequence, and wherein all pyrimidine nucleotides that may be present are 2′-deoxy-2′-fluoro modified nucleotides and all purine nucleotides that may be present are 2′-deoxy nucleotides except for (N N) nucleotides, which can comprise ribonucleotides, deoxynucleotides, universal bases, or other chemical modifications described herein. A modified internucleotide linkage, such as a phosphorothioate, phosphorodithioate or other modified internucleotide linkage as described herein, shown as “s” connects the (N N) nucleotides in the antisense strand. The antisense strand of constructs A-F comprise sequence complementary to any target nucleic acid sequence of the invention. Furthermore, when a glyceryl moiety (L) is present at the 3′-end of the antisense strand for any construct shown in FIG. 4A-F, the modified internucleotide linkage is optional.
  • FIG. 5A-F shows non-limiting examples of specific chemically-modified siNA sequences of the invention. A-F applies the chemical modifications described in FIG. 4A-F to an ECGF1 siNA sequence. Such chemical modifications can be applied to any sequence herein, such as any ECGF1 or ECGF1r sequence.
  • FIG. 6 shows non-limiting examples of different siNA constructs of the invention. The examples shown (constructs 1, 2, and 3) have 19 representative base pairs; however, different embodiments of the invention include any number of base pairs described herein. Bracketed regions represent nucleotide overhangs, for example comprising about 1, 2, 3, or 4 nucleotides in length, preferably about 2 nucleotides. Constructs 1 and 2 can be used independently for RNAi activity. Construct 2 can comprise a polynucleotide or non-nucleotide linker, which can optionally be designed as a biodegradable linker. In one embodiment, the loop structure shown in construct 2 can comprise a biodegradable linker that results in the formation of construct 1 in vivo and/or in vitro. In another example, construct 3 can be used to generate construct 2 under the same principle wherein a linker is used to generate the active siNA construct 2 in vivo and/or in vitro, which can optionally utilize another biodegradable linker to generate the active siNA construct 1 in vivo and/or in vitro. As such, the stability and/or activity of the siNA constructs can be modulated based on the design of the siNA construct for use in vivo or in vitro and/or in vitro.
  • FIG. 7A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate siNA hairpin constructs.
  • FIG. 7A: A DNA oligomer is synthesized with a 5′-restriction site (R1) sequence followed by a region having sequence identical (sense region of siNA) to a predetermined ECGF1 and/or ECGF1r target sequence, wherein the sense region comprises, for example, about 19, 20, 21, or 22 nucleotides (N) in length, which is followed by a loop sequence of defined sequence (X), comprising, for example, about 3 to about 10 nucleotides.
  • FIG. 7B: The synthetic construct is then extended by DNA polymerase to generate a hairpin structure having self-complementary sequence that will result in a siNA transcript having specificity for an ECGF1 and/or ECGF1r target sequence and having self-complementary sense and antisense regions.
  • FIG. 7C: The construct is heated (for example to about 95° C.) to linearize the sequence, thus allowing extension of a complementary second DNA strand using a primer to the 3′-restriction sequence of the first strand. The double-stranded DNA is then inserted into an appropriate vector for expression in cells. The construct can be designed such that a 3′-terminal nucleotide overhang results from the transcription, for example by engineering restriction sites and/or utilizing a poly-U termination region as described in Paul et al., 2002, Nature Biotechnology, 29, 505-508.
  • FIG. 8A-C is a diagrammatic representation of a scheme utilized in generating an expression cassette to generate double-stranded siNA constructs.
  • FIG. 8A: A DNA oligomer is synthesized with a 5′-restriction (R1) site sequence followed by a region having sequence identical (sense region of siNA) to a predetermined ECGF1 and/or ECGF1r target sequence, wherein the sense region comprises, for example, about 19, 20, 21, or 22 nucleotides (N) in length, and which is followed by a 3′-restriction site (R2) which is adjacent to a loop sequence of defined sequence (X).
  • FIG. 8B: The synthetic construct is then extended by DNA polymerase to generate a hairpin structure having self-complementary sequence.
  • FIG. 8C: The construct is processed by restriction enzymes specific to R1 and R2 to generate a double-stranded DNA which is then inserted into an appropriate vector for expression in cells. The transcription cassette is designed such that a U6 promoter region flanks each side of the dsDNA which generates the separate sense and antisense strands of the siNA. Poly T termination sequences can be added to the constructs to generate U overhangs in the resulting transcript.
  • FIG. 9A-E is a diagrammatic representation of a method used to determine target sites for siNA mediated RNAi within a particular target nucleic acid sequence, such as messenger RNA.
  • FIG. 9A: A pool of siNA oligonucleotides are synthesized wherein the antisense region of the siNA constructs has complementarity to target sites across the target nucleic acid sequence, and wherein the sense region comprises sequence complementary to the antisense region of the siNA.
  • FIGS. 9B&C: (FIG. 9B) The sequences are pooled and are inserted into vectors such that (FIG. 9C) transfection of a vector into cells results in the expression of the siNA.
  • FIG. 9D: Cells are sorted based on phenotypic change that is associated with modulation of the target nucleic acid sequence.
  • FIG. 9E: The siNA is isolated from the sorted cells and is sequenced to identify efficacious target sites within the target nucleic acid sequence.
  • FIG. 10 shows non-limiting examples of different stabilization chemistries (1-10) that can be used, for example, to stabilize the 3′-end of siNA sequences of the invention, including (1) [3-3′]-inverted deoxyribose; (2) deoxyribonucleotide; (3) [5′-3′]-3′-deoxyribonucleotide; (4) [5′-3′]-ribonucleotide; (5) [5′-3′]-3′-O-methyl ribonucleotide; (6) 3′-glyceryl; (7) [3′-5′]-3′-deoxyribonucleotide; (8) [3′-3′]-deoxyribonucleotide; (9) [5′-2′]-deoxyribonucleotide; and (10) [5-3′]-dideoxyribonucleotide. In addition to modified and unmodified backbone chemistries indicated in the figure, these chemistries can be combined with different backbone modifications as described herein, for example, backbone modifications having Formula I. In addition, the 2′-deoxy nucleotide shown 5′ to the terminal modifications shown can be another modified or unmodified nucleotide or non-nucleotide described herein, for example modifications having any of Formulae I-VII or any combination thereof.
  • FIG. 11 shows a non-limiting example of a strategy used to identify chemically modified siNA constructs of the invention that are nuclease resistance while preserving the ability to mediate RNAi activity. Chemical modifications are introduced into the siNA construct based on educated design parameters (e.g. introducing 2′-mofications, base modifications, backbone modifications, terminal cap modifications etc). The modified construct in tested in an appropriate system (e.g. human serum for nuclease resistance, shown, or an animal model for PK/delivery parameters). In parallel, the siNA construct is tested for RNAi activity, for example in a cell culture system such as a luciferase reporter assay). Lead siNA constructs are then identified which possess a particular characteristic while maintaining RNAi activity, and can be further modified and assayed once again. This same approach can be used to identify siNA-conjugate molecules with improved pharmacokinetic profiles, delivery, and RNAi activity.
  • DETAILED DESCRIPTION OF THE INVENTION
  • Mechanism of Action of Nucleic Acid Molecules of the Invention
  • The discussion that follows discusses the proposed mechanism of RNA interference mediated by short interfering RNA as is presently known, and is not meant to be limiting and is not an admission of prior art. Applicant demonstrates herein that chemically-modified short interfering nucleic acids possess similar or improved capacity to mediate RNAi as do siRNA molecules and are expected to possess improved stability and activity in vivo; therefore, this discussion is not meant to be limited to siRNA only and can be applied to siNA as a whole. By “improved capacity to mediate RNAi” or “improved RNAi activity” is meant to include RNAi activity measured in vitro and/or in vivo where the RNAi activity is a reflection of both the ability of the siNA to mediate RNAi and the stability of the siNAs of the invention. In this invention, the product of these activities can be increased in vitro and/or in vivo compared to an all RNA siRNA or a siNA containing a plurality of ribonucleotides. In some cases, the activity or stability of the siNA molecule can be decreased (i.e., less than ten-fold), but the overall activity of the siNA molecule is enhanced in vitro and/or in vivo.
  • RNA interference refers to the process of sequence specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., 1998, Nature, 391, 806). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes which is commonly shared by diverse flora and phyla (Fire et al., 1999, Trends Genet., 15, 358). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response though a mechanism that has yet to be fully characterized. This mechanism appears to be different from the interferon response that results from dsRNA-mediated activation of protein kinase PKR and 2′,5′-oligoadenylate synthetase resulting in non-specific cleavage of mRNA by ribonuclease L.
  • The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as Dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., 2001, Nature, 409, 363). Short interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes. Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., 2001, Science, 293, 834). The RNAi response also features an endonuclease complex containing a siRNA, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence homologous to the siRNA. Cleavage of the target RNA takes place in the middle of the region complementary to the guide sequence of the siRNA duplex (Elbashir et al., 2001, Genes Dev., 15, 188). In addition, RNA interference can also involve small RNA (e.g., micro-RNA or mRNA) mediated gene silencing, presumably though cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see for example Allshire, 2002, Science, 297, 1818-1819; Volpe et al., 2002, Science, 297, 1833-1837; Jenuwein, 2002, Science, 297, 2215-2218; and Hall et al., 2002, Science, 297, 2232-2237). As such, siNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional level or post-transcriptional level.
  • RNAi has been studied in a variety of systems. Fire et al., 1998, Nature, 391, 806, were the first to observe RNAi in C. elegans. Wianny and Goetz, 1999, Nature Cell Biol., 2, 70, describe RNAi mediated by dsRNA in mouse embryos. Hammond et al., 2000, Nature, 404, 293, describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., 2001, Nature, 411, 494, describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells. Recent work in Drosophila embryonic lysates has revealed certain requirements for siRNA length, structure, chemical composition, and sequence that are essential to mediate efficient RNAi activity. These studies have shown that 21 nucleotide siRNA duplexes are most active when containing two 2-nucleotide 3′-terminal nucleotide overhangs. Furthermore, substitution of one or both siRNA strands with 2′-deoxy or 2′-O-methyl nucleotides abolishes RNAi activity, whereas substitution of 3′-terminal siRNA nucleotides with deoxy nucleotides was shown to be tolerated. Mismatch sequences in the center of the siRNA duplex were also shown to abolish RNAi activity. In addition, these studies also indicate that the position of the cleavage site in the target RNA is defined by the 5′-end of the siRNA guide sequence rather than the 3′-end (Elbashir et al., 2001, EMBO J., 20, 6877). Other studies have indicated that a 5′-phosphate on the target-complementary strand of a siRNA duplex is required for siRNA activity and that ATP is utilized to maintain the 5′-phosphate moiety on the siRNA (Nykanen et al., 2001, Cell, 107, 309); however, siRNA molecules lacking a 5′-phosphate are active when introduced exogenously, suggesting that 5′-phosphorylation of siRNA constructs may occur in vivo.
  • Synthesis of Nucleic Acid Molecules
  • Synthesis of nucleic acids greater than 100 nucleotides in length is difficult using automated methods, and the therapeutic cost of such molecules is prohibitive. In this invention, small nucleic acid motifs (“small” refers to nucleic acid motifs no more than 100 nucleotides in length, preferably no more than 80 nucleotides in length, and most preferably no more than 50 nucleotides in length; e.g., individual siNA oligonucleotide sequences or siNA sequences synthesized in tandem) are preferably used for exogenous delivery. The simple structure of these molecules increases the ability of the nucleic acid to invade targeted regions of protein and/or RNA structure. Exemplary molecules of the instant invention are chemically synthesized, and others can similarly be synthesized.
  • Oligonucleotides (e.g., certain modified oligonucleotides or portions of oligonucleotides lacking ribonucleotides) are synthesized using protocols known in the art, for example as described in Caruthers et al., 1992, Methods in Enzymology 211, 3-19, Thompson et al., International PCT Publication No. WO 99/54459, Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al., 1997, Methods Mol. Bio., 74, 59, Brennan et al., 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311. All of these references are incorporated herein by reference. The synthesis of oligonucleotides makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 μmol scale protocol with a 2.5 minute coupling step for 2′-O-methylated nucleotides and a 45 second coupling step for 2′-deoxy nucleotides or 2′-deoxy-2′-fluoro nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 μmol scale can be performed on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle. A 33-fold excess (60 μL of 0.11 M=6.6 μmol) of 2′-O-methyl phosphoramidite and a 105-fold excess of S-ethyl tetrazole (60 μL of 0.25 M=15 μmol) can be used in each coupling cycle of 2′-O-methyl residues relative to polymer-bound 5′-hydroxyl. A 22-fold excess (40 μL of 0.11 M=4.4 μmol) of deoxy phosphoramidite and a 70-fold excess of S-ethyl tetrazole (40 μL of 0.25 M=10 μmol) can be used in each coupling cycle of deoxy residues relative to polymer-bound 5′-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); and oxidation solution is 16.9 mM I2, 49 mM pyridine, 9% water in THF (PERSEPTIVE™). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide, 0.05 M in acetonitrile) is used.
  • Deprotection of the DNA-based oligonucleotides is performed as follows: the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aqueous methylamine (1 mL) at 65° C. for 10 minutes. After cooling to −20° C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder.
  • The method of synthesis used for RNA including certain siNA molecules of the invention follows the procedure as described in Usman et al., 1987, J. Am. Chem. Soc., 109, 7845; Scaringe et al., 1990, Nucleic Acids Res., 18, 5433; and Wincott et al., 1995, Nucleic Acids Res. 23, 2677-2684 Wincott et al., 1997, Methods Mol. Bio., 74, 59, and makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5′-end, and phosphoramidites at the 3′-end. In a non-limiting example, small scale syntheses are conducted on a 394 Applied Biosystems, Inc. synthesizer using a 0.2 μmol scale protocol with a 7.5 minute coupling step for alkylsilyl protected nucleotides and a 2.5 minute coupling step for 2′-O-methylated nucleotides. Table V outlines the amounts and the contact times of the reagents used in the synthesis cycle. Alternatively, syntheses at the 0.2 μmol scale can be done on a 96-well plate synthesizer, such as the instrument produced by Protogene (Palo Alto, Calif.) with minimal modification to the cycle. A 33-fold excess (60 μL of 0.11 M=6.6 μmol) of 2′-O-methyl phosphoramidite and a 75-fold excess of S-ethyl tetrazole (60 μL of 0.25 M=15 μmol) can be used in each coupling cycle of 2′-O-methyl residues relative to polymer-bound 5′-hydroxyl. A 66-fold excess (120 μL of 0.11 M=13.2 μmol) of alkylsilyl (ribo) protected phosphoramidite and a 150-fold excess of S-ethyl tetrazole (120 μL of 0.25 M=30 μmol) can be used in each coupling cycle of ribo residues relative to polymer-bound 5′-hydroxyl. Average coupling yields on the 394 Applied Biosystems, Inc. synthesizer, determined by colorimetric quantitation of the trityl fractions, are typically 97.5-99%. Other oligonucleotide synthesis reagents for the 394 Applied Biosystems, Inc. synthesizer include the following: detritylation solution is 3% TCA in methylene chloride (ABI); capping is performed with 16% N-methyl imidazole in THF (ABI) and 10% acetic anhydride/10% 2,6-lutidine in THF (ABI); oxidation solution is 16.9 mM I2, 49 mM pyridine, 9% water in THF (PERSEPTIVE™). Burdick & Jackson Synthesis Grade acetonitrile is used directly from the reagent bottle. S-Ethyltetrazole solution (0.25 M in acetonitrile) is made up from the solid obtained from American International Chemical, Inc. Alternately, for the introduction of phosphorothioate linkages, Beaucage reagent (3H-1,2-Benzodithiol-3-one 1,1-dioxide0.05 M in acetonitrile) is used.
  • Deprotection of the RNA is performed using either a two-pot or one-pot protocol. For the two-pot protocol, the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 40% aq. methylamine (1 mL) at 65° C. for 10 minutes. After cooling to −20° C., the supernatant is removed from the polymer support. The support is washed three times with 1.0 mL of EtOH:MeCN:H2O/3:1:1, vortexed and the supernatant is then added to the first supernatant. The combined supernatants, containing the oligoribonucleotide, are dried to a white powder. The base deprotected oligoribonucleotide is resuspended in anhydrous TEA/HF/NMP solution (300 μL of a solution of 1.5 mL N-methylpyrrolidinone, 750 μL TEA and 1 mL TEA•3HF to provide a 1.4 M HF concentration) and heated to 65° C. After 1.5 hours, the oligomer is quenched with 1.5 M NH4HCO3.
  • Alternatively, for the one-pot protocol, the polymer-bound trityl-on oligoribonucleotide is transferred to a 4 mL glass screw top vial and suspended in a solution of 33% ethanolic methylamine/DMSO: 1/1 (0.8 mL) at 65° C. for 15 minutes. The vial is brought to room temperature. TEA•3HF (0.1 mL) is added and the vial is heated at 65° C. for 15 minutes. The sample is cooled at −20° C. and then quenched with 1.5 M NH4HCO3.
  • For purification of the trityl-on oligomers, the quenched NH4HCO3 solution is loaded onto a C-18 containing cartridge that had been prewashed with acetonitrile followed by 50 mM TEAA. After washing the loaded cartridge with water, the RNA is detritylated with 0.5% TFA for 13 minutes. The cartridge is then washed again with water, salt exchanged with 1 M NaCl and washed with water again. The oligonucleotide is then eluted with 30% acetonitrile.
  • The average stepwise coupling yields are typically >98% (Wincott et al., 1995 Nucleic Acids Res. 23, 2677-2684). Those of ordinary skill in the art will recognize that the scale of synthesis can be adapted to be larger or smaller than the example described above including but not limited to 96-well format.
  • Alternatively, the nucleic acid molecules of the present invention can be synthesized separately and joined together post-synthetically, for example, by ligation (Moore et al., 1992, Science 256, 9923; Draper et al., International PCT publication No. WO 93/23569; Shabarova et al., 1991, Nucleic Acids Research 19, 4247; Bellon et al., 1997, Nucleosides &Nucleotides, 16, 951; Bellon et al., 1997, Bioconjugate Chem. 8, 204), or by hybridization following synthesis and/or deprotection.
  • The siNA molecules of the invention can also be synthesized via a tandem synthesis methodology as described in Example I herein, wherein both siNA strands are synthesized as a single contiguous oligonucleotide fragment or strand separated by a cleavable linker which is subsequently cleaved to provide separate siNA fragments or strands that hybridize and permit purification of the siNA duplex. The linker can be a polynucleotide linker or a non-nucleotide linker. The tandem synthesis of siNA as described herein can be readily adapted to both multiwell/multiplate synthesis platforms such as 96 well or similarly larger multi-well platforms. The tandem synthesis of siNA as described herein can also be readily adapted to large scale synthesis platforms employing batch reactors, synthesis columns and the like.
  • A siNA molecule can also be assembled from two distinct nucleic acid strands or fragments wherein one fragment includes the sense region and the second fragment includes the antisense region of the RNA molecule.
  • The nucleic acid molecules of the present invention can be modified extensively to enhance stability by modification with nuclease resistant groups, for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-H (for a review see Usman and Cedergren, 1992, TIBS 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163). siNA constructs can be purified by gel electrophoresis using general methods or can be purified by high pressure liquid chromatography (HPLC; see Wincott et al., supra, the totality of which is hereby incorporated herein by reference) and re-suspended in water.
  • In another aspect of the invention, siNA molecules of the invention are expressed from transcription units inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. The recombinant vectors capable of expressing the siNA molecules can be delivered as described herein, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of siNA molecules.
  • Optimizing Activity of the Nucleic Acid Molecule of the Invention.
  • Chemically synthesizing nucleic acid molecules with modifications (base, sugar and/or phosphate) can prevent their degradation by serum ribonucleases, which can increase their potency (see e.g., Eckstein et al., International Publication No. WO 92/07065; Perrault et al., 1990 Nature 344, 565; Pieken et al., 1991, Science 253, 314; Usman and Cedergren, 1992, Trends in Biochem. Sci. 17, 334; Usman et al., International Publication No. WO 93/15187; and Rossi et al., International Publication No. WO 91/03162; Sproat, U.S. Pat. No. 5,334,711; Gold et al., U.S. Pat. No. 6,300,074; and Burgin et al., supra; all of which are incorporated by reference herein). All of the above references describe various chemical modifications that can be made to the base, phosphate and/or sugar moieties of the nucleic acid molecules described herein. Modifications that enhance their efficacy in cells, and removal of bases from nucleic acid molecules to shorten oligonucleotide synthesis times and reduce chemical requirements are desired.
  • There are several examples in the art describing sugar, base and phosphate modifications that can be introduced into nucleic acid molecules with significant enhancement in their nuclease stability and efficacy. For example, oligonucleotides are modified to enhance stability and/or enhance biological activity by modification with nuclease resistant groups, for example, 2′-amino, 2′-C-allyl, 2′-fluoro, 2′-O-methyl, 2′-O-allyl, 2′-H, nucleotide base modifications (for a review see Usman and Cedergren, 1992, TIBS. 17, 34; Usman et al., 1994, Nucleic Acids Symp. Ser. 31, 163; Burgin et al., 1996, Biochemistry, 35, 14090). Sugar modification of nucleic acid molecules have been extensively described in the art (see Eckstein et al., International Publication PCT No. WO 92/07065; Perrault et al. Nature, 1990, 344, 565-568; Pieken et al. Science, 1991, 253, 314-317; Usman and Cedergren, Trends in Biochem. Sci., 1992, 17, 334-339; Usman et al. International Publication PCT No. WO 93/15187; Sproat, U.S. Pat. No. 5,334,711 and Beigelman et al., 1995, J. Biol. Chem., 270, 25702; Beigelman et al., International PCT publication No. WO 97/26270; Beigelman et al., U.S. Pat. No. 5,716,824; Usman et al., U.S. Pat. No. 5,627,053; Woolf et al., International PCT Publication No. WO 98/13526; Thompson et al., U.S. Ser. No. 60/082,404 which was filed on Apr. 20, 1998; Karpeisky et al., 1998, Tetrahedron Lett., 39, 1131; Earnshaw and Gait, 1998, Biopolymers (Nucleic Acid Sciences), 48, 39-55; Verma and Eckstein, 1998, Annu. Rev. Biochem., 67, 99-134; and Burlina et al., 1997, Bioorg. Med. Chem., 5, 1999-2010; all of the references are hereby incorporated in their totality by reference herein). Such publications describe general methods and strategies to determine the location of incorporation of sugar, base and/or phosphate modifications and the like into nucleic acid molecules without modulating catalysis, and are incorporated by reference herein. In view of such teachings, similar modifications can be used as described herein to modify the siNA nucleic acid molecules of the instant invention so long as the ability of siNA to promote RNAi is cells is not significantly inhibited.
  • While chemical modification of oligonucleotide internucleotide linkages with phosphorothioate, phosphorodithioate, and/or 5′-methylphosphonate linkages improves stability, excessive modifications can cause some toxicity or decreased activity. Therefore, when designing nucleic acid molecules, the amount of these internucleotide linkages should be minimized. The reduction in the concentration of these linkages should lower toxicity, resulting in increased efficacy and higher specificity of these molecules.
  • Short interfering nucleic acid (siNA) molecules having chemical modifications that maintain or enhance activity are provided. Such a nucleic acid is also generally more resistant to nucleases than an unmodified nucleic acid. Accordingly, the in vitro and/or in vivo activity should not be significantly lowered. In cases in which modulation is the goal, therapeutic nucleic acid molecules delivered exogenously should optimally be stable within cells until translation of the target RNA has been modulated long enough to reduce the levels of the undesirable protein. This period of time varies between hours to days depending upon the disease state. Improvements in the chemical synthesis of RNA and DNA (Wincott et al., 1995, Nucleic Acids Res. 23, 2677; Caruthers et al., 1992, Methods in Enzymology 211,3-19 (incorporated by reference herein)) have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability, as described above.
  • In one embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) G-clamp nucleotides. A G-clamp nucleotide is a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine within a duplex, see for example Lin and Matteucci, 1998, J. Am. Chem. Soc., 120, 8531-8532. A single G-clamp analog substitution within an oligonucleotide can result in substantially enhanced helical thermal stability and mismatch discrimination when hybridized to complementary oligonucleotides. The inclusion of such nucleotides in nucleic acid molecules of the invention results in both enhanced affinity and specificity to nucleic acid targets, complementary sequences, or template strands. In another embodiment, nucleic acid molecules of the invention include one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) LNA “locked nucleic acid” nucleotides such as a 2′,4′-C methylene bicyclo nucleotide (see for example Wengel et al., International PCT Publication No. WO 00/66604 and WO 99/14226).
  • In another embodiment, the invention features conjugates and/or complexes of siNA molecules of the invention. Such conjugates and/or complexes can be used to facilitate delivery of siNA molecules into a biological system, such as a cell. The conjugates and complexes provided by the instant invention can impart therapeutic activity by transferring therapeutic compounds across cellular membranes, altering the pharmacokinetics, and/or modulating the localization of nucleic acid molecules of the invention. The present invention encompasses the design and synthesis of novel conjugates and complexes for the delivery of molecules, including, but not limited to, small molecules, lipids, cholosterol, phospholipids, nucleosides, nucleotides, nucleic acids, antibodies, toxins, negatively charged polymers and other polymers, for example, proteins, peptides, hormones, carbohydrates, polyethylene glycols, or polyamines, across cellular membranes. In general, the transporters described are designed to be used either individually or as part of a multi-component system, with or without degradable linkers. These compounds are expected to improve delivery and/or localization of nucleic acid molecules of the invention into a number of cell types originating from different tissues, in the presence or absence of serum (see Sullenger and Cech, U.S. Pat. No. 5,854,038). Conjugates of the molecules described herein can be attached to biologically active molecules via linkers that are biodegradable, such as biodegradable nucleic acid linker molecules.
  • The term “biodegradable linker” as used herein, refers to a nucleic acid or non-nucleic acid linker molecule that is designed as a biodegradable linker to connect one molecule to another molecule, for example, a biologically active molecule to a siNA molecule of the invention or the sense and antisense strands of a siNA molecule of the invention. The biodegradable linker is designed such that its stability can be modulated for a particular purpose, such as delivery to a particular tissue or cell type. The stability of a nucleic acid-based biodegradable linker molecule can be modulated by using various chemistries, for example combinations of ribonucleotides, deoxyribonucleotides, and chemically-modified nucleotides, such as 2′-O-methyl, 2′-fluoro, 2′-amino, 2′-O-amino, 2′-C-allyl, 2′-O-allyl, and other 2′-modified or base modified nucleotides. The biodegradable nucleic acid linker molecule can be a dimer, trimer, tetramer or longer nucleic acid molecule, for example, an oligonucleotide of about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length, or can comprise a single nucleotide with a phosphorus-based linkage, for example, a phosphoramidate or phosphodiester linkage. The biodegradable nucleic acid linker molecule can also comprise nucleic acid backbone, nucleic acid sugar, or nucleic acid base modifications.
  • The term “biodegradable” as used herein, refers to degradation in a biological system, for example enzymatic degradation or chemical degradation.
  • The term “biologically active molecule” as used herein, refers to compounds or molecules that are capable of eliciting or modifying a biological response in a system. Non-limiting examples of biologically active siNA molecules either alone or in combination with other molecules contemplated by the instant invention include therapeutically active molecules such as antibodies, cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, siNA, dsRNA, allozymes, aptamers, decoys and analogs thereof. Biologically active molecules of the invention also include molecules capable of modulating the pharmacokinetics and/or pharmacodynamics of other biologically active molecules, for example, lipids and polymers such as polyamines, polyamides, polyethylene glycol and other polyethers.
  • The term “phospholipid” as used herein, refers to a hydrophobic molecule comprising at least one phosphorus group. For example, a phospholipid can comprise a phosphorus-containing group and saturated or unsaturated alkyl group, optionally substituted with OH, COOH, oxo, amine, or substituted or unsubstituted aryl groups.
  • Therapeutic nucleic acid molecules (e.g., siNA molecules) delivered exogenously optimally are stable within cells until reverse transcription of the RNA has been modulated long enough to reduce the levels of the RNA transcript. The nucleic acid molecules are resistant to nucleases in order to function as effective intracellular therapeutic agents. Improvements in the chemical synthesis of nucleic acid molecules described in the instant invention and in the art have expanded the ability to modify nucleic acid molecules by introducing nucleotide modifications to enhance their nuclease stability as described above.
  • In yet another embodiment, siNA molecules having chemical modifications that maintain or enhance enzymatic activity of proteins involved in RNAi are provided. Such nucleic acids are also generally more resistant to nucleases than unmodified nucleic acids. Thus, in vitro and/or in vivo the activity should not be significantly lowered.
  • Use of the nucleic acid-based molecules of the invention will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes; nucleic acid molecules coupled with known small molecule modulators; or intermittent treatment with combinations of molecules, including different motifs and/or other chemical or biological molecules). The treatment of subjects with siNA molecules can also include combinations of different types of nucleic acid molecules, such as enzymatic nucleic acid molecules (ribozymes), allozymes, antisense, 2,5-A oligoadenylate, decoys, and aptamers.
  • In another aspect a siNA molecule of the invention comprises one or more 5′ and/or a 3′-cap structure, for example on only the sense siNA strand, the antisense siNA strand, or both siNA strands.
  • By “cap structure” is meant chemical modifications, which have been incorporated at either terminus of the oligonucleotide (see, for example, Adamic et al., U.S. Pat. No. 5,998,203, incorporated by reference herein). These terminal modifications protect the nucleic acid molecule from exonuclease degradation, and can help in delivery and/or localization within a cell. The cap can be present at the 5′-terminus (5′-cap) or at the 3′-terminal (3′-cap) or can be present on both termini. Non-limiting examples of the 5′-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety); 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide, 4′-thio nucleotide; carbocyclic nucleotide; 1,5-anhydrohexitol nucleotide; L-nucleotides; alpha-nucleotides; modified base nucleotide; phosphorodithioate linkage; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco nucleotide; acyclic 3,4-dihydroxybutyl nucleotide; acyclic 3,5-dihydroxypentyl nucleotide, 3′-3′-inverted nucleotide moiety; 3′-3′-inverted abasic moiety; 3′-2′-inverted nucleotide moiety; 3′-2′-inverted abasic moiety; 1,4-butanediol phosphate; 3′-phosphoramidate; hexylphosphate; aminohexyl phosphate; 3′-phosphate; 3′-phosphorothioate; phosphorodithioate; or bridging or non-bridging methylphosphonate moiety.
  • Non-limiting examples of the 3′-cap include, but are not limited to, glyceryl, inverted deoxy abasic residue (moiety), 4′,5′-methylene nucleotide; 1-(beta-D-erythrofuranosyl) nucleotide; 4′-thio nucleotide, carbocyclic nucleotide; 5′-amino-alkyl phosphate; 1,3-diamino-2-propyl phosphate; 3-aminopropyl phosphate; 6-aminohexyl phosphate; 1,2-aminododecyl phosphate; hydroxypropyl phosphate; 1,5-anhydrohexitol nucleotide; L-nucleotide; alpha-nucleotide; modified base nucleotide; phosphorodithioate; threo-pentofuranosyl nucleotide; acyclic 3′,4′-seco nucleotide; 3,4-dihydroxybutyl nucleotide; 3,5-dihydroxypentyl nucleotide, 5′-5′-inverted nucleotide moiety; 5′-5′-inverted abasic moiety; 5′-phosphoramidate; 5′-phosphorothioate; 1,4-butanediol phosphate; 5′-amino; bridging and/or non-bridging 5′-phosphoramidate, phosphorothioate and/or phosphorodithioate, bridging or non bridging methylphosphonate and 5′-mercapto moieties (for more details see Beaucage and Iyer, 1993, Tetrahedron 49, 1925; incorporated by reference herein).
  • By the term “non-nucleotide” is meant any group or compound which can be incorporated into a nucleic acid chain in the place of one or more nucleotide units, including either sugar and/or phosphate substitutions, and allows the remaining bases to exhibit their enzymatic activity. The group or compound is abasic in that it does not contain a commonly recognized nucleotide base, such as adenosine, guanine, cytosine, uracil or thymine and therefore lacks a base at the 1′-position.
  • An “alkyl” group refers to a saturated aliphatic hydrocarbon, including straight-chain, branched-chain, and cyclic alkyl groups. Preferably, the alkyl group has 1 to 12 carbons. More preferably, it is a lower alkyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkyl group can be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ═O, ═S, NO2 or N(CH3)2, amino, or SH. The term also includes alkenyl groups that are unsaturated hydrocarbon groups containing at least one carbon-carbon double bond, including straight-chain, branched-chain, and cyclic groups. Preferably, the alkenyl group has 1 to 12 carbons. More preferably, it is a lower alkenyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkenyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ═O, ═S, NO2, halogen, N(CH3)2, amino, or SH. The term “alkyl” also includes alkynyl groups that have an unsaturated hydrocarbon group containing at least one carbon-carbon triple bond, including straight-chain, branched-chain, and cyclic groups. Preferably, the alkynyl group has 1 to 12 carbons. More preferably, it is a lower alkynyl of from 1 to 7 carbons, more preferably 1 to 4 carbons. The alkynyl group may be substituted or unsubstituted. When substituted the substituted group(s) is preferably, hydroxyl, cyano, alkoxy, ═O, ═S, NO2 or N(CH3)2, amino or SH.
  • Such alkyl groups can also include aryl, alkylaryl, carbocyclic aryl, heterocyclic aryl, amide and ester groups. An “aryl” group refers to an aromatic group that has at least one ring having a conjugated pi electron system and includes carbocyclic aryl, heterocyclic aryl and biaryl groups, all of which may be optionally substituted. The preferred substituent(s) of aryl groups are halogen, trihalomethyl, hydroxyl, SH, OH, cyano, alkoxy, alkyl, alkenyl, alkynyl, and amino groups. An “alkylaryl” group refers to an alkyl group (as described above) covalently joined to an aryl group (as described above). Carbocyclic aryl groups are groups wherein the ring atoms on the aromatic ring are all carbon atoms. The carbon atoms are optionally substituted. Heterocyclic aryl groups are groups having from 1 to 3 heteroatoms as ring atoms in the aromatic ring and the remainder of the ring atoms are carbon atoms. Suitable heteroatoms include oxygen, sulfur, and nitrogen, and include furanyl, thienyl, pyridyl, pyrrolyl, N-lower alkyl pyrrolo, pyrimidyl, pyrazinyl, imidazolyl and the like, all optionally substituted. An “amide” refers to an —C(O)—NH—R, where R is either alkyl, aryl, alkylaryl or hydrogen. An “ester” refers to an —C(O)—OR′, where R is either alkyl, aryl, alkylaryl or hydrogen.
  • By “nucleotide” as used herein is as recognized in the art to include natural bases (standard), and modified bases well known in the art. Such bases are generally located at the 1′ position of a nucleotide sugar moiety. Nucleotides generally comprise a base, sugar and a phosphate group. The nucleotides can be unmodified or modified at the sugar, phosphate and/or base moiety, (also referred to interchangeably as nucleotide analogs, modified nucleotides, non-natural nucleotides, non-standard nucleotides and other; see, for example, Usman and McSwiggen, supra; Eckstein et al., International PCT Publication No. WO 92/07065; Usman et al., International PCT Publication No. WO 93/15187; Uhlman & Peyman, supra, all are hereby incorporated by reference herein). There are several examples of modified nucleic acid bases known in the art as summarized by Limbach et al., 1994, Nucleic Acids Res. 22, 2183. Some of the non-limiting examples of base modifications that can be introduced into nucleic acid molecules include, inosine, purine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6-methyluridine), propyne, and others (Burgin et al., 1996, Biochemistry, 35, 14090; Uhlman & Peyman, supra). By “modified bases” in this aspect is meant nucleotide bases other than adenine, guanine, cytosine and uracil at 1′ position or their equivalents.
  • In one embodiment, the invention features modified siNA molecules, with phosphate backbone modifications comprising one or more phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and/or alkylsilyl, substitutions. For a review of oligonucleotide backbone modifications, see Hunziker and Leumann, 1995, Nucleic Acid Analogues: Synthesis and Properties, in Modern Synthetic Methods, VCH, 331-417, and Mesmaeker et al., 1994, Novel Backbone Replacements for Oligonucleotides, in Carbohydrate Modifications in Antisense Research, ACS, 24-39.
  • By “abasic” is meant sugar moieties lacking a base or having other chemical groups in place of a base at the 1′ position, see for example Adamic et al., U.S. Pat. No. 5,998,203.
  • By “unmodified nucleoside” is meant one of the bases adenine, cytosine, guanine, thymine, or uracil joined to the 1′ carbon of β-D-ribo-furanose.
  • By “modified nucleoside” is meant any nucleotide base which contains a modification in the chemical structure of an unmodified nucleotide base, sugar and/or phosphate. Non-limiting examples of modified nucleotides are shown by Formulae I-VII and/or other modifications described herein.
  • In connection with 2′-modified nucleotides as described for the present invention, by “amino” is meant 2′-NH2 or 2′-O—NH2, which can be modified or unmodified. Such modified groups are described, for example, in Eckstein et al., U.S. Pat. No. 5,672,695 and Matulic-Adamic et al., U.S. Pat. No. 6,248,878, which are both incorporated by reference in their entireties.
  • Various modifications to nucleic acid siNA structure can be made to enhance the utility of these molecules. Such modifications will enhance shelf-life, half-life in vitro, stability, and ease of introduction of such oligonucleotides to the target site, e.g., to enhance penetration of cellular membranes, and confer the ability to recognize and bind to targeted cells.
  • Administration of Nucleic Acid Molecules
  • A siNA molecule of the invention can be adapted for use to treat, for example, tumor angiogenesis and cancer, including but not limited to breast cancer, lung cancer (including non-small cell lung carcinoma), prostate cancer, colorectal cancer, brain cancer, esophageal cancer, bladder cancer, pancreatic cancer, cervical cancer, head and neck cancer, skin cancers, nasopharyngeal carcinoma, liposarcoma, epithelial carcinoma, renal cell carcinoma, gallbladder adeno carcinoma, parotid adenocarcinoma, ovarian cancer, melanoma, lymphoma, glioma, endometrial sarcoma, multidrug resistant cancers, diabetic retinopathy, macular degeneration, neovascular glaucoma, myopic degeneration, arthritis, psoriasis, endometriosis, female reproduction, verruca vulgaris, angiofibroma of tuberous sclerosis, pot-wine stains, Sturge Weber syndrome, Kippel-Trenaunay-Weber syndrome, Osler-Weber-Rendu syndrome, renal disease such as Autosomal dominant polycystic kidney disease (ADPKD), and any other diseases or conditions that are related to or will respond to the levels of ECGF1 and/or ECGF1r in a cell or tissue, alone or in combination with other therapies For example, a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject, carriers and diluents and their salts, and/or can be present in pharmaceutically acceptable formulations. Methods for the delivery of nucleic acid molecules are described in Akhtar et al., 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al., 1999, Mol. Membr. Biol., 16, 129-140; Hofland and Huang, 1999, Handb. Exp. Pharmacol., 137, 165-192; and Lee et al., 2000, ACS Symp. Ser., 752, 184-192, all of which are incorporated herein by reference. Beigelman et al., U.S. Pat. No. 6,395,713 and Sullivan et al., PCT WO 94/02595 further describe the general methods for delivery of nucleic acid molecules. These protocols can be utilized for the delivery of virtually any nucleic acid molecule. Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins (see for example Gonzalez et al., 1999, Bioconjugate Chem., 10, 1068-1074), poly(lactic-co-glycolic)acid (PLGA) and PLCA microspheres (see for example U.S. Pat. No. 6,447,796 and US Patent Application Publication No. U.S. 2002130430), biodegradable nanocapsules, and bioadhesive microspheres, or by proteinaceous vectors (O'Hare and Normand, International PCT Publication No. WO 00/53722). Alternatively, the nucleic acid/vehicle combination is locally delivered by direct injection or by use of an infusion pump. Direct injection of the nucleic acid molecules of the invention, whether subcutaneous, intramuscular, or intradermal, can take place using standard needle and syringe methodologies, or by needle-free technologies such as those described in Conry et al., 1999, Clin. Cancer Res., 5, 2330-2337 and Barry et al., International PCT Publication No. WO 99/31262. The molecules of the instant invention can be used as pharmaceutical agents. Pharmaceutical agents prevent, modulate the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.
  • Thus, the invention features a pharmaceutical composition comprising one or more nucleic acid(s) of the invention in an acceptable carrier, such as a stabilizer, buffer, and the like. The polynucleotides of the invention can be administered (e.g., RNA, DNA or protein) and introduced into a subject by any standard means, with or without stabilizers, buffers, and the like, to form a pharmaceutical composition. When it is desired to use a liposome delivery mechanism, standard protocols for formation of liposomes can be followed. The compositions of the present invention can also be formulated and used as tablets, capsules or elixirs for oral administration, suppositories for rectal administration, sterile solutions, suspensions for injectable administration, and the other compositions known in the art.
  • The present invention also includes pharmaceutically acceptable formulations of the compounds described. These formulations include salts of the above compounds, e.g., acid addition salts, for example, salts of hydrochloric, hydrobromic, acetic acid, and benzene sulfonic acid.
  • A pharmacological composition or formulation refers to a composition or formulation in a form suitable for administration, e.g., systemic administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Such forms should not prevent the composition or formulation from reaching a target cell (i.e., a cell to which the negatively charged nucleic acid is desirable for delivery). For example, pharmacological compositions injected into the blood stream should be soluble. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
  • By “systemic administration” is meant in vivo systemic absorption or accumulation of drugs in the blood stream followed by distribution throughout the entire body. Administration routes that lead to systemic absorption include, without limitation: intravenous, subcutaneous, intraperitoneal, inhalation, oral, intrapulmonary and intramuscular. Each of these administration routes exposes the siNA molecules of the invention to an accessible diseased tissue. The rate of entry of a drug into the circulation has been shown to be a function of molecular weight or size. The use of a liposome or other drug carrier comprising the compounds of the instant invention can potentially localize the drug, for example, in certain tissue types, such as the tissues of the reticular endothelial system (RES). A liposome formulation that can facilitate the association of drug with the surface of cells, such as, lymphocytes and macrophages is also useful. This approach can provide enhanced delivery of the drug to target cells by taking advantage of the specificity of macrophage and lymphocyte immune recognition of abnormal cells, such as cells producing excess ECGF1 and/or ECGF1r.
  • By “pharmaceutically acceptable formulation” is meant a composition or formulation that allows for the effective distribution of the nucleic acid molecules of the instant invention in the physical location most suitable for their desired activity. Non-limiting examples of agents suitable for formulation with the nucleic acid molecules of the instant invention include: P-glycoprotein inhibitors (such as Pluronic P85), which can enhance entry of drugs into the CNS (Jolliet-Riant and Tillement, 1999, Fundam. Clin. Pharmacol., 13, 16-26); biodegradable polymers, such as poly (DL-lactide-coglycolide) microspheres for sustained release delivery after intracerebral implantation (Emerich, D F et al, 1999, Cell Transplant, 8, 47-58) (Alkermes, Inc. Cambridge, Mass.); and loaded nanoparticles, such as those made of polybutylcyanoacrylate, which can deliver drugs across the blood brain barrier and can alter neuronal uptake mechanisms (Prog Neuropsychopharmacol Biol Psychiatry, 23, 941-949, 1999). Other non-limiting examples of delivery strategies for the nucleic acid molecules of the instant invention include material described in Boado et al., 1998, J. Pharm. Sci., 87, 1308-1315; Tyler et al., 1999, FEBS Lett., 421, 280-284; Pardridge et al., 1995, PNAS USA., 92, 5592-5596; Boado, 1995, Adv. Drug Delivery Rev., 15, 73-107; Aldrian-Herrada et al., 1998, Nucleic Acids Res., 26, 4910-4916; and Tyler et al., 1999, PNAS USA., 96, 7053-7058.
  • The invention also features the use of the composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing the accumulation of drugs in target tissues. This class of drug carriers resists opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug (Lasic et al. Chem. Rev. 1995, 95, 2601-2627; Ishiwata et al., Chem. Pharm. Bull. 1995, 43, 1005-1011). Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al., Science 1995, 267, 1275-1276; Oku et al., 1995, Biochim. Biophys. Acta, 1238, 86-90). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al., J. Biol. Chem. 1995, 42, 24864-24870; Choi et al., International PCT Publication No. WO 96/10391; Ansell et al., International PCT Publication No. WO 96/10390; Holland et al., International PCT Publication No. WO 96/10392). Long-circulating liposomes are also likely to protect drugs from nuclease degradation to a greater extent compared to cationic liposomes, based on their ability to avoid accumulation in metabolically aggressive MPS tissues such as the liver and spleen.
  • The present invention also includes compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent. Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, Mack Publishing Co. (A. R. Gennaro edit. 1985), hereby incorporated by reference herein. For example, preservatives, stabilizers, dyes and flavoring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid. In addition, antioxidants and suspending agents can be used.
  • A pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state. The pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize. Generally, an amount between 0.1 mg/kg and 100 mg/kg body weight/day of active ingredients is administered dependent upon potency of the negatively charged polymer.
  • The nucleic acid molecules of the invention and formulations thereof can be administered orally, topically, parenterally, by inhalation or spray, or rectally in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles. The term parenteral as used herein includes percutaneous, subcutaneous, intravascular (e.g., intravenous), intramuscular, or intrathecal injection or infusion techniques and the like. In addition, there is provided a pharmaceutical formulation comprising a nucleic acid molecule of the invention and a pharmaceutically acceptable carrier. One or more nucleic acid molecules of the invention can be present in association with one or more non-toxic pharmaceutically acceptable carriers and/or diluents and/or adjuvants, and if desired other active ingredients. The pharmaceutical compositions containing nucleic acid molecules of the invention can be in a form suitable for oral use, for example, as tablets, troches, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs.
  • Compositions intended for oral use can be prepared according to any method known to the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more such sweetening agents, flavoring agents, coloring agents or preservative agents in order to provide pharmaceutically elegant and palatable preparations. Tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients that are suitable for the manufacture of tablets. These excipients can be, for example, inert diluents; such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets can be uncoated or they can be coated by known techniques. In some cases such coatings can be prepared by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate can be employed.
  • Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
  • Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions. Such excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl-methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monooleate. The aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
  • Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin. The oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. Sweetening agents and flavoring agents can be added to provide palatable oral preparations. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid.
  • Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives. Suitable dispersing or wetting agents or suspending agents are exemplified by those already mentioned above. Additional excipients, for example sweetening, flavoring and coloring agents, can also be present.
  • Pharmaceutical compositions of the invention can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil or mixtures of these. Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally-occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate. The emulsions can also contain sweetening and flavoring agents.
  • Syrups and elixirs can be formulated with sweetening agents, for example glycerol, propylene glycol, sorbitol, glucose or sucrose. Such formulations can also contain a demulcent, a preservative and flavoring and coloring agents. The pharmaceutical compositions can be in the form of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables.
  • The nucleic acid molecules of the invention can also be administered in the form of suppositories, e.g., for rectal administration of the drug. These compositions can be prepared by mixing the drug with a suitable non-irritating excipient that is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the drug. Such materials include cocoa butter and polyethylene glycols.
  • Nucleic acid molecules of the invention can be administered parenterally in a sterile medium. The drug, depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle. Advantageously, adjuvants such as local anesthetics, preservatives and buffering agents can be dissolved in the vehicle.
  • Dosage levels of the order of from about 0.1 mg to about 140 mg per kilogram of body weight per day are useful in the treatment of the above-indicated conditions (about 0.5 mg to about 7 g per subject per day). The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form varies depending upon the host treated and the particular mode of administration. Dosage unit forms generally contain between from about 1 mg to about 500 mg of an active ingredient.
  • It is understood that the specific dose level for any particular subject depends upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
  • For administration to non-human animals, the composition can also be added to the animal feed or drinking water. It can be convenient to formulate the animal feed and drinking water compositions so that the animal takes in a therapeutically appropriate quantity of the composition along with its diet. It can also be convenient to present the composition as a premix for addition to the feed or drinking water.
  • The nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect. The use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
  • In one embodiment, the invention comprises compositions suitable for administering nucleic acid molecules of the invention to specific cell types. For example, the asialoglycoprotein receptor (ASGPr) (Wu and Wu, 1987, J. Biol. Chem. 262, 4429-4432) is unique to hepatocytes and binds branched galactose-terminal glycoproteins, such as asialoorosomucoid (ASOR). In another example, the folate receptor is overexpressed in many cancer cells. Binding of such glycoproteins, synthetic glycoconjugates, or folates to the receptor takes place with an affinity that strongly depends on the degree of branching of the oligosaccharide chain, for example, triatennary structures are bound with greater affinity than biatenarry or monoatennary chains (Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945). Lee and Lee, 1987, Glycoconjugate J., 4, 317-328, obtained this high specificity through the use of N-acetyl-D-galactosamine as the carbohydrate moiety, which has higher affinity for the receptor, compared to galactose. This “clustering effect” has also been described for the binding and uptake of mannosyl-terminating glycoproteins or glycoconjugates (Ponpipom et al., 1981, J. Med. Chem., 24, 1388-1395). The use of galactose, galactosamine, or folate based conjugates to transport exogenous compounds across cell membranes can provide a targeted delivery approach to, for example, the treatment of liver disease, cancers of the liver, or other cancers. The use of bioconjugates can also provide a reduction in the required dose of therapeutic compounds required for treatment. Furthermore, therapeutic bioavialability, pharmacodynamics, and pharmacokinetic parameters can be modulated through the use of nucleic acid bioconjugates of the invention. Non-limiting examples of such bioconjugates are described in Vargeese et al, U.S. Ser. No. 10/201,394, filed Aug. 13, 2001; and Matulic-Adamic et al., U.S. Ser. No. 60/362,016, filed Mar. 6, 2002.
  • Alternatively, certain siNA molecules of the instant invention can be expressed within cells from eukaryotic promoters (e.g., Izant and Weintraub, 1985, Science, 229, 345; McGarry and Lindquist, 1986, Proc. Natl. Acad. Sci., USA 83, 399; Scanlon et al, 1991, Proc. Natl. Acad. Sci. USA, 88, 10591-5; Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Dropulic et al., 1992, J. Virol., 66, 1432-41; Weerasinghe et al., 1991, J. Virol., 65, 5531-4; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Sarver et al., 1990 Science, 247, 1222-1225; Thompson et al., 1995, Nucleic Acids Res., 23, 2259; Good et al., 1997, Gene Therapy, 4, 45. Those skilled in the art realize that any nucleic acid can be expressed in eukaryotic cells from the appropriate DNA/RNA vector. The activity of such nucleic acids can be augmented by their release from the primary transcript by a enzymatic nucleic acid (Draper et al., PCT WO 93/23569, and Sullivan et al., PCT WO 94/02595; Ohkawa et al., 1992, Nucleic Acids Symp. Ser., 27, 15-6; Taira et al., 1991, Nucleic Acids Res., 19, 5125-30; Ventura et al., 1993, Nucleic Acids Res., 21, 3249-55; Chowrira et al., 1994, J. Biol. Chem., 269, 25856.
  • In another aspect of the invention, RNA molecules of the present invention can be expressed from transcription units (see for example Couture et al., 1996, TIG., 12, 510) inserted into DNA or RNA vectors. The recombinant vectors can be DNA plasmids or viral vectors. siNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, or alphavirus. In another embodiment, pol III based constructs are used to express nucleic acid molecules of the invention (see for example Thompson, U.S. Pats. Nos. 5,902,880 and 6,146,886). The recombinant vectors capable of expressing the siNA molecules can be delivered as described above, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the siNA molecule interacts with the target mRNA and generates an RNAi response. Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell (for a review see Couture et al., 1996, TIG., 12, 510).
  • In one aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one siNA molecule of the instant invention. The expression vector can encode one or both strands of a siNA duplex, or a single self-complementary strand that self hybridizes into a siNA duplex. The nucleic acid sequences encoding the siNA molecules of the instant invention can be operably linked in a manner that allows expression of the siNA molecule (see for example Paul et al., 2002, Nature Biotechnology, 19, 505; Miyagishi and Taira, 2002, Nature Biotechnology, 19, 497; Lee et al., 2002, Nature Biotechnology, 19, 500; and Novina et al., 2002, Nature Medicine, advance online publication doi: 10.1038/nm725).
  • In another aspect, the invention features an expression vector comprising: a) a transcription initiation region (e.g., eukaryotic pol I, II or III initiation region); b) a transcription termination region (e.g., eukaryotic pol I, II or III termination region); and c) a nucleic acid sequence encoding at least one of the siNA molecules of the instant invention, wherein said sequence is operably linked to said initiation region and said termination region in a manner that allows expression and/or delivery of the siNA molecule. The vector can optionally include an open reading frame (ORF) for a protein operably linked on the 5′ side or the 3′-side of the sequence encoding the siNA of the invention and/or an intron (intervening sequences).
  • Transcription of the siNA molecule sequences can be driven from a promoter for eukaryotic RNA polymerase I (pol I), RNA polymerase II (pol II), or RNA polymerase III (pol III). Transcripts from pol II or pol III promoters are expressed at high levels in all cells; the levels of a given pol II promoter in a given cell type depends on the nature of the gene regulatory sequences (enhancers, silencers, etc.) present nearby. Prokaryotic RNA polymerase promoters are also used, providing that the prokaryotic RNA polymerase enzyme is expressed in the appropriate cells (Elroy-Stein and Moss, 1990, Proc. Natl. Acad. Sci. USA, 87, 6743-7; Gao and Huang 1993, Nucleic Acids Res., 21, 2867-72; Lieber et al., 1993, Methods Enzymol., 217, 47-66; Zhou et al., 1990, Mol. Cell. Biol., 10, 4529-37). Several investigators have demonstrated that nucleic acid molecules expressed from such promoters can function in mammalian cells (e.g. Kashani-Sabet et al., 1992, Antisense Res. Dev., 2, 3-15; Ojwang et al., 1992, Proc. Natl. Acad. Sci. USA, 89, 10802-6; Chen et al., 1992, Nucleic Acids Res., 20, 4581-9; Yu et al., 1993, Proc. Natl. Acad. Sci. USA, 90, 6340-4; L'Huillier et al., 1992, EMBO J., 11, 4411-8; Lisziewicz et al., 1993, Proc. Natl. Acad. Sci. U.S. A, 90, 8000-4; Thompson et al., 1995, Nucleic Acids Res., 23, 2259; Sullenger & Cech, 1993, Science, 262, 1566). More specifically, transcription units such as the ones derived from genes encoding U6 small nuclear (snRNA), transfer RNA (tRNA) and adenovirus VA RNA are useful in generating high concentrations of desired RNA molecules such as siNA in cells (Thompson et al., supra; Couture and Stinchcomb, 1996, supra; Noonberg et al., 1994, Nucleic Acid Res., 22, 2830; Noonberg et al., U.S. Pat. No. 5,624,803; Good et al., 1997, Gene Ther., 4, 45; Beigelman et al., International PCT Publication No. WO 96/18736. The above siNA transcription units can be incorporated into a variety of vectors for introduction into mammalian cells, including but not restricted to, plasmid DNA vectors, viral DNA vectors (such as adenovirus or adeno-associated virus vectors), or viral RNA vectors (such as retroviral or alphavirus vectors) (for a review see Couture and Stinchcomb, 1996, supra).
  • In another aspect the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the siNA molecules of the invention in a manner that allows expression of that siNA molecule. The expression vector comprises in one embodiment; a) a transcription initiation region; b) a transcription termination region; and c) a nucleic acid sequence encoding at least one strand of the siNA molecule, wherein the sequence is operably linked to the initiation region and the termination region in a manner that allows expression and/or delivery of the siNA molecule.
  • In another embodiment the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an open reading frame; and d) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3′-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the open reading frame and the termination region in a manner that allows expression and/or delivery of the siNA molecule. In yet another embodiment, the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; and d) a nucleic acid sequence encoding at least one siNA molecule, wherein the sequence is operably linked to the initiation region, the intron and the termination region in a manner which allows expression and/or delivery of the nucleic acid molecule.
  • In another embodiment, the expression vector comprises: a) a transcription initiation region; b) a transcription termination region; c) an intron; d) an open reading frame; and e) a nucleic acid sequence encoding at least one strand of a siNA molecule, wherein the sequence is operably linked to the 3′-end of the open reading frame and wherein the sequence is operably linked to the initiation region, the intron, the open reading frame and the termination region in a manner which allows expression and/or delivery of the siNA molecule.
  • ECGF1 Biology and Biochemistry
  • The following discussion is adapted from R&D Systems, Cytokine Mini Reviews, Platelet-derived endothelial cell growth factor (ECGF1), Copyright ©2002 R&D Systems. Platelet-derived endothelial cell growth factor (PD-ECGF), also known as placental derived growth factor, was originally isolated from platelets based on its ability to induce mitosis in endothelial cells. Following the production of antibodies against this factor, the placenta was also found to produce PD-ECGF. Given the relative abundance of this particular tissue, the placenta was subsequently used both to produce large amounts of purified protein and to construct a cDNA library for the PD-ECGF clone. Initial studies demonstrated chemotactic and mitogenic effects on endothelial cells in vitro, plus a profound angiogenic effect in vivo. PD-ECGF growth factor activities are attributed to secondary effects related to its identity with thymidine phosphorylase. Independent of studies on endothelial cells, PD-ECGF has also been investigated as an inhibitor of glial cell proliferation. Originally named gliostatin, it was found to act on glial cell tumors and astroblasts but not neuronal cells. For a review of PD-ECGF/Gliostatin/Thymidine Phosphorylase, see Miyazono et al. (1991) Prog. Growth Factor Res. 3, 207.
  • PD-ECGF was originally purified as a polypeptide with an apparent mass of about 45 kDa. On SDS-PAGE, the purified protein appears as a doublet, and it is now accepted that it occurs naturally as a non-disulfide liked homodimer. PD-ECGF is heat and acid labile, has a pI of 4.6, does not bind to heparin and does not appear to be glycosylated. The cloned cDNA for PD-ECGF predicts an amino acid (aa) sequence of 482 aa, which gives a calculated molecular weight of 49 kDa, a value consistent with a nonglycosylated molecule. The predicted aa sequence contains no leader peptide and most of the protein remains localized within the producer cell. This suggests the protein utilizes a non-classical protein secretion pathway, or that it is simply released following cell death. N-terminal sequence studies using purified protein indicates that PD-ECGF from placenta begins with aa residue #6 (threonine), while that from platelets begins with aa residue #11 (alanine). It is unclear whether this difference results from physiological processing or from proteolysis during purification. The mitogenic activity however remains the same for each of the N-terminally-modified proteins. PD-ECGF contains two nucleotide-binding sequence motifs (-G-X-G-X-X-G-) and a consensus sequence for a protein kinase C phosphorylation site (-S/T-X-K/R-). When PD-ECGF is expressed in cells incubated with labeled nucleotides, it is found to contain a nucleotide covalently bound to a serine. The significance of this nucleotidylation is unkown, though it may be related to the nucleoside- and phosphate-binding aspects of PD-ECGF/thymidine phosphorylase.
  • Following the cloning of PD-ECGF, portions of the molecule were observed to have significant homology (40-60%) to bacterial thymidine phosphorylase (TP). Subsequent studies looking for TP activity in PD-ECGF found that PD-ECGF indeed possessed thymidine phosphorylase activity, an activity that occurs when PD-ECGF serves as a catalyst in the inter-conversion of thymidine (plus orthophosphate) to the nucleic acid thymine plus 2-deoxy-d-ribose 1-phosphate. A direct comparison of the human PD-ECGF (hPD-ECGF) sequence with a partial clone of human TP (hTP) reveals complete aa identity over 120 aa residues, and this, coupled with equality in molecular mass, equivalency in enzyme activity, and complete immuno-crossreactivity, has led to the conclusion that TP and PD-ECGF are identical molecules. This identity, however, has raised questions about its growth factor-like effects. For example, it has been shown that the chemotactic effect of PD-ECGF on endothelial cells is abolished if thymidine is not present. Further, it is known that in vitro, PD-ECGF will not stimulate endothelial cell mitosis, but will promote endothelial cell thymidine uptake from culture media. Thus, it has been concluded that PD-ECGF/TP is not a classic growth factor acting through a receptor/signal transduction cascade, but instead represents an enzyme whose enzymatic byproducts have a biological action. This has raised questions about the use of tritiated thymidine uptake as a measure of cell proliferation (mitosis) in the absence of an actual cell count. Cells known to express PD- ECGF include fibroblasts, peripheral blood lymphocytes, macrophages, platelets, vascular smooth muscle, type B synovial cells, decidual cells, sensory and autonomic neurons, and numerous primary tumor and tumor cell lines. Additionally, human PD-ECGF has marked activity in all cross-species studies reported.
  • PD-ECGF has been shown to play a role in the uptake of labeled thymidine by endothelial cells. This activity is seen in human, porcine, and murine endothelial cells derived from umbilical vein, aorta and capillaries. Although this activity tends to be most pronounced for endothelial cells, some activity for other cells, including epithelial cells, kidney cells and choriocarcinoma cells has also been reported. PD-ECGF has also been reported to be a chemotactic agent for aortic endothelial cells, monocytes and neutrophils. As with PD-ECGF's reported mitogenic effect, chemotactic activity appears to be mediated by PD-ECGF enzymatic degradation products, which are subsequently converted to a chemotactically/angiogenically active 2-deoxy-ribose molecule.
  • The expression of TP/PD-ECGF by various cell types has been correlated with increased vascularization. During the decidualization process (transformation of uterine endometrium in response to blastocyst implantation), TP is increased in mesenchymal (embryonic connective tissue)-like stromal cells. This is rapidly followed by an ingrowth of blood vessels, an event necessary to a successful pregnancy. Such an effect is suggested to be mediated by the combined effects of TP-biproducts, TGF-alpha and FGF basic. In intraductal breast carcinoma tissue samples, TP expression has also been correlated with the degree of microvascularization, again suggesting a role for TP enzyme degradation products in blood vessel formation. In a study of ovarian carcinomas, increased blood flow (vascularization) was also correlated with TP/PD-ECGF expression, reinforcing the conclusion that tumor-derived TP may contribute to an increased vascularization necessary for some tumor types. Finally, elevated levels of gliostatin/PD-ECGF have also been found in the serum and synovial fluid of rheumatoid arthritis (RA) patients, suggesting that this factor might play a role in the aberrant neovascularization of the synovium associated with RA.
  • The use of small interfering nucleic acid molecules targeting ECGF1 and corresponding receptors and ligands therefore provides a class of novel therapeutic agents that can be used in the diagnosis of and the treatment of cancer, proliferative diseases, ocular conditions or any other disease or condition that responds to modulation of ECGF1 and/or ECGF1r genes.
  • EXAMPLES
  • The following are non-limiting examples showing the selection, isolation, synthesis and activity of nucleic acids of the instant invention.
  • Example 1 Tandem Synthesis of siNA Constructs
  • Exemplary siNA molecules of the invention are synthesized in tandem using a cleavable linker, for example, a succinyl-based linker. Tandem synthesis as described herein is followed by a one-step purification process that provides RNAi molecules in high yield. This approach is highly amenable to siNA synthesis in support of high throughput RNAi screening, and can be readily adapted to multi-column or multi-well synthesis platforms.
  • After completing a tandem synthesis of a siNA oligo and its complement in which the 5′-terminal dimethoxytrityl (5′-O-DMT) group remains intact (trityl on synthesis), the oligonucleotides are deprotected as described above. Following deprotection, the siNA sequence strands are allowed to spontaneously hybridize. This hybridization yields a duplex in which one strand has retained the 5′-O-DMT group while the complementary strand comprises a terminal 5′-hydroxyl. The newly formed duplex behaves as a single molecule during routine solid-phase extraction purification (Trityl-On purification) even though only one molecule has a dimethoxytrityl group. Because the strands form a stable duplex, this dimethoxytrityl group (or an equivalent group, such as other trityl groups or other hydrophobic moieties) is all that is required to purify the pair of oligos, for example, by using a C18 cartridge.
  • Standard phosphoramidite synthesis chemistry is used up to the point of introducing a tandem linker, such as an inverted deoxy abasic succinate or glyceryl succinate linker (see FIG. 1) or an equivalent cleavable linker. A non-limiting example of linker coupling conditions that can be used includes a hindered base such as diisopropylethylamine (DIPA) and/or DMAP in the presence of an activator reagent such as Bromotripyrrolidinophosphoniumhexaflurorophosphate (PyBrOP). After the linker is coupled, standard synthesis chemistry is utilized to complete synthesis of the second sequence leaving the terminal the 5′-O-DMT intact. Following synthesis, the resulting oligonucleotide is deprotected according to the procedures described herein and quenched with a suitable buffer, for example with 50 mM NaOAc or 1.5M NH4H2CO3.
  • Purification of the siNA duplex can be readily accomplished using solid phase extraction, for example using a Waters C18 SepPak 1 g cartridge conditioned with 1 column volume (CV) of acetonitrile, 2 CV H2O, and 2 CV 50 mM NaOAc. The sample is loaded and then washed with 1 CV H2O or 50 mM NaOAc. Failure sequences are eluted with 1 CV 14% ACN (Aqueous with 50 mM NaOAc and 5 mM NaCl). The column is then washed, for example with 1 CV H2O followed by on-column detritylation, for example by passing 1 CV of 1% aqueous trifluoroacetic acid (TFA) over the column, then adding a second CV of 1% aqueous TFA to the column and allowing to stand for approximately 10 minutes. The remaining TFA solution is removed and the column washed with H2O followed by 1 CV 1M NaCl and additional H2O. The siNA duplex product is then eluted, for example, using 1 CV 20% aqueous CAN.
  • FIG. 2 provides an example of MALDI-TOF mass spectrometry analysis of a purified siNA construct in which each peak corresponds to the calculated mass of an individual siNA strand of the siNA duplex. The same purified siNA provides three peaks when analyzed by capillary gel electrophoresis (CGE), one peak presumably corresponding to the duplex siNA, and two peaks presumably corresponding to the separate siNA sequence strands. Ion exchange HPLC analysis of the same siNA contract only shows a single peak. Testing of the purified siNA construct using a luciferase reporter assay described below demonstrated the same RNAi activity compared to siNA constructs generated from separately synthesized oligonucleotide sequence strands.
  • Example 2 Identification of Potential siNA Target Sites in any RNA Sequence
  • The sequence of an RNA target of interest, such as a viral or human mRNA transcript, is screened for target sites, for example by using a computer folding algorithm. In a non-limiting example, the sequence of a gene or RNA gene transcript derived from a database, such as Genbank, is used to generate siNA targets having complementarity to the target. Such sequences can be obtained from a database, or can be determined experimentally as known in the art. Target sites that are known, for example, those target sites determined to be effective target sites based on studies with other nucleic acid molecules, for example ribozymes or antisense, or those targets known to be associated with a disease or condition such as those sites containing mutations or deletions, can be used to design siNA molecules targeting those sites. Various parameters can be used to determine which sites are the most suitable target sites within the target RNA sequence. These parameters include but are not limited to secondary or tertiary RNA structure, the nucleotide base composition of the target sequence, the degree of homology between various regions of the target sequence, or the relative position of the target sequence within the RNA transcript. Based on these determinations, any number of target sites within the RNA transcript can be chosen to screen siNA molecules for efficacy, for example by using in vitro RNA cleavage assays, cell culture, or animal models. In a non-limiting example, anywhere from 1 to 1000 target sites are chosen within the transcript based on the size of the siNA construct to be used. High throughput screening assays can be developed for screening siNA molecules using methods known in the art, such as with multi-well or multi-plate assays to determine efficient reduction in target gene expression.
  • Example 3 Selection of siNA Molecule Target Sites in a RNA
  • The following non-limiting steps can be used to carry out the selection of siNAs targeting a given gene sequence or transcript.
    • 1. The target sequence is parsed in silico into a list of all fragments or subsequences of a particular length, for example 23 nucleotide fragments, contained within the target sequence. This step is typically carried out using a custom Perl script, but commercial sequence analysis programs such as Oligo, MacVector, or the GCG Wisconsin Package can be employed as well.
    • 2. In some instances the siNAs correspond to more than one target sequence; such would be the case for example in targeting different transcripts of the same gene, targeting different transcripts of more than one gene, or for targeting both the human gene and an animal homolog. In this case, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find matching sequences in each list. The subsequences are then ranked according to the number of target sequences that contain the given subsequence; the goal is to find subsequences that are present in most or all of the target sequences. Alternately, the ranking can identify subsequences that are unique to a target sequence, such as a mutant target sequence. Such an approach would enable the use of siNA to target specifically the mutant sequence and not effect the expression of the normal sequence.
    • 3. In some instances the siNA subsequences are absent in one or more sequences while present in the desired target sequence; such would be the case if the siNA targets a gene with a paralogous family member that is to remain untargeted. As in case 2 above, a subsequence list of a particular length is generated for each of the targets, and then the lists are compared to find sequences that are present in the target gene but are absent in the untargeted paralog.
    • 4. The ranked siNA subsequences can be further analyzed and ranked according to GC content. A preference can be given to sites containing 30-70% GC, with a further preference to sites containing 40-60% GC.
    • 5. The ranked siNA subsequences can be further analyzed and ranked according to self-folding and internal hairpins. Weaker internal folds are preferred; strong hairpin structures are to be avoided.
    • 6. The ranked siNA subsequences can be further analyzed and ranked according to whether they have runs of GGG or CCC in the sequence. GGG (or even more Gs) in either strand can make oligonucleotide synthesis problematic and can potentially interfere with RNAi activity, so it is avoided whenever better sequences are available. CCC is searched in the target strand because that will place GGG in the antisense strand.
    • 7. The ranked siNA subsequences can be further analyzed and ranked according to whether they have the dinucleotide UU (uridine dinucleotide) on the 3′-end of the sequence, and/or AA on the 5′-end of the sequence (to yield 3′ UU on the antisense sequence). These sequences allow one to design siNA molecules with terminal TT thymidine dinucleotides.
    • 8. Four or five target sites are chosen from the ranked list of subsequences as described above. For example, in subsequences having 23 nucleotides, the right 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the upper (sense) strand of the siNA duplex, while the reverse complement of the left 21 nucleotides of each chosen 23-mer subsequence are then designed and synthesized for the lower (antisense) strand of the siNA duplex (see Tables II and III). If terminal TT residues are desired for the sequence (as described in paragraph 7), then the two 3′ terminal nucleotides of both the sense and antisense strands are replaced by TT prior to synthesizing the oligos.
    • 9. The siNA molecules are screened in an in vitro, cell culture or animal model system to identify the most active siNA molecule or the most preferred target site within the target RNA sequence.
  • In an alternate approach, a pool of siNA constructs specific to an ECGF1 and/or ECGF1r target sequence is used to screen for target sites in cells expressing ECGF1 and/or ECGF1r RNA, such as HUVEC, HMVEC, or A375 cells. The general strategy used in this approach is shown in FIG. 9. A non-limiting example of such is a pool comprising sequences having any of SEQ ID NOS 1-224. Cells expressing ECGF1 and/or ECGF1r (e.g., HUVEC, HMVEC, or A375 cells) are transfected with the pool of siNA constructs and cells that demonstrate a phenotype associated with ECGF1 and/or ECGF1r inhibition are sorted. The pool of siNA constructs can be expressed from transcription cassettes inserted into appropriate vectors (see for example FIG. 7 and FIG. 8). The siNA from cells demonstrating a positive phenotypic change (e.g., decreased proliferation, decreased ECGF1 and/or ECGF1r mRNA levels or decreased ECGF1 and/or ECGF1r protein expression), are sequenced to determine the most suitable target site(s) within the target ECGF1 and/or ECGF1r RNA sequence.
  • Example 4 ECGF1 and/or ECGF1r Targeted siNA Design
  • siNA target sites were chosen by analyzing sequences of the ECGF1 and/or ECGF1r RNA target and optionally prioritizing the target sites on the basis of folding (structure of any given sequence analyzed to determine siNA accessibility to the target), by using a library of siNA molecules as described in Example 3, or alternately by using an in vitro siNA system as described in Example 6 herein. siNA molecules were designed that could bind each target and are optionally individually analyzed by computer folding to assess whether the siNA molecule can interact with the target sequence. Varying the length of the siNA molecules can be chosen to optimize activity. Generally, a sufficient number of complementary nucleotide bases are chosen to bind to, or otherwise interact with, the target RNA, but the degree of complementarity can be modulated to accommodate siNA duplexes or varying length or base composition. By using such methodologies, siNA molecules can be designed to target sites within any known RNA sequence, for example those RNA sequences corresponding to the any gene transcript.
  • Chemically modified siNA constructs are designed to provide nuclease stability for systemic administration in vivo and/or improved pharmacokinetic, localization, and delivery properties while preserving the ability to mediate RNAi activity. Chemical modifications as described herein are introduced synthetically using synthetic methods described herein and those generally known in the art. The synthetic siNA constructs are then assayed for nuclease stability in serum and/or cellular/tissue extracts (e.g. liver extracts). The synthetic siNA constructs are also tested in parallel for RNAi activity using an appropriate assay, such as a luciferase reporter assay as described herein or another suitable assay that can quantity RNAi activity. Synthetic siNA constructs that possess both nuclease stability and RNAi activity can be further modified and re-evaluated in stability and activity assays. The chemical modifications of the stabilized active siNA constructs can then be applied to any siNA sequence targeting any chosen RNA and used, for example, in target screening assays to pick lead siNA compounds for therapeutic development (see for example FIG. 11).
  • Example 5 Chemical Synthesis and Purification of siNA
  • siNA molecules can be designed to interact with various sites in the RNA message, for example, target sequences within the RNA sequences described herein. The sequence of one strand of the siNA molecule(s) is complementary to the target site sequences described above. The siNA molecules can be chemically synthesized using methods described herein. Inactive siNA molecules that are used as control sequences can be synthesized by scrambling the sequence of the siNA molecules such that it is not complementary to the target sequence. Generally, siNA constructs can by synthesized using solid phase oligonucleotide synthesis methods as described herein (see for example Usman et al., U.S. Pat. Nos. 5,804,683; 5,831,071; 5,998,203; 6,117,657; 6,353,098; 6,362,323; 6,437,117; 6,469,158; Scaringe et al., U.S. Pat. Nos. 6,111,086; 6,008,400; 6,111,086 all incorporated by reference herein in their entirety).
  • In a non-limiting example, RNA oligonucleotides are synthesized in a stepwise fashion using the phosphoramidite chemistry as is known in the art. Standard phosphoramidite chemistry involves the use of nucleosides comprising any of 5′-O-dimethoxytrityl, 2′-O-tert-butyldimethylsilyl, 3′-O-2-Cyanoethyl N,N-diisopropylphos-phoroamidite groups, and exocyclic amine protecting groups (e.g. N6-benzoyl adenosine, N4 acetyl cytidine, and N2-isobutyryl guanosine). Alternately, 2′-O-Silyl Ethers can be used in conjunction with acid-labile 2′-O-orthoester protecting groups in the synthesis of RNA as described by Scaringe supra. Differing 2′ chemistries can require different protecting groups, for example 2′-deoxy-2′-amino nucleosides can utilize N-phthaloyl protection as described by Usman et al., U.S. Pat. No. 5,631,360, incorporated by reference herein in its entirety).
  • During solid phase synthesis, each nucleotide is added sequentially (3′- to 5′-direction) to the solid support-bound oligonucleotide. The first nucleoside at the 3′-end of the chain is covalently attached to a solid support (e.g., controlled pore glass or polystyrene) using various linkers. The nucleotide precursor, a ribonucleoside phosphoramidite, and activator are combined resulting in the coupling of the second nucleoside phosphoramidite onto the 5′-end of the first nucleoside. The support is then washed and any unreacted 5′-hydroxyl groups are capped with a capping reagent such as acetic anhydride to yield inactive 5′-acetyl moieties. The trivalent phosphorus linkage is then oxidized to a more stable phosphate linkage. At the end of the nucleotide addition cycle, the 5′-O-protecting group is cleaved under suitable conditions (e.g., acidic conditions for trityl-based groups and Fluoride for silyl-based groups). The cycle is repeated for each subsequent nucleotide.
  • Modification of synthesis conditions can be used to optimize coupling efficiency, for example by using differing coupling times, differing reagent/phosphoramidite concentrations, differing contact times, differing solid supports and solid support linker chemistries depending on the particular chemical composition of the siNA to be synthesized. Deprotection and purification of the siNA can be performed as is generally described in Deprotection and purification of the siNA can be performed as is generally described in Usman et al., U.S. Pat. No. 5,831,071, U.S. Pat. No. 6,353,098, U.S. Pat. No. 6,437,117, and Bellon et al., U.S. Pat. No. 6,054,576, U.S. Pat. No. 6,162,909, U.S. Pat. No. 6,303,773, or Scaringe supra, incorporated by reference herein in their entireties. Additionally, deprotection conditions can be modified to provide the best possible yield and purity of siNA constructs. For example, applicant has observed that oligonucleotides comprising 2′-deoxy-2′-fluoro nucleotides can degrade under inappropriate deprotection conditions. Such oligonucleotides are deprotected using aqueous methylamine at about 35° C. for 30 minutes. If the 2′-deoxy-2′-fluoro containing oligonucleotide also comprises ribonucleotides, after deprotection with aqueous methylamine at about 35° C. for 30 minutes, TEA-HF is added and the reaction maintained at about 65° C. for an additional 15 minutes.
  • Example 6 RNAi In Vitro Assay to Assess siNA Activity
  • An in vitro assay that recapitulates RNAi in a cell-free system is used to evaluate siNA constructs targeting ECGF1 and/or ECGF1r RNA targets. The assay comprises the system described by Tuschl et al., 1999, Genes and Development, 13, 3191-3197 and Zamore et al., 2000, Cell, 101, 25-33 adapted for use with ECGF1 and/or ECGF1r target RNA. A Drosophila extract derived from syncytial blastoderm is used to reconstitute RNAi activity in vitro. Target RNA is generated via in vitro transcription from an appropriate ECGF1 and/or ECGF1r expressing plasmid using T7 RNA polymerase or via chemical synthesis as described herein. Sense and antisense siNA strands (for example 20 uM each) are annealed by incubation in buffer (such as 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, 2 mM magnesium acetate) for 1 minute at 90° C. followed by 1 hour at 37° C., then diluted in lysis buffer (for example 100 mM potassium acetate, 30 mM HEPES-KOH at pH 7.4, 2 mM magnesium acetate). Annealing can be monitored by gel electrophoresis on an agarose gel in TBE buffer and stained with ethidium bromide. The Drosophila lysate is prepared using zero to two-hour-old embryos from Oregon R flies collected on yeasted molasses agar that are dechorionated and lysed. The lysate is centrifuged and the supernatant isolated. The assay comprises a reaction mixture containing 50% lysate [vol/vol], RNA (10-50 pM final concentration), and 10% [vol/vol] lysis buffer containing siNA (10 nM final concentration). The reaction mixture also contains 10 mM creatine phosphate, 10 ug.ml creatine phosphokinase, 100 um GTP, 100 uM UTP, 100 uM CTP, 500 uM ATP, 5 mM DTT, 0.1 U/uL RNasin (Promega), and 100 uM of each amino acid. The final concentration of potassium acetate is adjusted to 100 mM. The reactions are pre-assembled on ice and preincubated at 25° C. for 10 minutes before adding RNA, then incubated at 25° C. for an additional 60 minutes. Reactions are quenched with 4 volumes of 1.25×Passive Lysis Buffer (Promega). Target RNA cleavage is assayed by RT-PCR analysis or other methods known in the art and are compared to control reactions in which siNA is omitted from the reaction.
  • Alternately, internally-labeled target RNA for the assay is prepared by in vitro transcription in the presence of [alpha-32p] CTP, passed over a G 50 Sephadex column by spin chromatography and used as target RNA without further purification. Optionally, target RNA is 5′-32P-end labeled using T4 polynucleotide kinase enzyme. Assays are performed as described above and target RNA and the specific RNA cleavage products generated by RNAi are visualized on an autoradiograph of a gel. The percentage of cleavage is determined by Phosphor Imager® quantitation of bands representing intact control RNA or RNA from control reactions without siNA and the cleavage products generated by the assay.
  • In one embodiment, this assay is used to determine target sites the ECGF1 and/or ECGF1r RNA target for siNA mediated RNAi cleavage, wherein a plurality of siNA constructs are screened for RNAi mediated cleavage of the ECGF1 and/or ECGF1r RNA target, for example, by analyzing the assay reaction by electrophoresis of labeled target RNA, or by northern blotting, as well as by other methodology well known in the art.
  • Example 7 Nucleic Acid Inhibition of ECGF1 and/or ECGF1r Target RNA In Vivo
  • siNA molecules targeted to the human ECGF1 and/or ECGF1r RNA are designed and synthesized as described above. These nucleic acid molecules can be tested for cleavage activity in vivo, for example, using the following procedure. The target sequences and the nucleotide location within the ECGF1 RNA are given in Table II and III.
  • Two formats are used to test the efficacy of siNAs targeting ECGF1 and/or ECGF1r. First, the reagents are tested in cell culture using, for example, HUVEC, HMVEC, or A375 cells to determine the extent of RNA and protein inhibition. siNA reagents (e.g.; see for example Tables II and III) are selected against the ECGF1 and/or ECGF1r target as described herein. RNA inhibition is measured after delivery of these reagents by a suitable transfection agent to, for example, HUVEC, HMVEC, or A375 cells. Relative amounts of target RNA are measured versus actin using real-time PCR monitoring of amplification (eg., ABI 7700 Taqman®). A comparison is made to a mixture of oligonucleotide sequences made to unrelated targets or to a randomized siNA control with the same overall length and chemistry, but randomly substituted at each position. Primary and secondary lead reagents are chosen for the target and optimization performed. After an optimal transfection agent concentration is chosen, a RNA time-course of inhibition is performed with the lead siNA molecule. In addition, a cell-plating format can be used to determine RNA inhibition.
  • Delivery of siNA to Cells
  • Cells (e.g., HUVEC, HMVEC, or A375 cells) are seeded, for example, at 1×105 cells per well of a six-well dish in EGM-2 (BioWhittaker) the day before transfection. siNA (final concentration, for example 20 nM) and cationic lipid (e.g., final concentration 2 μg/ml) are complexed in EGM basal media (Biowhittaker) at 37° C. for 30 minutes in polystyrene tubes. Following vortexing, the complexed siNA is added to each well and incubated for the times indicated. For initial optimization experiments, cells are seeded, for example, at 1×103 in 96 well plates and siNA complex added as described. Efficiency of delivery of siNA to cells is determined using a fluorescent siNA complexed with lipid. Cells in 6-well dishes are incubated with siNA for 24 hours, rinsed with PBS and fixed in 2% paraformaldehyde for 15 minutes at room temperature. Uptake of siNA is visualized using a fluorescent microscope.
  • Taqman and Lightcycler Quantification of mRNA
  • Total RNA is prepared from cells following siNA delivery, for example, using Qiagen RNA purification kits for 6-well or Rneasy extraction kits for 96-well assays. For Taqman analysis, dual-labeled probes are synthesized with the reporter dye, FAM or JOE, covalently linked at the 5′-end and the quencher dye TAMRA conjugated to the 3′-end. One-step RT-PCR amplifications are performed on, for example, an ABI PRISM 7700 Sequence Detector using 50 μl reactions consisting of 10 μl total RNA, 100 nM forward primer, 900 nM reverse primer, 100 nM probe, 1×TaqMan PCR reaction buffer (PE-Applied Biosystems), 5.5 mM MgCl2, 300 μM each dATP, dCTP, dGTP, and dTTP, 10 U RNase Inhibitor (Promega), 1.25 U AmpliTaq Gold (PE-Applied Biosystems) and 10 U M-MLV Reverse Transcriptase (Promega). The thermal cycling conditions can consist of 30 minutes at 48° C., 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and 1 minute at 60° C. Quantitation of mRNA levels is determined relative to standards generated from serially diluted total cellular RNA (300, 100, 33, 11 ng/rxn) and normalizing to β-actin or GAPDH mRNA in parallel TaqMan reactions. For each gene of interest an upper and lower primer and a fluorescently labeled probe are designed. Real time incorporation of SYBR Green I dye into a specific PCR product can be measured in glass capillary tubes using a lightcyler. A standard curve is generated for each primer pair using control cRNA. Values are represented as relative expression to GAPDH in each sample.
  • Western Blotting
  • Nuclear extracts can be prepared using a standard micro preparation technique (see for example Andrews and Faller, 1991, Nucleic Acids Research, 19, 2499). Protein extracts from supernatants are prepared, for example using TCA precipitation. An equal volume of 20% TCA is added to the cell supernatant, incubated on ice for 1 hour and pelleted by centrifugation for 5 minutes. Pellets are washed in acetone, dried and resuspended in water. Cellular protein extracts are run on a 10% Bis-Tris NuPage (nuclear extracts) or 4-12% Tris-Glycine (supernatant extracts) polyacrylamide gel and transferred onto nitro-cellulose membranes. Non-specific binding can be blocked by incubation, for example, with 5% non- fat milk for 1 hour followed by primary antibody for 16 hour at 4° C. Following washes, the secondary antibody is applied, for example (1:10,000 dilution) for 1 hour at room temperature and the signal detected with SuperSignal reagent (Pierce).
  • Example 8 Animal Models Useful to Evaluate the Down-Regulation of ECGF1 and/or ECGF1r Gene Expression
  • There are several animal models in which the anti-angiogenesis effect of nucleic acids of the present invention, such as siRNA, directed against ECGF1 and/or ECGF1r mRNAs can be tested. Typically a corneal model has been used to study angiogenesis in rat and rabbit since recruitment of vessels can easily be followed in this normally avascular tissue (Pandey et al., 1995 Science 268: 567-569). In these models, a small Teflon or Hydron disk pretreated with an angiogenesis factor (e.g. bFGF, VEGF or ECGF1) is inserted into a pocket surgically created in the cornea. Angiogenesis is monitored 3 to 5 days later. siRNA directed against ECGF1 and/or ECGF1r mRNAs are delivered in the disk as well, or dropwise to the eye over the time course of the experiment. In another eye model, hypoxia has been shown to cause both increased expression of VEGF and neovascularization in the retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909; Shweiki et al., 1992 J. Clin. Invest. 91: 2235-2243). This model could likewise be used to evaluate modulation of ECGF1 and/or ECGF1r using siNA molecules of the invention.
  • In human glioblastomas, it has been shown that ECGF1 is at least partially responsible for tumor angiogenesis (Plate et al., 1992 Nature 359, 845). Animal models have been developed in which glioblastoma cells are implanted subcutaneously into nude mice and the progress of tumor growth and angiogenesism is studied (Kim et al., 1993 supra; Millauer et al., 1994 supra).
  • Another animal model used to measure neovascularization employs the use of Matrigel matrix, an extract of basement membrane that becomes a solid gel when injected subcutaneously (Passaniti et al., 1992 Lab. Invest. 67: 519-528). When the Matrigel is supplemented with angiogenesis factors such as VEGF, vessels grow into the Matrigel over a period of 3 to 5 days and angiogenesis can be assessed. Likewise, nucleic acids directed against ECGF1r and/or ECGF1r mRNAs are delivered in the Matrigel and evaluated for efficacy.
  • Several animal models exist for screening of anti-angiogenic agents. These include corneal vessel formation following corneal injury (Burger et al., 1985 Cornea 4: 35-41; Lepri, et al., 1994 J. Ocular Pharmacol. 10: 273-280; Ormerod et al., 1990 Am. J. Pathol. 137: 1243-1252) or intracorneal growth factor implant (Grant et al., 1993 Diabetologia 36: 282-291; Pandey et al. 1995 supra; Zieche et al., 1992 Lab. Invest. 67: 711-715), vessel growth into Matrigel matrix containing growth factors (Passaniti et al., 1992 supra), female reproductive organ neovascularization following hormonal manipulation (Shweiki et al., 1993 Clin. Invest. 91: 2235-2243), several models involving inhibition of tumor growth in highly vascularized solid tumors (O'Reilly et al., 1994 Cell 79: 315-328; Senger et al., 1993 Cancer and Metas. Rev. 12: 303-324; Takahasi et al., 1994 Cancer Res. 54: 4233-4237; Kim et al., 1993 supra), and transient hypoxia-induced neovascularization in the mouse retina (Pierce et al., 1995 Proc. Natl. Acad. Sci. USA. 92: 905-909).
  • The cornea model, described in Pandey et al. supra, is the most common and well characterized model for screening anti-angiogenic agent efficacy. This model involves an avascular tissue into which vessels are recruited by a stimulating agent (growth factor, thermal or alkalai burn, endotoxin). The corneal model utilizes the intrastromal corneal implantation of a Teflon pellet soaked in an VEGF or ECGF1-Hydron solution to recruit blood vessels toward the pellet, which can be quantitated using standard microscopic and image analysis techniques. To evaluate their anti-angiogenic efficacy, nucleic acids are applied topically to the eye or bound within Hydron on the Teflon pellet itself. This avascular cornea as well as the Matrigel (see below) provide for low background assays. While the corneal model has been performed extensively in the rabbit, studies in the rat have also been conducted.
  • The mouse model (Passaniti et al., supra) is a non-tissue model that utilizes Matrigel, an extract of basement membrane (Kleinman et al., 1986) or Millipore® filter disk, which can be impregnated with growth factors and anti-angiogenic agents in a liquid form prior to injection. Upon subcutaneous administration at body temperature, the Matrigel or Millipore® filter disk forms a solid implant. ECGF1 or VEGF embedded in the Matrigel or Millipore® filter disk is used to recruit vessels within the matrix of the Matrigel or Millipore® filter disk which can be processed histologically for endothelial cell specific vWF (factor VIII antigen) immunohistochemistry, Trichrome-Masson stain, or hemoglobin content. Like the cornea, the Matrigel or Millipore® filter disk is avascular; however, it is not tissue. In the Matrigel or Millipore® filter disk model, nucleic acids are administered within the matrix of the Matrigel or Millipore® filter disk to test their anti-angiogenic efficacy. Thus, delivery issues in this model, as with delivery of nucleic acids by Hydron-coated Teflon pellets in the rat cornea model, may be less problematic due to the homogeneous presence of the nucleic acid within the respective matrix.
  • Other model systems to study tumor angiogenesis is reviewed by Folkman, 1985 Adv. Cancer. Res. 43, 175.
  • Use of Murine Models
  • For a typical systemic study involving 10 mice (20 g each) per dose group, 5 doses (1, 3, 10, 30 and 100 mg/kg daily over 14 days continuous administration), approximately 400 mg of siRNA, formulated in saline is used. A similar study in young adult rats (200 g) requires over 4 g. Parallel pharmacokinetic studies involve the use of similar quantities of siRNA further justifying the use of murine models.
  • Lewis Lung Carcinoma and B-16 Melanoma Murine Models
  • Identifying a common animal model for systemic efficacy testing of nucleic acids is an efficient way of screening siRNA for systemic efficacy.
  • The Lewis lung carcinoma and B-16 murine melanoma models are well accepted models of primary and metastatic cancer and are used for initial screening of anti-cancer agents. These murine models are not dependent upon the use of immunodeficient mice, are relatively inexpensive, and minimize housing concerns. Both the Lewis lung and B-16 melanoma models involve subcutaneous implantation of approximately 106 tumor cells from metastatically aggressive tumor cell lines (Lewis lung lines 3LL or D122, LLc-LN7; B-16-BL6 melanoma) in C57BL/6J mice. Alternatively, the Lewis lung model can be produced by the surgical implantation of tumor spheres (approximately 0.8 mm in diameter). Metastasis also can be modeled by injecting the tumor cells directly intravenously. In the Lewis lung model, microscopic metastases can be observed approximately 14 days following implantation with quantifiable macroscopic metastatic tumors developing within 21-25 days. The B-16 melanoma exhibits a similar time course with tumor neovascularization beginning 4 days following implantation. Since both primary and metastatic tumors exist in these models after 21-25 days in the same animal, multiple measurements can be taken as indices of efficacy. Primary tumor volume and growth latency as well as the number of micro- and macroscopic metastatic lung foci or number of animals exhibiting metastases can be quantitated. The percent increase in lifespan can also be measured. Thus, these models provide suitable primary efficacy assays for screening systemically administered siRNA nucleic acids and siRNA nucleic acid formulations.
  • In the Lewis lung and B-16 melanoma models, systemic pharmacotherapy with a wide variety of agents usually begins 1-7 days following tumor implantation/inoculation with either continuous or multiple administration regimens. Concurrent pharmacokinetic studies can be performed to determine whether sufficient tissue levels of siRNA can be achieved for pharmacodynamic effect to be expected. Furthermore, primary tumors and secondary lung metastases can be removed and subjected to a variety of in vitro studies (i.e. target RNA reduction).
  • In addition, animal models are useful in screening compounds, eg. siRNA molecules, for efficacy in treating renal failure, such as a result of autosomal dominant polycystic kidney disease (ADPKD). The Han:SPRD rat model, mice with a targeted mutation in the Pkd2 gene and congenital polycystic kidney (cpk) mice, closely resemble human ADPKD and provide animal models to evaluate the therapeutic effect of siRNA constructs that have the potential to interfere with one or more of the pathogenic elements of ADPKD mediated renal failure, such as angiogenesis. Angiogenesis may be necessary in the progression of ADPKD for growth of cyst cells as well as increased vascular permeability promoting fluid secretion into cysts. It is proposed that anti-ECGF1 or ECGF1r siRNA molecules would attenuate cystic epithelial cell proliferation and apoptosis which would in turn lead to less cyst formation. Further, it is proposed that ECGF1 may be a stimulus for angiogenesis as well as epithelial cell proliferation and apoptosis. The use of Han:SPRD rats (see for eaxmple Kaspareit-Rittinghausen et al., 1991, Am. J. Pathol. 139, 693-696), mice with a targeted mutation in the Pkd2 gene (Pkd2−/− mice, see for example Wu et al., 2000, Nat. Genet. 24, 75-78) and cpk mice (see for example Woo et al., 1994, Nature, 368, 750-753) all provide animal models to study the efficacy of siNA molecles of the invention against ECGF1 and ECGF1r mediated renal failure.
  • ECGF1 and/or ECGF1r protein levels can be measured clinically or experimentally by FACS analysis. ECGF1 and/or ECGF1r encoded mRNA levels are assessed by Northern analysis, RNase-protection, primer extension analysis and/or quantitative RT-PCR. siNA nucleic acids that block ECGF1 and/or ECGF1r protein encoding mRNAs and therefore result in decreased levels of ECGF1 and/or ECGF1r activity by more than 20% in vitro can be identified.
  • Example 9 siNA-Mediated Inhibition of Angiogenesis In Vivo
  • The purpose of this study is to assess the anti-angiogenic activity of siNA targeted against ECGF1r in the rat cornea model of ECGF1 induced angiogenesis (see above). The siNA molecules have matched inverted controls, which are inactive since they are not able to interact with the RNA target. The siNA molecules and ECGF1 are co-delivered using the filter disk method: Nitrocellulose filter disks (Millipore®) of 0.057 diameter are immersed in appropriate solutions and are surgically implanted in rat cornea as described by Pandey et al., supra.
  • The stimulus for angiogenesis in this study is the treatment of the filter disk with 30 μM ECGF1, which is implanted within the cornea's stroma. This dose yields reproducible neovascularization stemming from the pericorneal vascular plexus growing toward the disk in a dose-response study 5 days following implant. Filter disks treated only with the vehicle for ECGF1 show no angiogenic response. The siNA are co-adminstered with ECGF1 on a disk in two different siNA concentrations. Blocking the production of ECGF1 or ECGF1r using simultaneous administration of anti-ECGF1 or ECGF1r mRNA siNA could attenuate the normal neovascularization induced by the filter disk treated with ECGF1.
  • Materials and Methods:
  • Test Compounds and Controls
      • R&D Systems ECGF1, carrier free at 75 μM in 82 mM Tris-Cl, pH 6.9
      • siNA, 1.67 μG/μL, sense/antisense
      • siNA, 1.67 μG/μL, INVERTED CONTROL (SEQ ID NO: 19; SEQ ID NO: 20) sense/antisense
        Animals
      • Harlan Sprague-Dawley Rats, Approximately 225-250 g
      • 45 males, 5 animals per group.
        Husbandry
  • Animals are housed in groups of two. Feed, water, temperature and humidity are determined according to Pharmacology Testing Facility performance standards (SOP's) which are in accordance with the 1996 Guide for the Care and Use of Laboratory Animals (NRC). Animals are acclimated to the facility for at least 7 days prior to experimentation. During this time, animals are observed for overall health and sentinels are bled for baseline serology.
  • Experimental Groups
  • Each solution (ECGF1 and siNAs) is prepared as a 1×solution for final concentrations shown in the experimental groups described in Table III.
  • siNA Annealing Conditions
  • siNA sense and antisense strands are annealed for 1 minute in H2O at 1.67 mg/mL/strand followed by a 1 hour incubation at 37° C. producing 3.34 mg/mL of duplexed siNA. For the 20 μg/eye treatment, 6 μLs of the 3.34 mg/mL duplex is injected into the eye (see below). The 3.34 mg/mL duplex siNA can then be serially diluted for dose response assays.
  • Preparation of ECGF1 Filter Disk
  • For corneal implantation, 0.57 mm diameter nitrocellulose disks, prepared from 0.45 μm pore diameter nitrocellulose filter membranes (Millipore Corporation), are soaked for 30 min in 1 μL of 75 μM ECGF1 in 82 mM Tris HCl (pH 6.9) in covered petri dishes on ice. Filter disks soaked only with the vehicle for ECGF1 (83 mM Tris-Cl pH 6.9) elicit no angiogenic response.
  • Corneal Surgery
  • The rat corneal model used in this study is a modified from Koch et al. Supra and Pandey et al., supra. Briefly, corneas were irrigated with 0.5% povidone iodine solution followed by normal saline and two drops of 2% lidocaine. Under a dissecting microscope (Leica MZ-6), a stromal pocket is created and a presoaked filter disk (see above) is inserted into the pocket such that its edge is 1 mm from the corneal limbus.
  • Intraconjunctival Injection of Test Solutions
  • Immediately after disk insertion, the tip of a 40-50 μm OD injector (constructed in our laboratory) is inserted within the conjunctival tissue 1 mm away from the edge of the corneal limbus that is directly adjacent to the ECGF1-soaked filter disk. Six hundred nanoliters of test solution (siNA, inverted control or sterile water vehicle) are dispensed at a rate of 1.2 μL/min using a syringe pump (Kd Scientific). The injector is then removed, serially rinsed in 70% ethanol and sterile water and immersed in sterile water between each injection. Once the test solution is injected, closure of the eyelid is maintained using microaneurism clips until the animal begins to recover gross motor activity. Following treatment, animals are warmed on a heating pad at 37° C.
  • Quantitation of Angiogenic Response
  • Five days after disk implantation, animals are euthanized following administration of 0.4 mg/kg atropine and corneas are digitally imaged. The neovascular surface area (NSA, expressed in pixels) is measured postmortem from blood-filled corneal vessels using computerized morphometry (Image Pro Plus, Media Cybernetics, v2.0). The individual mean NSA is determined in triplicate from three regions of identical size in the area of maximal neovascularization between the filter disk and the limbus. The number of pixels corresponding to the blood-filled corneal vessels in these regions is summated to produce an index of NSA. A group mean NSA is then calculated. Data from each treatment group were normalized to ECGF1/siNA vehicle-treated control NSA and finally expressed as percent inhibition of ECGF1-induced angiogenesis.
  • Statistics
  • After determining the normality of treatment group means, group mean percent inhibition of ECGF1-induced angiogenesis is subjected to a one-way analysis of variance. This is followed by two post-hoc tests for significance including Dunnett's (comparison to ECGF1 control) and Tukey-Kramer (all other group mean comparisons) at alpha=0.05. Statistical analyses are performed using JMP v.3.1.6 (SAS Institute).
  • Example 10 RNAi Mediated Inhibition of ECGF1 and/or ECGF1r RNA Expression
  • siNA constructs (Table III) are tested for efficacy in reducing ECGF1 and/or ECGF1r RNA expression in, for example, HUVEC, HMVEC, or A375 cells. Cells are plated approximately 24 h before transfection in 96-well plates at 5,000-7,500 cells/well, 100 μl/well, such that at the time of transfection cells are 70-90% confluent. For transfection, annealed siNAs are mixed with the transfection reagent (Lipofectamine 2000, Invitrogen) in a volume of 501 μl/well and incubated for 20 minutes at room temperature. The siNA transfection mixtures are added to cells to give a final siNA concentration of 25 nM in a volume of 150 μl. Each siNA transfection mixture is added to 3 wells for triplicate siNA treatments. Cells are incubated at 37° for 24 hours in the continued presence of the siNA transfection mixture. At 24 hours, RNA is prepared from each well of treated cells. The supernatants with the transfection mixtures are first removed and discarded, then the cells are lysed and RNA prepared from each well. Target gene expression following treatment is evaluated by RT-PCR for the target gene and for a control gene (36B4, an RNA polymerase subunit) for normalization. The triplicate data is averaged and the standard deviations determined for each treatment. Normalized data are graphed and the percent reduction of target mRNA by active siNAs in comparison to their respective inverted control siNAs is determined.
  • Example 11 Indications
  • The present body of knowledge in ECGF1 research indicates the need for methods to assay ECGF1 and/or ECGF1r activity and for compounds that can regulate ECGF1 and/or ECGF1r expression for research, diagnostic, and therapeutic use. As described herein, the nucleic acid molecules of the present invention can be used in assays to diagnose disease state related of ECGF1 and/or ECGF1r levels. In addition, the nucleic acid molecules can be used to treat disease state related to ECGF1 and/or ECGF1r levels.
  • Particular conditions and disease states that can be associated with ECGF1 and/or ECGF1r expression modulation include, but are not limited to:
  • 1) Tumor angiogenesis: Angiogenesis has been shown to be necessary for tumors to grow into pathological size (Folkman, 1971, PNAS 76, 5217-5221; Wellstein & Czubayko, 1996, Breast Cancer Res and Treatment 38, 109-119). In addition, it allows tumor cells to travel through the circulatory system during metastasis. Increased levels of gene expression of a number of angiogenic factors have been reported in vascularized and edema-associated brain tumors (Berkman et al., 1993 J. Clini. Invest. 91, 153). A more direct demostration of the role of angiogenic factors in tumor angiogenesis was demonstrated by Jim Kim et al., 1993 Nature 362,841 wherein, monoclonal antibodies against angiogenic factors were successfully used to inhibit the growth of rhabdomyosarcoma, glioblastoma multiforme cells in nude mice. Specific tumor/cancer types that can be targeted using the nucleic acid molecules of the invention include but are not limited to the tumor/cancer types described herein.
  • 2) Ocular diseases: Neovascularization has been shown to cause or exacerbate ocular diseases including, but not limited to, macular degeneration, neovascular glaucoma, diabetic retinopathy, myopic degeneration, and trachoma (Norrby, 1997, APMIS 105, 417-437). These observations support a direct role for angiogenesis in ocular diseases. Angiogenic factors, including factors that can stimulate ECGF1 synthesis, may also contribute to these indications. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating a variety of ocular diseases and conditions.
  • 3) Dermatological Disorders: Many indications have been identified which may beangiogenesis dependent, including but not limited to, psoriasis, verruca vulgaris, angiofibroma of tuberous sclerosis, pot-wine stains, Sturge Weber syndrome, Kippel-Trenaunay-Weber syndrome, and Osler-Weber-Rendu syndrome (Norrby, supra). Intradermal injection of the angiogenic factor b-FGF demonstrated angiogenesis in nude mice (Weckbecker et al., 1992, Angiogenesis: Key principles-Science-Technology-Medicine, ed R. Steiner). Detmar et al., 1994 J. Exp. Med. 180, 1141 reported that angiogenic factors were over-expressed in psoriatic skin and psoriatic dermal microvessels, suggesting that angiogenesis plays a significant role in psoriasis. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating psoriasis and other dermatological disorders.
  • 4) Rheumatoid arthritis: Immunohistochemistry and in situ hybridization studies on tissues from the joints of patients suffering from rheumatoid arthritis show an increased level of angiogenic factors (Fava et al., 1994 J. Exp. Med. 180, 341). Additionally, Koch et al., 1994 J. Immunol. 152, 4149, found that certain antibodies targeting angioenic factors were able to significantly reduce the mitogenic activity of synovial tissues from patients suffering from rheumatoid arthritis. Other angiogenic factors including those of the present invention may also be involved in arthritis. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating arthritis.
  • 5) Endometriosis: Various studies indicate that angiogenesis is directly implicated in endometriosis. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating endometriosis.
  • 6) Kidney disease: Autosomal dominant polycystic kidney disease (ADPKD) is the most common life threatening hereditary disease in the USA. It affects about 1:400 to 1:1000 people and approximately 50% of people with ADPKD develop renal failure. ADPKD accounts for about 5-10% of end-stage renal failure in the USA, requiring dialysis and renal transplantation. Angiogenesis is implicated in the progression of ADPKD for growth of cyst cells, as well as increased vascular permeability promoting fluid secretion into cysts. Modulation of angiogenesis using nucleic acid molecules of the invention may provide an approch to treating polycystic kidney disease.
  • The use of radiation treatments and chemotherapeutics, such as Gemcytabine and cyclophosphamide, are non-limiting examples of chemotherapeutic agents that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA molecules) of the instant invention. In addition, the use of combination treatments comprising anti-VEGF/VEGFr molecules (such as siNAs targeting VEGF and VEGF receptor RNA), may provide improved efficacy in treating angiogenesis related diseases and conditions. Those skilled in the art will recognize that other anti-cancer compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g. siNA molecules) and are hence within the scope of the instant invention. Such compounds and therapies are well known in the art (see for example Cancer: Principles and Pranctice of Oncology, Volumes 1 and 2, eds Devita, V. T., Hellman, S., and Rosenberg, S. A., J. B. Lippincott Company, Philadelphia, USA; incorporated herein by reference) and include, without limitation, folates, antifolates, pyrimidine analogs, fluoropyrimidines, purine analogs, adenosine analogs, topoisomerase I inhibitors, anthrapyrazoles, retinoids, antibiotics, anthacyclins, platinum analogs, alkylating agents, nitrosoureas, plant derived compounds such as vinca alkaloids, epipodophyllotoxins, tyrosine kinase inhibitors, taxols, radiation therapy, surgery, nutritional supplements, gene therapy, radiotherapy, for example 3D-CRT, immunotoxin therapy, for example ricin, and monoclonal antibodies. Specific examples of chemotherapeutic compounds that can be combined with or used in conjuction with the nucleic acid molecules of the invention include, but are not limited to, Paclitaxel; Docetaxel; Methotrexate; Doxorubin; Edatrexate; Vinorelbine; Tomaxifen; Leucovorin; 5-fluoro uridine (5-FU); Ionotecan; Cisplatin; Carboplatin; Amsacrine; Cytarabine; Bleomycin; Mitomycin C; Dactinomycin; Mithramycin; Hexamethylmelamine; Dacarbazine; L-asperginase; Nitrogen mustard; Melphalan, Chlorambucil; Busulfan; Ifosfamide; 4-hydroperoxycyclophosphamide; Thiotepa; Irinotecan (CAMPTOSAR®, CPT-11, Camptothecin-11, Campto) Tamoxifen; Herceptin; IMC C225; ABX-EGF; and combinations thereof. The above list of compounds are non-limiting examples of compounds and/or methods that can be combined with or used in conjunction with the nucleic acid molecules (e.g. siNA) of the instant invention. Those skilled in the art will recognize that other drug compounds and therapies can similarly be readily combined with the nucleic acid molecules of the instant invention (e.g., siNA molecules) are hence within the scope of the instant invention.
  • Example 12 Diagnostic Uses
  • The siNA molecules of the invention can be used in a variety of diagnostic applications, such as in the identification of molecular targets (e.g., RNA) in a variety of applications, for example, in clinical, industrial, environmental, agricultural and/or research settings. Such diagnostic use of siNA molecules involves utilizing reconstituted RNAi systems, for example, using cellular lysates or partially purified cellular lysates. siNA molecules of this invention can be used as diagnostic tools to examine genetic drift and mutations within diseased cells or to detect the presence of endogenous or exogenous, for example viral, RNA in a cell. The close relationship between siNA activity and the structure of the target RNA allows the detection of mutations in any region of the molecule, which alters the base-pairing and three-dimensional structure of the target RNA. By using multiple siNA molecules described in this invention, one can map nucleotide changes, which are important to RNA structure and function in vitro, as well as in cells and tissues. Cleavage of target RNAs with siNA molecules can be used to inhibit gene expression and define the role of specified gene products in the progression of disease or infection. In this manner, other genetic targets can be defined as important mediators of the disease. These experiments will lead to better treatment of the disease progression by affording the possibility of combination therapies (e.g., multiple siNA molecules targeted to different genes, siNA molecules coupled with known small molecule inhibitors, or intermittent treatment with combinations siNA molecules and/or other chemical or biological molecules). Other in vitro uses of siNA molecules of this invention are well known in the art, and include detection of the presence of mRNAs associated with a disease, infection, or related condition. Such RNA is detected by determining the presence of a cleavage product after treatment with a siNA using standard methodologies, for example, fluorescence resonance emission transfer (FRET).
  • In a specific example, siNA molecules that cleave only wild-type or mutant forms of the target RNA are used for the assay. The first siNA molecules (i.e., those that cleave only wild-type forms of target RNA) are used to identify wild-type RNA present in the sample and the second siNA molecules (i.e., those that cleave only mutant forms of target RNA) are used to identify mutant RNA in the sample. As reaction controls, synthetic substrates of both wild-type and mutant RNA are cleaved by both siNA molecules to demonstrate the relative siNA efficiencies in the reactions and the absence of cleavage of the “non-targeted” RNA species. The cleavage products from the synthetic substrates also serve to generate size markers for the analysis of wild-type and mutant RNAs in the sample population. Thus, each analysis requires two siNA molecules, two substrates and one unknown sample, which is combined into six reactions. The presence of cleavage products is determined using an RNase protection assay so that full-length and cleavage fragments of each RNA can be analyzed in one lane of a polyacrylamide gel. It is not absolutely required to quantify the results to gain insight into the expression of mutant RNAs and putative risk of the desired phenotypic changes in target cells. The expression of mRNA whose protein product is implicated in the development of the phenotype (i.e., disease related or infection related) is adequate to establish risk. If probes of comparable specific activity are used for both transcripts, then a qualitative comparison of RNA levels is adequate and decreases the cost of the initial diagnosis. Higher mutant form to wild-type ratios are correlated with higher risk whether RNA levels are compared qualitatively or quantitatively.
  • All patents and publications mentioned in the specification are indicative of the levels of skill of those skilled in the art to which the invention pertains. All references cited in this disclosure are incorporated by reference to the same extent as if each reference had been incorporated by reference in its entirety individually.
  • One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The methods and compositions described herein as presently representative of preferred embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art, which are encompassed within the spirit of the invention, are defined by the scope of the claims.
  • It will be readily apparent to one skilled in the art that varying substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention. Thus, such additional embodiments are within the scope of the present invention and the following claims. The present invention teaches one skilled in the art to test various combinations and/or substitutions of chemical modifications described herein toward generating nucleic acid constructs with improved activity for mediating RNAi activity. Such improved activity can comprise improved stability, improved bioavailability, and/or improved activation of cellular responses mediating RNAi. Therefore, the specific embodiments described herein are not limiting and one skilled in the art can readily appreciate that specific combinations of the modifications described herein can be tested without undue experimentation toward identifying siNA molecules with improved RNAi activity.
  • The invention illustratively described herein suitably can be practiced in the absence of any element or elements, limitation or limitations that are not specifically disclosed herein. Thus, for example, in each instance herein any of the terms “comprising”, “consisting essentially of”, and “consisting of” may be replaced with either of the other two terms. The terms and expressions which have been employed are used as terms of description and not of limitation, and there is no intention that in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the description and the appended claims.
  • In addition, where features or aspects of the invention are described in terms of Markush groups or other grouping of alternatives, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
    TABLE I
    ECGF1 Accession Numbers
    NM_001400
    Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled
    receptor, 1 (EDG1), mRNA
    gi|13027635|ref|NM_001400.2|[13027635]
    NM_001953
    Homo sapiens endothelial cell growth factor 1 (platelet-derived) (ECGF1),
    mRNA
    gi|7669488|ref|NM_001953.2|[7669488]
    M58602
    Human platelet-derived endothelial cell growth factor gene, exons 1
    through 10
    gi|189723|gb|M58602.1|HUMPDGFAA[189723]
    M63193
    Human platelet-derived endothelial cell growth factor mRNA, complete
    cds
    gi|189700|gb|M63193.1|HUMPDECGF|[189700]
    M31210
    Human endothelial differentiation protein (edg-1) gene mRNA, complete
    cds
    gi|181948|gb|M31210.1|HUMEDG[181948]
  • TABLE II
    ECGF1 siNA and Target Sequences
    ECGF1 NM_001953.2
    Seq Seq
    Pos Seq Seq ID UPos Upper seq ID LPos Lower seq ID
    3 CCCGCCGCCGGCAGUGGAC 1 3 CCCGCCGCCGGCAGUGGAC 1 21 GUCCACUGCCGGCGGCGGG 90
    21 CCGCUGUGCGCGAACCCUG 2 21 CCGCUGUGCGCGAACCCUG 2 39 CAGGGUUCGCGCACAGCGG 91
    39 GAACCCUACGGUCCCGACC 3 39 GAACCCUACGGUCCCGACC 3 57 GGUCGGGACCGUAGGGUUC 92
    57 CCGCGGGCGAGGCCGGGUA 4 57 CCGCGGGCGAGGCCGGGUA 4 75 UACCCGGCCUCGCCCGCGG 93
    75 ACCUGGGCUGGGAUCCGGA 5 75 ACCUGGGCUGGGAUCCGGA 5 93 UCCGGAUCCCAGCCCAGGU 94
    93 AGCAAGCGGGCGAGGGCAG 6 93 AGCAAGCGGGCGAGGGCAG 6 111 CUGCCCUCGCCCGCUUGCU 95
    111 GCGCCCUAAGCAGGCCCGG 7 111 GCGCCCUAAGCAGGCCCGG 7 129 CCGGGCCUGCUUAGGGCGC 96
    129 GAGCGAUGGCAGCCUUGAU 8 129 GAGCGAUGGCAGCCUUGAU 8 147 AUCAAGGCUGCCAUCGCUC 97
    147 UGACCCCGGGAACCGGGGC 9 147 UGACCCCGGGAACCGGGGC 9 165 GCCCCGGUUCCCGGGGUCA 98
    165 CCCCACCCGCGCCUGGUGA 10 165 CCCCACCCGCGCCUGGUGA 10 183 UCACCAGGCGCGGGUGGGG 99
    183 ACUUCUCCGGGGAAGGGAG 11 183 ACUUCUCCGGGGAAGGGAG 11 201 CUCCCUUCCCCGGAGAAGU 100
    201 GCCAGGGACUUCCCGACCC 12 201 GCCAGGGACUUCCCGACCC 12 219 GGGUCGGGAAGUCCCUGGC 101
    219 CUUCGCCAGAGCCCAAGCA 13 219 CUUCGCCAGAGCCCAAGCA 13 237 UGCUUGGGCUCUGGCGAAG 102
    237 AGCUCCCGGAGCUGAUCCG 14 237 AGCUCCCGGAGCUGAUCCG 14 255 CGGAUCAGCUCCGGGAGCU 103
    255 GCAUGAAGCGAGACGGAGG 15 255 GCAUGAAGCGAGACGGAGG 15 273 CCUCCGUCUCGCUUCAUGC 104
    273 GCCGCCUGAGCGAAGCGGA 16 273 GCCGCCUGAGCGAAGCGGA 16 291 UCCGCUUCGCUCAGGCGGC 105
    291 ACAUCAGGGGCUUCGUGGC 17 291 ACAUCAGGGGCUUCGUGGC 17 309 GCCACGAAGCCCCUGAUGU 106
    309 CCGCUGUGGUGAAUGGGAG 18 309 CCGCUGUGGUGAAUGGGAG 18 327 CUCCCAUUCACCACAGCGG 107
    327 GCGCGCAGGGCGCACAGAU 19 327 GCGCGCAGGGCGCACAGAU 19 345 AUCUGUGCGCCCUGCGCGC 108
    345 UCGGGGCCAUGCUGAUGGC 20 345 UCGGGGCCAUGCUGAUGGC 20 363 GCCAUCAGCAUGGCCCCGA 109
    363 CCAUCCGACUUCGGGGCAU 21 363 CCAUCCGACUUCGGGGCAU 21 381 AUGCCCCGAAGUCGGAUGG 110
    381 UGGAUCUGGAGGAGACCUC 22 381 UGGAUCUGGAGGAGACCUC 22 399 GAGGUCUCCUCCAGAUCCA 111
    399 CGGUGCUGACCCAGGCCCU 23 399 CGGUGCUGACCCAGGCCCU 23 417 AGGGCCUGGGUCAGCACCG 112
    417 UGGCUCAGUCGGGACAGCA 24 417 UGGCUCAGUCGGGACAGCA 24 435 UGCUGUCCCGACUGAGCCA 113
    435 AGCUGGAGUGGCCAGAGGC 25 435 AGCUGGAGUGGCCAGAGGC 25 453 GCCUCUGGCCACUCCAGCU 114
    453 CCUGGCGCCAGCAGCUUGU 26 453 CCUGGCGCCAGCAGCUUGU 26 471 ACAAGCUGCUGGCGCCAGG 115
    471 UGGACAAGCAUUCCACAGG 27 471 UGGACAAGCAUUCCACAGG 27 489 CCUGUGGAAUGCUUGUCCA 116
    489 GGGGUGUGGGUGACAAGGU 28 489 GGGGUGUGGGUGACAAGGU 28 507 ACCUUGUCACCCACACCCC 117
    507 UCAGCCUGGUCCUCGCACC 29 507 UCAGCCUGGUCCUCGCACC 29 525 GGUGCGAGGACCAGGCUGA 118
    525 CUGCCCUGGCGGCAUGUGG 30 525 CUGCCCUGGCGGCAUGUGG 30 543 CCACAUGCCGCCAGGGCAG 119
    543 GCUGCAAGGUGCCAAUGAU 31 543 GCUGCAAGGUGCCAAUGAU 31 561 AUCAUUGGCACCUUGCAGC 120
    561 UCAGCGGACGUGGUCUGGG 32 561 UCAGCGGACGUGGUCUGGG 32 579 CCCAGACCACGUCCGCUGA 121
    579 GGCACACAGGAGGCACCUU 33 579 GGCACACAGGAGGCACCUU 33 597 AAGGUGCCUCCUGUGUGCC 122
    597 UGGAUAAGCUGGAGUCUAU 34 597 UGGAUAAGCUGGAGUCUAU 34 615 AUAGACUCCAGCUUAUCCA 123
    615 UUCCUGGAUUCAAUGUCAU 35 615 UUCCUGGAUUCAAUGUCAU 35 633 AUGACAUUGAAUCCAGGAA 124
    633 UCCAGAGCCCAGAGCAGAU 36 633 UCCAGAGCCCAGAGCAGAU 36 651 AUCUGCUCUGGGCUCUGGA 125
    651 UGCAAGUGCUGCUGGACCA 37 651 UGCAAGUGCUGCUGGACCA 37 669 UGGUCCAGCAGCACUUGCA 126
    669 AGGCGGGCUGCUGUAUCGU 38 669 AGGCGGGCUGCUGUAUCGU 38 687 ACGAUACAGCAGCCCGCCU 127
    687 UGGGUCAGAGUGAGCAGCU 39 687 UGGGUCAGAGUGAGCAGCU 39 705 AGCUGCUCACUCUGACCCA 128
    705 UGGUUCCUGCGGACGGAAU 40 705 UGGUUCCUGCGGACGGAAU 40 723 AUUCCGUCCGCAGGAACCA 129
    723 UCCUAUAUGCAGCCAGAGA 41 723 UCCUAUAUGCAGCCAGAGA 41 741 UCUCUGGCUGCAUAUAGGA 130
    741 AUGUGACAGCCACCGUGGA 42 741 AUGUGACAGCCACCGUGGA 42 759 UCCACGGUGGCUGUCACAU 131
    759 ACAGCCUGCCACUCAUCAC 43 759 ACAGCCUGCCACUCAUCAC 43 777 GUGAUGAGUGGCAGGCUGU 132
    777 CAGCCUCCAUUCUCAGUAA 44 777 CAGCCUCCAUUCUCAGUAA 44 795 UUACUGAGAAUGGAGGCUG 133
    795 AGAAACUCGUGGAGGGGCU 45 795 AGAAACUCGUGGAGGGGCU 45 813 AGCCCCUCCACGAGUUUCU 134
    813 UGUCCGCUCUGGUGGUGGA 46 813 UGUCCGCUCUGGUGGUGGA 46 831 UCCACCACCAGAGCGGACA 135
    831 ACGUUAAGUUCGGAGGGGC 47 831 ACGUUAAGUUCGGAGGGGC 47 849 GCCCCUCCGAACUUAACGU 136
    849 CCGCCGUCUUCCCCAACCA 48 849 CCGCCGUCUUCCCCAACCA 48 867 UGGUUGGGGAAGACGGCGG 137
    867 AGGAGCAGGCCCGGGAGCU 49 867 AGGAGCAGGCCCGGGAGCU 49 885 AGCUCCCGGGCCUGCUCCU 138
    885 UGGCAAAGACGCUGGUUGG 50 885 UGGCAAAGACGCUGGUUGG 50 903 CCAACCAGCGUCUUUGCCA 139
    903 GCGUGGGAGCCAGCCUAGG 51 903 GCGUGGGAGCCAGCCUAGG 51 921 CCUAGGCUGGCUCCCACGC 140
    921 GGCUUCGGGUCGCGGCAGC 52 921 GGCUUCGGGUCGCGGCAGC 52 939 GCUGCCGCGACCCGAAGCC 141
    939 CGCUGACCGCCAUGGACAA 53 939 CGCUGACCGCCAUGGACAA 53 957 UUGUCCAUGGCGGUCAGCG 142
    957 AGCCCCUGGGUCGCUGCGU 54 957 AGCCCCUGGGUCGCUGCGU 54 975 ACGCAGCGACCCAGGGGCU 143
    975 UGGGCCACGCCCUGGAGGU 55 975 UGGGCCACGCCCUGGAGGU 55 993 ACCUCCAGGGCGUGGCCCA 144
    993 UGGAGGAGGCGCUGCUCUG 56 993 UGGAGGAGGCGCUGCUCUG 56 1011 CAGAGCAGCGCCUCCUCCA 145
    1011 GCAUGGACGGCGCAGGCCC 57 1011 GCAUGGACGGCGCAGGCCC 57 1029 GGGCCUGCGCCGUCCAUGC 146
    1029 CGCCAGACUUAAGGGACCU 58 1029 CGCCAGACUUAAGGGACCU 58 1047 AGGUCCCUUAAGUCUGGCG 147
    1047 UGGUCACCACGCUCGGGGG 59 1047 UGGUCACCACGCUCGGGGG 59 1065 CCCCCGAGCGUGGUGACCA 148
    1065 GCGCCCUGCUCUGGCUCAG 60 1065 GCGCCCUGCUCUGGCUCAG 60 1083 CUGAGCCAGAGCAGGGCGC 149
    1083 GCGGACACGCGGGGACUCA 61 1083 GCGGACACGCGGGGACUCA 61 1101 UGAGUCCCCGCGUGUCCGC 150
    1101 AGGCUCAGGGCGCUGCCCG 62 1101 AGGCUCAGGGCGCUGCCCG 62 1119 CGGGCAGCGCCCUGAGCCU 151
    1119 GGGUGGCCGCGGCGCUGGA 63 1119 GGGUGGCCGCGGCGCUGGA 63 1137 UCCAGCGCCGCGGCCACCC 152
    1137 ACGACGGCUCGGCCCUUGG 64 1137 ACGACGGCUCGGCCCUUGG 64 1155 CCAAGGGCCGAGCCGUCGU 153
    1155 GCCGCUUCGAGCGGAUGCU 65 1155 GCCGCUUCGAGCGGAUGCU 65 1173 AGCAUCCGCUCGAAGCGGC 154
    1173 UGGCGGCGCAGGGCGuGGA 66 1173 UGGCGGCGCAGGGCGUGGA 66 1191 UCCACGCCCUGCGCCGCCA 155
    1191 AUCCCGGUCUGGCCCGAGC 67 1191 AUCCCGGUCUGGCCCGAGC 67 1209 GCUCGGGCCAGACCGGGAU 156
    1209 CCCUGUGCUCGGGAAGUCC 68 1209 CCCUGUGCUCGGGAAGUCC 68 1227 GGACUUCCCGAGCACAGGG 157
    1227 CCGCAGAACGCCGGCAGCU 69 1227 CCGCAGAACGCCGGCAGCU 69 1245 AGCUGCCGGCGUUCUGCGG 158
    1245 UGCUGCCUCGCGCCCGGGA 70 1245 UGCUGCCUCGCGCCCGGGA 70 1263 UCCCGGGCGCGAGGCAGCA 159
    1263 AGCAGGAGGAGCUGCUGGC 71 1263 AGCAGGAGGAGCUGCUGGC 71 1281 GCCAGCAGCUCCUCCUGCU 160
    1281 CGCCCGCAGAUGGCACCGU 72 1281 CGCCCGCAGAUGGCACCGU 72 1299 ACGGUGCCAUCUGCGGGCG 161
    1299 UGGAGCUGGUCCGGGCGCU 73 1299 UGGAGCUGGUCCGGGCGCU 73 1317 AGCGCCCGGACCAGCUCCA 162
    1317 UGCCGCUGGCGCUGGUGCU 74 1317 UGCCGCUGGCGCUGGUGCU 74 1335 AGCACCAGCGCCAGCGGCA 163
    1335 UGCACGAGCUCGGGGCCGG 75 1335 UGCACGAGCUCGGGGCCGG 75 1353 CCGGCCCCGAGCUCGUGCA 164
    1353 GGCGCAGCCGCGCUGGGGA 76 1353 GGCGCAGCCGCGCUGGGGA 76 1371 UCCCCAGCGCGGCUGCGCC 165
    1371 AGCCGCUCCGCCUGGGGGU 77 1371 AGCCGCUCCGCCUGGGGGU 77 1389 ACCCCCAGGCGGAGCGGCU 166
    1389 UGGGCGCAGAGCUGCUGGU 78 1389 UGGGCGCAGAGCUGCUGGU 78 1407 ACCAGCAGCUCUGCGCCCA 167
    1407 UCGACGUGGGUCAGAGGCU 79 1407 UCGACGUGGGUCAGAGGCU 79 1425 AGCCUCUGACCCACGUCGA 168
    1425 UGCGCCGUGGGACCCCCUG 80 1425 UGCGCCGUGGGACCCCCUG 80 1443 CAGGGGGUCCCACGGCGCA 169
    1443 GGCUCCGCGUGCACCGGGA 81 1443 GGCUCCGCGUGCACCGGGA 81 1461 UCCCGGUGCACGCGGAGCC 170
    1461 ACGGCCCCGCGCUCAGCGG 82 1461 ACGGCCCCGCGCUCAGCGG 82 1479 CCGCUGAGCGCGGGGCCGU 171
    1479 GCCCGCAGAGCCGCGCCCU 83 1479 GCCCGCAGAGCCGCGCCCU 83 1497 AGGGCGCGGCUCUGCGGGC 172
    1497 UGCAGGAGGCGCUCGUACU 84 1497 UGCAGGAGGCGCUCGUACU 84 1515 AGUACGAGCGCCUCCUGCA 173
    1515 UCUCCGACCGCGCGCCAUU 85 1515 UCUCCGACCGCGCGCCAUU 85 1533 AAUGGCGCGCGGUCGGAGA 174
    1533 UCGCCGCGCCCUCGCCCUU 86 1533 UCGCCGCCCCCUCGCCCUU 86 1551 AAGGGCGAGGGGGCGGCGA 175
    1551 UCGCAGAGCUCGUUCUGCC 87 1551 UCGCAGAGCUCGUUCUGCC 87 1569 GGCAGAACGAGCUCUGCGA 176
    1569 CGCCGCAGCAAUAAAGCUC 88 1569 CGCCGCAGCAAUAAAGCUC 88 1587 GAGCUUUAUUGCUGCGGCG 177
    1580 UAAAGCUCCUUUGCCGCGA 89 1580 UAAAGCUCCUUUGCCGCGA 89 1598 UCGCGGCAAAGGAGCUUUA 178

    The 3′-ends of the Upper sequence and the Lower sequence of the siNA construct can include an overhang sequence, for example about 1, 2, 3, or 4 nucleotides in length, preferably 2 nucleotides in length, wherein the overhanging sequence of the lower sequence is optionally complementary to a portion of the target sequence.
    # The upper sequence is also referred to as the sense strand, whereas the lower sequence is also referred to as the antisense strand. The upper and lower sequences in the Table can further comprise a chemical modification having Formulae I-VII or any combination thereof.
  • TABLE III
    ECGF1 Synthetic Modified siNA constructs
    Target Seq Seq
    Pos Target ID Aliases Sequence ID
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:593U21 siRNA sense ACCUUGGAUAAGCUGGAGUTT 183
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:685U21 siRNA sense CGUGGGUCAGAGUGAGCAGTT 184
    690 GUCAGAGUGAGCAGCUGGUUCCU 181 ECGF1:692U21 siRNA sense CAGAGUGAGCAGCUGGUUCTT 185
    1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1033U21 siRNA sense AGACUUAAGGGACCUGGUCTT 186
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:611L21 siRNA (593C) antisense ACUCCAGCUUAUCCAAGGUTT 187
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 EGGE1:703L21 siRNA (685C) antisense CUGGUCACUCUGACCCACGTT 188
    690 GUCAGAGUGAGCAGCUGGUUCCU 181 ECGF1:710L21 siRNA (692C) antisense GAACCAGCUGCUCACUCUGTT 189
    1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1051L21 siRNA (1033C) antisense GACCAGGUCCCUUAAGUCUTT 190
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:593U21 siRNA stab04 sense B AccuuGGAuAAGcuGGAGuTT B 191
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:685U21 siRNA stab04 sense B cGuGGGucAGAGuGAGcAGTT B 192
    690 GUCAGAGUGAGCAGCUGGUUCCU 181 ECGF1:692U21 siRNA stab04 sense B cAGAGuGAGcAGcuGGuucTT B 193
    1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1033U21 siRNA stabo4 sense B AGAcuuAAGGGAccuGGucTT B 194
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:611L21 siRNA (593C) stab05 AcuccAGcuuAuccAAGGuTsT 195
    antisense
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:703L21 siRNA (685C) stab05 cuGcucAcucuGAcccAcGTsT 196
    antisense
    690 GUCAGAGUGAGCAG0UGGUUCCU 181 ECGF1:710L21 siRNA (692C) stab05 GAAccAGcuGcucAcucuGTsT 197
    antisense
    1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1051L21 siRNA (1033C) stab05 GAccAGGucccuuAAGucuTsT 198
    antisense
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:593U21 siRNA stab07 sense B AccuuGGAuAAGcuGGAGuTT B 199
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:685U21 siRNA stab07 sense B cGuGGGuCAGAGuGAGcAGTT B 200
    690 GUCAGAGUGAGCAGCUGGUUCCu 181 ECGF1:692U21 siRNA stab07 sense B cAGAGuGAGcAGcuGGuucTT B 201
    1031 CCAGACUUAAGGGACCUGGUCAC 182 ECGF1:1033U21 siRNA stab07 sense B AGAcuuAAGGGAccuGGucTT B 202
    591 GCACCUUGGAUAAGCUGGAGUCU 179 ECGF1:611L21 siRNA (593C) stab11 AcuccAGcuuAuccAAGGuTsT 203
    antisense
    683 AUCGUGGGUCAGAGUGAGCAGCU 180 ECGF1:703L21 siRNA (685C) stab11 cuGcucAcucuGAcccAcGTsT 204
    antisense
    690 GUCAGAGUGAGCAGCUGGUUCCU 181 ECGF1:710L21 siRNA (692C) stab11 GAAccAGcuGcucAcucuGTsT 205
    antisense
    1031 CGAGACUUAAGGGACCUGGUCAC 182 ECGF1:1051L21 siRNA (1033C) stab11 GAccAGGucccuuAAGucuTsT 206
    antisense

    Uppercase = ribonucleotide

    u, c = 2′-deoxy-2′-fluoro U, C

    T = thymidine

    B = inverted deoxy abasic

    s = phosphorothioate linkage

    A = deoxy Adenosine

    G = deoxy Guanosine
  • TABLE IV
    Non-limiting examples of Stabilization Chemistries for chemically
    modified siNA constructs
    Chemistry pyrimidine Purine cap p = S Strand
    “Stab 1” Ribo Ribo 5 at 5′-end S/AS
    1 at 3′-end
    “Stab 2” Ribo Ribo All Usually AS
    linkages
    “Stab 3” 2′-fluoro Ribo 4 at 5′-end Usually S
    4 at 3′-end
    “Stab 4” 2′-fluoro Ribo 5′ and Usually S
    3′-ends
    “Stab 5” 2′-fluoro Ribo 1 at 3′-end Usually AS
    “Stab 6” 2′-O-Methyl Ribo 5′ and Usually S
    3′-ends
    “Stab 7” 2′-fluoro 2′-deoxy 5′ and Usually S
    3′-ends
    “Stab 8” 2′-fluoro 2′-O- 1 at 3′-end Usually AS
    Methyl
    “Stab 9” Ribo Ribo 5′ and Usually S
    3′-ends
    “Stab 10” Ribo Ribo 1 at 3′-end Usually AS
    “Stab 11” 2′-fluoro 2′-deoxy 1 at 3′-end Usually AS
     Stab 12 2′-fluoro LNA 5′ and Usually S
    3′-ends
    “Stab 13” 2′-fluoro LNA 1 at 3′-end Usually AS
    “Stab 14” 2′-fluoro 2′-deoxy 2 at 5′-end Usually AS
    1 at 3′-end
    “Stab 15” 2′-deoxy 2′-deoxy 2 at 5′-end Usually AS
    1 at 3′-end
    “Stab 16 Ribo 2′-O- 5′ and Usually S
    Methyl 3′-ends
    “Stab 17” 2′-O-Methyl 2′-O- 5′ and Usually S
    Methyl 3′-ends
    “Stab 18” 2′-fluoro 2′-O- 1 at 3′-end Usually AS
    Methyl

    CAP = any terminal cap, see for example FIG. 10.

    All Stab 1-11 chemistries can comprise 3′-terminal thymidine (TT) residues

    All Stab 1-11 chemistries typically comprise 21 nucleotides, but can vary as described herein.

    S = sense strand

    AS = antisense strand
  • TABLE V
    Wait Time*
    Reagent Equivalents Amount Wait Time* DNA 2′-O-methyl Wait Time*RNA
    A. 2.5 μmol Synthesis Cycle ABI 394 Instrument
    Phosphoramidites 6.5 163 μL 45 sec 2.5 min 7.5 min
    S-Ethyl Tetrazole 23.8 238 μL 45 sec 2.5 min 7.5 min
    Acetic Anhydride 100 233 μL  5 sec 5 sec 5 sec
    N-Methyl 186 233 μL  5 sec 5 sec 5 sec
    Imidazole
    TCA 176 2.3 mL 21 sec 21 sec 21 sec
    Iodine 11.2 1.7 mL 45 sec 45 sec 45 sec
    Beaucage 12.9 645 μL 100 sec  300 sec 300 sec
    Acetonitrile NA 6.67 mL NA NA NA
    B. 0.2 μmol Synthesis Cycle ABI 394 Instrument
    Phosphoramidites 15 31 μL 45 sec 233 sec 465 sec
    S-Ethyl Tetrazole 38.7 31 μL 45 sec 233 min 465 sec
    Acetic Anhydride 655 124 μL  5 sec 5 sec 5 sec
    N-Methyl 1245 124 μL  5 sec 5 sec 5 sec
    Imidazole
    TCA 700 732 μL 10 sec 10 sec 10 sec
    Iodine 20.6 244 μL 15 sec 15 sec 15 sec
    Beaucage 7.7 232 μL 100 sec  300 sec 300 sec
    Acetonitrile NA 2.64 mL NA NA NA
    Equivalents: DNA/ Amount: DNA/2′-O- Wait Time* 2′-O-
    Reagent 2′-O-methyl/Ribo methyl/Ribo Wait Time* DNA methyl Wait Time* Ribo
    C. 0.2 μmol Synthesis Cycle 96 well Instrument
    Phosphoramidites 22/33/66 40/60/120 μL 60 sec 180 sec 360 sec
    S-Ethyl Tetrazole 70/105/210 40/60/120 μL 60 sec 180 min 360 sec
    Acetic Anhydride 265/265/265 50/50/50 μL 10 sec 10 sec  10 sec
    N-Methyl 502/502/502 50/50/50 μL 10 sec 10 sec  10 sec
    Imidazole
    TCA 238/475/475 250/500/500 μL 15 sec 15 sec  15 sec
    Iodine 6.8/6.8/6.8 80/80/80 μL 30 sec 30 sec  30 sec
    Beaucage 34/51/51 80/120/120 100 sec  200 sec 200 sec
    Acetonitrile NA 1150/1150/1150 μL NA NA NA

    *Wait time does not include contact time during delivery.

    *Tandem synthesis utilizes double coupling of linker molecule

Claims (36)

1. A double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a platelet-derived endothelial cell growth factor (ECGF1) gene, wherein said siNA molecule comprises about 21 nucleotides.
2. The siNA molecule of claim 1, wherein said siNA molecule does not contain any ribonucleotides.
3. The siNA molecule of claim 1, wherein said siNA molecule comprises one or more ribonucleotides.
4. The siNA molecule of claim 1, wherein one of the strands of said double-stranded siNA molecule comprises a nucleotide sequence that is complementary to a nucleotide sequence of an ECGF1 gene or a portion thereof, and wherein the second strand of said double-stranded siNA molecule comprises a nucleotide sequence substantially similar to the nucleotide sequence of said ECGF1 gene or a portion thereof.
5. The siNA molecule of claim 4, wherein each strand of the siNA molecule comprises about 19 to about 23 nucleotides, and wherein each strand comprises at least about 19 nucleotides that are complementary to the nucleotides of the other strand.
6. The siNA molecule of claim 1, wherein said siNA molecule comprises an antisense region comprising a nucleotide sequence that is complementary to a nucleotide sequence of an ECGF1 gene or a portion thereof, and wherein said siNA further comprises a sense region, wherein said sense region comprises a nucleotide sequence substantially similar to the nucleotide sequence of said ECGF1 gene or a portion thereof.
7. The siNA molecule of claim 6, wherein said antisense region and said sense region each comprise about 19 to about 23 nucleotides, and wherein said antisense region comprises at least about 19 nucleotides that are complementary to nucleotides of the sense region.
8. The siNA molecule of claim 1, wherein said siNA molecule comprises a sense region and an antisense region and wherein said antisense region comprises a nucleotide sequence that is complementary to a nucleotide sequence of RNA encoded by an ECGF1 gene or a portion thereof and said sense region comprises a nucleotide sequence that is complementary to said antisense region.
9. The siNA molecule of claim 6, wherein said siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of said siNA molecule.
10. The siNA molecule of claim claim 6, wherein said sense region is connected to the antisense region via a linker molecule.
11. The siNA molecule of claim 10, wherein said linker molecule is a polynucleotide linker.
12. The siNA molecule of claim 10, wherein said linker molecule is a non-nucleotide linker.
13. The siNA molecule of claim 6, wherein pyrimidine nucleotides in the sense region are 2′-O-methylpyrimidine nucleotides.
14. The siNA molecule of claim 6, wherein purine nucleotides in the sense region are 2′-deoxy purine nucleotides.
15. The siNA molecule of claim 6, wherein the pyrimidine nucleotides present in the sense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides.
16. The siNA molecule of claim 9, wherein the fragment comprising said sense region includes a terminal cap moiety at the 5′-end, the 3′-end, or both of the 5′ and 3′ ends of the fragment comprising said sense region.
17. The siNA molecule of claim 16, wherein said terminal cap moiety is an inverted deoxy abasic moiety.
18. The siNA molecule of claim 6, wherein the pyrimidine nucleotides of said antisense region are 2′-deoxy-2′-fluoro pyrimidine nucleotides
19. The siNA molecule of claim 6, wherein the purine nucleotides of said antisense region are 2′-O-methyl purine nucleotides.
20. The siNA molecule of claim 6, wherein the purine nucleotides present in said antisense region comprise 2′-deoxy-purine nucleotides.
21. The siNA molecule of claim 18, wherein said antisense region comprises a phosphorothioate internucleotide linkage at the 3′ end of said antisense region.
22. The siNA molecule of claim 6, wherein said antisense region comprises a glyceryl modification at the 3′ end of said antisense region.
23. The siNA molecule of claim 9, wherein each of the two fragments of said siNA molecule comprise 21 nucleotides.
24. The siNA molecule of claim 23, wherein about 19 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule and wherein at least two 3′ terminal nucleotides of each fragment of the siNA molecule are not base-paired to the nucleotides of the other fragment of the siNA molecule.
25. The siNA molecule of claim 24, wherein each of the two 3′ terminal nucleotides of each fragment of the siNA molecule are 2′-deoxy-pyrimidines.
26. The siNA molecule of claim 25, wherein said 2′-deoxy-pyrimidine is 2′-deoxy-thymidine.
27. The siNA molecule of claim 23, wherein all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
28. The siNA molecule of claim 23, wherein about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence of the RNA encoded by an ECGF1 gene or a portion thereof.
29. The siNA molecule of claim 23, wherein 21 nucleotides of the antisense region are base-paired to the nucleotide sequence of the RNA encoded by an ECGF1r gene or a portion thereof.
30. The siNA molecule of claim 9, wherein the 5′-end of the fragment comprising said antisense region optionally includes a phosphate group.
31. A double-stranded short interfering nucleic acid (siNA) molecule that down-regulates the expression of an ECGF1 gene, wherein said siNA molecule does not contain any ribonucleotides and wherein each strand of said double-stranded siNA molecule comprisess about 21 nucleotides.
32. A double-stranded short interfering nucleic acid (siNA) molecule that down-regulates the expression of an ECGF1 gene, wherein said siNA molecule does not require the presence of a ribonucleotide within the siNA molecule for said down-regulation of expression of the ECGF1 gene and wherein each strand of said double-stranded siNA molecule comprises about 21 nucleotides.
33. A pharmaceutical composition comprising the siNA molecule of claim 1 in an acceptable carrier or diluent.
34. A medicament comprising the siNA molecule of claim 1.
35. Active ingredient comprising the siNA molecule of claim 1.
36. Use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of an ECGF1 gene, wherein said siNA molecule comprises one or more chemical modifications and each strand of said double-stranded siNA comprises about 21 nucleotides.
US10/652,791 2000-08-30 2003-08-29 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA) Abandoned US20050106726A1 (en)

Priority Applications (42)

Application Number Priority Date Filing Date Title
US10/652,791 US20050106726A1 (en) 2002-02-20 2003-08-29 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US10/693,059 US20080039414A1 (en) 2002-02-20 2003-10-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10/720,448 US8273866B2 (en) 2002-02-20 2003-11-24 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
US10/724,270 US20050080031A1 (en) 2001-05-18 2003-11-26 Nucleic acid treatment of diseases or conditions related to levels of Ras, HER2 and HIV
US10/757,803 US20050020525A1 (en) 2002-02-20 2004-01-14 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10/783,128 US20050096284A1 (en) 2002-02-20 2004-02-20 RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US10/824,036 US20050191638A1 (en) 2002-02-20 2004-04-14 RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
PCT/US2004/011848 WO2004111237A1 (en) 2003-04-16 2004-04-16 RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR (ECGF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US10/826,966 US20050032733A1 (en) 2001-05-18 2004-04-16 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SiNA)
US10/840,731 US20050137153A1 (en) 2002-02-20 2004-05-06 RNA interference mediated inhibition of alpha-1 antitrypsin (AAT) gene expression using short interfering nucleic acid (siNA)
JP2006514948A JP4948163B2 (en) 2003-05-23 2004-05-24 RNA interference-mediated suppression of gene expression using chemically modified small interfering nucleic acids (siNA)
US10/557,542 US20070032441A1 (en) 2001-05-18 2004-05-24 Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (sina)
PCT/US2004/016390 WO2005019453A2 (en) 2001-05-18 2004-05-24 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
AU2004266311A AU2004266311B2 (en) 2001-05-18 2004-05-24 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
CA2526831A CA2526831C (en) 2001-05-18 2004-05-24 Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (sina)
DE602004022535T DE602004022535D1 (en) 2003-05-23 2004-05-24 INHIBITION OF GENETER SINA (SHORT INTERFERING NUCLEIC ACID) MEDIATED BY RNA INTERFERENCE
AT04776102T ATE439438T1 (en) 2003-05-23 2004-05-24 RNA INTERFERENCE-MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SINA (SHORT INTERFERING NUCLEIC ACID)
EP04776102A EP1627061B1 (en) 2001-05-18 2004-05-24 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US10/562,561 US20060247194A1 (en) 2000-08-30 2004-06-25 Rna interference mediated treatment of alzheimer's disease using short interfering nucleic acid (sina)
US10/567,888 US20070093437A1 (en) 2001-05-18 2004-08-06 Rna interference mediated inhibition of xiap gene expression using short interfering nucleic acid (sina)
US10/922,034 US20050164967A1 (en) 2001-05-18 2004-08-19 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US10/923,379 US20050239731A1 (en) 2001-05-18 2004-08-20 RNA interference mediated inhibition of MAP kinase gene expression using short interfering nucleic acid (siNA)
US10/944,611 US20050233998A1 (en) 2001-05-18 2004-09-16 RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
HK06108326.2A HK1086036A1 (en) 2003-05-23 2006-07-27 Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (sina)
US12/204,572 US7678897B2 (en) 2002-02-20 2008-09-04 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US12/689,714 US7897755B2 (en) 2002-02-20 2010-01-19 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US13/480,655 US8618277B2 (en) 2002-02-20 2012-05-25 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US14/083,525 US20140288148A1 (en) 2002-02-20 2013-11-19 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US14/514,112 US9181551B2 (en) 2002-02-20 2014-10-14 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US14/731,346 US9771588B2 (en) 2002-02-20 2015-06-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US14/861,805 US9657294B2 (en) 2002-02-20 2015-09-22 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/084,865 US9732344B2 (en) 2002-02-20 2016-03-30 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/483,354 US9738899B2 (en) 2002-02-20 2017-04-10 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/617,814 US9957517B2 (en) 2002-02-20 2017-06-08 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/637,579 US10000754B2 (en) 2002-02-20 2017-06-29 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/677,719 US10351852B2 (en) 2002-02-20 2017-08-15 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US15/977,746 US20180245083A1 (en) 2002-02-20 2018-05-11 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US16/136,191 US20190010497A1 (en) 2002-02-20 2018-09-19 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US16/183,530 US10889815B2 (en) 2002-02-20 2018-11-07 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US16/295,274 US20190194658A1 (en) 2002-02-20 2019-03-07 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)
US16/381,288 US10662428B2 (en) 2002-02-20 2019-04-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US17/105,174 US20220056441A1 (en) 2002-02-20 2020-11-25 Rna interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (sina)

Applications Claiming Priority (15)

Application Number Priority Date Filing Date Title
US35858002P 2002-02-20 2002-02-20
US36312402P 2002-03-11 2002-03-11
US38678202P 2002-06-06 2002-06-06
US40678402P 2002-08-29 2002-08-29
US40837802P 2002-09-05 2002-09-05
US40929302P 2002-09-09 2002-09-09
US44012903P 2003-01-15 2003-01-15
PCT/US2003/005028 WO2003074654A2 (en) 2002-02-20 2003-02-20 Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
WOPCT/US03/05028 2003-02-20
PCT/US2003/005346 WO2003070918A2 (en) 2002-02-20 2003-02-20 Rna interference by modified short interfering nucleic acid
WOPCT/US03/05346 2003-02-20
US41701203A 2003-04-16 2003-04-16
US42270403A 2003-04-24 2003-04-24
US10/444,853 US8202979B2 (en) 2002-02-20 2003-05-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US10/652,791 US20050106726A1 (en) 2002-02-20 2003-08-29 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)

Related Parent Applications (5)

Application Number Title Priority Date Filing Date
PCT/US2003/005346 Continuation-In-Part WO2003070918A2 (en) 2000-02-11 2003-02-20 Rna interference by modified short interfering nucleic acid
US42270403A Continuation 2000-08-30 2003-04-24
US42270403A Continuation-In-Part 2000-08-30 2003-04-24
US10/427,160 Continuation-In-Part US7833992B2 (en) 2000-02-11 2003-04-30 Conjugates and compositions for cellular delivery
US10/444,853 Continuation-In-Part US8202979B2 (en) 2000-02-11 2003-05-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid

Related Child Applications (7)

Application Number Title Priority Date Filing Date
PCT/US2003/005028 Continuation-In-Part WO2003074654A2 (en) 2000-02-11 2003-02-20 Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US10/427,160 Continuation-In-Part US7833992B2 (en) 2000-02-11 2003-04-30 Conjugates and compositions for cellular delivery
US10/444,853 Continuation-In-Part US8202979B2 (en) 2000-02-11 2003-05-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US10/693,059 Continuation-In-Part US20080039414A1 (en) 2000-02-11 2003-10-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10/724,270 Continuation-In-Part US20050080031A1 (en) 2001-05-18 2003-11-26 Nucleic acid treatment of diseases or conditions related to levels of Ras, HER2 and HIV
PCT/US2004/011848 Continuation-In-Part WO2004111237A1 (en) 2001-05-18 2004-04-16 RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR (ECGF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
PCT/US2004/016390 Continuation-In-Part WO2005019453A2 (en) 2000-02-11 2004-05-24 RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA)

Publications (1)

Publication Number Publication Date
US20050106726A1 true US20050106726A1 (en) 2005-05-19

Family

ID=46299317

Family Applications (18)

Application Number Title Priority Date Filing Date
US10/444,853 Expired - Lifetime US8202979B2 (en) 2000-02-11 2003-05-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US10/652,791 Abandoned US20050106726A1 (en) 2000-08-30 2003-08-29 RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
US11/358,807 Abandoned US20060217335A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,932 Abandoned US20060217337A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,443 Abandoned US20060217334A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,924 Abandoned US20060247429A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,862 Abandoned US20060287266A1 (en) 2002-02-20 2006-02-21 RNA interference mediated ihibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,863 Abandoned US20060217336A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,540 Abandoned US20060247428A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,520 Abandoned US20070004663A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,533 Abandoned US20060293272A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,521 Expired - Lifetime US7989612B2 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,633 Abandoned US20070004665A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,893 Abandoned US20060275903A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,885 Abandoned US20060292691A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,876 Abandoned US20060281175A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,875 Abandoned US20070004667A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/676,124 Active 2024-10-31 US8846894B2 (en) 2001-05-18 2007-02-16 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)

Family Applications Before (1)

Application Number Title Priority Date Filing Date
US10/444,853 Expired - Lifetime US8202979B2 (en) 2000-02-11 2003-05-23 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid

Family Applications After (16)

Application Number Title Priority Date Filing Date
US11/358,807 Abandoned US20060217335A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,932 Abandoned US20060217337A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,443 Abandoned US20060217334A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,924 Abandoned US20060247429A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,862 Abandoned US20060287266A1 (en) 2002-02-20 2006-02-21 RNA interference mediated ihibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,863 Abandoned US20060217336A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/358,540 Abandoned US20060247428A1 (en) 2002-02-20 2006-02-21 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,520 Abandoned US20070004663A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,533 Abandoned US20060293272A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,521 Expired - Lifetime US7989612B2 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/499,633 Abandoned US20070004665A1 (en) 2002-02-20 2006-08-04 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,893 Abandoned US20060275903A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,885 Abandoned US20060292691A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,876 Abandoned US20060281175A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/502,875 Abandoned US20070004667A1 (en) 2002-02-20 2006-08-11 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US11/676,124 Active 2024-10-31 US8846894B2 (en) 2001-05-18 2007-02-16 RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)

Country Status (1)

Country Link
US (18) US8202979B2 (en)

Cited By (29)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050255487A1 (en) * 2002-11-14 2005-11-17 Dharmacon, Inc. Methods and compositions for selecting siRNA of improved functionality
US20050267300A1 (en) * 2004-04-05 2005-12-01 Muthiah Manoharan Processes and reagents for oligonucleotide synthesis and purification
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US20050288244A1 (en) * 2004-04-30 2005-12-29 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a C5-modified pyrimidine
WO2006009784A1 (en) * 2004-06-18 2006-01-26 Mirus Bio Corporation Small interfering rna with improved activity
WO2006023491A2 (en) 2004-08-16 2006-03-02 The Cbr Institute For Biomedical Research, Inc. Method of delivering rna interference and uses thereof
US20060287260A1 (en) * 2004-06-30 2006-12-21 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US20070027097A1 (en) * 2005-07-28 2007-02-01 Lewis David L Small interfering RNA with improved activity
US20080113370A1 (en) * 2002-11-14 2008-05-15 Dharmacon, Inc. siRNA targeting apolipoprotein B (APOB)
US7626014B2 (en) 2004-04-27 2009-12-01 Alnylam Pharmaceuticals Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US7632932B2 (en) 2004-08-04 2009-12-15 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US20100113307A1 (en) * 2002-11-14 2010-05-06 Dharmacon, Inc. siRNA targeting vascular endothelial growth factor (VEGF)
US7772387B2 (en) 2004-07-21 2010-08-10 Alnylam Pharmaceuticals Oligonucleotides comprising a modified or non-natural nucleobase
US20100317029A1 (en) * 2009-06-15 2010-12-16 Lih-Chyang Chen Nasopharyngeal cancer malingancy biomarker and method thereof
US20120070486A1 (en) * 2007-02-12 2012-03-22 Sood Anil K Methods and compositions related to prefoldin and its regulation
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy
US8232385B2 (en) 2002-11-14 2012-07-31 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9719092B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting CNTD2
US9719094B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting SEC61G
US9771586B2 (en) 2002-11-14 2017-09-26 Thermo Fisher Scientific Inc. RNAi targeting ZNF205
US9839649B2 (en) 2002-11-14 2017-12-12 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9879266B2 (en) 2002-11-14 2018-01-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US10011836B2 (en) 2002-11-14 2018-07-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference

Families Citing this family (232)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8541548B2 (en) * 1999-06-07 2013-09-24 Arrowhead Madison Inc. Compounds and methods for reversible modification of biologically active molecules
US20080281041A1 (en) * 1999-06-07 2008-11-13 Rozema David B Reversibly Masked Polymers
GB9925459D0 (en) * 1999-10-27 1999-12-29 Plant Bioscience Ltd Gene silencing
US7833992B2 (en) * 2001-05-18 2010-11-16 Merck Sharpe & Dohme Conjugates and compositions for cellular delivery
US8202979B2 (en) * 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US7491805B2 (en) 2001-05-18 2009-02-17 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
AU2001249622B2 (en) 2000-03-30 2007-06-07 Massachusetts Institute Of Technology RNA sequence-specific mediators of RNA interference
WO2002044321A2 (en) * 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US20050159382A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA)
US20080188430A1 (en) * 2001-05-18 2008-08-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hypoxia inducible factor 1 (HIF1) gene expression using short interfering nucleic acid (siNA)
US20050176666A1 (en) * 2001-05-18 2005-08-11 Sirna Therapeutics, Inc. RNA interference mediated inhibition of GPRA and AAA1 gene expression using short interfering nucleic acid (siNA)
US20050203040A1 (en) * 2001-05-18 2005-09-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular cell adhesion molecule (VCAM) gene expression using short interfering nucleic acid (siNA)
US20050159381A1 (en) * 2001-05-18 2005-07-21 Sirna Therapeutics, Inc. RNA interference mediated inhibition of chromosome translocation gene expression using short interfering nucleic acid (siNA)
US20050164966A1 (en) * 2001-05-18 2005-07-28 Sirna Therapeutics, Inc. RNA interference mediated inhibition of type 1 insulin-like growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050288242A1 (en) * 2001-05-18 2005-12-29 Sirna Therapeutics, Inc. RNA interference mediated inhibition of RAS gene expression using short interfering nucleic acid (siNA)
EP1572902B1 (en) 2002-02-01 2014-06-11 Life Technologies Corporation HIGH POTENCY siRNAS FOR REDUCING THE EXPRESSION OF TARGET GENES
US20040014956A1 (en) 2002-02-01 2004-01-22 Sequitur, Inc. Double-stranded oligonucleotides
US20060009409A1 (en) * 2002-02-01 2006-01-12 Woolf Tod M Double-stranded oligonucleotides
US20090137510A1 (en) * 2002-02-20 2009-05-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF NF-KAPPA B/ REL-A GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2003207708A1 (en) * 2002-02-20 2003-09-09 Sirna Therapeutics, Inc. Rna interference mediated inhibition of map kinase genes
US20090137507A1 (en) * 2002-02-20 2009-05-28 Sirna Therapeutics, Inc. RNA INTERFERENCE MEDIATED INHIBITION OF ANGIOPOIETIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US8008355B2 (en) * 2002-03-11 2011-08-30 Roche Madison Inc. Endosomolytic poly(vinyl ether) polymers
US8138383B2 (en) * 2002-03-11 2012-03-20 Arrowhead Madison Inc. Membrane active heteropolymers
ES2465574T3 (en) * 2002-05-03 2014-06-06 Duke University A method to regulate gene expression
US20100075423A1 (en) * 2002-06-12 2010-03-25 Life Technologies Corporation Methods and compositions relating to polypeptides with rnase iii domains that mediate rna interference
US20040248094A1 (en) * 2002-06-12 2004-12-09 Ford Lance P. Methods and compositions relating to labeled RNA molecules that reduce gene expression
AU2003243541A1 (en) * 2002-06-12 2003-12-31 Ambion, Inc. Methods and compositions relating to labeled rna molecules that reduce gene expression
ATE427352T1 (en) * 2002-07-26 2009-04-15 Novartis Vaccines & Diagnostic MODIFIED SMALL IRNS MOLECULES AND METHODS OF THEREOF APPLICATION
WO2004014933A1 (en) 2002-08-07 2004-02-19 University Of Massachusetts Compositions for rna interference and methods of use thereof
US20040029275A1 (en) * 2002-08-10 2004-02-12 David Brown Methods and compositions for reducing target gene expression using cocktails of siRNAs or constructs expressing siRNAs
AU2003282877B9 (en) 2002-09-25 2011-05-12 University Of Massachusetts In Vivo gene silencing by chemically modified and stable siRNA
CA2533701A1 (en) 2003-07-31 2005-02-17 Isis Pharmaceuticals, Inc. Oligomeric compounds and compositions for use in modulation of small non-coding rnas
AU2004269150C1 (en) * 2003-08-28 2010-11-18 Novartis Ag Interfering RNA duplex having blunt-ends and 3'-modifications
US20050202075A1 (en) * 2004-03-12 2005-09-15 Pardridge William M. Delivery of genes encoding short hairpin RNA using receptor-specific nanocontainers
AU2005222965B8 (en) 2004-03-15 2010-07-01 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
US20070265220A1 (en) 2004-03-15 2007-11-15 City Of Hope Methods and compositions for the specific inhibition of gene expression by double-stranded RNA
KR101147147B1 (en) * 2004-04-01 2012-05-25 머크 샤프 앤드 돔 코포레이션 Modified polynucleotides for reducing off-target effects in rna interference
CA2565450C (en) 2004-05-07 2018-03-06 Gyorgy Petrovics Methods of diagnosing or treating prostate cancer using the erg gene, alone or in combination with other over or under expressed genes in prostate cancer
US8394947B2 (en) 2004-06-03 2013-03-12 Isis Pharmaceuticals, Inc. Positionally modified siRNA constructs
CA2572439A1 (en) * 2004-07-02 2006-01-12 Protiva Biotherapeutics, Inc. Immunostimulatory sirna molecules and uses therefor
US20060019258A1 (en) * 2004-07-20 2006-01-26 Illumina, Inc. Methods and compositions for detection of small interfering RNA and micro-RNA
US8138161B2 (en) * 2004-10-01 2012-03-20 Novartis Vaccines And Diagnostics, Inc. Modified small interfering RNA molecules and methods of use
US8765704B1 (en) * 2008-02-28 2014-07-01 Novartis Ag Modified small interfering RNA molecules and methods of use
WO2007001448A2 (en) 2004-11-04 2007-01-04 Massachusetts Institute Of Technology Coated controlled release polymer particles as efficient oral delivery vehicles for biopharmaceuticals
DK2302055T3 (en) 2004-11-12 2014-10-13 Asuragen Inc Methods and compositions involving miRNA and miRNA inhibitor molecules
EP2199298A1 (en) * 2004-11-17 2010-06-23 Protiva Biotherapeutics Inc. Sirna silencing of Apolipoprotein B
US20060142228A1 (en) * 2004-12-23 2006-06-29 Ambion, Inc. Methods and compositions concerning siRNA's as mediators of RNA interference
EP1841464B1 (en) * 2005-01-24 2012-06-27 Alnylam Pharmaceuticals Inc. Rnai modulation of the nogo-l or nogo-r gene and uses thereof
US7718625B2 (en) * 2005-01-27 2010-05-18 University Of South Florida Polynucleotides targeted against the extended 5′-UTR region of argininosuccinate synthase and uses thereof
WO2006113743A2 (en) * 2005-04-18 2006-10-26 Massachusetts Institute Of Technology Compositions and methods for rna interference with sialidase expression and uses thereof
EP1913141A2 (en) * 2005-06-03 2008-04-23 The CBR Institute for Biomedical Research, Inc. Sirna microbicides for preventing and treating viral diseases
WO2006131925A2 (en) * 2005-06-10 2006-12-14 Quark Pharmaceuticals, Inc. Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases
US20070054873A1 (en) * 2005-08-26 2007-03-08 Protiva Biotherapeutics, Inc. Glucocorticoid modulation of nucleic acid-mediated immune stimulation
WO2007051303A1 (en) 2005-11-02 2007-05-10 Protiva Biotherapeutics, Inc. MODIFIED siRNA MOLECULES AND USES THEREOF
AU2006311730B2 (en) * 2005-11-09 2010-12-02 Alnylam Pharmaceuticals, Inc. Compositions and methods for inhibiting expression of Factor V Leiden mutant gene
US20070218122A1 (en) * 2005-11-18 2007-09-20 Protiva Biotherapeutics, Inc. siRNA silencing of influenza virus gene expression
WO2007067733A2 (en) * 2005-12-09 2007-06-14 Massachusetts Institute Of Technology Compositions and methods to monitor rna delivery to cells
WO2007070682A2 (en) 2005-12-15 2007-06-21 Massachusetts Institute Of Technology System for screening particles
BRPI0709147A2 (en) * 2006-03-24 2011-06-28 Novartis Ag dsrna compositions and methods for treating hpv infection
CA2648099C (en) 2006-03-31 2012-05-29 The Brigham And Women's Hospital, Inc System for targeted delivery of therapeutic agents
GB0608838D0 (en) 2006-05-04 2006-06-14 Novartis Ag Organic compounds
EP2019691B1 (en) 2006-05-15 2020-08-12 Massachusetts Institute of Technology Polymers for functional particles
WO2007136758A2 (en) * 2006-05-19 2007-11-29 Board Of Regents, The University Of Texas System Sirna inhibition of p13k p85, p110, and akt2 and methods of use
AU2007256780B2 (en) * 2006-06-02 2013-08-29 President And Fellows Of Harvard College Protein surface remodeling
US7915399B2 (en) * 2006-06-09 2011-03-29 Protiva Biotherapeutics, Inc. Modified siRNA molecules and uses thereof
WO2007150030A2 (en) 2006-06-23 2007-12-27 Massachusetts Institute Of Technology Microfluidic synthesis of organic nanoparticles
CN102614528B (en) * 2006-08-18 2014-02-26 箭头研究公司 Polyconjugates for in vivo delivery of polynucleotides
JP5352462B2 (en) * 2006-09-22 2013-11-27 ダーマコン, インコーポレイテッド Double-stranded oligonucleotide complex, gene silencing method by RNA interference, and pharmaceutical composition
CA3018520C (en) 2006-10-10 2022-05-17 The Henry M. Jackson Foundation For The Advancement Of Military Medicine, Inc. Prostate cancer-specific alterations in erg gene expression and detection and treatment methods based on those alterations
JP2010507387A (en) * 2006-10-25 2010-03-11 クアーク・ファーマスーティカルス、インコーポレイテッド Novel siRNA and method of using the same
EP2089029B1 (en) 2006-11-10 2012-10-03 Massachusetts Institute of Technology Pak inhibitors for use in treating neurodevelopmental disorders
EP2094832B1 (en) 2006-11-15 2015-04-22 The J. David Gladstone Institutes Methods and compositions for reducing amyloid beta levels
CA2671850A1 (en) * 2006-12-08 2008-06-19 Massachusetts Institute Of Technology Delivery of nanoparticles and/or agents to cells
EP2641971A1 (en) * 2007-01-29 2013-09-25 Isis Pharmaceuticals, Inc. Compounds and methods for modulating protein expression
US9217129B2 (en) 2007-02-09 2015-12-22 Massachusetts Institute Of Technology Oscillating cell culture bioreactor
US20100292301A1 (en) * 2007-02-28 2010-11-18 Elena Feinstein Novel sirna structures
PE20090064A1 (en) * 2007-03-26 2009-03-02 Novartis Ag DOUBLE-CHAIN RIBONUCLEIC ACID TO INHIBIT THE EXPRESSION OF THE HUMAN E6AP GENE AND THE PHARMACEUTICAL COMPOSITION THAT INCLUDES IT
WO2008124634A1 (en) 2007-04-04 2008-10-16 Massachusetts Institute Of Technology Polymer-encapsulated reverse micelles
EP2144600A4 (en) 2007-04-04 2011-03-16 Massachusetts Inst Technology Poly (amino acid) targeting moieties
MX2009011218A (en) * 2007-04-17 2010-02-11 Baxter Int Nucleic acid microparticles for pulmonary delivery.
EP2152870A2 (en) * 2007-05-02 2010-02-17 Sirna Therapeutics Inc. Rna interference mediated inhibition of cyclic nucleotide type 4 phosphodiesterase (pde4b) gene expression using short interfering nucleic acid (sina)
JP2010526542A (en) 2007-05-16 2010-08-05 エムエーティー・マルタ・アドヴァンスト・テクノロジーズ・リミテッド Influenza treatment and prevention
WO2009023055A2 (en) * 2007-05-17 2009-02-19 Dana-Farber Cancer Institute, Inc. Blockade of the inhibitory qa-1-cd94/nkg2a pathway for treatment of autoimmune disease
EP2162538B1 (en) 2007-05-22 2016-04-20 Arcturus Therapeutics, Inc. Oligomers for therapeutics
WO2008154482A2 (en) * 2007-06-08 2008-12-18 Sirnaomics, Inc. Sirna compositions and methods of use in treatment of ocular diseases
CN101802173B (en) * 2007-06-13 2014-09-24 联邦科学技术研究组织 Modulating production traits in avians
JP5188107B2 (en) * 2007-06-21 2013-04-24 株式会社東芝 Array type photo detector
JP2010532786A (en) * 2007-07-06 2010-10-14 ノースイースタン ユニバーシティ Mixed micelles containing amphiphilic conjugation of RNA agents and uses thereof
WO2009039173A2 (en) * 2007-09-19 2009-03-26 Applied Biosystems Inc. SiRNA SEQUENCE-INDEPENDENT MODIFICATION FORMATS FOR REDUCING OFF-TARGET PHENOTYPIC EFFECTS IN RNAi, AND STABILIZED FORMS THEREOF
RU2487716C2 (en) * 2007-10-03 2013-07-20 Кварк Фармасьютикалс, Инк. New structures of small interfering rna (sirna)
BRPI0817664A2 (en) 2007-10-12 2015-03-24 Massachusetts Inst Technology Nanoparticles, method for preparing nanoparticles and method for therapeutically or prophylactically treating an individual
TW200927177A (en) * 2007-10-24 2009-07-01 Nat Inst Of Advanced Ind Scien Lipid-modified double-stranded RNA having potent RNA interference effect
US7732659B2 (en) * 2007-11-20 2010-06-08 Genetic Services, Inc. Injecting Drosophila embryos
WO2009074990A2 (en) * 2007-12-12 2009-06-18 Quark Pharmaceuticals, Inc. Rtp801l sirna compounds and methods of use thereof
US8614311B2 (en) 2007-12-12 2013-12-24 Quark Pharmaceuticals, Inc. RTP801L siRNA compounds and methods of use thereof
CA2710713C (en) 2007-12-27 2017-09-19 Protiva Biotherapeutics, Inc. Silencing of polo-like kinase expression using interfering rna
EP2242854A4 (en) * 2008-01-15 2012-08-15 Quark Pharmaceuticals Inc Sirna compounds and methods of use thereof
US8188060B2 (en) 2008-02-11 2012-05-29 Dharmacon, Inc. Duplex oligonucleotides with enhanced functionality in gene regulation
CN102026670A (en) * 2008-03-20 2011-04-20 夸克医药公司 Novel siRNA compounds for inhibiting RTP801
WO2009123185A1 (en) * 2008-03-31 2009-10-08 独立行政法人産業技術総合研究所 Double-stranded lipid-modified rna having high rna interference effect
CA2721333C (en) 2008-04-15 2020-12-01 Protiva Biotherapeutics, Inc. Novel lipid formulations for nucleic acid delivery
AU2009236219B8 (en) 2008-04-15 2015-06-25 Arbutus Biopharma Corporation Silencing of CSN5 gene expression using interfering RNA
CA2722276A1 (en) * 2008-04-25 2009-10-29 Commonwealth Scientific Industrial Research Organisation Recombinant cells and methods for hydroxylating fatty acids
AU2009243187C1 (en) * 2008-04-28 2015-12-24 President And Fellows Of Harvard College Supercharged proteins for cell penetration
WO2009143345A2 (en) * 2008-05-22 2009-11-26 University Of Massachusetts Nucleic acid silencing agent-protein conjugates and use thereof for treating hcv-related disorders
JP5524189B2 (en) 2008-06-06 2014-06-18 クォーク ファーマシューティカルズ インコーポレーティッド Compositions and methods for the treatment of otic disorders
CN102076844B (en) 2008-06-30 2013-08-07 成血管细胞系统公司 Treatment of eye diseases and excessive neovascularization using a combined therapy
US9000142B2 (en) * 2008-07-07 2015-04-07 Syntrix Biosystems, Inc. Photocleavable sense-antisense complex
WO2010039801A2 (en) 2008-10-02 2010-04-08 The J. David Gladstone Institutes Methods of treating hepatitis c virus infection
US8343498B2 (en) 2008-10-12 2013-01-01 Massachusetts Institute Of Technology Adjuvant incorporation in immunonanotherapeutics
US8343497B2 (en) 2008-10-12 2013-01-01 The Brigham And Women's Hospital, Inc. Targeting of antigen presenting cells with immunonanotherapeutics
US8277812B2 (en) 2008-10-12 2012-10-02 Massachusetts Institute Of Technology Immunonanotherapeutics that provide IgG humoral response without T-cell antigen
US8591905B2 (en) 2008-10-12 2013-11-26 The Brigham And Women's Hospital, Inc. Nicotine immunonanotherapeutics
WO2010045384A2 (en) * 2008-10-15 2010-04-22 Somagenics Inc. Short hairpin rnas for inhibition of gene expression
US20100267803A1 (en) * 2008-11-07 2010-10-21 The Research Foundation Of State University Of New York Regulators Of Fat Metabolism As Anti-Cancer Targets
US20100233270A1 (en) 2009-01-08 2010-09-16 Northwestern University Delivery of Oligonucleotide-Functionalized Nanoparticles
WO2010083338A2 (en) 2009-01-14 2010-07-22 Philadelphia Health And Education Corporation Modulation of pre-mrna using splice modulating oligonucleotides as therapeutic agents in the treatment of disease
US20120041049A1 (en) * 2009-02-24 2012-02-16 Riboxx Gmbh Design of small-interfering rna
WO2010107957A2 (en) * 2009-03-19 2010-09-23 Merck Sharp & Dohme Corp. RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
JP2012521762A (en) * 2009-03-27 2012-09-20 メルク・シャープ・エンド・ドーム・コーポレイション RNA interference-mediated inhibition of nerve growth factor β chain (NGFβ) gene expression using small interfering nucleic acids (siNA)
US8563710B2 (en) 2009-04-03 2013-10-22 Biomics Biotechnologies Co., Ltd. Modified oligonucleotide and its preparation and application
JP2012525146A (en) 2009-04-28 2012-10-22 プレジデント アンド フェロウズ オブ ハーバード カレッジ Overcharged protein for cell penetration
AU2010244972A1 (en) 2009-05-08 2011-11-24 The Walter And Eliza Hall Institute Of Medical Research Modulation of inducible nitric oxide (iNOS) binding to SPRY domain-containing SOCS-box peptides (SSB)
MX2011012597A (en) 2009-05-27 2012-04-19 Selecta Biosciences Inc Nanocarriers possessing components with different rates of release.
EP2440666B1 (en) 2009-06-10 2017-03-01 Temasek Life Sciences Laboratory Limited Virus induced gene silencing (vigs) for functional analysis of genes in cotton
JP5766188B2 (en) 2009-07-01 2015-08-19 プロチバ バイオセラピューティクス インコーポレイティッド Lipid formulations for delivering therapeutic agents to solid tumors
EP2449106B1 (en) 2009-07-01 2015-04-08 Protiva Biotherapeutics Inc. Compositions and methods for silencing apolipoprotein b
US8871730B2 (en) 2009-07-13 2014-10-28 Somagenics Inc. Chemical modification of short small hairpin RNAs for inhibition of gene expression
US8716464B2 (en) 2009-07-20 2014-05-06 Thomas W. Geisbert Compositions and methods for silencing Ebola virus gene expression
EP2480668A2 (en) 2009-09-23 2012-08-01 Protiva Biotherapeutics Inc. Compositions and methods for silencing genes expressed in cancer
CN102666856B (en) 2009-11-08 2016-04-06 夸克制药公司 Be directed to the purposes of double-stranded RNA compound in the medicine manufacturing treatment neuropathic pain of RhoA target gene
WO2011066475A1 (en) 2009-11-26 2011-06-03 Quark Pharmaceuticals, Inc. Sirna compounds comprising terminal substitutions
WO2011084193A1 (en) 2010-01-07 2011-07-14 Quark Pharmaceuticals, Inc. Oligonucleotide compounds comprising non-nucleotide overhangs
DK2539451T3 (en) * 2010-02-24 2016-04-04 Arrowhead Res Corp Compositions for targeted delivery of siRNA
CN107080839A (en) 2010-05-26 2017-08-22 西莱克塔生物科技公司 The synthesis nano-carrier vaccine of multivalence
US9243246B2 (en) 2010-08-24 2016-01-26 Sirna Therapeutics, Inc. Single-stranded RNAi agents containing an internal, non-nucleic acid spacer
US20120328701A1 (en) 2011-01-24 2012-12-27 Anterios, Inc. Nanoparticle compositions, formulations thereof, and uses therefor
DK2667854T3 (en) 2011-01-24 2019-04-23 Anterios Inc NANO PARTICLE FORMATIONS
SI3505528T1 (en) 2011-04-21 2021-04-30 Glaxo Group Limited Modulation of hepatitis b virus (hbv) expression
US8809293B2 (en) * 2011-06-30 2014-08-19 Arrowhead Madison Inc. Compositions and methods for inhibiting gene expression of hepatitis B virus
WO2013012835A2 (en) * 2011-07-18 2013-01-24 Oregon Health & Science University Sirna useful in the treatment of flavivirus infection
CN103702687A (en) 2011-07-29 2014-04-02 西莱克塔生物科技公司 Synthetic nanocarriers that generate humoral and cytotoxic T lymphocyte (CTL) immune responses
JP2013059424A (en) 2011-09-12 2013-04-04 Daicel Corp Needleless syringe
US20130071444A1 (en) 2011-09-16 2013-03-21 The Charlotte-Mecklenburg Hospital Authority D/B/A Carolinas Healthcare System Amphiphilic Cationic Polymers and Methods of Use Thereof
US9035039B2 (en) 2011-12-22 2015-05-19 Protiva Biotherapeutics, Inc. Compositions and methods for silencing SMAD4
KR102075810B1 (en) 2012-02-24 2020-02-10 아뷰터스 바이오파마 코포레이션 Trialkyl cationic lipids and methods of use thereof
WO2013144325A1 (en) 2012-03-28 2013-10-03 Katholieke Universiteit Leuven Fatty acid elongation enzymes as targets for cancer diagnostics and therapeutics
AU2013204327B2 (en) 2012-04-20 2016-09-01 Aviagen Cell transfection method
WO2013165816A2 (en) 2012-05-02 2013-11-07 Merck Sharp & Dohme Corp. SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS
JP6139671B2 (en) * 2012-05-22 2017-05-31 オリックス ファーマシューティカルズ インコーポレイテッドOlix Pharmaceuticals Inc. Nucleic acid molecule that induces RNA interference with intracellular penetration ability and use thereof
CN112587671A (en) 2012-07-18 2021-04-02 博笛生物科技有限公司 Targeted immunotherapy for cancer
BR112015013105B1 (en) 2012-12-05 2022-02-08 Alnylam Pharmaceuticals, Inc DOUBLE-STRAND RNAI AGENT CAPABLE OF INHIBITING PCSK9 EXPRESSION, ITS USES, PHARMACEUTICAL COMPOSITION AND METHOD OF INHIBITING PCSK9 EXPRESSION IN A CELL IN VITRO
EP2992098B1 (en) 2013-05-01 2019-03-27 Ionis Pharmaceuticals, Inc. Compositions and methods for modulating hbv and ttr expression
JP6297794B2 (en) 2013-06-12 2018-03-20 株式会社ダイセル Syringe
CA2916533C (en) 2013-06-25 2022-12-20 University Of Canberra Methods and compositions for modulating cancer stem cells
CN105764513A (en) 2013-09-18 2016-07-13 堪培拉大学 Stem cell modulation II
EP3052107B1 (en) * 2013-10-04 2018-05-02 Novartis AG Organic compounds to treat hepatitis b virus
AU2014346457A1 (en) 2013-11-11 2016-06-02 Sirna Therapeutics, Inc. Systemic delivery of myostatin short interfering nucleic acids (siNA) conjugated to a lipophilic moiety
WO2015103989A1 (en) 2014-01-10 2015-07-16 Shanghai Birdie Biotech, Inc. Compounds and compositions for immunotherapy
AU2015236215B2 (en) 2014-03-25 2020-03-19 Arcturus Therapeutics, Inc. UNA oligomers having reduced off-target effects in gene silencing
JP6771387B2 (en) 2014-03-25 2020-10-21 アークトゥラス・セラピューティクス・インコーポレイテッドArcturus Therapeutics,Inc. Transthyretin allele-selective UNA oligomer for gene silencing
US9856475B2 (en) 2014-03-25 2018-01-02 Arcturus Therapeutics, Inc. Formulations for treating amyloidosis
CN112546230A (en) 2014-07-09 2021-03-26 博笛生物科技有限公司 Combination therapeutic compositions and combination therapeutic methods for treating cancer
TWI691335B (en) 2014-07-09 2020-04-21 英屬開曼群島商博笛生物科技有限公司 Anti-pd-l1 combinations for treating tumors
US9790509B2 (en) 2014-07-18 2017-10-17 Oregon Health & Science University 5′-triphosphate oligoribonucleotides
CN107106517A (en) 2014-08-25 2017-08-29 堪培拉大学 Composition for adjusting cancer stem cell and application thereof
JP2016049246A (en) 2014-08-29 2016-04-11 株式会社ダイセル Needleless injector
CN112546238A (en) 2014-09-01 2021-03-26 博笛生物科技有限公司 anti-PD-L1 conjugates for the treatment of tumors
WO2016061131A1 (en) 2014-10-14 2016-04-21 The J. David Gladstone Institutes Compositions and methods for reactivating latent immunodeficiency virus
JOP20200092A1 (en) 2014-11-10 2017-06-16 Alnylam Pharmaceuticals Inc HEPATITIS B VIRUS (HBV) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
CA2968531A1 (en) 2014-11-21 2016-05-26 Northwestern University The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
WO2016094845A2 (en) 2014-12-12 2016-06-16 Woolf Tod M Compositions and methods for editing nucleic acids in cells utilizing oligonucleotides
US10519447B2 (en) 2015-04-01 2019-12-31 Arcturus Therapeutics, Inc. Therapeutic UNA oligomers and uses thereof
JP6471029B2 (en) 2015-04-10 2019-02-13 株式会社ダイセル Syringe
CA2985818A1 (en) 2015-05-31 2016-12-08 Curegenix Corporation Combination compositions comprising an antagonist of porcupine and a pd-l/pd-1 axis antagonist for immunotherapy
US10933049B2 (en) 2015-06-03 2021-03-02 The University Of Queensland Mobilizing agents and uses therefor
WO2017015671A1 (en) 2015-07-23 2017-01-26 Arcturus Therapeutics, Inc. Compositions for treating amyloidosis
EP3331536A4 (en) 2015-08-03 2019-03-27 The Regents of The University of California Compositions and methods for modulating abhd2 activity
CA2991639A1 (en) 2015-08-07 2017-02-16 Arrowhead Pharmaceuticals, Inc. Rnai therapy for hepatitis b virus infection
US10633653B2 (en) 2015-08-14 2020-04-28 University Of Massachusetts Bioactive conjugates for oligonucleotide delivery
WO2017029703A1 (en) 2015-08-18 2017-02-23 株式会社ダイセル Needle-free injector
IL293355B2 (en) 2015-08-25 2024-07-01 Alnylam Pharmaceuticals Inc Methods and compositions for treating a proprotein convertase subtilisin kexin (pcsk9) gene-associated disorder
US20190225644A1 (en) * 2015-10-16 2019-07-25 Modernatx, Inc. Mrna cap analogs and methods of mrna capping
WO2017066797A1 (en) 2015-10-16 2017-04-20 Modernatx, Inc. Trinucleotide mrna cap analogs
WO2017088017A1 (en) 2015-11-24 2017-06-01 Commonwealth Scientific And Industrial Research Organisation Production of viruses in avian eggs
EP3380611A4 (en) 2015-11-24 2020-02-12 Commonwealth Scientific and Industrial Research Organisation Production of viruses in cell culture
ES2952064T3 (en) 2015-12-16 2023-10-26 Walter & Eliza Hall Inst Medical Res Cytokine-induced inhibition of SH2 protein in NK cells
CN108472451B (en) 2015-12-28 2021-11-26 株式会社大赛璐 Dosing device design system, dosing device design method, dosing device design program, and medical device design system
EP3408391A4 (en) 2016-01-31 2019-08-28 University of Massachusetts Branched oligonucleotides
MA45328A (en) * 2016-04-01 2019-02-06 Avidity Biosciences Llc NUCLEIC ACID-POLYPEPTIDE COMPOSITIONS AND USES THEREOF
MA45349A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc EGFR NUCLEIC ACIDS AND THEIR USES
MA45470A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc KRAS NUCLEIC ACIDS AND THEIR USES
MA45469A (en) 2016-04-01 2019-02-06 Avidity Biosciences Llc BETA-CATENIN NUCLEIC ACIDS AND THEIR USES
WO2017193087A1 (en) 2016-05-06 2017-11-09 Exicure, Inc. Liposomal spherical nucleic acid (sna) constructs prsenting antisense oligonucleotides(aso) for specific knockdown of interleukin 17 receptor mrna
JP6872560B2 (en) 2016-05-06 2021-05-19 エム. ウルフ、トッド Improved methods for genome editing with programmable nucleases and genome editing without programmable nucleases
US10036024B2 (en) 2016-06-03 2018-07-31 Purdue Research Foundation siRNA compositions that specifically downregulate expression of a variant of the PNPLA3 gene and methods of use thereof for treating a chronic liver disease or alcoholic liver disease (ALD)
JOP20170161A1 (en) 2016-08-04 2019-01-30 Arrowhead Pharmaceuticals Inc RNAi Agents for Hepatitis B Virus Infection
CA3033368A1 (en) 2016-08-12 2018-02-15 University Of Massachusetts Conjugated oligonucleotides
WO2018038117A1 (en) 2016-08-23 2018-03-01 株式会社ダイセル Actuator
US11364304B2 (en) 2016-08-25 2022-06-21 Northwestern University Crosslinked micellar spherical nucleic acids
EP3516062A1 (en) 2016-09-21 2019-07-31 Alnylam Pharmaceuticals, Inc. Myostatin irna compositions and methods of use thereof
WO2018129384A1 (en) 2017-01-06 2018-07-12 Avidity Biosciences Llc Nucleic acid-polypeptide compositions and methods of inducing exon skipping
EP3613856A4 (en) * 2017-03-31 2020-12-23 Staidson(Beijing) Biopharmaceuticals Co., Ltd. Shrna expression cassette, polynucleotide sequence carrying same, and application thereof
US11324820B2 (en) 2017-04-18 2022-05-10 Alnylam Pharmaceuticals, Inc. Methods for the treatment of subjects having a hepatitis b virus (HBV) infection
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
US11433131B2 (en) 2017-05-11 2022-09-06 Northwestern University Adoptive cell therapy using spherical nucleic acids (SNAs)
JP7406793B2 (en) 2017-06-23 2023-12-28 ユニバーシティー オブ マサチューセッツ Two-tail self-delivery siRNA and related methods
JP6973778B2 (en) 2017-06-27 2021-12-01 株式会社ダイセル Injector
US10549038B2 (en) 2017-06-29 2020-02-04 Daicel Corporation Syringe
GB201711809D0 (en) 2017-07-21 2017-09-06 Governors Of The Univ Of Alberta Antisense oligonucleotide
CA3077213A1 (en) * 2017-10-04 2019-04-11 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
US20200282010A1 (en) 2017-11-08 2020-09-10 Epiaxis Therapeutics Pty Ltd Immunogenic compositions and uses therefor
MX2020005860A (en) 2017-12-06 2020-09-09 Avidity Biosciences Inc Compositions and methods of treating muscle atrophy and myotonic dystrophy.
US10857174B2 (en) 2018-07-27 2020-12-08 United States Government As Represented By The Department Of Veterans Affairs Morpholino oligonucleotides useful in cancer treatment
SG11202101288TA (en) 2018-08-10 2021-03-30 Univ Massachusetts Modified oligonucleotides targeting snps
MX2021001056A (en) 2018-08-13 2021-04-12 Alnylam Pharmaceuticals Inc HEPATITIS B VIRUS (HBV) dsRNA AGENT COMPOSITIONS AND METHODS OF USE THEREOF.
TW202039573A (en) 2018-12-21 2020-11-01 美商亞維代堤生物科學公司 Anti-transferrin receptor antibodies and uses thereof
EP3911747A4 (en) * 2019-01-18 2023-05-24 University Of Massachusetts Dynamic pharmacokinetic-modifying anchors
WO2020225779A1 (en) 2019-05-09 2020-11-12 Istituto Pasteur Italia - Fondazione Cenci Bolognetti Rig-i agonists for cancer treatment and immunotherapy
US12006499B2 (en) 2019-06-06 2024-06-11 Avidity Biosciences, Inc. Una amidites and uses thereof
CA3142283A1 (en) 2019-06-06 2020-12-10 Avidity Biosciences, Inc. Nucleic acid-polypeptide compositions and uses thereof
JP2022547790A (en) 2019-08-09 2022-11-16 ユニバーシティー オブ マサチューセッツ Chemically modified oligonucleotides targeting SNPs
CA3172111A1 (en) 2020-03-19 2021-09-23 Barbora MALECOVA Compositions and methods of treating facioscapulohumeral muscular dystrophy
JP2023527638A (en) 2020-03-27 2023-06-30 アビディティー バイオサイエンシーズ,インク. Compositions and methods for treating facioscapulohumeral muscular dystrophy
JP2024515999A (en) * 2021-04-30 2024-04-11 アルナイラム ファーマシューティカルズ, インコーポレイテッド Methods for redirecting RISC for RNA editing
BR112023026862A2 (en) 2021-06-23 2024-03-05 Beth Israel Deaconess Medical Ct Inc ANTI-FLT1 OLIGONUCLEOTIDE COMPOUNDS OPTIMIZED FOR THE TREATMENT OF PRE-ECLAMPSIA AND OTHER ANGIOGENIC DISORDERS
GB202112807D0 (en) 2021-09-08 2021-10-20 Univ Edinburgh Genetic resistance to viral disease in salmonid fish
EP4401792A1 (en) 2021-09-16 2024-07-24 Avidity Biosciences, Inc. Compositions and methods of treating facioscapulohumeral muscular dystrophy
WO2023069987A1 (en) 2021-10-20 2023-04-27 University Of Rochester Rejuvenation treatment of age-related white matter loss cross reference to related application
AU2023214198A1 (en) 2022-01-31 2024-08-15 Genevant Sciences Gmbh Ionizable cationic lipids for lipid nanoparticles
AU2023211981A1 (en) 2022-01-31 2024-08-15 Genevant Sciences Gmbh Poly(alkyloxazoline)-lipid conjugates and lipid particles containing same
US12071621B2 (en) 2022-04-05 2024-08-27 Avidity Biosciences, Inc. Anti-transferrin receptor antibody-PMO conjugates for inducing DMD exon 44 skipping

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5587471A (en) * 1994-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Method of making oligonucleotide libraries
US5998203A (en) * 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6716975B2 (en) * 2002-08-09 2004-04-06 Isis Pharmaceuticals, Inc. Antisense modulation of EDG1 expression

Family Cites Families (168)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US151116A (en) * 1874-05-19 Improvement in implements for constructing rail fences
US82404A (en) * 1868-09-22 Improvement in machines foe sheaeing sheep
US201394A (en) * 1878-03-19 Improvement in mirror and other frames
US402996A (en) * 1889-05-07 Territory
US409293A (en) * 1889-08-20 James arthur lewis
US358580A (en) * 1887-03-01 Enos e
US444853A (en) * 1891-01-20 Notes
US362016A (en) * 1887-04-26 knott
US406784A (en) * 1889-07-09 Job smith
US363124A (en) * 1887-05-17 Elouild duplessis
US386782A (en) * 1888-07-24 Thomas w
US543480A (en) * 1895-07-30 hendrickson
US422704A (en) * 1890-03-04 Bedstead
US408378A (en) * 1889-08-06 Seed-planter
US417012A (en) * 1889-12-10 Thomas flynn
US440129A (en) * 1890-11-11 Sash-cord fastener
US427160A (en) * 1890-05-06 davis
US652791A (en) * 1899-10-30 1900-07-03 Heiman H Levy Method of branding.
US693059A (en) * 1901-06-06 1902-02-11 Gerardo Pascale Pier for the support of bridges.
US727780A (en) * 1902-07-12 1903-05-12 John C Gabel Jr Soap-feeding attachment for brushes.
US720448A (en) * 1902-08-11 1903-02-10 Charley Lind Currycomb.
US740332A (en) * 1903-04-03 1903-09-29 Johann Stumpf Steam-turbine.
US2003020A (en) * 1930-09-16 1935-05-28 Stoody Co Welding rod for applying protective abrasion resisting facings
US4987071A (en) * 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
CA1339303C (en) 1987-09-21 1997-08-19 Lyle John Arnold Jr. Non-nucleotide linking reagents for nucleotide probes
US5108921A (en) * 1989-04-03 1992-04-28 Purdue Research Foundation Method for enhanced transmembrane transport of exogenous molecules
JPH04507083A (en) 1989-05-19 1992-12-10 ヘム・リサーチ・インコーポレーテッド Short therapeutic dsRNA of defined structure
CA2039718C (en) 1989-08-31 2003-02-25 John J. Rossi Chimeric dna-rna catalytic sequences
EP0942000B1 (en) 1989-10-24 2004-06-23 Isis Pharmaceuticals, Inc. 2'-Modified oligonucleotides
US6153737A (en) 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6005087A (en) 1995-06-06 1999-12-21 Isis Pharmaceuticals, Inc. 2'-modified oligonucleotides
US5670633A (en) 1990-01-11 1997-09-23 Isis Pharmaceuticals, Inc. Sugar modified oligonucleotides that detect and modulate gene expression
US5214136A (en) 1990-02-20 1993-05-25 Gilead Sciences, Inc. Anthraquinone-derivatives oligonucleotides
US6168778B1 (en) * 1990-06-11 2001-01-02 Nexstar Pharmaceuticals, Inc. Vascular endothelial growth factor (VEGF) Nucleic Acid Ligand Complexes
US5962219A (en) 1990-06-11 1999-10-05 Nexstar Pharmaceuticals, Inc. Systematic evolution of ligands by exponential enrichment: chemi-selex
US5138045A (en) 1990-07-27 1992-08-11 Isis Pharmaceuticals Polyamine conjugated oligonucleotides
JP3257675B2 (en) 1990-10-12 2002-02-18 マックス−プランク−ゲゼルシャフト ツール フェルデルング デル ビッセンシャフテン エー.ファウ. Modified ribozyme
DE4216134A1 (en) 1991-06-20 1992-12-24 Europ Lab Molekularbiolog SYNTHETIC CATALYTIC OLIGONUCLEOTIDE STRUCTURES
US5776563A (en) * 1991-08-19 1998-07-07 Abaxis, Inc. Dried chemical compositions
US6335434B1 (en) 1998-06-16 2002-01-01 Isis Pharmaceuticals, Inc., Nucleosidic and non-nucleosidic folate conjugates
US5652094A (en) 1992-01-31 1997-07-29 University Of Montreal Nucleozymes
US6469158B1 (en) 1992-05-14 2002-10-22 Ribozyme Pharmaceuticals, Incorporated Synthesis, deprotection, analysis and purification of RNA and ribozymes
WO1993023569A1 (en) 1992-05-11 1993-11-25 Ribozyme Pharmaceuticals, Inc. Method and reagent for inhibiting viral replication
US5804683A (en) 1992-05-14 1998-09-08 Ribozyme Pharmaceuticals, Inc. Deprotection of RNA with alkylamine
US20030206887A1 (en) * 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US5977343A (en) 1992-05-14 1999-11-02 Ribozyme Pharmaceuticals, Inc. Synthesis, deprotection, analysis and purification of RNA and ribozymes
EP0649467B1 (en) 1992-07-02 1998-09-16 HYBRIDON, Inc. Self-stabilized oligonucleotides as therapeutic agents
EP0654077A4 (en) 1992-07-17 1996-03-13 Ribozyme Pharm Inc Method and reagent for treatment of animal diseases.
US6235886B1 (en) 1993-09-03 2001-05-22 Isis Pharmaceuticals, Inc. Methods of synthesis and use
EP1195442A3 (en) * 1992-12-04 2002-07-31 Innovir Laboratories, Inc. Ribozyme amplified diagnostics
JPH08507203A (en) * 1992-12-04 1996-08-06 イノーバー ラボラトリーズ,インコーポレイテッド Regulatable nucleic acid therapies and methods of their use
CA2154363A1 (en) 1993-01-22 1994-08-04 Bruce A. Sullenger Localization of therapeutic agents
US5871914A (en) * 1993-06-03 1999-02-16 Intelligene Ltd. Method for detecting a nucleic acid involving the production of a triggering RNA and transcription amplification
US5731294A (en) 1993-07-27 1998-03-24 Hybridon, Inc. Inhibition of neovasularization using VEGF-specific oligonucleotides
CA2169645A1 (en) 1993-09-02 1995-03-09 Nassim Usman Non-nucleotide containing enzymatic nucleic acid
EP0728139B1 (en) 1993-09-03 2003-08-13 Isis Pharmaceuticals, Inc. Amine-derivatized nucleosides and oligonucleosides
US5624803A (en) * 1993-10-14 1997-04-29 The Regents Of The University Of California In vivo oligonucleotide generator, and methods of testing the binding affinity of triplex forming oligonucleotides derived therefrom
DK0725788T3 (en) 1993-10-27 1999-08-23 Ribozyme Pharm Inc 2'-amido and 2'-peptide modified oligonucleotides
US6060456A (en) 1993-11-16 2000-05-09 Genta Incorporated Chimeric oligonucleoside compounds
US5631359A (en) * 1994-10-11 1997-05-20 Ribozyme Pharmaceuticals, Inc. Hairpin ribozymes
US5902880A (en) * 1994-08-19 1999-05-11 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US5627053A (en) 1994-03-29 1997-05-06 Ribozyme Pharmaceuticals, Inc. 2'deoxy-2'-alkylnucleotide containing nucleic acid
JPH10501686A (en) 1994-04-13 1998-02-17 ザ ロックフェラー ユニヴァーシティ AAV-mediated delivery of DNA to cells of the nervous system
US6447796B1 (en) 1994-05-16 2002-09-10 The United States Of America As Represented By The Secretary Of The Army Sustained release hydrophobic bioactive PLGA microspheres
US5633133A (en) * 1994-07-14 1997-05-27 Long; David M. Ligation with hammerhead ribozymes
US5646262A (en) 1994-07-28 1997-07-08 Georgetown University Antisense oligonucleotides against hepatitis B viral replication
US6146886A (en) * 1994-08-19 2000-11-14 Ribozyme Pharmaceuticals, Inc. RNA polymerase III-based expression of therapeutic RNAs
US6350934B1 (en) * 1994-09-02 2002-02-26 Ribozyme Pharmaceuticals, Inc. Nucleic acid encoding delta-9 desaturase
US5820873A (en) 1994-09-30 1998-10-13 The University Of British Columbia Polyethylene glycol modified ceramide lipids and liposome uses thereof
US5753613A (en) 1994-09-30 1998-05-19 Inex Pharmaceuticals Corporation Compositions for the introduction of polyanionic materials into cells
US5885613A (en) 1994-09-30 1999-03-23 The University Of British Columbia Bilayer stabilizing components and their use in forming programmable fusogenic liposomes
JPH08208687A (en) * 1994-11-25 1996-08-13 Sankyo Co Ltd Glyceryl oligonucleotide
US5716824A (en) 1995-04-20 1998-02-10 Ribozyme Pharmaceuticals, Inc. 2'-O-alkylthioalkyl and 2-C-alkylthioalkyl-containing enzymatic nucleic acids (ribozymes)
US5889136A (en) 1995-06-09 1999-03-30 The Regents Of The University Of Colorado Orthoester protecting groups in RNA synthesis
US6346398B1 (en) 1995-10-26 2002-02-12 Ribozyme Pharmaceuticals, Inc. Method and reagent for the treatment of diseases or conditions related to levels of vascular endothelial growth factor receptor
EP0886641A2 (en) 1996-01-16 1998-12-30 Ribozyme Pharmaceuticals, Inc. Synthesis of methoxy nucleosides and enzymatic nucleic acid molecules
US6214805B1 (en) 1996-02-15 2001-04-10 The United States Of America As Represented By The Department Of Health And Human Services RNase L activators and antisense oligonucleotides effective to treat RSV infections
US5898031A (en) * 1996-06-06 1999-04-27 Isis Pharmaceuticals, Inc. Oligoribonucleotides for cleaving RNA
US5849902A (en) * 1996-09-26 1998-12-15 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US5989912A (en) * 1996-11-21 1999-11-23 Oligos Etc. Inc. Three component chimeric antisense oligonucleotides
US6248878B1 (en) 1996-12-24 2001-06-19 Ribozyme Pharmaceuticals, Inc. Nucleoside analogs
US20030064945A1 (en) * 1997-01-31 2003-04-03 Saghir Akhtar Enzymatic nucleic acid treatment of diseases or conditions related to levels of epidermal growth factor receptors
US6001311A (en) 1997-02-05 1999-12-14 Protogene Laboratories, Inc. Apparatus for diverse chemical synthesis using two-dimensional array
US6235310B1 (en) 1997-04-04 2001-05-22 Valentis, Inc. Methods of delivery using cationic lipids and helper lipids
KR100518108B1 (en) * 1997-05-05 2005-10-04 아벤티스 파마 도이칠란트 게엠베하 Modified antisense nucleotides complementary to a section of the human Ha-ras gene
US6395713B1 (en) 1997-07-23 2002-05-28 Ribozyme Pharmaceuticals, Inc. Compositions for the delivery of negatively charged molecules
US20030035829A1 (en) 1997-07-24 2003-02-20 Townsend And Townsend And Crew Liposomal compositions for the delivery of nucleic acid catalysts
TW589189B (en) 1997-08-04 2004-06-01 Scras Kit containing at least one double-stranded RNA combined with at least one anti-viral agent for therapeutic use in the treatment of a viral disease, notably of viral hepatitis
US6617156B1 (en) 1997-08-15 2003-09-09 Lynn A. Doucette-Stamm Nucleic acid and amino acid sequences relating to Enterococcus faecalis for diagnostics and therapeutics
EP1557424A1 (en) 1997-09-12 2005-07-27 Exiqon A/S Bi-cyclic nucleoside, nucleotide and oligonucleoide analogues
IL135140A0 (en) * 1997-09-17 2001-05-20 Univ East Carolina Multiple target hybridizing nucleic acids, their preparation, compositions, formulation, kits and applications
US6054576A (en) 1997-10-02 2000-04-25 Ribozyme Pharmaceuticals, Inc. Deprotection of RNA
JP2003528024A (en) 1997-12-16 2003-09-24 バレンティス・インコーポレーテッド Needle-free injection of formulated nucleic acid molecules
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
EP1044021B1 (en) 1998-01-05 2009-09-23 The University of Washington Enhanced transport using membrane disruptive agents
DE19905837A1 (en) * 1999-02-12 2000-08-17 Basf Ag Process for the racemization of optically active amines
US6111086A (en) 1998-02-27 2000-08-29 Scaringe; Stephen A. Orthoester protecting groups
NZ547283A (en) 1998-03-20 2008-06-30 Commw Scient Ind Res Org Control of gene expression
AUPP249298A0 (en) 1998-03-20 1998-04-23 Ag-Gene Australia Limited Synthetic genes and genetic constructs comprising same I
WO1999053050A1 (en) 1998-04-08 1999-10-21 Commonwealth Scientific And Industrial Research Organisation Methods and means for obtaining modified phenotypes
EP1071753A2 (en) * 1998-04-20 2001-01-31 Ribozyme Pharmaceuticals, Inc. Nucleic acid molecules with novel chemical compositions capable of modulating gene expression
AR020078A1 (en) 1998-05-26 2002-04-10 Syngenta Participations Ag METHOD FOR CHANGING THE EXPRESSION OF AN OBJECTIVE GENE IN A PLANT CELL
GB9827152D0 (en) 1998-07-03 1999-02-03 Devgen Nv Characterisation of gene function using double stranded rna inhibition
KR100768381B1 (en) 1998-09-24 2007-10-18 파마시아 앤드 업존 캄파니 엘엘씨 Alzheimer's Disease Secretase
EP1147204A1 (en) 1999-01-28 2001-10-24 Medical College Of Georgia Research Institute, Inc. Composition and method for in vivo and in vitro attenuation of gene expression using double stranded rna
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for inhibiting the expression of a given gene
AU3369900A (en) 1999-02-19 2000-09-04 General Hospital Corporation, The Gene silencing
US5998206A (en) 1999-02-23 1999-12-07 Isis Pharmaceuticals Inc. Antisense inhibiton of human G-alpha-12 expression
DE60040274D1 (en) 1999-03-10 2008-10-30 Phogen Ltd ADMINISTRATION OF NUCLEIC ACIDS AND PROTEINS ON CELLS
US5998148A (en) 1999-04-08 1999-12-07 Isis Pharmaceuticals Inc. Antisense modulation of microtubule-associated protein 4 expression
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
ES2283298T3 (en) 1999-05-04 2007-11-01 Santaris Pharma A/S ANALOGS OF L-RIBO-LNA.
CA2378653A1 (en) 1999-07-09 2001-01-18 American Home Products Corporation Methods and compositions for preventing the formation of aberrant rna during transcription of a plasmid sequence
WO2001029058A1 (en) 1999-10-15 2001-04-26 University Of Massachusetts Rna interference pathway genes as tools for targeted genetic interference
GB9927444D0 (en) 1999-11-19 2000-01-19 Cancer Res Campaign Tech Inhibiting gene expression
DE10160151A1 (en) 2001-01-09 2003-06-26 Ribopharma Ag Inhibiting expression of target gene, useful e.g. for inhibiting oncogenes, by administering double-stranded RNA complementary to the target and having an overhang
DE10100586C1 (en) 2001-01-09 2002-04-11 Ribopharma Ag Inhibiting gene expression in cells, useful for e.g. treating tumors, by introducing double-stranded complementary oligoRNA having unpaired terminal bases
AU1767301A (en) 1999-11-29 2001-06-04 Cold Spring Harbor Laboratory Regulation of polycomb group gene expression for increasing seed size in plants
RU2164944C1 (en) 1999-12-09 2001-04-10 Институт молекулярной биологии им. В.А. Энгельгардта РАН Method of alternation of organism genetic features
FR2802276B1 (en) * 1999-12-13 2002-06-07 Nobel Plastiques LOW PERMEABILITY CONNECTION DEVICE
WO2001049844A1 (en) 1999-12-30 2001-07-12 Rutgers, The State University Of New Jersey Compositions and methods for gene silencing
IT1316982B1 (en) 2000-01-17 2003-05-26 Univ Roma ISOLATION AND CHARACTERIZATION OF A GENE FOR GENE SILENCE N.CRASSA AND ITS USES.
US6831171B2 (en) 2000-02-08 2004-12-14 Yale University Nucleic acid catalysts with endonuclease activity
US8202979B2 (en) * 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
WO2002081628A2 (en) * 2001-04-05 2002-10-17 Ribozyme Pharmaceuticals, Incorporated Modulation of gene expression associated with inflammation proliferation and neurite outgrowth, using nucleic acid based technologies
US8273866B2 (en) * 2002-02-20 2012-09-25 Merck Sharp & Dohme Corp. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (SINA)
WO2003070918A2 (en) 2002-02-20 2003-08-28 Ribozyme Pharmaceuticals, Incorporated Rna interference by modified short interfering nucleic acid
JP2003526367A (en) 2000-03-16 2003-09-09 ジェネティカ インコーポレイテッド RNA interference method and RNA interference composition
CN1426466A (en) 2000-03-17 2003-06-25 贝尼泰克澳大利亚有限公司 Genetic silencing
US7399900B2 (en) 2000-03-22 2008-07-15 Sanofi-Aventis Deutschland Gmbh Nematodes as model organisms for the investigation of neurodegenerative diseases, in particular parkinsons disease, uses and methods for the discovery of substances and genes which can used in the treatment of the above disease states and identification of anematode gene
GB0007268D0 (en) 2000-03-24 2000-05-17 Cyclacel Ltd Cell cycle progression proteins
AU2001249622B2 (en) 2000-03-30 2007-06-07 Massachusetts Institute Of Technology RNA sequence-specific mediators of RNA interference
US6824972B2 (en) 2000-05-22 2004-11-30 Baylor College Of Medicine Diagnosis and treatment of medical conditions associated with defective NFkappa B(NF-κB) activation
JP4901051B2 (en) 2000-05-30 2012-03-21 ジョンソン アンド ジョンソン リサーチ プロプライアトリー リミテッド Methods for mediating gene suppression by using factors that enhance RNAi
AU2001275474A1 (en) 2000-06-12 2001-12-24 Akkadix Corporation Materials and methods for the control of nematodes
GB0020616D0 (en) 2000-08-21 2000-10-11 Quadrant Holdings Cambridge Particulates
US20030190635A1 (en) * 2002-02-20 2003-10-09 Mcswiggen James A. RNA interference mediated treatment of Alzheimer's disease using short interfering RNA
US6613567B1 (en) 2000-09-15 2003-09-02 Isis Pharmaceuticals, Inc. Antisense inhibition of Her-2 expression
US7368248B2 (en) 2000-11-09 2008-05-06 Cenix Bioscience Gmbh Eukaryotic cell division genes and their use in diagnosis and treatment of proliferative diseases
WO2002044321A2 (en) * 2000-12-01 2002-06-06 MAX-PLANCK-Gesellschaft zur Förderung der Wissenschaften e.V. Rna interference mediating small rna molecules
US20020130430A1 (en) 2000-12-29 2002-09-19 Castor Trevor Percival Methods for making polymer microspheres/nanospheres and encapsulating therapeutic proteins and other products
US20030087855A1 (en) 2001-09-13 2003-05-08 Isis Pharmaceuticals Inc. Antisense modulation of protein kinase R expression
US20050148530A1 (en) * 2002-02-20 2005-07-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
EP3231445A1 (en) 2001-05-18 2017-10-18 Sirna Therapeutics, Inc. Conjugates and compositions for cellular delivery
US20030175950A1 (en) * 2001-05-29 2003-09-18 Mcswiggen James A. RNA interference mediated inhibition of HIV gene expression using short interfering RNA
US20040019001A1 (en) 2002-02-20 2004-01-29 Mcswiggen James A. RNA interference mediated inhibition of protein typrosine phosphatase-1B (PTP-1B) gene expression using short interfering RNA
EP2070939B1 (en) 2001-05-25 2014-04-02 Duke University Modulators of pharmacological agents
US20040005543A1 (en) * 2002-01-18 2004-01-08 Abraham Grossman Compositions and methods for binding agglomeration proteins
FR2826666B1 (en) 2001-07-02 2004-07-02 Novaleads METHOD FOR SELECTING BIO-ACTIVE AGENTS BY LUMINESCENCE COUPLING AND LIVING CELLULAR SYSTEM FOR CARRYING OUT SAID METHOD
WO2003005346A1 (en) 2001-07-03 2003-01-16 Intel Zao Method and apparatus for fast calculation of observation probabilities in speech recognition
US6586524B2 (en) 2001-07-19 2003-07-01 Expression Genetics, Inc. Cellular targeting poly(ethylene glycol)-grafted polymeric gene carrier
US7919309B2 (en) 2001-09-13 2011-04-05 California Institute Of Technology Method for expression of small antiviral RNA molecules within a cell
GB0122318D0 (en) 2001-09-14 2001-11-07 Novartis Ag Organic compounds
WO2003044188A1 (en) 2001-11-21 2003-05-30 Mitsubishi Chemical Corporation Method of inhibiting gene expression
US7060498B1 (en) 2001-11-28 2006-06-13 Genta Salus Llc Polycationic water soluble copolymer and method for transferring polyanionic macromolecules across biological barriers
US7141540B2 (en) 2001-11-30 2006-11-28 Genta Salus Llc Cyclodextrin grafted biocompatible amphilphilic polymer and methods of preparation and use thereof
US20040014956A1 (en) 2002-02-01 2004-01-22 Sequitur, Inc. Double-stranded oligonucleotides
ATE427352T1 (en) * 2002-07-26 2009-04-15 Novartis Vaccines & Diagnostic MODIFIED SMALL IRNS MOLECULES AND METHODS OF THEREOF APPLICATION
EP1527176B2 (en) 2002-08-05 2017-03-22 Silence Therapeutics GmbH Further novel forms of interfering rna molecules
US20050106731A1 (en) 2002-08-05 2005-05-19 Davidson Beverly L. siRNA-mediated gene silencing with viral vectors
AU2003282877B9 (en) 2002-09-25 2011-05-12 University Of Massachusetts In Vivo gene silencing by chemically modified and stable siRNA
US9150605B2 (en) 2002-11-05 2015-10-06 Isis Pharmaceuticals, Inc. Compositions comprising alternating 2′-modified nucleosides for use in gene modulation
EP2298886A3 (en) 2002-11-22 2011-12-14 Bio-Think Tank Co., Ltd. Method for searching target base sequence of RNA interference, method for designing base sequence of polynucleotide for causing RNA interference, method for producing double-stranded polynucleotide, method for inhibiting gene expression, base sequence processing apparatus, program for running base sequence processing method on computer, recording medium, and base sequence processing system
US20040198640A1 (en) * 2003-04-02 2004-10-07 Dharmacon, Inc. Stabilized polynucleotides for use in RNA interference
JP2007505606A (en) 2003-09-16 2007-03-15 サーナ・セラピューティクス・インコーポレイテッド RNA interference-mediated suppression of hepatitis C virus (HCV) expression using small interfering nucleic acids (siNA)
WO2005049821A1 (en) 2003-11-21 2005-06-02 Bio-Think Tank Co., Ltd. METHOD OF EVALUATING RNAi ACTIVITY AND miRNA ACTIVITY
AU2004294567A1 (en) 2003-11-26 2005-06-16 University Of Massachusetts Sequence-specific inhibition of small RNA function
US20050182005A1 (en) 2004-02-13 2005-08-18 Tuschl Thomas H. Anti-microRNA oligonucleotide molecules

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5587471A (en) * 1994-01-11 1996-12-24 Isis Pharmaceuticals, Inc. Method of making oligonucleotide libraries
US5998203A (en) * 1996-04-16 1999-12-07 Ribozyme Pharmaceuticals, Inc. Enzymatic nucleic acids containing 5'-and/or 3'-cap structures
US6716975B2 (en) * 2002-08-09 2004-04-06 Isis Pharmaceuticals, Inc. Antisense modulation of EDG1 expression

Cited By (82)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050267058A1 (en) * 2001-05-18 2005-12-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (sINA)
US9994853B2 (en) 2001-05-18 2018-06-12 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
US9181551B2 (en) 2002-02-20 2015-11-10 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10889815B2 (en) 2002-02-20 2021-01-12 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10662428B2 (en) 2002-02-20 2020-05-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10351852B2 (en) 2002-02-20 2019-07-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US10000754B2 (en) 2002-02-20 2018-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9957517B2 (en) 2002-02-20 2018-05-01 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9771588B2 (en) 2002-02-20 2017-09-26 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9738899B2 (en) 2002-02-20 2017-08-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9732344B2 (en) 2002-02-20 2017-08-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US9657294B2 (en) 2002-02-20 2017-05-23 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA)
US7829696B2 (en) 2002-11-14 2010-11-09 Dharmacon, Inc. siRNA targeting amyloid beta (A4) precursor protein (APP)
US8293887B2 (en) 2002-11-14 2012-10-23 Dharmacon, Inc. SiRNA targeting beta secretase (BACE)
US11198870B2 (en) 2002-11-14 2021-12-14 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10765695B2 (en) 2002-11-14 2020-09-08 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US20100069622A1 (en) * 2002-11-14 2010-03-18 Dharmacon, Inc. siRNA targeting amyloid beta (A4) precursor protein (APP)
US20100113307A1 (en) * 2002-11-14 2010-05-06 Dharmacon, Inc. siRNA targeting vascular endothelial growth factor (VEGF)
US10696968B2 (en) 2002-11-14 2020-06-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US10233449B2 (en) 2002-11-14 2019-03-19 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US7795421B2 (en) 2002-11-14 2010-09-14 Dharmacon, Inc. siRNA targeting apolipoprotein B (APOB)
US20050255487A1 (en) * 2002-11-14 2005-11-17 Dharmacon, Inc. Methods and compositions for selecting siRNA of improved functionality
US10011836B2 (en) 2002-11-14 2018-07-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US20100331214A1 (en) * 2002-11-14 2010-12-30 Dharmacon Inc. siRNA Targeting Survivin
US20110003713A1 (en) * 2002-11-14 2011-01-06 Dharmacon, Inc. siRNA targeting apolipoprotein B (APOB)
US20110003714A1 (en) * 2002-11-14 2011-01-06 Dharmacon, Inc. siRNA Targeting Beta Secretase (BACE)
US20110021382A1 (en) * 2002-11-14 2011-01-27 Dharmacon, Inc. siRNA targeting amyloid beta (A4) precursor protein (APP)
US20110034349A1 (en) * 2002-11-14 2011-02-10 Dharmacon, Inc. siRNA targeting proto-oncogene MET
US9879266B2 (en) 2002-11-14 2018-01-30 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US7985854B2 (en) 2002-11-14 2011-07-26 Dharmacon, Inc. siRNA targeting TATA box binding protein (TBP)-associated factor (TAF1)
US7999097B2 (en) 2002-11-14 2011-08-16 Dharmacon, Inc. siRNA targeting beta secretase (BACE)
US8000902B2 (en) 2002-11-14 2011-08-16 Dharmacon, Inc. Methods and compositions for selecting siRNA of improved functionality
US8008474B2 (en) 2002-11-14 2011-08-30 Dharmacon, Inc. siRNA targeting KRAS
US9839649B2 (en) 2002-11-14 2017-12-12 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US8030474B2 (en) 2002-11-14 2011-10-04 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase 4 (CDK4)
US9777270B2 (en) 2002-11-14 2017-10-03 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US20070031844A1 (en) * 2002-11-14 2007-02-08 Anastasia Khvorova Functional and hyperfunctional siRNA
US8071754B2 (en) 2002-11-14 2011-12-06 Dharmacon, Inc. siRNA targeting apolipoprotein B (APOB)
US8090542B2 (en) 2002-11-14 2012-01-03 Dharmacon Inc. Functional and hyperfunctional siRNA
US8093370B2 (en) 2002-11-14 2012-01-10 Dharmacon, Inc. siRNA targeting spleen tyrosine kinase
US8138329B2 (en) 2002-11-14 2012-03-20 Dharmacon, Inc. siRNA targeting connective tissue growth factor (CTGF)
US9771586B2 (en) 2002-11-14 2017-09-26 Thermo Fisher Scientific Inc. RNAi targeting ZNF205
US20080113370A1 (en) * 2002-11-14 2008-05-15 Dharmacon, Inc. siRNA targeting apolipoprotein B (APOB)
US8222396B2 (en) 2002-11-14 2012-07-17 Dharmacon, Inc. SiRNA targeting proto-oncogene MET
US8232385B2 (en) 2002-11-14 2012-07-31 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase inhibitor 1B (p27, Kip1) (CDKN1B)
US8232386B2 (en) 2002-11-14 2012-07-31 Dharmacon, Inc. SiRNA targeting apolipoprotein B (APOB)
US8268985B2 (en) 2002-11-14 2012-09-18 Dharmacon, Inc. siRNA targeting amyloid beta (A4) precursor protein (APP)
US20090203895A1 (en) * 2002-11-14 2009-08-13 Dharmacon, Inc. siRNA targeting cyclin-dependent kinase 4 (CDK4)
US8314229B2 (en) 2002-11-14 2012-11-20 Dharmacon, Inc. siRNA targeting tie-2
US8426579B2 (en) 2002-11-14 2013-04-23 Dharmacon, Inc. SiRNA targeting myeloid differentiation primary response gene (88) (MYD88)
US9719094B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting SEC61G
US8461326B2 (en) 2002-11-14 2013-06-11 Dharmacon, Inc. SiRNA targeting connective tissue growth factor (CTGF)
US9719092B2 (en) 2002-11-14 2017-08-01 Thermo Fisher Scientific Inc. RNAi targeting CNTD2
US8633306B2 (en) 2002-11-14 2014-01-21 Thermo Fisher Scientific Biosciences Inc. SiRNA targeting histamine receptor H1
US9228186B2 (en) 2002-11-14 2016-01-05 Thermo Fisher Scientific Inc. Methods and compositions for selecting siRNA of improved functionality
US8063198B2 (en) 2004-04-05 2011-11-22 Alnylam Pharmaceuticals, Inc. Processes and reagents for desilylation of oligonucleotides
US8431693B2 (en) 2004-04-05 2013-04-30 Alnylam Pharmaceuticals, Inc. Process for desilylation of oligonucleotides
US8058448B2 (en) 2004-04-05 2011-11-15 Alnylam Pharmaceuticals, Inc. Processes and reagents for sulfurization of oligonucleotides
US20050267300A1 (en) * 2004-04-05 2005-12-01 Muthiah Manoharan Processes and reagents for oligonucleotide synthesis and purification
US7626014B2 (en) 2004-04-27 2009-12-01 Alnylam Pharmaceuticals Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US8470988B2 (en) 2004-04-27 2013-06-25 Alnylam Pharmaceuticals, Inc. Single-stranded and double-stranded oligonucleotides comprising a 2-arylpropyl moiety
US7674778B2 (en) 2004-04-30 2010-03-09 Alnylam Pharmaceuticals Oligonucleotides comprising a conjugate group linked through a C5-modified pyrimidine
US20050288244A1 (en) * 2004-04-30 2005-12-29 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a C5-modified pyrimidine
US10508277B2 (en) 2004-05-24 2019-12-17 Sirna Therapeutics, Inc. Chemically modified multifunctional short interfering nucleic acid molecules that mediate RNA interference
WO2006009784A1 (en) * 2004-06-18 2006-01-26 Mirus Bio Corporation Small interfering rna with improved activity
US7723512B2 (en) 2004-06-30 2010-05-25 Alnylam Pharmaceuticals Oligonucleotides comprising a non-phosphate backbone linkage
US8013136B2 (en) 2004-06-30 2011-09-06 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US20090318676A1 (en) * 2004-06-30 2009-12-24 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US20060287260A1 (en) * 2004-06-30 2006-12-21 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US7615618B2 (en) 2004-06-30 2009-11-10 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a non-phosphate backbone linkage
US7772387B2 (en) 2004-07-21 2010-08-10 Alnylam Pharmaceuticals Oligonucleotides comprising a modified or non-natural nucleobase
US7893224B2 (en) 2004-08-04 2011-02-22 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
US7632932B2 (en) 2004-08-04 2009-12-15 Alnylam Pharmaceuticals, Inc. Oligonucleotides comprising a ligand tethered to a modified or non-natural nucleobase
WO2006023491A2 (en) 2004-08-16 2006-03-02 The Cbr Institute For Biomedical Research, Inc. Method of delivering rna interference and uses thereof
US20070027097A1 (en) * 2005-07-28 2007-02-01 Lewis David L Small interfering RNA with improved activity
US20120070486A1 (en) * 2007-02-12 2012-03-22 Sood Anil K Methods and compositions related to prefoldin and its regulation
US20100317029A1 (en) * 2009-06-15 2010-12-16 Lih-Chyang Chen Nasopharyngeal cancer malingancy biomarker and method thereof
US9970005B2 (en) 2010-10-29 2018-05-15 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US11193126B2 (en) 2010-10-29 2021-12-07 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US9260471B2 (en) 2010-10-29 2016-02-16 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
US11932854B2 (en) 2010-10-29 2024-03-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using short interfering nucleic acids (siNA)
WO2012075337A2 (en) 2010-12-01 2012-06-07 Spinal Modulation, Inc. Directed delivery of agents to neural anatomy

Also Published As

Publication number Publication date
US20060247428A1 (en) 2006-11-02
US20060292691A1 (en) 2006-12-28
US20060287266A1 (en) 2006-12-21
US20070004663A1 (en) 2007-01-04
US20060217335A1 (en) 2006-09-28
US20060247429A1 (en) 2006-11-02
US20060293271A1 (en) 2006-12-28
US20070004667A1 (en) 2007-01-04
US20040192626A1 (en) 2004-09-30
US8846894B2 (en) 2014-09-30
US20060217334A1 (en) 2006-09-28
US7989612B2 (en) 2011-08-02
US20060275903A1 (en) 2006-12-07
US20070167393A1 (en) 2007-07-19
US20070004665A1 (en) 2007-01-04
US20060281175A1 (en) 2006-12-14
US8202979B2 (en) 2012-06-19
US20060217336A1 (en) 2006-09-28
US20060293272A1 (en) 2006-12-28
US20060217337A1 (en) 2006-09-28

Similar Documents

Publication Publication Date Title
US20050106726A1 (en) RNA interference mediated inhibition of platelet-derived endothelial cell growth factor (ECGF1) gene expression using short interfering nucleic acid (siNA)
EP2902406B1 (en) Rna interference mediated inhibition of gene expression using short interfering nucleic acid (sina)
US20040209832A1 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US7659390B2 (en) RNA interference mediated inhibition of muscarinic colinergic receptor gene expression using short interfering nucleic acid (siNA)
AU2003216323B2 (en) Inhibition of vascular endothelial growth factor (vegf) and vegf receptor gene expression using short interfereing nucleic acid (sina)
US20050148530A1 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050048529A1 (en) RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA)
US20040138163A1 (en) RNA interference mediated inhibition of vascular edothelial growth factor and vascular edothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050096284A1 (en) RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
WO2003070910A2 (en) INHIBITION OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) AND VEGF RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20070203333A1 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
US20050191638A1 (en) RNA interference mediated treatment of polyglutamine (polyQ) repeat expansion diseases using short interfering nucleic acid (siNA)
US20050054596A1 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
WO2003070972A9 (en) RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
US20040198682A1 (en) RNA interference mediated inhibition of placental growth factor gene expression using short interfering nucleic acid (siNA)
US20050075304A1 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)
EP1465910A2 (en) Rna interference mediated inhibition of checkpoint kinase-1 (chk-1) gene expression using short interfering nucleic acid
US8017765B2 (en) RNA interference mediated treatment of alzheimer's disease using short interfering nucleic acid (siNA)
EP1710307A2 (en) RNA interference mediated inhibition of gene expression using short interfering nucleic acid (siNA)
WO2004111237A1 (en) RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR (ECGF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA)
AU2006203062B2 (en) RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA)

Legal Events

Date Code Title Description
AS Assignment

Owner name: SIRNA THERAPEUTICS, INC., COLORADO

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MCSWIGGEN, JAMES;CHOWRIRA, BHARAT;REEL/FRAME:015885/0924

Effective date: 20040928

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION