WO2020225779A1 - Rig-i agonists for cancer treatment and immunotherapy - Google Patents

Abstract

Disclosed herein are compositions and methods for the treatment of cancer, particularly compositions including at least one oligoribonucleotide-based RIG-1 agonist and methods of use of such compositions. Methods for stimulating an immune response against a tumor antigen in a subject at risk of having or having a cancer comprising the tumor antigen, which involve administering at least one oligoribonucleotide-based RIG-1 agonist to the subject, are also described. Also provided are cancer vaccines and immunization kits.

Description

RIG-1 AGONISTS FOR CANCER TREATMENT AND IMMUNOTHERAPY

CROSS-REFERENCE TO RELATED APPLICATION

[0001] This application claims the priority of U.S. Provisional Application No. 62/845,783, titled“RIG-I AGONISTS FOR CANCER TREATMENT” and filed on May 9, 2019, which is incorporated by reference herein in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under grants AM 08861 and 7R21 CA192185 awarded by the National Institutes of Health. The government has certain rights in the invention.

FIELD OF THE DISCLOSURE

[0003] Generally, the field is RNA-based therapeutic molecules. More specifically, the field is 5'- triphosphate oligoribonucleotide immune system agonists, pharmaceutical compositions comprising the same, and methods of use of the compositions.

BACKGROUND OF THE DISCLOSURE

[0004] The innate immune system has evolved numerous molecular sensors and signaling pathways to detect, contain and clear viral infections (Takeuchi & Akira, Immunol Rev 227:75-86, 2009; Yoneyama & Fujita, Rev Med Virol 20:4-22, 2010; Wilkins & Gale, Curr Opin Immunol 22:41 -47, 2010; Brennan & Bowie, Curr Opin Microbiol 13:503-507, 2010). Viruses are sensed by a subset of pattern recognition receptors (PRRs) that recognize evolutionarily conserved structures known as pathogen- associated molecular patterns (PAMPs). Classically, viral nucleic acids are the predominant PAMPs detected by these receptors during infection. These sensing steps contribute to the activation of signaling cascades that culminate in the early production of antiviral effector molecules, cytokines and chemokines responsible for the inhibition of viral replication and the induction of adaptive immune responses (Takeuchi & Akira, Cell 140:805-820, 2010; Liu et al., Curr Opin Immunol 23:57-64, 2011 ; Akira et al., Cell 124:783-801 , 2006). In addition to the nucleic acid sensing by a subset of endosome- associated Toll-like receptors (TLR), viral RNA structures within the cytoplasm are recognized by members of the retinoic acid-inducible gene-l (RIG-l)-like receptors (RLRs) family, including the three DExD/H box RNA helicases RIG-I, Mda5 and LGP-2 (Kumar et al., Int Rev Immunol 30:16-34, 2011 ; Loo & Gale, Immunity 34:680-692, 2011 ; Belgnaoui et al., Curr Opin Immunol 23:564-572, 2011 ; Beutler, Blood 1 13:1399-1407, 2009; Kawai & Akira, Immunity 34, 637-650, 201 1 ).

[0005] Upon progression, tumors adopt multiple strategies to escape immune surveillance and to generate an immunosuppressive and pro-tumorigenic microenvironment (Schreiber et al., Science 331 :1565-1570, 201 1 ). During this“immunoediting escape phase”, cancer cells become less visible to cells of the immune system by: 1 ) downregulation of HLA-ABC, co-stimulatory molecules and NK ligands; 2) expression or secretion of immunosuppressing molecules (such as PD-L1 , Galectin 9, ID01 ); and/or 3) chemoattraction of immunosuppressive cells such as regulatory T cells, myeloid derived suppressor cells or tumor activated macrophage cells (Treg, MDSC and TAM, respectively) (Mittal et al., Curr Opin Immunol 27:16-25, 2014). Several strategies are currently being investigated to overcome the limitations of the immunosuppressive microenvironment and induce tumor cell death. Among these approaches, the use of compounds that mimic viral infection represent a promising strategy to pair cell death signals with immune activation events (lurescia et al., Front Immunol 9:711 , 2018).

[0006] The retinoic acid inducible gene-l (RIG-I) is a cytosolic PRR for short 5' triphosphate double strand RNA, that has a crucial role in activating immune response against viral infection (Hornung et al., Science 314:994-997, 2006). RIG-I is a cytosolic multidomain protein that detects viral RNA through its helicase domain (Jiang et al., Nature 479:423-427, 2011 ; Yoneyama & Fujita, J Biol Chem 282, 15315-15318, 2007). In addition to its RNA sensing domain, RIG-I also possesses an effector caspase activation and recruitment domain (CARD) that interacts with the mitochondrial adaptor MAVS, also known as VISA, I PS-1 , and Cardif (Kawai et al., Nat Immunol 6:981 -988, 2005; Meylan et al., Nature 437:1 167-1172, 2005). Upon recognition of viral RNA, RIG-I activates through CARD- mediated interactions the adaptor mitochondrial antiviral signaling protein (MAVS), which in turn activates TANK-binding kinase 1 (TBK1 ) and the IKB kinase (IKK) complex (Kawai et al., Nat Immunol 6:981-988, 2005). TBK1 and IKK, then, lead to the activation of interferon regulatory factor 3 (IRF3) and nuclear factor kappa B (NF-KB), respectively, thus inducing interferon (IFN), antiviral and inflammatory response (Goulet et al., PLoS Pathog 9 :e 1003298, 2013; Zevini et al., Trends Immunol. 38(3):194-205, 2017). Additionally, RIG-I signaling can also trigger suicide of infected cells as an ultimate mechanism of protection to limit viral spread through at least three different mechanisms: IRF3-dependent induction of apoptotic genes (Heylbroeck et al., J Virol 74:3781-92, 2000); IRF3- mediated induction of BAX-dependent mitochondrial apoptosis (Chattopadhyay et al., Immunity 44:1 151-1161 , 2016); and, direct RIG-I induction of necroptosis (Schock et al., Cell Death Differ 24:615-625, 2017). Such dual effects (i.e., induction of cell death and immune activation) render RIG- I agonists as a promising therapeutic approach for cancer treatment. Indeed, preliminary results have already shown that RIG-I agonists can induce cell death in different tumor types and activate both innate and adaptive immunity against tumors in mouse models (Poeck et al., Nat Med 14:1256-1263, 2008; Besch et al., J Clin Invest 119:2399-241 1 , 2009; Glas et al., Stem Cells 31 :1064-1074, 2013; Ellermeier et al., Cancer Res 73:1709-1720, 2013; Duewell et al., Cell Death Differ 21 :1825-1837, 2014).

[0007] The nature of the ligand recognized by RIG-I has been the subject of intense study given that PAMPs are the initial triggers of the antiviral immune response. In vitro synthesized RNA carrying an exposed 5' terminal triphosphate (5'ppp) moiety was identified as a RIG-1 agonist (Hornung et ai, Science 314:994-997, 2006; Pichlmair et ai, Science 314:997-1001 , 2006; and Kim et ai, Nat Biotechol 22:321 -325, 2004). The 5'ppp moiety is added to the end of all viral and eukaryotic RNA molecules generated by RNA polymerization. However, in eukaryotic cells, RNA processing in the nucleus cleaves the 5'ppp end and the RNA is capped prior to release into the cytoplasm. The eukaryotic immune system evolved the ability to distinguish viral‘non-self 5'ppp RNA from cellular ‘self RNA through RIG-I (Fujita, Immunity 31 :4-5, 2009). Further characterization of RIG-I ligand structure indicated that blunt base pairing at the 5' end of the RNA and a minimum double strand (ds) length of 20 nucleotides were also important for RIG-I signaling (Schlee & Hartmann, Molecular Therapy 18:1254-1262, 2010). Further studies indicated that a dsRNA length of less than 300 base pairs led to RIG-I activation but a dsRNA length of more than 2000 bp lacking a 5'ppp (as is the case with poly l:C) failed to activate RIG-I (Kato et ai, J Exp Med 205: 1601 - 1610, 2008).

[0008] RNA extracted from virally infected cells, specifically viral RNA genomes or viral replicative intermediates, was also shown to activate RIG-I (Baum et ai., Proc Natl Acad Sci USA 107:16303- 16308, 2010; Rehwinkel & Sousa, Science 327:284-286, 2010; Rehwinkel et ai., Cell 140:397-408, 2010). Interestingly, the highly conserved 5' and 3' untranslated regions (UTRs) of negative single strand RNA virus genomes display high base pair complementarity and the panhandle structure theoretically formed by the viral genome meets the requirements for RIG-I recognition. The elucidation of the crystal structure of RIG-I highlighted the molecular interactions between RIG-I and 5'ppp-dsRNA (Cui et ai, Molecular Cell 29:169-179, 2008), providing a structural basis for the conformational changes involved in exposing the CARD domain for effective downstream signaling.

[0009] By modifying the length, structure and sequence of the 5’ end of Vesicular Stomatitis Virus (VSV) RNA, a RIG-I agonist (named M8) was developed that was 10-100 fold more potent in stimulating an antiviral response compared to other agonists (Chiang et ai, J Virol 89:8011-8025, 2015; U.S. Patents No. 9,790,509 and No. 10,167,476). M8 potently blocked a variety of viral infections in vitro and in vivo, in part due to the activation of an innate immune response with great breadth and intensity. Furthermore, M8 acted as a potent vaccine adjuvant against influenza, leading to high antibody titers and Th1 -shift in immune responses (Beljanski et ai, J Virol 89:10612-10624, 2015).

[0010] U.S. Patent Publications No. US 2014/0287023 (published September 25, 2014), is incorporated herein by reference.

SUMMARY OF THE DISCLOSURE

[0011] Disclosed herein are methods of treating cancer, which methods involve administering to a subject at least one synthetic oligoribonucleotide RIG-I agonist that is at least 41 nucleotides in length and that can form a hairpin structure comprising at least 17 base pairs. The synthetic oligoribonucleotide further includes a triphosphate group at its 5' end. The oligoribonucleotide can also be of at least 99 nucleotides in length and can form a hairpin structure of at least 48 base pairs. In such an oligoribonucleotide, the hairpin structure can comprise at least 26 consecutive U-A base pairs. Examples of the therapeutic oligoribonucleotides include sequences such as any one of SEQ ID NOs: 10-17.

[0012] One embodiment is a method of treating cancer in a subject in need thereof including administering a therapeutically effective amount of a synthetic oligoribonucleotide including a 5' end triphosphate group and including (or having only) the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10) to the subject, thereby treating the cancer in the subject. In examples of this embodiment, the cancer includes melanoma, adenocarcinoma, carcinoma, or a metastatic cancer. In other examples, the cancer includes lung cancer, colon cancer, or prostate cancer.

[0013] Another provided embodiment is a method of inducing death of cancerous cells in a subject, the method including administering a therapeutically effective amount of a synthetic oligoribonucleotide including a 5' end triphosphate group and including (or having only) the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10) to the subject, thereby inducing death of cancerous cells in the subject. By way of example, in such methods the cancerous cells include melanoma cells, adenocarcinoma cells, carcinoma cells, or metastatic cells. In other examples of this embodiment, the cancerous cells arise from melanoma, adenocarcinoma, carcinoma, or a metastatic cancer. In other examples, the cancerous cells arise from lung, colon, or prostate cancer.

[0014] In examples of the methods of inducing cell death of cancerous cells in a subject, the cell death is dependent on caspase 3. In examples of the methods of inducing cell death of cancerous cells in a subject, the cell death is dependent on type I interferon (IFN-I). In particular embodiments, death of cancerous cells includes: an increase in expression of chemokines CCL2, CXCL1 , CXCL10, and/or IFNp in the cancerous cells; an increase in surface exposure of calreticulin on the cancerous cells; an increase in secretion of High Mobility Group Box 1 (HMGB1 ) from the cancerous cells; and/or an increase in release of ATP from the cancerous cells, as compared to the corresponding parameter in cancerous cells from the subject prior to the administering.

[0015] In yet further examples of these methods administering further elicits immune reactivation in the subject. In particular embodiments, the immune reactivation comprises: an increase in natural killer (NK) activating ligands on the cancerous cells; induction of expression of an NK inhibiting marker on the cancerous cells; induction of antigen processing machinery (APM) genes in the cancerous cells; an increase in expression of CD80, CD86, and/or HLA-DR on dendritic cells from the subject; and/or an increase in IL-12 expression in dendritic cells from the subject, as compared to the corresponding parameter in cancerous cells or dendritic cells from the subject prior to the administering.

[0016] Optionally, in any of these methods of treating cancer or inducing cell death of cancerous cells in a subject, the method further involves administering at least one second anti-cancer agent. [0017] In representative examples of any of the provided methods, the therapeutically effective amount includes at least 0.2 milligrams to at least 5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.2-5 mg/kg/wk).

[0018] In additional representative examples of any of the provided methods, the therapeutically effective amount includes at least 0.5 milligrams to at least 2.5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.5-2.5 mg/kg/wk).

[0019] In yet more representative examples of any of the provided methods, the synthetic oligoribonucleotide is administered to the subject for at least 1 -52 weeks; and/or administered to the subject 1 -6 times per week; and / or administered 1 -6 times during the first week and 1 time each subsequent week.

[0020] Further examples, the provided methods involve the synthetic oligoribonucleotide being administered in a total weekly dose of any of 10 mg, 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, or 750 mg.

[0021] Further examples of the methods include the effective amount of the synthetic oligoribonucleotide being administered at a rate of 5 n M/kg to 100 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body. By way of specific example, the therapeutically effective amount includes 15.5 nM/kg to 77.5 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body.

[0022] Another provided embodiment is a vaccine composition including: a tumor antigen; an adjuvant; and a pharmaceutically acceptable carrier, wherein the adjuvant comprises at least one synthetic oligoribonucleotide RIG-I agonist described herein. Examples of the oligoribonucleotides suitable for an adjuvant include sequences such as any one of SEQ ID NOs: 10-17. In particular embodiments, the synthetic oligoribonucleotide has a sequence set forth in SEQ ID NO: 10 (M5) or SEQ ID NO: 13 (M8).

[0023] Examples of the vaccine composition include a tumor antigen derived from tumors found in melanoma, skin cancer, prostate cancer, lung cancer, pancreatic cancer, or breast cancer. Further examples of the vaccine composition include a tumor antigen that is part of a tumor cell lysate. Yet another example of the vaccine composition includes a tumor antigen that is part of an inactivated cancer cell population. Further examples of the vaccine composition include a tumor antigen that is part of an antigen presenting cell (APC) population. In particular embodiments, the APC population includes dendritic cells.

[0024] In yet other examples of the vaccine composition, the adjuvant further includes mineral oil, bacterial toxins, aluminum salts, squalene, virosomes, mineral oil in water emulsions, CpG, lipopolysaccharide (LPS), monophosphoryl lipid A (MPLA), QS21 or AS02, flagellin, peptidoglycans, inactivated bacterial pathogens, and/or RNAse inhibitors. In further examples of the vaccine composition, the synthetic oligoribonucleotide is in a nanoparticle formulation. In particular embodiments, the tumor antigen and the adjuvant are formulated together. In particular embodiments, the tumor antigen and the adjuvant are not formulated together.

[0025] Another provided embodiment is a method for stimulating an immune response against a tumor antigen in a subject at risk of having or having a cancer including the tumor antigen, including administering to the subject a therapeutically effective amount of the vaccine composition. In further examples, these methods for stimulating an immune response against a tumor antigen further include administering at least one second anti-cancer agent. In particular embodiments, the second anti cancer agent is low dose chemotherapy. In particular embodiments, the second anti-cancer agent is an immune checkpoint inhibitor that blocks programmed cell death protein 1 (PD-1 ).

[0026] Another provided embodiment is a method of activating antigen presenting cells (APC) ex vivo including contacting the APC with the vaccine composition. In further examples, these methods of activating APC ex vivo further include administering the contacted APC to a subject at risk of having or having a cancer comprising the tumor antigen.

[0027] Another provided embodiment is an immunization kit including a vaccine composition described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0028] FIG. 1A-1 G. RIG-I agonist M8 induces cell death in cancer cells. FIG. 1 A. Viability of Mel1007 cells transfected with different doses of M8 (1 -500 ng/ml) for 48 hours assessed by 7-AAD exclusion by flow cytometry. FIG. 1 B. LDH based cytotoxicity was measured on supernatant of Mel1007 cells transfected with different doses of M8 (1 -500 ng/ml) for 48 hours, the % was calculated as the ratio of spontaneous-normalized LDH activity over normalized maximum control following manufactured instructions. FIG. 1 C. Viability of Mel1007 cells transfected with M8 or 5’ dephosphorylated M8 (CIAP-M8) (500 ng/ml) for 48 h assessed by 7-AAD exclusion by flow cytometry. FIG. 1 D. Viability of Mel1007 cells pretreated for 24 h with siRNA specific for RIG-I gene and then transfected with M8 (500 ng/ml) for 48 h. FIG. 1 E. Viability of Mel1007 cells transfected with the indicated RIG-I agonists (500 ng/ml), untreated, or transfected only with lipofectamine for 48 hours. FIG. 1 F. Viability of metastatic melanoma Me120, lung adenocarcinoma A549, colon carcinoma HCT 116, and prostate carcinoma PC3 transfected with 500 ng/ml of M8 for 48 hours. FIG. 1 G. Viability of PBMC transfected with different doses of M8 (1 -500 ng/ml) for 48 hours assessed by 7-AAD exclusion by flow cytometry. ^* P < 0.05; ^** P < 0.01 ; ^*** P < 0.001

[0029] FIG. 2A-2F. M8 activates intrinsic apoptosis driven by PUMA and NOXA. FIG. 2A (parts 1 and 2). Flow Cytometry evaluation of Annexin V/7-AAD positivity of Mel1007 cells transfected with M8 (500 ng/ml) assessed at 10, 16, 24, 32 and 48 h. FIG. 2B. Viability of Mel1007 cell transfected for 48 h with M8 and treated with pan-caspase inhibitor ZVAD-FMK (100 pM), caspase 1 inhibitor YVAD- FMK (50 pg/ml), and necroptosis inhibitor necrostatin 1 (100 pM). FIG. 2C. Western blot of Mel1007 cells transfected for 24 or 48 h with different doses of M8. FIG. 2D. Analysis of % of Mel1007 24 h after transfection showing monomeric JC-1 , an indicator of mitochondria depolarization. CCCP was used as a positive control and added 30’ before the analysis. FIG. 2E. Expression levels of NOXA gene in Mel1007 cells 24 h after transfection with the indicated doses of M8. FIG. 2F. Expression levels of PUMA gene in Mel1007 cells 24 h after transfection with the indicated doses of M8. ^* P < 0.05; ^** P < 0.01 ; ^*** P < 0.001

[0030] FIG. 3A-3C. M8 induced apoptosis relies on IFN-I signaling. FIG. 3A. Viability of Mel1007 cells transfected with M8 (500 ng/ml) and treated with IFNAR1 blocking Ab for 48h (1 pg/ml). FIG. 3B and FIG. 3C. Expression levels of NOXA and PUMA genes, respectively in Mel1007 cells 24 h after transfection with M8 500 ng/ml treated with IFNAR1 blocking Ab for 48h (1 pg/ml). Fold changes were calculated over untreated Mel1007 cells. ^** P < 0.01

[0031] FIG. 4A-4C. M8 induces immunogenic cell death in cancer cells. FIG. 4A and FIG. 4B. Expression levels of IFNp and CXCL10 gene, respectively, in Mel1007 cells 24 h after transfection with different doses of M8 (1 -500 ng/ml) and IFNAR1 blocking Ab (1 pg/ml) over control cells. FIG. 4C. Analysis by Magnetic Luminex assay from R&D systems (see Material and Methods for details) of the chemokines CCL2, CXCL1 , CXCL10, and IFNp on supernatants of Mel1007 cells stimulated for 24 hours with M8 (10, 100, and 500 ng/ml). Untransfected (Un) and lipofectamine RNAiMax transfected (lipo) Mel1007 were used as negative controls. ^* P < 0.05; ^** P < 0.01 ; ^*** P < 0.001

[0032] FIG. 5A-5E. Cancer cells exposed to M8 exhibit the hallmarks of ICD. FIG. 5A. Calreticulin expression levels as assessed by % of positive cells in Mel1007 30 h after transfection with M8 (500 ng/ml); mitoxantrone (1 pM) was used as positive control; FIG. 5B. Calreticulin expression levels as assessed by % of positive cells in HCT1 16 cells (left) and PC3 cells (right) 24 or 18 h, respectively, after transfection with M8 (500 ng/ml), mitoxantrone (1 pM) was used as positive control; FIG. 5C. HMGB1 levels assessed by ELISA on supernatants of Mel1007 cells transfected with M8 (500 ng/ml) for 48 h; mitoxantrone (1 pM) was used as positive control; FIG. 5D. HMGB1 levels assessed by ELISA on supernatants of HCT116 and PC3 cells transfected with M8 (500 ng/ml) for 48 h, mitoxantrone (1 pM) was used as positive control; FIG. 5E. ATP release by Mel1007 cells left untransfected (Ut) or transfected with either lipofectamine RNAiMAX alone (lipo) or in combination with 500 ng/ml M8 for 48h. ATP levels in culture supernatants were quantified by a luciferase-based test. ^* P < 0.05; ^** P < 0.01 .

[0033] FIG. 6A-6E. M8 triggering of RIG-I represses NK cell-mediated cancer cell killing and activates antigen processing machinery. FIG. 6A. Relative expression levels of NK activating ligands on Mel1007 transfected with M8 (10-100 ng/ml) for 48 h. FIG. 6B. Degranulation of NK from healthy donors co-cultured with Mel1007 cells transfected with M8 (10-100 ng/ml) for 48 h. FIG. 6C. Cytotoxicity assay of NKL cell line against Mel1007 cells transfected with M8 (10-100 ng/ml) for 48 h. Both in FIG. 6B and FIG. 6C, K562 were used as positive control of NK activation. FIG. 6D. MFI of HLA-ABC expression levels of Mel1007 transfected for 24 h with different doses of M8 (1 -500 ng/ml) and IFNAR1 blocking Ab (1 pg/ml) over control cells; FIG. 6E. Expression levels of the indicated APM genes in Mel1007 cells 24 h after transfection with different doses of M8 (1 -500 ng/ml) and IFNAR1 blocking Ab (1 pg/ml) over control cells. ^* P < 0.05; ^** P < 0.01 .

[0034] FIG. 7A-7E. M8 treatment in cancer cells induces phagocytosis and pro-inflammatory phenotype in DC. FIG. 7A and FIG. 7B. Mel1007 cells were stained with CTFR and then transfected with M8 (500 ng/ml). After 48 h, Mo-DC were added to the cell culture at a 1 :1 ratio. After 4 h phagocytosis of DC was analyzed by flow cytometry analyzing the % of DC (gated on CD209 expression) that incorporated CTFR. FIG. 7A. Representative plots of phagocytosis assay. FIG. 7B Percentage of DC phagocytosis as in FIG. 7A. FIGs. 7C-7E. Effects of supernatants of transfected Mel1007 cells on DC. Mel1007 were transfected for 48 h with different doses of M8 (1 -500 ng/ml), supernatants were then used to stimulate DC. FIG. 7C. Cell surface expression levels expressed as relative MFI of costimulatory markers CD80 and CD86 and HLA-DR in DC treated for 24 h with supernatants of Mel1007 transfected with different doses of M8. FIG. 7D and FIG. 7E. Expression levels of IL-12A, IL-10 and CXCL10 genes at in DC treated as in c). ^* P< 0.05; ^** P<0.01 ; ^*** P<0.001 .

[0035] FIG. 8 is a drawing of the secondary structure of WT (SEQ ID NO: 5), M5 (SEQ ID NO: 10), and M8 (SEQ ID NO: 13) 5'pppRNA oligonucleotides.

[0036] FIG. 9 is a schematic representation of 5'pppRNA sequences that include variations of the wild type (WT; SEQ ID NO: 5) VSV-derived 5’pppRNA (M1 -M8; SEQ ID NOs: 6-13).

[0037] FIG. 10 is a schematic representation of modifications to the M8 5'pppRNA (SEQ ID NO: 13). Sequence changes were made to the poly AU base-pair stretch (M8A, SEQ ID NO: 14; M8C, SEQ ID NO: 15), the WT-derived blunt-end (M8D, SEQ ID NO: 16), and the entire sequence (M8B, SEQ ID NO: 17) while keeping the structure intact.

SEQUENCE LISTING

[0038] The nucleic acid sequences described herein are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. §1 .822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included in embodiments where it would be appropriate.

[0039] A computer readable text file, entitled“l081 -0003PCT_ST25.txt” created on or about May 7, 2020, with a file size of ~16 KB, contains the sequence listing for this application and is hereby incorporated by reference in its entirety. [0040] Table 1 : Sequences in Sequence Listing

DETAILED DESCRIPTION

[0041] Disclosed herein are methods of treating cancer, using composition(s) that contain at least one synthetic RIG-I agonist oligoribonucleotide, synthesized with a triphosphate group at its 5' end. In various embodiments, the oligoribonucleotide includes: a first polynucleotide having the sequence shown in SEQ ID NO: 1 , a second polynucleotide having the sequence shown in SEQ ID NO: 2 and a third polynucleotide having the sequence shown in SEQ ID NO: 3 with SEQ ID NO: 3 located between SEQ ID NO: 1 and SEQ ID NO: 2. SEQ ID NO: 1 can be 5' of SEQ ID NO: 2 or SEQ ID NO: 1 can be 3' of SEQ ID NO: 2. The oligoribonucleotides can comprise any additional sequence.

[0042] In examples where SEQ ID NO: 1 is 5' of SEQ ID NO: 2, the RIG-I agonist oligoribonucleotides include the structure:

GACGAAGACCACAAAACCAGAU(A)nUAA(U)nAUCUGGUUUUGUGGUCUUCGUC (SEQ ID NO: 49) or GACGAAGACCACAAAACCAGAU(U)nUAA(A)nAUCUGGUUUUGUGGUCUUCGUC (SEQ ID NO: 50); wherein n is any integer greater than 1. This structure indicates that the nucleotide in parentheses is repeated the number of times equal to n. For example, n can equal 2, 3, 6, 1 1 , 16, 26, or more than 26 repeats of the nucleotide indicated in parentheses.

[0043] The oligoribonucleotides can also include the structure:

GACGAAGACCACAAAACCAGAU(AAU)xU(AUU)yAUCUGGUUUUGUGGUCUUCGUC (SEQ ID NO: 51 ) or

GACGAAGACCACAAAACCAGAU(AUU)xU(AAU)yAUCUGGUUUUGUGGUCUUCGUC (SEQ ID NO: 52); wherein x and y are any integer greater than 2. In this embodiment, the tripeptide in parentheses is repeated a number of times equal to x or y. In this example, x and y can be different numbers. For example, x can equal 10 while y can equal 8.

[0044] In examples where SEQ ID NO: 1 is 3' of SEQ ID NO: 2, the oligoribonucleotides can have the structure:

AUCUGGUUUUGUGGUCUUCGUC(A)nUAA(U)nGACGAAGACCACAAAACCAGAU (SEQ ID NO:

53); or

AUCUGGUUUUGUGGUCUUCGUC(U)nUAA(A)nGACGAAGACCACAAAACCAGAU (SEQ ID NO:

54), wherein n is an integer greater than 1 .

[0045] Alternatively, the therapeutic synthetic oligoribonucleotide can be an oligoribonucleotide of at least 59 nucleotides in length that can form a hairpin structure comprising at least 29 base pairs, the synthetic oligonucleotide further comprising a triphosphate group at the 5' end of the oligoribonucleotide. In examples of these aspects, the oligoribonucleotides are at least 99 nucleotides in length that can form a hairpin structure comprising at least 49 base pairs. [0046] Synthetic Oligonucleotide RIG-1 Agonists

[0047] The synthetic oligoribonucleotides described herein can be expressed from a DNA plasmid. Such a DNA plasmid comprises the DNA sequence that encodes the described oligoribonucleotides. The oligoribonucleotides can be transcribed as an RNA molecule that automatically folds into duplexes with hairpin loops. Typically, a transcriptional unit or cassette will contain an RNA transcript promoter sequence, such as a T7 promoter operably linked to the sequence encoding the oligoribonucleotide.

[0048] The synthetic oligoribonucleotides described herein comprise a 5'-triphosphate group. These may collectively be referred to as 5'pppRNA or individually as 5'ppp-SEQ ID NO: XX herein. Alternatively, individual compounds may be referred to herein by names such as WT, M5, or M8 as indicated in the Sequence Listing (including, for instance, SEQ ID NOs: 5-17). See also FIGs. 7, 8, and 9, as well as U.S. Patent Publication No. 2017-0268007 and U.S. Patent No. 10,167,476.

[0049] Methods of isolating RNA, synthesizing RNA, hybridizing nucleic acids, making and screening cDNA libraries, and performing PCR are well known in the art (see, e.g., Gubler & Hoffman, Gene 25:263-269, 1983; Sambrook & Russell, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor NY, 2001 ) as are PCR methods (see, U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications, Innis et ai, Eds, 1990). Expression libraries are also well known to those of skill in the art. Additional basic texts disclosing the general methods of use in this invention include Sambrook and Russell (2001 ) supra ; Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); and Current Protocols in Molecular Biology (Ausubel et ai, eds., 1994).

[0050] An oligoribonucleotide can also be chemically synthesized. Synthesis of the single- stranded nucleic acid makes use of common nucleic acid protecting and coupling groups, such as dimethoxytrityl at the 5'-end and phosphoramidites at the 3'-end. As a non-limiting example, small scale syntheses can be conducted on an Applied Biosystems synthesizer using a 0.2 micromolar scale protocol with a 2.5 min coupling step for 2'-0-methylated nucleotides. Alternatively, syntheses at the 0.2 micromolar scale can be performed on a 96-well plate synthesizer from Protogene. However, a larger or smaller scale of synthesis is encompassed by the invention, including any method of synthesis now known or yet to be disclosed. Suitable reagents for synthesis of the single-stranded oligonucleotides, methods of RNA deprotection, methods of RNA purification, and methods of adding phosphate groups to an oligoribonucleotide are known to those of skill in the art.

[0051] An oligoribonucleotide can be synthesized via a tandem synthesis technique, wherein both strands are synthesized as a single continuous fragment or strand separated by a linker that is subsequently cleaved to provide separate fragments or strands that hybridize to form an RNA duplex. The linker can be any linker, including a polynucleotide linker or a non-nucleotide linker. The linker can comprise any sequence of one or more ribonucleotides. The tandem synthesis of RNA can be readily adapted to both multiwell/multiplate synthesis platforms as well as large scale synthesis platforms employing batch reactors, synthesis columns, and the like.

[0052] Alternatively, the oligoribonucleotide can be assembled from two distinct single-stranded molecules, wherein one strand includes the sense strand and the other includes the antisense strand of the RNA. For example, each strand can be synthesized separately and joined together by hybridization or ligation following synthesis and/or deprotection. Either the sense or the antisense strand can contain additional nucleotides that are not complementary to one another and do not form a double stranded RNA molecule. In certain other instances, the oligoribonucleotide can be synthesized as a single continuous fragment, where the self- complementary sense and antisense regions hybridize to form an RNA duplex having a hairpin or panhandle secondary structure.

[0053] An oligoribonucleotide can comprise a duplex having two complementary strands that form a double-stranded region with least one modified nucleotide in the double-stranded region. The modified nucleotide may be on one strand or both. If the modified nucleotide is present on both strands, it may be in the same or different positions on each strand. Examples of modified nucleotides suitable for use in the present invention include, but are not limited to, ribonucleotides having a 2'-0-methyl (2'OMe), 2'-deoxy-2'-fluoro (2'F), 2'-deoxy, 5-C-methyl, 2'-0-(2-methoxyethyl) (MOE), 4'-thio, 2'-amino, or 2'-C-allyl group. Modified nucleotides having a conformation such as those described in, for example in Sanger ( Principles of Nucleic Acid Structure, Springer-Verlag Ed., 1984), are also suitable for use in oligoribonucleotides. Other modified nucleotides include, without limitation: locked nucleic acid (LNA) nucleotides, G-clamp nucleotides, or nucleotide base analogs. LNA nucleotides include but need not be limited to 2'-0, 4'-C-methylene-(D-ribofuranosyl)nucleotides), 2'-0-(2-methoxyethyl) (MOE) nucleotides, 2'-methyl-thio-ethyl nucleotides, 2'-deoxy-2'-fluoro (2'F) nucleotides, 2'-deoxy-2'- chloro (20) nucleotides, and 2'-azido nucleotides. A G-clamp nucleotide refers to a modified cytosine analog wherein the modifications confer the ability to hydrogen bond both Watson-Crick and Hoogsteen faces of a complementary guanine nucleotide within a duplex (Lin et ai, J Am Chem Soc, 120:8531 -8532, 1998). Nucleotide base analogs include for example, C-phenyl, C- naphthyl, other aromatic derivatives, inosine, azole carboxamides, and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole, and 6-nitroindole (Loakes, Nucl Acids Res, 29:2437-2447, 2001 ).

[0054] An oligoribonucleotide can comprise one or more chemical modifications such as terminal cap moieties, phosphate backbone modifications, and the like. Examples of classes of terminal cap moieties include, without limitation, inverted deoxy abasic residues, glyceryl modifications, 4', 5'- methylene nucleotides, l -(P-D-erythrofuranosyl) nucleotides, 4'-thio nucleotides, carbocyclic nucleotides, 1 ,5-anhydrohexitol nucleotides, L-nucleotides, a- nucleotides, modified base nucleotides, threo pentofuranosyl nucleotides, acyclic 3',4'-seco nucleotides, acyclic 3,4-dihydroxybutyl nucleotides, acyclic 3,5-dihydroxypentyl nucleotides, 3'- 3'-inverted nucleotide moieties, 3'-3'-inverted abasic moieties, 3'-2'-inverted nucleotide moieties, 3'-2'-inverted abasic moieties, 5'-5'-inverted nucleotide moieties, 5'-5'-inverted abasic moieties, 3'-5'-inverted deoxy abasic moieties, S'-amino-alkyl phosphate, 1 ,3-diamino-2-propyl phosphate, 3 aminopropyl phosphate, 6-aminohexyl phosphate, 1 ,2- aminododecyl phosphate, hydroxypropyl phosphate, 1 ,4-butanediol phosphate, 3'-phosphoramidate, 5' phosphoramidate, hexylphosphate, aminohexyl phosphate, 3'-phosphate, 5'-amino, 3'- phosphorothioate, 5'-phosphorothioate, phosphorodithioate, and bridging or non-bridging methylphosphonate or 5'-mercapto moieties (see, e.g., U.S. Pat. No. 5,998,203; Beaucage et al., Tetrahedron 49:1925, 1993). Non-limiting examples of phosphate backbone modifications (i.e., resulting in modified internucleotide linkages) include phosphorothioate, phosphorodithioate, methylphosphonate, phosphotriester, morpholino, amidate, carbamate, carboxymethyl, acetamidate, polyamide, sulfonate, sulfonamide, sulfamate, formacetal, thioformacetal, and alkylsilyl substitutions (see, e.g., Hunziker et at., Modern Synthetic Methods, VCH, 331 -417, 1995; Mesmaeker et al., Antisense Research, ACS, 24-39, 1994). Such chemical modifications can occur at the 5'-end and/or 3'-end of the sense strand, antisense strand, or both strands of the oligoribonucleotide.

[0055] The sense and/or antisense strand of an oligoribonucleotide may comprise a 3'-terminal overhang having 1 to 4 or more 2'-deoxyribonucleotides and/or any combination of modified and unmodified nucleotides. Additional examples of modified nucleotides and types of chemical modifications that can be introduced into the modified oligoribonucleotides of the present invention are described, e.g., in Patent No. GB 2,397,818 B and U.S. Patent Publications No. 2004/0192626 and 2005/0282188.

[0056] An oligoribonucleotide may comprise one or more non-nucleotides in one or both strands of the siRNA. A non-nucleotide can be any subunit, functional group, or other molecular entity capable of being incorporated into a nucleic acid chain in the place of one or more nucleotide units that is not or does not comprise a commonly recognized nucleotide base such as adenosine, guanine, cytosine, uracil, or thymine, such as a sugar or phosphate.

[0057] Chemical modification of the disclosed oligoribonucleotides may also comprise attaching a conjugate to the oligoribonucleotide molecule. The conjugate can be attached at the 5'- and/or the 3'- end of the sense and/or the antisense strand of the oligoribonucleotide via a covalent attachment such as a nucleic acid or non-nucleic acid linker. The conjugate can also be attached to the oligoribonucleotide through a carbamate group or other linking group (see, e.g., U.S. Patent Publications No. 2005/0074771 , 2005/0043219, and 2005/0158727). A conjugate may be added to the oligoribonucleotide for any of a number of purposes. For example, the conjugate may be a molecular entity that facilitates the delivery of the oligoribonucleotide into a cell or the conjugate a molecule that comprises a drug or label.

[0058] Examples of conjugate molecules suitable for attachment to the disclosed oligoribonucleotides include, without limitation, steroids such as cholesterol, glycols such as polyethylene glycol (PEG), human serum albumin (FISA), fatty acids, carotenoids, terpenes, bile acids, folates (e.g., folic acid, folate analogs and derivatives thereof), sugars {e.g., galactose, galactosamine, N-acetyl galactosamine, glucose, mannose, fructose, fucose, etc.), phospholipids, peptides, ligands for cellular receptors capable of mediating cellular uptake, and combinations thereof (see, e.g., U.S. Patent Publications No. 2003/0130186, 2004/01 10296, and 2004/0249178; U.S. Pat. No. 6,753,423). Other examples include the lipophilic moiety, vitamin, polymer, peptide, protein, nucleic acid, small molecule, oligosaccharide, carbohydrate cluster, intercalator, minor groove binder, cleaving agent, and cross- linking agent conjugate molecules described in U.S. Patent Publication Nos. 200501 19470 and 20050107325. Other examples include the 2'-0-alkyl amine, 2'-0-alkoxyalkyl amine, polyamine, C5- cationic modified pyrimidine, cationic peptide, guanidinium group, amidininium group, cationic amino acid conjugate molecules described in U.S. Patent Publication No. 2005/0153337. Additional examples of conjugate molecules include a hydrophobic group, a membrane active compound, a cell penetrating compound, a cell targeting signal, an interaction modifier, or a steric stabilizer as described in U.S. Patent Publication No. 2004/0167090. Further examples include the conjugate molecules described in U.S. Patent Publication No. 2005/0239739.

[0059] The type of conjugate used and the extent of conjugation to the disclosed oligoribonucleotides can be evaluated for improved pharmacokinetic profiles, bioavailability, and/or stability of the oligoribonucleotide while retaining activity. As such, one skilled in the art can screen oligoribonucleotides having various conjugates attached thereto to identify oligonucleotide conjugates having improved properties using any of a variety of well-known in vitro cell culture or in vivo animal models.

[0060] Pharmaceutical Compositions

[0061] The therapeutic compounds provided herein can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient in a variety of forms adapted to the chosen route of administration, i.e., orally or parenterally, by intravenous, intramuscular, topical or subcutaneous routes.

[0062] The therapeutic compounds provided herein can be formulated as an adjuvant in a cancer vaccine composition. A cancer vaccine is a biological preparation that improves immunity to a particular cancerous disease. Vaccine compositions can affect the course of a cancerous disease by causing an effect on cells of the adaptive immune response, namely, B cells and/or T cells. The effect of vaccines can include, for example, induction of cell-mediated immunity or alteration of the response of a T cell to its antigen. A vaccine typically contains an agent (e.g., immunogen) that stimulates the body's immune system to recognize the agent as foreign, destroy it, and“remember” it, so that the immune system can more easily recognize and destroy the agent at subsequent encounters. A successful immune response is characterized by, e.g., eradication of pathogens, tissue repair, eradication of tumors, and/or short and long term immune memory. The agent can include molecules derived from a cancerous disease-causing pathogen or can be inactivated cancer cells, tumor cell lysates, or tumor-specific antigens. Vaccines can be prophylactic or therapeutic.

[0063] A tumor (i.e. cancer) antigen is presented on the surface of cancer cells and may be specific, associated, or over-expressed on such cancer cells. Tumor antigens can be obtained by conventional techniques, such as by preparation of tumor cell lysates by repeatedly freezing and thawing tumor cells/tissues obtained from either fresh tumor biopsy tissues or from tumor cells generated in vitro by tissue culture. The tumor lysate can be obtained by centrifugation and harvesting the supernatant fluid. The tumor cell lysates can be used immediately or frozen and stored until ready for use. The tumor antigen can be used in a purified form or in partially purified or unpurified form as cell lysate. Alternatively, the tumor antigen may be expressed by recombinant DNA techniques in any of a wide variety of expression systems. In particular embodiments, a tumor antigen is derived from tumors found in melanoma, skin cancer, prostate cancer, lung cancer, pancreatic cancer, or breast cancer. In particular embodiments, a tumor antigen includes a tumor cell lysate. In particular embodiments, the tumor antigen is included in a population of cells including antigen presenting cells (APC). APC include cells that express MHC Class I and/or Class II molecules that present antigens to T cells. Examples of APCs include, e.g., professional or non-professional antigen processing and presenting cells. Examples of APC include dendritic cells, B cells, spleen cells, lymph node cells, bone-marrow derived cells, monocytes, macrophages, or non-fractionated peripheral blood mononuclear cells (PMBC). Examples of hematopoietic APC include dendritic cells, B cells, and macrophages.

[0064] A vaccine often contains, or is administered with, an adjuvant. A vaccine adjuvant is an agent that stimulates the immune system and increases the immune system's response to a vaccine. In particular embodiments, RIG-1 agonists of the disclosure can increase immunogenicity of a vaccine for an infectious disease or cancer. In particular embodiments, RIG-1 agonists can activate interferon- Y (IFN-g) producing type 1 T helper cells (Th1 ) and cytotoxic T lymphocytes (CTLs). In particular embodiments, the vaccine is a cancer vaccine. The cancer vaccine can include a tumor antigen against which an immune response is desired and a RIG-I agonist of the present disclosure. In particular embodiments, the tumor antigen and the adjuvant are formulated together. In particular embodiments, the tumor antigen and the adjuvant are not formulated together.

[0065] A RIG-I agonist functioning as an adjuvant may be formulated with buffers, carriers, preservatives, and/or excipients as described below. A RIG-I agonist may also be delivered with other PAMPs such as CpG, lipopolysaccharide (LPS), flagellin, or monophosphoryl lipid A (MPLA).

[0066] An adjuvant including a RIG-I agonist can also include a pharmaceutically acceptable excipient, and optionally other adjuvant ingredients. For example, the adjuvant may include mineral oil, certain bacterial toxins, aluminum salts such as aluminum hydroxide and aluminum phosphate, squalene, virosomes, mineral oil in water emulsions (e.g., MF59, AS3, and montanide), CpG, LPS, MPLA, QS21 or AS02, flagellin, peptidoglycans, and/or whole killed or otherwise inactivated bacterial pathogens. An adjuvant may also include agents that help stabilize the antigen and/or the RNA component, e.g., RNAse inhibitors.

[0067] An oligoribonucleotide may be incorporated into a composition including a pharmaceutically acceptable carrier or transfection reagent, including the oligoribonucleotides described herein. The carrier system may be a lipid-based carrier system such as a stabilized nucleic acid-lipid particle (e.g., SNALP or SPLP), cationic lipid or liposome nucleic acid complexes (i.e., lipoplexes), a liposome, a micelle, a virosome, or a mixture thereof. In other embodiments, the carrier system is a polymer-based carrier system such as a cationic polymer-nucleic acid complex (i.e., polyplex). In additional embodiments, the carrier system is a cyclodextrin-based carrier system such as a cyclodextrin polymer-nucleic acid complex (see US Patent Publication 2007/0218122). In further embodiments, the carrier system is a protein-based carrier system such as a cationic peptide-nucleic acid complex. An oligoribonucleotide molecule may also be delivered as naked RNA.

[0068] A pharmaceutical composition can be any combination of active and/or inert materials that can be administered to a subject for the purpose of treating a disease. A pharmaceutically acceptable carrier/vehicle can be any material or molecular entity that facilitates the administration or other delivery of the pharmaceutical composition. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.

[0069] Exemplary generally used pharmaceutically acceptable carriers include any and all bulking agents or fillers, solvents or co-solvents, dispersion media, coatings, surfactants, antioxidants (e.g., ascorbic acid, methionine, vitamin E), preservatives, isotonic agents, absorption delaying agents, salts, stabilizers, buffering agents, gels, binders, disintegration agents, and/or lubricants.

[0070] Exemplary buffering agents include citrate buffers, succinate buffers, tartrate buffers, fumarate buffers, gluconate buffers, oxalate buffers, lactate buffers, acetate buffers, phosphate buffers, histidine buffers and trimethylamine salts.

[0071] Exemplary preservatives include phenol, benzyl alcohol, meta-cresol, methyl paraben, propyl paraben, octadecyldimethylbenzyl ammonium chloride, benzalkonium halides, hexamethonium chloride, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol and 3- pentanol.

[0072] Exemplary isotonic agents include polyhydric sugar alcohols including trihydric or higher sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol.

[0073] Exemplary stabilizers include organic sugars, polyhydric sugar alcohols, polyethylene glycol; sulfur-containing reducing agents, amino acids, low molecular weight polypeptides, proteins, immunoglobulins, hydrophilic polymers and polysaccharides. [0074] For injection, compositions can be made as aqueous solutions, such as in buffers such as Flanks' solution, Ringer's solution, or physiological saline. The solutions can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the composition can be in lyophilized and/or powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

[0075] In particular embodiments, compositions can include liposomes. Liposomes are self assembling phospholipid bilayer structures that can be prepared from natural or synthetic phospholipid sources. These vesicles can encapsulate water soluble molecules in the aqueous volume while water insoluble molecules can be embedded in the hydrophobic region of the lipid bilayer. The simplest and the most widely used method for preparing liposomes is the thin lipid film hydration method introduced by Bangham et at. (J Mol Biol, 13:238, 1965). The constituents of a liposomal delivery system are the primary determinants of the preparation method to be employed. For instance, hydrophobic molecules can be included during the lipid film formation process (passive loading), whereas water soluble molecules can be introduced during the hydration step (passive loading) or incorporated later by active loading procedures using ion gradients. The phospholipid backbone of the liposomes includes saturated or unsaturated phospholipids with acyl chain length of 14 to 20 carbons. Surface modification by hydrophilic polymers is a commonly used method in liposomal delivery systems. The main goals of surface modification are prevention of particle aggregation and reduction of the capture of the liposomes by cells of the reticuloendothelial system. Due to their low degree of immunogenicity and antigenicity, polyethylene ethylene glycol (PEG) molecules of various chain lengths can be used to provide a protective shield over the phospholipid bilayer. PEG is a linear polyether diol that has a chemically inert backbone and hydroxyl groups available for derivatization. There are commercially available PEG derivatives that are covalently bound to phospholipids, functional groups, proteins, and even fluorescent probes. In certain embodiments, the liposomes contain at least one metal ion donor, such as MnC and/or MgC ; for instance, specific liposome embodiments contain 1 mM MnC and/or 10 mM MgCh.

[0076] The therapeutic compounds described herein may be systemically administered, e.g., orally, in combination with a pharmaceutically acceptable vehicle such as an inert diluent or an assimilable, edible carrier. They may be enclosed in hard or soft shell gelatin capsules, may be compressed into tablets, or may be incorporated directly with the food of the patient's diet. For oral therapeutic administration, the active compound may be combined with one or more excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 60% of the weight of a given unit dosage form. The amount of active compound in such therapeutically useful compositions is such that an effective dosage level will be obtained.

[0077] The tablets, troches, pills, capsules, and the like may also contain the following: binders such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid and the like; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, fructose, lactose or aspartame or a flavoring agent such as peppermint, oil of wintergreen, or cherry flavoring may be added. When the unit dosage form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac or sugar and the like. A syrup or elixir may contain the active compound, sucrose or fructose as a sweetening agent, methyl and propylparabens as preservatives, a dye and flavoring such as cherry or orange flavor. Of course, any material used in preparing any unit dosage form should be pharmaceutically acceptable and substantially non-toxic in the amounts employed. In addition, the active compound may be incorporated into sustained-release preparations and devices.

[0078] The active compound may also be administered intravenously or intraperitoneally by infusion or injection. Solutions of the active compound or its salts can be prepared in water, optionally mixed with a nontoxic surfactant. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, triacetin, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0079] The pharmaceutical dosage forms suitable for injection or infusion can include sterile aqueous solutions or dispersions or sterile powders comprising the active ingredient which are adapted for the extemporaneous preparation of sterile injectable or infusible solutions or dispersions, optionally encapsulated in liposomes. In all cases, the ultimate dosage form should be sterile, fluid and stable under the conditions of manufacture and storage. The liquid carrier or vehicle can be a solvent or liquid dispersion medium comprising, for example, water, ethanol, a polyol (for example, glycerol, propylene glycol, liquid polyethylene glycols, and the like), vegetable oils, nontoxic glyceryl esters, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the formation of liposomes, by the maintenance of the required particle size in the case of dispersions or by the use of surfactants. The prevention of the action of (contaminating) microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, buffers or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin. [0080] Sterile injectable solutions are prepared by incorporating the active compound in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filter sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and the freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired ingredient present in the previously sterile-filtered solutions.

[0081] For topical administration, the present compounds may be applied in pure form, i.e., when they are liquids. However, it will generally be desirable to administer them to the skin as compositions or formulations, in combination with a dermatologically acceptable carrier, which may be a solid or a liquid.

[0082] Useful solid carriers include finely divided solids such as talc, clay, microcrystalline cellulose, silica, alumina and the like. Useful liquid carriers include water, alcohols or glycols or water- alcohol/glycol blends, in which the present compounds can be dissolved or dispersed at effective levels, optionally with the aid of non-toxic surfactants. Adjuvants such as fragrances and additional antimicrobial agents can be added to optimize the properties for a given use. The resultant liquid compositions can be applied from absorbent pads, used to impregnate bandages and other dressings, or sprayed onto the affected area using pump-type or aerosol sprayers.

[0083] Thickeners such as synthetic polymers, fatty acids, fatty acid salts and esters, fatty alcohols, modified celluloses or modified mineral materials can also be employed with liquid carriers to form spreadable pastes, gels, ointments, soaps, and the like, for application directly to the skin of the user.

[0084] In particular embodiments, for topical administration, the formulation can further include a penetration enhancer. The penetration enhancer can be a skin penetration enhancer. A skin penetration enhancer is a molecule that promotes the diffusion of polypeptides through the skin. A variety of compounds have been shown to be effective skin penetration enhancers. See, Percutaneous Penetration Enhancers (Smith et al., CRC Press, Inc., Boca Raton, F.L. 1995). Exemplary skin penetration enhancers include sulfoxides such as dimethylsulfoxide (DMSO) and decylmethylsulfoxide (CioMSO; DeMS); ethers such as diethylene glycol monoethyl ether and diethylene glycol monomethyl ether; surfactants such as sodium laurate, sodium lauryl sulfate, cetyltrimethylammonium bromide, benzalkonium chloride, Poloxamer (231 , 182, 184), Tween (20, 40, 60, 80), and lecithin; the 1 - substituted azacycloheptan-2-ones, particularly l-n-dodecylcyclazacycloheptan-2-one; alcohols such as ethanol, propanol, octanol, benzyl alcohol, etc.; fatty acids such as lauric acid, oleic acid and valeric acid; fatty acid esters such as isopropyl myristate, isopropyl palmitate, methylpropionate, and ethyl oleate; polyols and esters thereof such as propylene glycol, ethylene glycol, glycerol, butanediol, polyethylene glycol, and polyethylene glycol monolaurate; amides and other nitrogenous compounds such as urea, dimethylacetamide (DMA), dimethylformamide (DMF), 2-pyrrolidone, l-methyl-2- pyrrolidone, ethanolamine, diethanolamine and triethanolamine; terpenes; alkanones; organic acids, particularly salicylic acid and salicylates, citric acid, and succinic acid; polyacrylic acids such as a carbomer (CARBOPOL™, B. F. Goodrich Company) and copolymers of C10 to C30 alkyl acrylates and one or more monomers of acrylic acid, methacrylic acid or one of their simple esters crosslinked with an allyl ether of sucrose or an allyl ether of pentaerythritol (PERMULEN™, B.F. Goodrich Company); galactomannan gums such as guar gum or locust bean gum; polysaccharide gum such as agar gum, alginate, carob gum, carrageen gum, ghatti gum, guar gum, karaya gum, kadaya gum, locust bean gum, rhamsan gum, xanthan gum, or a mixture thereof; and cellulose derivatives such as ethyl cellulose, methyl cellulose, hyrdoxypropyl cellulose, and mixtures thereof.

[0085] In particular embodiments, the compositions can be in the form of, e.g., gels, ointments, pastes, lotions, creams, sprays, foams, liquids, aerosol, suspension, emulsion, hydrogels, or powders. It is particularly contemplated that the compositions may be formulated as shampoos, soaps, body washes, and the like. A gel is a substantially dilute cross-linked system, which exhibits no flow when in the steady-state. Most gels are liquid; however, they behave more like solids due to the three- dimensional cross-linked network within the liquid. Gels can have properties ranging from soft and weak to hard and tough. An ointment is a homogeneous, viscous, semi-solid preparation, most commonly a greasy, thick oil (oil 80% - water 20%) with a high viscosity. Ointments have a water number, which is the maximum quantity of water that 100 g of a base can contain at 20°C. A paste includes three agents - oil, water, and powder, one of which includes a therapeutic agent. Pastes can be an ointment in which a powder is suspended. A lotion also includes oil, water, and powder, but can have additional components (e.g., alcohol to hold the emulsion together) and often has a lower viscosity than a paste. A cream is an emulsion of oil and water in equal proportions. Creams are thicker than lotions and maintain their shape when removed from a container.

[0086] Topical formulations disclosed herein can include components, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc, titanium oxide, and zinc oxide, or mixtures thereof. In particular embodiments, topical formulations may include thickening agents, surfactants, organic solvents, and/or tonicity modifiers. Optionally, in certain embodiments the topical formulations include one or more of retinol, tretinoin, vitamin A, vitamin C, hydroquinones, alpha hydroxy acids (AHAs), and/or beta hydroxy acids (BHAs).

[0087] Examples of useful dermatological compositions which can be used to deliver the therapeutic compounds provided herein to the skin are known to the art; for example, see Jacquet et al. (U.S. Pat. No. 4,608,392), Geria (U.S. Pat. No. 4,992,478), Smith et al. (U.S. Pat. No. 4,559,157) and Wortzman (U.S. Pat. No. 4,820,508).

[0088] In particular embodiments, the compositions may be in the form of emulsions. An emulsion is a dispersed system containing at least two immiscible liquid phases, one of which is dispersed in the form of small droplets throughout the other, and an emulsifying agent in order to improve the stability of the system. There are two types of emulsions depending on the droplet size of the liquids present in the emulsions: macroemulsions and microemulsions. Light does not pass through macroemulsions because the droplets have average diameters of 10 to 1000 pm. These emulsions typically appear milky white. Microemulsions are stable systems having droplets which are significantly smaller, being 500 nm or smaller in diameter on the average. As such, microemulsions are translucent, and routinely transparent, in appearance. Microemulsions are an extraordinary type of emulsion that form spontaneously. Products having these systems are valued for their stability and small particle size, thus affording microemulsions a special consideration in the marketplace.

[0089] Compositions can also be depot preparations. Such long acting compositions may be administered by, for example, implantation (for example, subcutaneously). Thus, for example, compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as sparingly soluble salts. Optionally, such preparations may include one or more injectable fillers.

[0090] Additionally, compositions can be delivered using sustained-release systems, such as semipermeable matrices of solid polymers containing at least one compound disclosed herein. Various sustained-release materials have been established and are well known by those of ordinary skill in the art. Sustained-release capsules may, depending on their chemical nature, release the compound following administration for a few weeks up to over 100 days.

[0091] Useful dosages of the therapeutic compounds provided herein can be determined by comparing their in vitro activity, and in vivo activity in animal models. Methods for the extrapolation of effective dosages in mice, and other animals, to humans are known to the art; for example, see U.S. Pat. No. 4,938,949.

[0092] The amount of the compound useful or required for use in treatment will vary not only with the particular compound selected but also with the route of administration, the nature of the condition being treated and the age and condition of the patient and will be ultimately at the discretion of the attendant physician or clinician.

[0093] The desired dose may conveniently be presented in a single dose or as divided doses administered at appropriate intervals, for example, as two, three, four or more sub-doses per day. The sub-dose itself may be further divided, e.g., into a number of discrete loosely spaced administrations.

[0094] Methods of Use:

[0095] Methods disclosed herein include treating subjects (humans, veterinary animals (dogs, cats, reptiles, birds, etc.) livestock (horses, cattle, goats, pigs, chickens, etc.) and research animals (monkeys, rats, mice, fish, etc.) with one or more therapeutic compositions disclosed herein. Treating subjects includes delivering one or more therapeutically effective amount(s). Therapeutically effective amounts include those that provide effective amounts, prophylactic treatments and/or therapeutic treatments.

[0096] Further types of subjects to which the pharmaceutical composition may be properly administered include subjects known to have cancer or any neoplastic disease (identified through, for example, a molecular diagnostic test or clinical diagnosis), subjects having a predisposition to developing cancer, or subjects displaying one or more symptoms of cancer.

[0097] Cancer (neoplasia) is characterized by deregulated cell growth and cell division. There are numerous types of cancers. Examples of cancers include acoustic neuroma, adenocarcinoma, astrocytoma, basal cell cancer, bile duct cancer, bladder cancer, brain cancer, breast cancer, bronchogenic cancer, central nervous system cancer, cervical cancer, colon cancer, lung cancer, prostate cancer, ovarian cancer, pancreatic cancer, thyroid cancer, and leukemia. Examples of cancers include acoustic neuroma, adenocarcinoma, astrocytoma, basal cell cancer, bile duct cancer, bladder cancer, brain cancer, breast cancer, bronchogenic cancer, central nervous system cancer, cervical cancer, chondrosarcoma, choriocarcinoma, chronic lymphocytic leukemia, colon cancer, craniopharyngioma, ependymoma, Ewing's tumor, fibrosarcoma, glandular cancer, glioma, hairy cell leukemia, hemangioblastoma, hepatocellular carcinoma, hepatoma, kidney cancer, leiomyosarcoma, liver cancer, liposarcoma, lung cancer, melanoma, medulloblastoma, medullary cancer, medullary thyroid cancer, menangioma, mesothelioma, multiple myeloma (MM), myxosarcoma, neuroblastoma, non-Flodgkin's lymphoma, oligodendroglioma, osteogenic sarcoma, ovarian cancer, papillary adenocarcinomas, papillary thyroid cancer, pancreatic cancer, pheochromocytomas papillary cancer, pineal cancer, prolymphocytic leukemia, prostate cancer (including castration-resistant prostate cancer), renal cell cancer, retinoblastoma, rhabdomyosarcoma, sarcoma, sebaceous gland cancer, seminoma, skin cancer, squamous cell cancer, sweat gland cancer, synovioma, testicular cancer, and/or Wilms' tumor.

[0098] In some embodiments, it is believed that certain types of cancers may be less susceptible to the therapeutic treatments described herein. For instance, because RIG-1 agonist mediated cancer cell death is mediated in part by IFN release, cells that have a poor IFN response may be more resistant to cell death induction. However, the other (IFN-independent) mechanisms described herein would nevertheless become activated to kill these cells. Alternatively, some tumor cells may be resistant to uptake of the therapeutic RNA oligonucleotide (e.g., M8), such that the amount delivered to the cells might be limited, which would then limit cell death. This issue can be corrected by delivering the therapeutic RIG-1 agonist RNA as a formulation, such as a nanoparticle that 'protects' the RNA. Similarly, tumor cells that are rich in RNAase activity could destroy the therapeutic RNA oligonucleotide before it has an opportunity to bind RIG-1 and activate the cell death cascade.

[0099] Cancer (sometimes referred to medically as malignant neoplasm) refers to a class of diseases in which a group of cells display uncontrolled growth (division beyond the normal limits), invasion (intrusion on and destruction of adjacent tissues), and sometimes metastasis.“Metastasis” refers to the spread of cancer cells from their original site of proliferation to another part of the body. For solid tumors, the formation of metastasis is a very complex process and depends on detachment of malignant cells from the primary tumor, invasion of the extracellular matrix, penetration of the endothelial basement membranes to enter the body cavity and vessels, and then, after being transported by the blood or lymph, infiltration of target organs. Finally, the growth of a new tumor, i.e. a secondary tumor or metastatic tumor, at the target site depends on angiogenesis. Tumor metastasis often occurs even after the removal of the primary tumor because tumor cells or components may remain and develop metastatic potential.

[0100] Treating subjects includes delivering therapeutically effective amounts. Therapeutically effective amounts include those that provide effective amounts, prophylactic treatments and/or therapeutic treatments.

[0101] An“effective amount” is the amount of active agent(s) or composition(s) necessary to result in a desired physiological change in vivoor in vitro. Effective amounts are often administered for research purposes. In particular embodiments, effective amounts disclosed herein can cause a statistically- significant effect in an animal model or in vitro assay relevant to the assessment of: number of cancer cells; number of tumors, size of tumors and/or total tumor burden; level or speed of metastasis; frequency of or time to onset of cancer; and risk of death (hazard ratios) and/or increase in survival in subjects exposed to a cancer-causing agent.

[0102] A“prophylactic treatment” includes a treatment administered to a subject who does not display signs or symptoms of cancer, cancer relapse, or metastasis or displays only early signs or symptoms of cancer, cancer relapse, or metastasis such that treatment is administered for the purpose of diminishing, preventing, or decreasing the risk of developing cancer relapse or metastasis further. Thus, a prophylactic treatment functions as a preventative treatment against cancer, cancer relapse, or metastasis. In particular embodiments, prophylactic treatments prevent, reduce, or delay cancer, cancer relapse, or metastasis from a primary tumor site from occurring.

[0103] A “therapeutic treatment” includes a treatment administered to a subject who displays symptoms or signs of cancer (initial, relapsed, or metastasis) and is administered to the subject for the purpose of diminishing or eliminating further signs or symptoms of cancer or metastasis. The therapeutic treatment can reduce, control, or eliminate the presence or activity of cancer or metastasis and/or reduce control or eliminate side effects of cancer or metastasis. In particular embodiments, therapeutic treatments prevent, reduce, or delay further cancer or metastasis from occurring.

[0104] In particular embodiments, therapeutically effective amounts provide an anti-cancer effect, through providing an effective amount, a prophylactic treatment and/or a therapeutic treatment. As used herein, an anti-cancer effect refers to a biological effect, which can be manifested by a decrease in tumor volume, a decrease in the number of cancer cells, a decrease in the number of metastases, an increase in life expectancy, and/or a decrease of various physiological symptoms associated with the cancerous condition. An anti-cancer effect can also be manifested by a decrease in recurrence or an increase in the time before recurrence.

[0105] In particular embodiments, an anti-cancer effect includes death of cancerous cells in a subject in need thereof administered a RIG-I agonist of the present disclosure. Death of the cancerous cells can be indicated or measured in a number of ways. In particular embodiments, death of the cancerous cells is associated with an increase in expression of chemokines CCL2, CXCL1 , CXCL10, and/or IFNp in the cancerous cells. In particular embodiments, chemokines CCL2, CXCL1 , CXCL10, and/or IFNp in the cancerous cells increase by 2 fold, 3 fold, 4 fold, 5 fold, or more, as compared to the corresponding chemokine expression in cancerous cells in the subject prior to the administering. In particular embodiments, death of the cancerous cells is associated with an increase in surface exposure of calreticulin on the cancerous cells. In particular embodiments, the percentage of cancerous cells that express calreticulin increases 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, or more as compared to the percentage of cancerous cells that express calreticulin in the subject prior to the administering. In particular embodiments, death of the cancerous cells is associated with an increase in secretion of High Mobility Group Box 1 (HMGB1 ) from the cancerous cells. In particular embodiments, HMGB1 secretion from the cancerous cells is increased 1.5 fold, 2 fold, 3 fold, 4 fold, 5 fold, or more, as compared to secretion of HMGB1 from cancerous cells in the subject prior to the administering. In particular embodiments, death of the cancerous cells is associated with an increase in release of ATP. In particular embodiments, ATP release from the cancerous cells increases 5 fold, 10 fold, 20 fold, 50 fold, 100 fold, 1000 fold, or more, as compared to ATP release from cancerous cells in the subject prior to the administering.

[0106] In particular embodiments, an anti-cancer effect includes immune reactivation in a subject in need thereof administered a RIG-I agonist of the present disclosure. Immune reactivation can be indicated or measured in a number of ways. In particular embodiments, immune reactivation is associated with an increase in NK activating ligands on the cancerous cells. In particular embodiments, the NK activating ligands include MICA, MICB, ULBP1 , ULBP3, Nectin-2, PVR, and/or B7-H6. In particular embodiments, the amount of NK activating ligands on the cancerous cells increase 1 .1 fold, 1.2 fold, 1 .3 fold, 1 .4 fold, 1 .5 fold, 1 .6 fold, 1 .7 fold, 1.8 fold, 1 .9 fold, 2 fold, or more as compared to the amount of corresponding NK activating ligands on cancerous cells in the subject prior to the administering. In particular embodiments, immune reactivation is associated with induction of expression of an NK inhibiting marker on the cancerous cells. In particular embodiments, the NK inhibiting marker is HLA-ABC. In particular embodiments, NK inhibiting marker expression is induced 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, or more, as compared to NK inhibiting marker expression in cancerous cells in the subject prior to the administering. In particular embodiments, immune reactivation is associated with induction of antigen processing machinery (APM) genes in the cancerous cells. In particular embodiments, the APM genes include: immunoproteasome subunits PSMB8, PSMB9, and PSMB10; transporters associated with antigen processing TAP1 and TAP2; and the endoplasmic reticulum chaperone Tapasin (TAPBP). In particular embodiments, APM genes are induced 15 fold, 20 fold, 30 fold, 40 fold, 50 fold, 60 fold, 70 fold, 80 fold, 90 fold, 100 fold, 200 fold, 300 fold, 400 fold, 500 fold, or more, as compared to the corresponding APM gene levels in cancerous cells in the subject prior to the administering. In particular embodiments, immune reactivation is associated with an increase in expression of CD80, CD86, and/or HLA-DR on dendritic cells from the subject. In particular embodiments, expression of CD80, CD86, and/or HLA-DR on dendritic cells increase 2 fold, 3 fold, 4 fold, 5 fold, or more, as compared to the corresponding markers on dendritic cells from the subject prior to the administering. In particular embodiments, immune reactivation is associated with an increase in IL-12 expression in dendritic cells from the subject. In particular embodiments, IL-12 expression increases 5 fold, 10 fold, 15 fold, 20 fold, or more, as compared to IL- 12 expression in dendritic cells from the subject prior to the administering.

[0107] In particular embodiments, methods of the disclosure include using a RIG-I agonist of the disclosure as an adjuvant for a cancer vaccine to stimulate an immune response against a tumor antigen in a subject at risk of having or having a cancer comprising the tumor antigen. Effectiveness of a RIG-I agonist as an adjuvant can be measured by a number of parameters including: tumor growth; early and late apoptosis of tumor cells by T cells using annexin V-FITC and propidium idodide, respectively; effector function of T cells isolated from tumors can be assessed for activation, proliferation, and lytic function by examining the levels of ICOS, Ki-67, and Granzyme B, respectively; tumor infiltrating cells can be identified and quantified by flow cytometry as follows: 1 ) cells of the innate immune compartment including NK cells (NK1 1 ^hi, CD3 NK1 1 ^hi, or CD3 DX5+) and NKT cells (NK1 .1 ^hi(or DX5⁺)CD3e^hiCD1 d^hiCD60^hi), and 2) cells of the adaptive compartment including CD8+ T cells, CD8+ subpopulations (IFNg⁺ Th1 , IL4⁺ Th2, IL-17⁺, Th17), CD4+ T cells, and CD4+ subpopulations (FoxP3⁺CD127 CD25^hi Treg) ; identification and quantification of immunosuppressive regulatory T cells (CD4^hiCD25^hiFoxP3^hi) and myeloid-derived suppressor cells (CD1 1 b^hiGr1 ^hi) by flow cytometry; memory status of CD8+ cells can be characterized by CCR7/CD45RO/CD62L/CD45RA expression levels; identification and quantification of granulocytic (CD1 1 b⁺Ly6G⁺Ly6C'°) and monocytic (CD1 1 b⁺Ly6G Ly6C^hi) myeloid-derived suppressor cells; and/or macrophage M1 /M2 polarization status.

[0108] In particular embodiments, methods to stimulate an immune response against a tumor antigen in a subject at risk of having or having a cancer comprising the tumor antigen can further include administering a second anti-cancer agent to the subject. In particular embodiments, the second anti cancer agent is low dose chemotherapy. In particular embodiments, the second anti-cancer agent is an immune checkpoint inhibitor drug that blocks an immune checkpoint protein selected from programmed cell death protein 1 (PD-1 ), programmed death-ligand 1 (PD-L1 ), and cytotoxic T- lymphocyte-associated protein 4 (CTLA-4).

[0109] A“tumor” is a swelling or lesion formed by an abnormal growth of cells (called neoplastic cells or tumor cells). A“tumor cell” is an abnormal cell that divides by a rapid, uncontrolled cellular proliferation and continues to divide after the stimuli that initiated the new division cease. Tumors show partial or complete lack of structural organization and functional coordination with the normal tissue, and usually form a distinct mass of tissue, which may be either benign, pre-malignant or malignant.

[0110] For administration, therapeutically effective amounts (also referred to herein as doses) can be initially estimated based on results from in vitro assays and/or animal model studies. The actual dose amount administered to a particular subject can be determined by a physician, veterinarian or researcher taking into account parameters such as physical and physiological factors including target, body weight, severity of cancer, type of cancer, stage of cancer, previous or concurrent therapeutic interventions, idiopathy of the subject and route of administration.

[0111] A therapeutically effective amount or concentration of a compound such as the disclosed oligoribonucleotides may be any amount of a composition that alone, or together with one or more additional therapeutic agents (such as another anti-cancer agent), is sufficient to achieve a desired effect in a subject. The effective amount of the agent will be dependent on several factors, including, but not limited to, the subject being treated and the manner of administration of the therapeutic composition. In one example, a therapeutically effective amount or concentration is one that is sufficient to prevent advancement, delay progression, or to cause regression of a disease, or which is capable of reducing symptoms caused by any disease, including cancer or any neoplasia.

[0112] In one example, a desired effect is to reduce or inhibit one or more symptoms associated with cancer. The one or more symptoms do not have to be completely eliminated for the composition to be effective. For example, a composition can decrease the sign or symptom by a desired amount, for example by at least 20%, at least 50%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100%, as compared to the sign or symptom in the absence of the composition.

[0113] A therapeutically effective amount of a pharmaceutical composition can be administered in a single dose, or in several doses, for example daily, during a course of treatment. Flowever, the therapeutically effective amount can depend on the subject being treated, the severity and type of the condition being treated, and the manner of administration. For example, a therapeutically effective amount of such agent can vary from about 100 pg -10 mg per kg body weight if administered intravenously.

[0114] The actual dosages will vary according to factors such as the type of cancer to be treated and the particular status of the subject (for example, the subject’s age, size, fitness, extent of symptoms, susceptibility factors, and the like) time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of treatments for cancer for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response.

[0115] Dosage can be varied by the attending clinician to maintain a desired concentration. Higher or lower concentrations can be selected based on the mode of delivery, for example, trans-epidermal, rectal, oral, pulmonary, intranasal delivery, intravenous or subcutaneous delivery.

[0116] Determination of effective amount is in some instances based on animal model studies followed up by human clinical trials and can be guided by administration protocols that significantly reduce the occurrence or severity of targeted disease symptoms or conditions in the subject. Suitable models in this regard include, for example, murine, rat, porcine, feline, non-human primate, and other accepted animal model subjects known in the art. Alternatively, effective dosages can be determined using in vitro models (for example, cell culture assays). Using such models, only ordinary calculations and adjustments are required to determine an appropriate concentration and dose to administer a therapeutically effective amount of the treatments for cancer treatment (for example, amounts that are effective to alleviate one or more symptoms of a cancer).

[0117] A therapeutically effective amount is also one in which any toxic or detrimental side effects of the compound and/or other biologically active agent is outweighed in clinical terms by therapeutically beneficial effects. A non-limiting range for a therapeutically effective amount of treatments for cancer within the methods and formulations of the disclosure is about 0.0001 pg/kg body weight to about 10 mg/kg body weight per dose, such as about 0.0001 pg/kg body weight to about 0.001 pg/kg body weight per dose, about 0.001 pg/kg body weight to about 0.01 pg/kg body weight per dose, about 0.01 pg/kg body weight to about 0.1 pg/kg body weight per dose, about 0.1 pg/kg body weight to about 10 pg/kg body weight per dose, about 1 pg/kg body weight to about 100 pg/kg body weight per dose, about 100 pg/kg body weight to about 500 pg/kg body weight per dose, about 500 pg/kg body weight per dose to about 1000 pg/kg body weight per dose, or about 1 .0 mg/kg body weight to about 10 mg/kg body weight per dose.

[0118] By way of specific example, the compound herein referred to as M8 was administered at a rate of 2-25 pg per mouse (the average weight of which was 0.01 kg). This is equivalent to 15.5 nM/kg - 77.5 nM/kg, which provides useful doses for treatment in other subjects, including human subjects.

[0119] Useful doses of a therapeutic compounds, such as the oligonucleotides described herein, can range from 0.1 to 5 pg or from 0.5 to 1 pg. In other examples, a dose can include 1 pg, 5 pg, 10 pg, 15 pg, 20 pg, 25 pg, 30 pg, 35 pg, 40 pg, 45 pg, 50 pg, 55 pg, 60 pg, 65 pg, 70 pg, 75 pg, 80 pg, 85 pg, 90 pg, 95 pg, 100 pg, 150 pg, 200 pg, 250 pg, 350 pg, 400 pg, 450 pg, 500 pg, 550 pg, 600 pg, 650 pg, 700 pg, 750 pg, 800 pg, 850 pg, 900 pg, 950 pg, 1000 pg, 0.1 to 5 mg or from 0.5 to 1 mg. In other examples, a dose can include 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60 mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg, 150 mg, 200 mg, 250 mg, 350 mg, 400 mg, 450 mg, 500 mg, 550 mg, 600 mg, 650 mg, 700 mg, 750 mg, 800 mg, 850 mg, 900 mg, 950 mg, 1000 mg, or more. In one particular example, doses can be administered QD or BID to a subject with, e.g., total daily doses of 1 .5 mg/kg, 3.0 mg/kg, or 4.0 mg/kg of a composition with up to 92-98% wt/v of the compounds disclosed herein.

[0120] In particular embodiments, a therapeutic compound may be present from 0.1 wt. % to 10 wt. %, 0.1 wt. % to 9 wt. %, 0.1 wt. % to 8 wt. %, 0.1 wt. % to 7 wt. %, 0.1 wt. % to 6 wt. %, 0.1 wt. % to 5 wt. %, 0.1 wt. % to 4 wt. %, 0.1 wt. % to 3 wt. %, 0.1 wt. % to 2 wt. %, or 0.1 wt. % to 1 wt. %. Specific examples include 0.1 wt. %, 0.5 wt. %, 1 wt. %, 2 wt. %, 5 wt. %, 10 wt. %, and ranges between any two of these values. The weight percentages disclosed herein may be weight-to-weight or weight-to- volume percentages with respect to the total amount of the composition.

[0121] Therapeutically effective amounts can be achieved by administering single or multiple doses during the course of a treatment regimen (e.g., hourly, every 2 hours, every 3 hours, every 4 hours, every 6 hours, every 9 hours, every 12 hours, every 18 hours, daily, every other day, every 3 days, every 4 days, every 5 days, every 6 days, weekly, every 2 weeks, every 3 weeks, or monthly).

[0122] Administration of a pharmaceutical composition may be any method of providing or give a subject a pharmaceutical composition comprising the disclosed oligoribonucleotides, by any effective route. Exemplary routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.

[0123] In particular embodiments, administration of the therapeutic compound is by topical application, transdermal, percutaneous, or microneedle injection. Administration can also be, for example, parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, oral, buccal, or ocular routes, or intravaginally, by inhalation, by depot injections, or by implants.

[0124] In particular embodiments, therapeutic compositions are administered percutaneously, and the compound reaches epidermal and dermal layer through percutaneous absorption. In some embodiments, the percutaneous application of the anhydrous composition does not result in systemic absorption. In some embodiments, percutaneous delivery is aided by the use of ultrasound technology. The ultrasound energy is applied to percutaneous delivery composition over the tissue and assists the diffusion of the composition past the tissue. Also contemplated are delivery methods involving iontophoresis, electroporation, magnetophoresis, laser assisted peptide delivery, and so forth.

[0125] In particular embodiments, the compositions disclosed herein can be used in conjunction with other cancer treatments. For example, the composition disclosed herein can be administered in combination with other active ingredients, for example, a gonadotropin-releasing hormone agonist or antagonist (e.g., Lupron, Zoladex (Goserelin), Degarelix, Ozarelix, ABT-620 (Elagolix), TAK-385 (Relugolix), EP-100 or KLH-2109); a phosphoinositide 3-kinase (PI3K) inhibitor, a TORC inhibitor, or a dual PI3K/TORC inhibitor (e.g., BEZ-235, BKM120, BGT226, BYL-719, GDC0068, GDC-0980, GDC0941 , GDC0032, MK-2206, OSI-027, CC-223, AZD8055, SAR245408, SAR245409, PF04691502, WYE125132, GSK2126458, GSK-2636771 , BAY806946, PF-05212384, SF1 126, PX866, AMG319, ZSTK474, Call 01 , PWT33597, LY-317615 (enzastaurin hydrochloride), CU-906, or CUDC-907); a CYP17 inhibitor in addition to Galeterone ( e.g ., abiraterone acetate (Zytiga), TAK-700 (orteronel), or VT-464); prednisone; an osteoprotective agent; a radiation therapy; a kinase inhibitor (e.g. MET, VEGFR, EGFR, MEK, SRC, AKT, RAF, FGFR, CDK4/6); Provenge, Prostvac, Ipilimumab, a PD-1 inhibitor; a taxane or tubulin inhibitor; an anti-STEAP-1 antibody; a heat shock protein 90 (HSP90) or heat shock protein 27 (HSP27) pathway modulator; an anti-androgen (e.g., bicalutamide); and/or immunotherapy.

[0126] Kits.

[0127] Active component(s), including particularly at least one described RIG agonist, can be provided as kits. Kits can include one or more containers including (containing) one or more or more compounds as described herein, optionally along with one or more agents for use in therapy. For instance, some kits will include an amount of at least one additional anti-cancer composition. In particular embodiments a kit can include an immunization kit including a vaccine composition described herein (for instance, a cancer vaccine composition). In particular embodiments, a vaccine composition includes: a tumor antigen; and an adjuvant including at least one described RIG agonist of the disclosure. In particular embodiments, the tumor antigen and the adjuvant are in separate containers. In particular embodiments, the tumor antigen and the adjuvant are in the same container.

[0128] Any active component in a kit may be provided in premeasured dosages, though this is not required; and it is anticipated that certain kits will include more than one dose.

[0129] Kits can also include a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use, or sale for human administration. The notice may state that the provided active ingredients can be administered to a subject. The kits can include further instructions for using the kit, for example, instructions regarding administration; proper disposal of related waste; and the like. The instructions can be in the form of printed instructions provided within the kit or the instructions can be printed on a portion of the kit itself. Instructions may be in the form of a sheet, pamphlet, brochure, CD-ROM, or computer-readable device, or can provide directions to instructions at a remote location, such as a website. In particular embodiments, kits can also include some or all of the necessary medical supplies needed to use the kit effectively, such as applicators, ampules, sponges, sterile adhesive strips, Chloraprep, gloves, and the like. Variations in contents of any of the kits described herein can be made. The instructions of the kit will direct use of the active ingredient(s) included in that kit to effectuate a clinical and/or therapeutic use described herein.

[0130] Suitable methods, materials, and examples used in the practice and/or testing of embodiments of the disclosed invention are described herein. Such methods and materials are illustrative only and are not intended to be limiting. Other methods, materials, and examples similar or equivalent to those described herein can be used.

[0131] Exemplary Embodiments.

1. A method of treating cancer in a subject in need thereof including: administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide including: a 5' end triphosphate group, and the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10), thereby treating the cancer in the subject.

2. A method of treating cancer in a subject in need thereof including: administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide including: a 5' end triphosphate group, and the sequence shown in SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17, thereby treating the cancer in the subject.

3. The method of embodiment 1 or embodiment 2, wherein the cancer includes melanoma, adenocarcinoma, carcinoma, or a metastatic cancer.

4. The method of embodiment 1 or embodiment 2, wherein the cancer includes lung cancer, colon cancer, or prostate cancer.

5. The method of embodiment 1 or embodiment 2, wherein the sequence of the synthetic oligonucleotide consists of the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10).

6. The method of embodiment 1 or embodiment 2 , further administering at least one second anti-cancer agent.

7. A method of inducing death of cancerous cells in a subject, including: administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide including: a 5' end triphosphate group, and the sequence shown in M8 (SEQ ID NO: 13), r M5 (SEQ ID NO: 10), SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17, thereby inducing death of cancerous cells in the subject.

8. The method of embodiment 7, wherein the cancerous cells include melanoma cells, adenocarcinoma cells, carcinoma cells, or metastatic cells.

9. The method of embodiment 7, wherein the cell death is dependent on caspase 3.

10. The method of embodiment 7, wherein the cell death is dependent on type I interferon (IFN-I).

11 . The method of embodiment 7, wherein death of cancerous cells includes: an increase in expression of chemokines CCL2, CXCL1 , CXCL10, and/or IFNp in the cancerous cells; an increase in surface exposure of calreticulin on the cancerous cells; an increase in secretion of High Mobility Group Box 1 (HMGB1 ) from the cancerous cells; and/or an increase in release of ATP from the cancerous cells, as compared to the corresponding parameter in cancerous cells from the subject prior to the administering.

12. The method of embodiment 7, wherein administering further elicits immune reactivation in the subject. 13. The method of embodiment 12, wherein the immune reactivation includes: an increase in NK activating ligands on the cancerous cells; induction of expression of an NK inhibiting marker on the cancerous cells; induction of antigen processing machinery (APM) genes in the cancerous cells; an increase in expression of CD80, CD86, and/or HLA-DR on dendritic cells from the subject; and/or an increase in IL-12 expression in dendritic cells from the subject, as compared to the corresponding parameter in cancerous cells or dendritic cells from the subject prior to the administering.

14. The method of embodiment 7, wherein the sequence of the synthetic oligonucleotide consists of the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10).

15. The method of embodiment 7, further administering at least one second anti-cancer agent.

16. The method of any one of embodiments 1 , 2, or 6, wherein the therapeutically effective amount includes at least 0.2 milligrams to at least 5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.2-5 mg/kg/wk).

17. The method of any one of embodiments 1 , 2, or 6, wherein the therapeutically effective amount includes at least 0.5 milligrams to at least 2.5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.5-2.5 mg/kg/wk).

18. The method of any one of embodiments 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered to the subject for at least 1 -52 weeks.

19. The method of any one of embodiments 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered to the subject 1 -6 times per week.

20. The method of any one of embodiments 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered 1 -6 times during the first week and 1 time each subsequent week.

21 . The method of any one of embodiments 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered in a total weekly dose of any of 10 mg, 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, or 750 mg.

22. The method of any one of embodiments 1 , 2, or 6, wherein the effective amount is administered at a rate of 5 nM/kg to 100 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body.

23. The method of embodiment 22, wherein the therapeutically effective amount includes 15.5 nM/kg to 77.5 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body.

24. A cancer vaccine composition including a tumor antigen; an adjuvant; and a pharmaceutically acceptable carrier,

wherein the adjuvant includes a synthetic oligoribonucleotide including: a 5' end triphosphate group, and the sequence shown in M8 (SEQ ID NO: 13), M5 (SEQ ID NO: 10), SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17 25. The cancer vaccine composition of embodiment 24, wherein the tumor antigen is derived from tumors found in melanoma, skin cancer, prostate cancer, lung cancer, pancreatic cancer, or breast cancer.

26. The cancer vaccine composition of embodiment 24, wherein the tumor antigen is part of a tumor cell lysate.

27. The cancer vaccine composition of embodiment 24, wherein the tumor antigen is part of an inactivated cancer cell population.

28. The cancer vaccine composition of embodiment 24, wherein the tumor antigen is part of an antigen presenting cell (APC) population.

29. The cancer vaccine composition of embodiment 28, wherein the APC population includes dendritic cells.

30. The cancer vaccine composition of embodiment 24, wherein the adjuvant further includes mineral oil, bacterial toxins, aluminum salts, squalene, virosomes, mineral oil in water emulsions, CpG, lipopolysaccharide (LPS), monophosphoryl lipid A (MPLA), QS21 or AS02, flagellin, peptidoglycans, inactivated bacterial pathogens, and/or RNAse inhibitors.

31 . The cancer vaccine composition of embodiment 24, wherein the synthetic oligoribonucleotide is in a nanoparticle formulation.

32. The cancer vaccine composition of embodiment 24, wherein the tumor antigen and the adjuvant are formulated together.

33. The cancer vaccine composition of embodiment 24, wherein the tumor antigen and the adjuvant are not formulated together.

34. A method for stimulating an immune response against a tumor antigen in a subject at risk of having or having a cancer including the tumor antigen, including administering to the subject a therapeutically effective amount of the cancer vaccine composition of embodiment 24.

35. The method of embodiment 34, further administering at least one second anti-cancer agent.

36. The method of embodiment 35, wherein the second anti-cancer agent is low dose chemotherapy.

37. The method of embodiment 36, wherein the second anti-cancer agent is an immune checkpoint inhibitor that blocks programmed cell death protein 1 (PD-1 ).

38. A method of activating antigen presenting cells (APC) ex vivo including contacting the APC with the cancer vaccine composition of embodiment 24.

39. The method of embodiment 38, further administering the contacted APC to a subject at risk of having or having a cancer including the tumor antigen.

40. An immunization kit including the cancer vaccine composition of embodiment 24. [0132] EXAMPLES

[0133] The following examples are illustrative of disclosed methods. In light of this disclosure, those of skill in the art will recognize that variations of these examples and other examples of the disclosed method would be possible without undue experimentation. At least some of the material described in Example 1 was published as Castiello et al. {Cancer Immunol. Immunother. 68(9) :1479-1492, August 28, 2019).

[0134] Example 1 : Sequence-optimized RIG-I agonist M8 induces immunogenic cell death of cancer cells and dendritic cell activation

[0135] This Example demonstrates that activation of the cytosolic innate immune sensor RIG-I using a sequence-optimized RIG-I agonist M8 induces type-l-IFN/caspase 3-dependent cell death in cancer cells characterized by induction of multiple markers of immunogenic cell death (ICD). Also, M8 activates antigen processing machinery and mature dendritic cells to a pro-inflammatory phenotype.

[0136] RIG-I is a cytosolic RNA sensor that recognizes short 5' triphosphate RNA, commonly generated during virus infection. Upon activation, RIG-I initiates antiviral immunity, and in some circumstances, induces cell death. Because of this dual capacity, RIG-I has emerged as a promising target for cancer immunotherapy.

[0137] In previous studies, a sequence-optimized RIG-I agonist (termed M8) was identified for its ability to stimulate a robust innate immune response capable of blocking viral infection and functioning as an adjuvant in vaccination strategies of influenza antigens. In this example, the potential of M8 as an anti-cancer agent is further investigated by analyzing its ability to both induce cell death and activate the immune response.

[0138] In multiple cancer cell lines, M8 treatment strongly activated caspase 3-dependent apoptosis. Apoptosis relied on an intrinsic NOXA and PUMA-driven pathway that was largely dependent on IFN- I signaling. Additionally, cell death induced by M8 was characterized by the expression of the immunogenic cell death markers - calreticulin and HMGB1 - as well as high levels of CXCL10, a marker of inflammation. Additionally, cell death induced by M8 was characterized by the expression of the immunogenic cell death related DAMP (ICD-DAMP) - calreticulin, HMGB1 and ATP - as well as high levels of CCL2, CXCL1 , CXCL10, and IFNp, cytokine markers of ICD and inflammation. Moreover, M8 increased the levels of HLA-ABC expression on the tumor cell surface, as well as up-regulation of genes involved in antigen processing and presentation. M8 induction of the RIG-I pathway in cancer cells favored dendritic cell phagocytosis and induction of co-stimulatory molecules CD80 and CD86, together with increased expression of IL12 and CXCL10. Altogether, these results highlight the potential of RIG-I agonist M8 for cancer immunotherapy, by inducing immunogenic cell death and activating immunostimulatory signals that can synergize with current therapies. [0139] Introduction: Upon progression, tumors adopt multiple strategies to escape immune surveillance and to generate an immunosuppressive and protumorigenic microenvironment (Schreiber et al., Science 331 :1565-1570, 201 1 ). During this“immunoediting escape phase”, cancer cells become less visible to cells of the immune system by: 1 ) downregulation of HLA-ABC, co-stimulatory molecules and NK ligands; 2) expression or secretion of immunosuppressing molecules (such as PD- L1 , Galectin 9, ID01 ); and/or 3) chemoattraction of immunosuppressive cells such as regulatory T cells, myeloid derived suppressor cells or tumor activated macrophage cells (Treg, MDSC and TAM, respectively) (Mittal et al., Curr Opin Immunol 27:16-25, 2014). Several strategies are currently being investigated to overcome the limitations of the immunosuppressive microenvironment and induce tumor cell death. Among these approaches, the use of compounds that mimic viral infection represent a promising strategy to pair cell death signals with immune activation events (lurescia et al., Front Immunol 9:71 1 , 2018). During viral infection, in fact, cells sense pathogen-associated molecular patterns (PAMP) and damage-associated molecular patterns (DAMP) through a family of sensors, collectively named pattern recognition receptors (PRR) that activate multiple immune response pathways, and in some cases, lead to death of infected cells.

[0140] The retinoic acid inducible gene-l (RIG-I) is a cytosolic PRR for short 5' triphosphate double strand RNA, that has a crucial role in activating immune response against viral infection (Hornung et al., Science 314:994-997, 2006). Upon recognition of viral RNA, RIG-I activates through caspase recruitment domain (CARD)-mediated interactions the adaptor mitochondrial antiviral signaling protein (MAVS), which in turn activates TANK-binding kinase 1 (TBK1 ) and the IKB kinase (IKK) complex (Kawai et al., Nat Immunol 6:981-988, 2005). TBK1 and IKK, then, lead to the activation of IRF3 and NF-KB, respectively, thus inducing interferon (IFN), antiviral and inflammatory response (Goulet et al., PLoS Pathog 9:e1003298, 2013; Zevini et al., Trends Immunol. 38(3):194-205, 2017). Additionally, RIG-I signaling can also trigger suicide of infected cells as an ultimate mechanism of protection to limit viral spread through at least three different mechanisms: IRF3-dependent induction of apoptotic genes (Heylbroeck et al., J Virol 74:3781-92, 2000); IRF3-mediated induction of BAX-dependent mitochondrial apoptosis (Chattopadhyay et al., Immunity 44:1 151-1161 , 2016); and, direct RIG-I induction of necroptosis (Schock et al., Cell Death Differ 24:615-625, 2017). Such dual effects (i.e., induction of cell death and immune activation) render RIG-I agonists as a promising therapeutic approach for cancer treatment. Indeed, preliminary results have already shown that RIG-I agonists can induce cell death in different tumor types and activate both innate and adaptive immunity against tumors in mouse models (Poeck et al., Nat Med 14:1256-1263, 2008; Besch et al., J Clin Invest 119:2399-41 1 , 2009; Glas et al., Stem Cells 31 :1064-1074, 2013; Ellermeier et al., Cancer Res 73:1709-1720, 2013; Duewell et al., Cell Death Differ 21 :1825-1837, 2014).

[0141] By modifying the length, structure and sequence of the 5’ end of Vesicular Stomatitis Virus (VSV) RNA, a RIG-I agonist (named M8) was developed that was 10-100 fold more potent in stimulating an antiviral response compared to other agonists (Chiang et al., J Virol 89:801 1 -25, 2015; U.S. Patents No. 9,790,509 and No. 10,167,476). M8 potently blocked a variety of viral infections in vitro and in vivo, in part due to the activation of an innate immune response with great breadth and intensity. Furthermore, M8 acted as a potent vaccine adjuvant against influenza, leading to high antibody titers and Th1 -shift in immune responses (Beljanski et ai, J Virol 89:10612-24, 2015).

[0142] In the current example, M8 was tested for cancer therapeutic effects, by taking advantage of its dual ability to induce cell death and activate innate immunity. The results described herein demonstrate that stimulation of the RIG-I pathway by M8 induced an IFN-dependent intrinsic apoptosis in different cancer cells, characterized by many immunogenic cell death features and it was paired by increased antigen processing activity and strong activation of dendritic cells (DC).

Synthetic

[0143] MATERIALS AND METHODS

[0144] Cell lines and cultures: Primary Mel1007 and metastatic melanoma Mel120 cells were a kind gift of Dr. G. Parmiani (Milan, Italy), A549, HCT1 16 and PC3 were all from ATCC. Mel1007, Mel120, and PC3 cells were grown in RPMI supplemented with 10% Fetal Bovine Serum (FBS, Thermo Fisher Scientific) and 1 % of Penicillin-Streptomycin solution (P/S, 10000 U/ml Penicillin and 10 mg/ml Streptomycin sulfate, Euroclone). A549 cells were grown in Ham's F-12K (Kaighn's) Medium (Thermo Fisher Scientific) supplemented with 10% FBS and 1 % of P/S. HCT1 16 cells were grown in McCoy's 5A (Modified) Medium (Thermo Fisher Scientific) supplemented with 10% FBS and 1 % of P/S.

[0145] Generation of RIG-I agonists and transfection: M8, RIG-I agonists #1 and #2 (RA#1 and RA#2) (Poeck et al., Nat Med. 14(1 1 ) :1256-1263, 2008; Duewell & Latz, Methods Mol Biol. 1040:19- 27, 2013) were synthesized using Megascript T7 Transcription Kit (Thermo Fisher Scientific) on synthetic oligonucleotides (Eurofins Genomics) and following manufacturer instruction. Templates used were:

[0146] For RA#1 and RA#2, the two templates were used separately to generate complementary RNAs that were annealed before transfection. Synthesized RNA was then purified using Nucleospin MiRNA Kit (Mackerey-Nagel) and concentration assessed using Nanodrop 2000 (Thermo Fisher Scientific).

[0147] For transfection of all RA, Lipofectamine RNA/iMax (Thermo Fischer Scientific) was used following manufacturer instructions. The amount of lipofectamine was optimized for each cell type in order to reduce toxicity: 1.5 mI/ml were used for Mel 1007 cells, 2 mI/ml for HCT1 16, 3 mI/ml for PC3, Mel120 and A549. Both RNAiMAX and RA were diluted in Opti-Mem (Thermo Fisher Scientific). To remove the 5’ triphosphate group of M8, Calf Intestinal Alkaline Phosphatase (Thermo Fischer Scientific) was used following manufacturer instruction and RNA was then purified as before.

[0148] Reagents: LDH cytotoxicity assay (Thermo Fischer Scientific) was used following manufacturer instructions. For cell death inhibition Z-VAD-FMK (Santa Cruz Biotechnology) was used at a final concentration of 100 mM, Ac-YVAD-CMK (Sigma Aldrich) was used at a final concentration of 100 pg/ml (-180 mM), Necrostatin-1 (Cayman Chemical) was used at a final concentration of 50 mM; all the reagents were added to the culture immediately after transfection. For RIG-I silencing by siRNA, Mel1007 plated in 6-well plates were transfected with 80 pmol of RIG-I siRNA or Control- siRNA-A (Santa Cruz Biotechnology) using Lipofectamine RNA/iMax. After 24 h, cells were transfected with M8 and viability assessed after 48 h. To block IFN-I signaling Anti-lnterferon-a/b Receptor Chain 2 Antibody (clone MMHAR-2, Merck Millipore) was added to culture media immediately after M8-transfection at a final concentration of 1 pg/ml.

[0149] PBMC and DC differentiation: PBMC were isolated starting from healthy donor buffy coat by standard stratification with Ficoll® Paque PLUS density gradient (GE Healthcare) following manufacturer instructions and cultured in RPMI supplemented with 10% Certified FBS (Thermo Fisher Scientific) and 1 % of P/S. For DC differentiation, monocytes were isolated from fresh PBMC by magnetic selection using CD14 MicroBeads (Miltenyi Biotec) and cultured in RPMI supplemented with 10% Certified FBS (Thermo Fisher Scientific), 1 % of P/S, 50 ng/ml of GMCSF (Miltenyi) and 25 ng/ml of IL-4 (Miltenyi). After 5 days of culture, DC were used for phagocytosis assay or stimulated for 24 h with supernatants of transfected Mel1007 cells.

[0150] NK CD107 degranulation and cytotoxicity assay: As the source of effector cells, PBMCs were isolated from two healthy donors by Lymphoprep (Nycomed, Oslo, Norway) gradient centrifugation and co-cultured for 10d with the irradiated (30 Gy) EBV-transformed B cell line RPMI 8866 at 37°C in a humidified 5% CO2 atmosphere, as previously described (Zingoni et al., Eur J Immunol 30:644-651 , 2000). On day 10, the cell population was routinely >95% CD56⁺CD16⁺CD3-, as assessed by immunofluorescence and flow cytometry analysis. M8-transfected Mel1007 cells and K562 cells were then incubated with the effector cells at 37°C for 2 h. Thereafter, cells were washed and incubated for 45’ at 4°C with the lysosomal marker CD107a-APC and anti-CD3-APC-H7 and anti- CD56-PE to gate on NK cells. At the end of incubation cells were washed and analyzed by flow cytometry for percentage of CD107a+ cells among the gated CD3-/CD56+ cells. [0151] The effector NKL cells were labeled with CFSE and co-cultured for 4 h with target Mel 1007 transfected or not with M8 for 48 h or K562 cells at different Effector to Target ratios for 4 h at 37°C. Cells were then washed and cytotoxicity assessed at flow cytometer analyzing viable cells using 7- AAD among the CFSE- cells.

[0152] Phagocytosis assay: Mel 1007 cells were labeled with Cell Trace Far Red (CTFR) (Thermo Fischer Scientific) and transfected with M8 for 48 h. Cells were then cocultured at a 1 :1 ratio with DC for 4 h. Cells were then washed and labeled with anti-CD209-PE and 7-AAD, and analyzed by flow cytometer assessing CTFR⁺ cells among live CD209⁺ cells.

[0153] Flow cytometry: Viability was assessed by gating 7-AAD exclusion over FSC-A plots on FSC- A vs FSC-H gated single cell suspensions. To evaluate early and late apoptosis, cells were labeled with Annexin-V-APC (Biolegend) and 7-AAD in a solution of HEPES 0.01 M (Sigma Aldrich), NaCI 140 mM (Sigma Aldrich), CaC 2.5 mM (Sigma Aldrich) following manufacturer instructions. To stain for calreticulin, cells were washed twice with cold PBS, fixed for 5’ in 0.25% paraformaldehyde, washed twice in cold PBS and incubated for 20’ with anti-calreticulin Ab (PA3900, Thermo Fischer Scientific). Labeled cells were then washed twice and incubated with AlexaFluor488-labeled secondary Ab for 30’ on ice (ab150077, Abeam). At the end of incubation, cells were washed twice and resuspended in a PBS solution containing 7-AAD. Cells treated with 1 mM Mitoxantrone (Sigma Aldrich) were used as a positive control.

[0154] Staining for other cell surface markers was performed using standard incubation protocols and staining with anti-HLA-ABC-PE, anti-HLA-DR-APC (21388996) (both from Immunotools), anti-CD86- Brilliant Violet 421 (305426) and anti-CD209-PE (330106) (both from Biolegend), anti-CD80-FITC (557226), anti-CD3-APC-H7 (clone SK7), anti-CD56-PE (clone NCAM16.2), anti-CD107a-APC (clone H4A3) (all from BD Biosciences) antibodies. All the experiments were performed on BD FacsCanto II (BD Biosciences).

[0155] Quantitative PCR: RNA were isolated by column separation using RNeasy Kit (Qiagen) and following manufacturer instructions and measured with Nanodrop 2000 (Thermo Fischer Scientific). 350 ng of RNA were used for cDNA synthesis using High-Capacity cDNA Reverse Transcription Kit (Thermo Fischer Scientific). Quantitative PCR was then performed using Taqman Fast Advanced MasterMix with Taqman probes or Universal ProbeLibrary Probes (Roche) with specific primers designed using Roche Lifescience Assay Design Center (available online at lifescience.roche.eom/en_it/brands/universal-probe-library.html#assay-design-center) on a StepOnePlus Real-Time PCR System (Thermo Fischer Scientific). Relative quantification method was used with GAPDH as housekeeper gene.

[0156] Magnetic Luminex Assay: Supernatants of M8-transfected Mel 1007 cells were analyzed on a 96-well plate for the presence of the following analytes: CCL2, CXCL1 , CXCL10, and IFNp. The fluorescence responses and concentrations of cytokines were obtained using a Human Premixed Multi-Analyte kit (R&D systems, Minneapolis, Minnesota, USA), and analyzed with a MAGPIX system and the accompanying xPONENT Software. All reagents were provided with the kit and were prepared according to the manufacturer’s recommendations: reconstituted standards were serially diluted 1 to 3 in calibrator diluent, which was used as background. Concentrated wash buffer was diluted in a 25- fold volume of deionized water. Microparticle cocktail, biotin-antibody cocktail, and Streptavidin-PE were diluted in their specific buffers immediately before the assay. The protocol outlined in the Luminex manual was followed exactly. Briefly, all supernatants were diluted 2-fold with calibrator diluent prior to data acquisition. 50 mI of samples and standards were incubated for 2 hours with 50 mI of microplate cocktail, then the plate was washed and 50 mI of biotin antibody cocktail was added. After a 1 -hour incubation, plate was washed and 50 mI of streptavidin-PE were added for 30-min, followed by a final wash and resuspension in 100 mI of wash buffer. All incubations were done at room temperature on a microplate shaker at 800 rpm. Both standards and samples were tested in duplicate. The concentration values and detection limits were determined from standard curves generated from each kit’s standards using the weighted 5PL curve fitting procedure. To maximize the number of concentration values available for analysis the extrapolated values were included.

[0157] HMGB1 Elisa: Supernatants of Mel1007, HCT1 16 and PC3 cells transfected or not with M8 for 48 h were analyzed for HMGB1 levels using HMGB1 Elisa kit (ST51001 , IBL international) following manufacturer instructions and absorbance measured with iMark™ Microplate Absorbance Reader (Bio-Rad). As positive control, cells treated with Mitoxantrone 1 mM (Sigma Aldrich) were used.

[0158] ATP release: Extracellular ATP levels were measured by the luciferin-based ENLITEN ATP Assay (Promega, Madison, Wl, USA), following the manufacturer’s instructions, and light intensity was measured by Glomax luminometer. Briefly, 100 mI of not diluted supernatant were dispensed, in duplicate, in an opaque-walled 96 well plate; in each well an equal volume of rL/L reagent was added by an injection system and a 2-second delay time after injection, 10-second RLU signal integration time were used to record the light signals resulting from the luciferase reactions.

[0159] Statistical Analysis: Graphs and statistical analysis were performed using GraphPad Prism 6. Depending on the type of data analyzed ordinary one-way ANOVA or two-way ANOVA were used correcting multiple comparisons with Tukey’s test, or standard t-test using Sidak correction for multiple comparisons.

[0160] RESULTS

[0161] Sequence-optimized RIG-I agonist M8 potently induced cell death in cancer cells. To assess the potential of M8 as an anti-cancer agent, its ability to induce cell death in the melanoma cell line Mel1007 was analyzed. Significant levels of cell death were observed with concentrations of M8 higher than 100 ng/ml (FIGs. 1A, B). To determine the specificity of M8 to induce RIG-l-directed cell killing, the 5’ triphosphate group of M8 was removed by calf intestinal phosphatase, resulting in a dramatic reduction of cell death (50% vs 3.7%) (FIG. 1 C). A similar result was observed when the expression of RIG-1 was silenced by transfecting cells with siRNA against RIG-1 for 24h prior to M8 treatment. Indeed, M8-directed cell death was reduced to control levels in RIG-1 silenced cells (from 30 % to 9.5. %) (FIG. 1 D), thus supporting the observation that 5’ triphosphate containing M8 maintained specificity for the RIG-I sensor, as observed in other models (Goulet et al., PLoS Pathog 9:e1003298, 2013; Chiang et al., J Virol 89:801 1-25, 2015).

[0162] Next, the capacity of M8 to induce cell death was compared to other RIG-I agonists previously shown to induce cell death in cancer cells (Poeck et al., Nat Med 14:1256-1263, 2008; Duewell et al., Cell Death Differ 21 :1825-1837, 2014). Among the compounds tested, M8 proved to be the strongest inducer of cell death in Mel1007 (>58% vs 1 1 and 8%) (FIG. 1 E). Moreover, M8 was effective in inducing cell death in a variety of cancer cell lines, including metastatic melanoma Mel120, lung adenocarcinoma A549, colon carcinoma HCT1 16, prostate carcinoma PC3 (FIG. 1 F) (40%, 75%, 45%, and 33%, respectively), indicating that cell death pathways activated by M8 were intact among several cancer cell types.

[0163] The toxicity of M8 was also evaluated in PBMC. Interestingly, at 48h after transfection into PBMC, M8 led to minimal levels of cell death, even at the highest dose (FIG. 1 G), thus indicating that M8 toxicity was selective for cancer cells rather than normal cells, as previously described (Besch et al., J Clin Invest 1 19:2399-41 1 , 2009). These results indicate that M8 activation of RIG-I is able to induce cell death in different cancer cell types, while displaying limited toxicity in non-cancerous cells.

[0164] M8 induced RIG-I-, IFN-I-, NOXA-dependent apoptotic pathway. Next, the kinetics of induction of apoptosis was analyzed at different times after M8 treatment by annexin V staining. As shown in FIG. 2A, Mel1007 treated with M8 began showing apoptotic features as early as 16h post transfection with high percentages of early apoptotic cells between 24 and 30h, while by 48h most of the cells were already dead, thus indicating that the mechanisms leading to cell death start within the first 24h. Several pharmacological inhibitors of cell death pathways were used to explore the specificity of M8-mediated cell death. The pan-caspase inhibitor Z-VAD significantly reduced M8-induced cell death (19% vs 44%), suggesting caspase involvement, whereas involvement of caspase 1 -dependent pyroptosis or necroptosis through the RIP1 kinase were ruled out, based on the use of the caspase 1 inhibitor YVAD or the necroptosis inhibitor necrostatin 1 (FIG. 2B). Cleavage of caspases 3 and 9 was detected by immunoblot 24h post M8 treatment (FIG. 2C), indicating that M8-induced cell death involved the intrinsic apoptotic pathway. This observation was further confirmed by analyzing mitochondria depolarization by JC1 staining at 24h post treatment; as shown in FIG. 2D, M8 treatment of mel1007 cells increased the percentage of cells exhibiting disrupted mitochondria.

[0165] Next, to understand the proapoptotic factors involved in M8-induced cell death, gene expression levels of proapoptotic genes Noxa and Puma was analyzed. Notably, both genes were significantly induced upon M8 transfection (FIGs. 2E, 2F), however while Puma expression levels were induced only 3 fold, Noxa gene expression was induced approximately 100 fold. [0166] To evaluate whether the apoptosis induced by M8 was modulated by type I IFN (IFN-I), cell death levels were evaluated in M8-treated Mel1007 cells in the presence of IFNAR1 blocking antibodies. As shown in FIG. 3A, cell death induced by M8 was inhibited by IFNAR1 blocking antibodies (21 % vs 57%), thus demonstrating the requirement for IFN-I production and indicating that secreted IFN-I contributed to apoptosis. Consistent with this observation, the blockade of IFN-I signaling with IFNAR1 blocking antibodies inhibited proapoptotic genes and reduced the expression levels of PUMA and NOXA in M8 treated cells (1 .4 vs 2.6 fold for PUMA, 45 vs 1 10 fold for NOXA) (FIGs. 3B, 3C). These results indicate that in Mel1007 cells M8 induced an intrinsic apoptotic pathway that relied on IFN-l-dependent induction of Puma and Noxa.

[0167] M8 induced ICD-DAMP. Given its ability to mimic virus infection, M8 induced a RIG-I- dependent innate response. IFNp transcriptional levels increased proportionally with the tested concentration of M8 (10, 100, 500 ng/ml), and the downstream chemokine CXCL10 underwent an even more dramatic induction that was significantly reduced by blocking IFNAR1 signaling (FIGs. 4A, B). Given that IFNp and CXCL10 are two critical factors required for ICD [19] the potential of M8 to induce the complete chemokine signature of ICD (i.e. CCL2, CXCL1 , CXCL10 and IFNP) was investigated next by a multiplex ELISA assay. All tested cytokines displayed an M8-dose-dependent, and statistically significant increase in chemokine production, as measured in the supernatant of MS- treated Mel1007 versus control (FIG. 4C).

[0168] Apoptosis of cancer cells induced by M8 displayed several other features of ICD. By flow cytometry, it was found that M8 in Mel1007 cells induced surface exposure of calreticulin at levels comparable to the ICD inducer mitoxantrone (FIG. 5A). Similar results were also observed in other cell lines (FIG. 5B). As an additional marker of ICD, the release of the High Mobility Group Box 1 (HMGB1 ) was measured; after 48h of M8 treatment, secretion of HMGB1 was significantly increased in a panel of cancer cells (FIG. 5C, 5D). Finally, the release of ATP in the extracellular supernatants of Mel1007 cell cultures was measured using a luciferase-based assay, and demonstrated high level ATP release after M8 treatment (FIG. 5E). Altogether, these results indicated that M8 induces a caspase 3- dependent cell death characterized by stimulation of multiple immunogenic cell death associated molecular patterns (ICD-DAMP).

[0169] M8 triggering of RIG-I represses NK activity and upregulates antigen processing machinery (APM). Having observed the activation of many ICD markers in cancer cells stimulated by M8, whether pathways downstream of RIG-I activation also generated signals crucial for immune cell recognition was studied next. The induction of NK cell activating signals on Mel1007 was evaluated using mid-range doses of M8 to ensure strong RIG-I activation and minimize cell death. As shown in FIG. 6A, most activating NK ligands were increased on the Mel1007 cell surface after M8 treatment, although not to a statistically relevant level. However, when NK degranulation and cytotoxic activities were measured, a clear inhibition of NK activity was observed. In fact, both CD107 exposure on the NK surface and the percentage of dead target cells after co-culture NK / M8-Mel1007 cells indicated that M8 treatment resulted in reduced NK activity when compared to negative or positive control cells (FIGs. 6B,6C), thus suggesting the involvement of inhibitory markers. In fact, a consistent induction of the NK inhibiting marker HLA-ABC expression was observed after M8 treatment (FIG. 6D) and associated with a general increase in the activity of the antigen processing machinery (APM).

[0170] The expression of numerous APM genes - immunoproteasome subunits PSMB8, PSMB9, and PSMB10, transporters associated with antigen processing TAP1 and TAP2, and the endoplasmic reticulum chaperone Tapasin (TAPBP) - displayed a dose dependent increase in M8-Mel1007 cells, peaking at a concentration of 100 ng/ml M8, with inductions ranging from 15-500 fold over untreated cells (FIG. 6E). In line with previous studies (Leone et at., JNCI J Natl Cancer Inst 105:1 172-1187, 2013), the expression levels of APM factors were strongly dependent on IFN-I, since IFNAR1 signaling blockade resulted in a reduction on the expression levels of both HLA-ABC protein (to basal levels) and APM genes (~3-6 fold) (FIGs. 6D, 6E). Similar results on reduced NK activity and induction of APM were also observed in HCT1 16 cells. Taken together, these results indicated that the antigen processing machinery was activated in an IFN-dependent manner in cancer cells treated with M8, whereas anti-tumoral NK activity was inhibited.

[0171] Activation of monocyte-derived dendritic cells is skewed to a Th1 phenotype. Based on the induction of ICD and APM activation in M8-Mel1007, the modulation of DC activity was next analyzed to determine whether the immunogenic signals induced by M8 enhanced DC phagocytosis of M8-Mel1007. Monocyte-derived DC (MoDC) co-cultured with labeled Mel1007 or M8-Mel1007 were evaluated for their ability to incorporate the membrane dye by phagocytosis. Interestingly, MoDC phagocytized more M8-Mel1007 cells compared to control Mel 1007, based on membrane dye inclusion (9.5% vs 2.2%) (FIGs. 7A, 7B).

[0172] Next, whether immunogenic signals induced in M8-Mel1007 cells affected DC phenotype, specifically expression of co-stimulatory markers and cytokine production, was evaluated. Cytometric analyses showed that supernatants of M8-Mel1007 administered to DC increased the expression levels of costimulatory markers CD80 and CD86, and of HLA-DR of ~ 2.2, 4.7, and 2 fold respectively, thus indicating an increased ability to stimulate T cell activation (FIG. 7C). Moreover, expression of the pro-Th1 cytokine IL-12 was stimulated in DC, whereas levels of the pro-Treg cytokine IL-10 remained unchanged (FIG. 7D). The proinflammatory cytokine CXCL10 was stimulated by M8- Mel1007 in a dose dependent manner (FIG. 7E), further evidence that M8 treatment of Mel1007 affected DC function, by stimulating their phagocytic potential and also driving them towards a pro- inflammatory Th1 biased phenotype. [0173] DISCUSSION

[0174] Immune mechanisms against viral infection rely on recognition of viral components (including for instance unusual RNA structures) to initiate a complex and multifaceted array of processes that includes the secretion of IFN-I and chemokines to mobilize immune effector cells, the activation of the APM for immune recognition of non-self antigens, and in the last instance, cell death. All these processes are critical for the development of an efficient cancer immunotherapy. Within this setting, tumor cells develop multiple strategies to escape immune recognition and thereby evade immune control.

[0175] Here, the sequence optimized RIG agonist M8 (Chiang et al., J Virol 89:8011-8025, 2015; Beljanski et al., J Virol 89:10612-10624, 2015) was assessed for its potential effectiveness in cancer immunotherapy and its capacity to induce immunogenic cell death in several cancer cell lines that rely on secretion of IFN-I and induction of intrinsic apoptotic pathways is described. Moreover, M8 boosted HLA-ABC and APM expression, and activated proinflammatory phagocytic DC, thus illustrating its potential to trigger many propitious anti-cancer effects by inducing death of tumor cells and eliciting immune reactivation.

[0176] Cancer immunotherapy has recently emerged as a powerful tool against cancer, and many approaches mimicking viral infections have been tested or are in early phase clinical trials. Most of the RIG-1 agonists (RAs) developed for cancer immunotherapy has coupled RA activity with specific silencing of oncogenes or immunosuppressive factors (Poeck et al., Nat Med 14:1256-1263, 2008; Besch et al., J Clin Invest 1 19:2399-2411 , 2009; Ellermeier et al., Cancer Res 73:1709-1720, 2013), thus illustrating the potential of RIG-I signaling as an anti-cancer immunotherapeutic strategy. Here, a sequence optimized RA (i.e., M8) was used that strongly outperforms other RA in the induction of antiviral signaling (Chiang et al., J Virol 89:801 1-8025, 2015), as well as in the triggering and potentiation of immune response (Beljanski et al., J Virol 89:10612-10624, 2015), but whose efficacy entirely relies on functional RIG-I signaling pathway. Depending on the tumor setting, RIG-I exerts both pro- and anti-tumorigenic roles and therefore its functional activity and expression level are widely affected (Xu et al., Protein Cell 9:246-253, 2018). M8 induced cell death in several cancer cell lines together with the expression of ICD markers and activated direct and indirect immune processes. Therefore, the results presented herein highlight M8 as a promising broad-acting RA for cancer immunotherapy against multiple tumor types. More detailed studies may be helpful to dissect settings in which RIG-I activation is most preferable.

[0177] IFN-I play a critical role in tumor development and in response to therapy (Dunn et al., Nat Immunol 6:722-9, 2005; Katlinskaya et al., Cell Rep 15:171-180, 2016; Katlinski et al., Cancer Cell 31 :194-207, 2017; Castiello et al., Cancer Immunol Res 6:658-670, 2018; Rizza et al., Cytokine Growth Factor Rev 26:195-201 , 2015; Gajewski et al., Cancer Immunol Immunother 61 :1343-1347, 2012). As a large body of literature has highlighted, IFN-I are the cornerstone for the development of anti-tumor response thanks to the activity on tumor cells and ICD (Galluzzi et al., Nat Rev Immunol 17:97-1 1 1 , 2017), and to the activation of anti-tumor immune cells (Snell et al., Trends Immunol 38:542-557, 2017).

[0178] Tumor cells often develop resistance to IFN-I signaling by downregulating IFNAR1 or altering downstream factors (Katlinskaya et al., Cell Rep 15:171-180, 2016; Katlinski et al., Cancer Cell 31 :194-207, 2017; FluangFu et al., Oncogene 31 :161-172, 2012; Bhattacharya et al., Oncogene 32:4214-21 , 2013), even though some IFN-I signals are minimally affected by IFNAR1 levels (Levin et al., Mol Cell Biol 31 :3252-66, 201 1 ). Cell death pathway induced by M8 strongly relies on IFN-I; in fact, by blocking IFNAR1 activation, cell death strongly diminished and was reasonably due to an IFN- I dependent induction of the pro-apoptotic NOXA.

[0179] Other RA have shown similar effects (Poeck et al., Nat Med 14:1256-1263, 2008), whereas others seem to induce cell death in an IFN-I independent manner (Besch etal., J Clin Invest 1 19: 2399- 241 1 , 2009). This may depend on the different ability of M8 - and other RAs - to preferentially activate antiviral response over other downstream pathways. Whether M8 effects would be limited by tumor deregulated IFN-I signaling can be explored more in depth, and strategies, such as oncolytic virotherapy, that specifically take advantage of defective IFN-I signaling may be more suited in such settings (Stojdl etal., Cancer Cell 4:263-75, 2003; Nguyen etal., Proc Natl Acad Sci 105:14981 -14986, 2008; Olagnier et al., Mol Ther 25:1900-1916, 2017).

[0180] NK cells exert a crucial role in controlling and modulating therapy response in several settings (Sanchez-Correa et al., Cancer Immunol Immunother 60:1 195-1205, 2011 ; Zingoni et al., Front Immunol 8 :1 194, 2017). However, contrasting results have been reported on the relevance of NK cells in RA-based immunotherapy (Poeck et al., Nat Med 14:1256-1263, 2008; Glas et al., Stem Cells 31 :1064-1074, 2013; Ellermeier et al., Cancer Res 73:1709-1720, 2013; Barsoum et al., Cancer Immunol Res 5:B44-B44, 2017). Differently from other groups that analyzed systemic NK activation (Poeck et al., Nat Med 14:1256-1263, 2008) or the activating effect of cell supernatants (Glas et al., Stem Cells 31 :1064-1074, 2013), the herein presented results with M8 showed an overall inhibition of NK cell activity against M8-transfected cells, despite the increased expression of several NK activating ligands. It is believed that this may be due to the strong overexpression of the inhibitory ligand HLA-ABC, but additional factors could also be involved. Whether such reduced NK activity can affect M8-based immunotherapy will be more clearly evaluated in future in vivo studies together with a more detailed understanding of mechanisms regulating NK activity upon RA immunotherapy.

[0181] The generation and/or strengthening of anti-tumor antigen specific immune responses are thought to be the foundation for successful cancer immunotherapy, particularly given the progress with immune checkpoint inhibitor therapies (Ribas & Wolchok, Science 359:1350-1355, 2018; Rizvi et al., Science 348:124-128, 2015; Van Allen et al., Science 350:207-21 1 , 2015). Because of their ability in actively uptake and process tumor antigens, DC play a pivotal role in inducing and maintaining tumor- specific T cell responses (Zong et al., Cancer Immunol Immunother 65:821-833, 2016) and combination therapies directed towards increasing the pool of tumor antigens recognized by T cells are highly sought after strategies (Schumacher & Schreiber, Science 348:69-74, 2015). In light of this, the observations described herein that M8 treated cells are highly phagocytized by DC and that DC stimulated with supernatants of M8 treated cells increase the expression of HLA-DR and of costimulatory molecules, and switch towards a Th1 biasing cytokine production, strongly indicate that M8 immunotherapy could broaden the anti-tumor antigenic repertoire. Also, the upregulation of the APM in cancer cells induced by M8 should increase the recognition of cancer cells by the tumor infiltrating lymphocytes and thus additionally favor a strong antigen-specific T cell mediated immune response.

[0182] During the final preparation of this study, an excellent study that evaluate a distinct engineered RIG-I agonist in a breast cancer cell panel that represented each of three major clinical breast cancer subtypes was published (Elion et al., Cancer Res. 78(21 ):6183-6195, 2018). Notably, in this setting the RIG-I agonist triggered the extrinsic apoptosis pathway and pyroptosis, and also induced expression of lymphocyte-recruiting chemokines and type I IFN. Importantly, RIG-I activation in breast tumors increased tumor lymphocytes and decreased tumor growth and metastasis, thus illustrating the successful therapeutic delivery of a synthetic RIG-I agonist to induce breast tumor cell killing and to modulate the tumor microenvironment in vivo.

[0183] In conclusion, the research described herein demonstrates that the sequence-optimized RA M8 was capable of inducing an IFN-I dependent ICD in several tumor cell lines, together with the activation of APM and DC. The results described here strongly suggest that M8 triggering of RIG-I can activate multiple processes within the tumor microenvironment that favor the induction and strength of antigen-specific responses and that could strongly synergize with checkpoint inhibitors.

[0184] Example 2: Triggering M8 Induced Cell Death using Natural Killer (NK) Cells

[0185] The effect of M8 on melanoma (Mel1007) tumor cells and other tumor cell types, in terms of the induction of NK cell activity, is being examined, with the hypothesis that M8 will increase receptor expression on Mel cells. Results demonstrate that treatment of Mel1007 with M8 sensitizes the tumor cells to killing by NK cells.

[0186] The effect of M8 directly on NK cell function is also being examined. It is expected that M8 treatment of NK cells will stimulate their death effector functions and increase granzyme B release. As the name implies NK cells, can be stimulated to attack and kill tumor cells. This may be an important addition in terms of mechanism of cell death by M8. [0187] Example 3: Cancer Immunotherapy Mediated by RIG-I Pathway Activation

[0188] This example describes translational studies that build upon mechanistic knowledge of RIG-I signaling described herein. These studies apply this knowledge to the discovery, evaluation, and development of potent immunotherapeutics based on RIG-I agonists. Use of multiple tumor models, including metastatic and poorly immunogenic models will define the therapeutic potential of RIG-I agonists in cancer immunotherapy.

[0189] Cancer vaccines represent an attractive strategy to activate the immune system against tumor cells, despite the many pitfalls to be overcome to generate a successful vaccine. On the one hand, tumour antigens are usually self-proteins, and therefore poorly immunogenic; while on the other hand, tumours develop several escape mechanisms, including loss of MHC class I molecules and secretion of suppressive cytokines. Additionally, cancer patients are frequently immune suppressed because of treatments; therefore, a therapeutic cancer vaccine requires a strong adjuvant to increase its immunogenicity. An ideal cancer immunotherapy should induce such a strong immune activation that overcomes tumour escape strategies, with acceptable profiles of toxicity and safety. The desired immune response in cancer therapy involves the activation of interferon-y (IFN-g) producing type 1 T helper cells (Th1 ) and cytotoxic T lymphocytes (CTLs). However, despite many attempts, an ideal adjuvant remains to be identified. While Alum has been widely used in prophylactic vaccines that promote type 2 helper T cells (Th2)-dependent immunity, Alum has not been effective for the induction of strong Th1 -dependent immunity. Because the immune system is tuned to recognize pathogen- associated molecular patterns (PAMPs) by means of pathogen-recognition receptors (PRRs), molecules that mimic PAMP strongly stimulate innate immunity and may therefore be ideally suited to augment cancer immunotherapy.

[0190] Using the discoveries described herein, immunostimulatory therapies can now be developed based on the provided first-in-class RNA molecules against a novel target with a well-understood mode of action. The translation of these approaches toward clinical use is an important end goal for which the proposed studies will provide the foundation. It is believed that stimulation of multiple innate antiviral and inflammatory pathways by RIG-I agonist M8 will enhance antiviral and protective immunity against infectious diseases and cancer.

[0191] Assess immunotherapeutic potential of M8 in cancer vaccine formulations. The ability of M8 to increase antitumor immune response in different tumor antigen formulations will be evaluated using metastatic and/or poorly immunogenic mouse tumor models. Nanoparticle formulated M8 will be incubated with 1 ) granulocyte-macrophage colony-stimulating factor (GM-CSF)-producing cellular cancer vaccines, 2) tumor cell lysates, or 3) single tumor antigens. Subcutaneously growing MC38 colon carcinoma, B16-F10 metastatic melanoma, and poorly immunogenic TC-2 prostate cells, KPC pancreatic adenocarcinoma, CT26 colon carcinoma cells, and breast carcinoma transgenic Neu^+/_ mice will be used as tumor models. Tumor antigens will be derived from both matched and un-matched tumor cell lysates; unmatched lysates will be used for comparison.

[0192] Determine the adjuvant potential of M8 in melanoma bearing mice. To determine whether M8 can break T cell tolerance to a naturally expressed tumor-antigen, we will utilize B16 and B16-F10 melanoma mouse model and stimulate antitumor immune responses using a single antigen, either Mart-1 or gp100, which are tumor associated antigens expressed by B16 cells. Also, to test a broader source of tumor antigen to be adjuvanted, M8 will be combined with B16 cell lysate or irradiated, GM- CSF expressing B16 cells. Mice with subcutaneously growing B16 cells will be vaccinated subcutaneously with the above antitumor vaccines formulated with or without M8 and compared to standard adjuvants Alum and AddaVax™ squalene-based oil-in-water adjuvant (InvivoGen). Subcutaneous tumor growth will be measured, and splenic cytotoxic T cell responses will be evaluated as described herein. In addition, T cell killing activity of B16 cells will be evaluated by flow cytometry. B16 cells will be labeled with PKH26 and then cocultured with T cells for 4 hours. Early and late apoptosis will be measured among PKFI26+ target cells by using Annexin-FITC and PI, respectively. Identical experiments will be performed with B16-F10 metastatic melanoma.

[0193] Activity of M8 adjuvant in other aggressive and poorly immunogenic tumor settings. T o confirm M8 adjuvant properties for cancer vaccines, M8 adjuvanted vaccines will be tested against other aggressive, poorly immunogenic and transgenic tumor models. MC38 and CT26 colon carcinoma (derived from BALB/c mice) and TC-2 prostate carcinoma (derived from C57BL6/J mice) and the KPC adenocarcinoma model of pancreatic cancer. Tumor bearing mice will be vaccinated with tumor cell lysate or irradiated, GM-CSF expressing tumor cells with or without M8. Tumor growth and immune activation will be monitored as above.

[0194] Characterize M8 stimulation of DC ex vivo for cell immunotherapy. To test the ability of M8 to activate and polarize dendritic cells (DC) ex vivo for tumor cell-based immunotherapy, femur bone collected DC of therapy-naive animals will be expanded in primary cell media. DC will be then pulsed ex-vivo with B16 tumor cell lysates or single Mart-1 or gp100 tumor antigens alone, in combination with the standard activation signal LPS, or in combination with M8. Pulsed DC will be then injected subcutaneously into tumor bearing mice and tumor growth and infiltration of immune cells will be assessed. Tumors will be digested to single cell levels and tumor infiltrating cells will be quantified as follows: 1 ) innate immune compartment, NK cells (NK1 .1 ^hi) and NKT cells (NK1 1 ^hiCD3e^hiCD1 d^hiCD60^hi), and 2) the adaptive compartment will include CD8+ and conventional CD4+ T cells. Effector function of T cells isolated from tumors will be assessed for activation, proliferation, and lytic function by examining the levels of ICOS, Ki-67, and Granzyme B, respectively. Immunosuppressive regulatory T cells (CD4^hiCD25^hiFoxP3^hi) and myeloid-derived suppressor cells (CD1 1 b^hiGr1 ^hi) will be also quantified upon treatments with flow cytometry. Unpulsed DC or DC pulsed with an unrelated protein will be used as negative control. [0195] Elucidation of immune cell/pathway contribution to M8-based immunotherapy. To determine cell type(s) primarily affected upon M8 vaccination, in-depth analysis of tumor cell infiltrates will be performed. Tumors will be digested to single cell levels and tumor infiltrating cells will be quantified: 1 ) innate immune compartment, NK cells (CD3 NK1 .1 ^hi or CD3 DX5+ depending on mouse models) and NKT cells(NK1 1 ^hi(or DX5⁺)CD3e^hiCD1 d^hiCD60^hi), and 2) the adaptive compartment will include analysis of both CD4+ and CD8+ and their subpopulations (IFNg⁺ Th1 , IL4⁺ Th2, IL-17⁺ Th17, and FoxP3⁺CD127 CD25^hi Treg for CD4+ cells; CD8+ cells will be characterized for their memory status by CCR7/CD45RO/CD62L/CD45RA expression levels). Effector function of T cells isolated from tumors will be assessed for activation, proliferation, and lytic function by examining the levels of ICOS, Ki-67, and Granzyme B, respectively. We will also quantify granulocytic (CD1 1 b⁺Ly6G⁺Ly6C'°) and monocytic (CD1 1 b⁺Ly6G Ly6C^hi) myeloid-derived suppressor cells, and characterize macrophages based on their M1/M2 polarization status. Lastly, to determine which cell type(s) primarily mediate therapeutic effects of M8, treatment that yielded best immune responses (as determined in the studies described above) will be repeated in mice with targeted deletions of CD4 or CD8 T cells or in mice that are severely deficient in NK cells. In a separate set of experiments, mice will be depleted for CD4+, CD8+, or NK cells using appropriate depleting antibodies. Adequate cell depletion of each cell subset upon antibody treatment will be confirmed by flow cytometry of peripheral blood. Mice deficient for CD4, CD8 or NK cells will be injected with MC38, B16-F10, or TC-2 cells, vaccinated, and therapeutic effect of M8 will be assessed by examining long-term survival.

[0196] Development of M8 vaccination with immunomodulatory strategies. In order to strengthen vaccine immune responses and overcome tumor-induced immune tolerance, the vaccination strategies described above will be combined with 1 ) low dose chemotherapy to eliminate Treg cells and to reactivate the immune system, or 2) the immunomodulatory antibodies anti-PD1 to activate tumor infiltrating T cells inhibited by tumor microenvironment. Therefore, to test the synergistic effect of chemotherapy with M8-induced vaccination, we will administer one therapeutic dose of cyclophosphamide (which depletes Treg cells) IP prior to vaccination. Then, 1 day later, mice will be vaccinated subcutaneously with the most promising immunization strategies identified above. In parallel, such immunization strategies will be combined with IP injection of anti-PD1 twice a week after vaccination. Tumor growth will be followed over time in both treated and control animals and immune responses will be examined post-vaccination as above.

[0197] Experiments described in this Example will examine whether M8 will augment an effective antitumor immune response when combined with tumor antigens. The results of these studies will also determine which tumor antigen formulation is optimal in combination with M8, and which immune cells mediate the immunostimulatory antitumor effects of M8. Several parameters may be adjusted, such as the dose of M8 and the ratio of M8/tumor antigen concentration, as well as vaccination regimen needed for additional immunomodulatory strategies to overcome immune tolerance and/or boost immune response.

[0198] RIG-I agonists possess many intrinsic advantages over currently approved antiviral and adjuvant therapies, with the capacity to transiently stimulate antiviral, inflammatory and immune modulatory gene networks that bridge innate and adaptive immune responses. Sequence dependent optimization of the RIG-I agonist, coupled with an advanced understanding of the activation pathways, provide a solid foundation for these challenging and ambitious analyses. The discoveries provided herein enable immunostimulatory therapies based on a first-in-class RNA motif targeted against a well-defined immunomodulatory pathway. The programs and research described herein provide antiviral and adjuvant immunotherapies with improved efficacy against different immunogenic and non-immunogenic tumors. As vaccine adjuvants, RNA molecules combine simplicity, safety, and focused immunogenicity with favorable immunological properties: 1 ) an RNA adjuvant is molecularly defined and can target a specific pathway; and 2) RNA is rapidly degraded by ubiquitous RNases, leading to a precise‘hit & run’ stimulation of specific innate pathways and bypass of autoimmune responses that could result from repeated administration. Significant advances in RNA chemistry and delivery have ushered in a new era of RNA-based therapeutics, involving technologies that improve stability and delivery, including lipid-based nanovectors, polymer-mediated delivery systems, and oligonucleotide nanoparticles. Finally, the capacity of the RIG-I agonist to stimulate immune responses to antitumor vaccines is an important challenge for the development of cancer vaccines. Collectively, these studies form the basis of a novel adjuvant-vaccine approach that provides improvements in the efficacy of immunotherapy against cancer.

[0199] As will be understood by one of ordinary skill in the art, each embodiment disclosed herein can comprise, consist essentially of or consist of its particular stated element, step, ingredient or component. Thus, the terms“include” or“including” should be interpreted to recite:“comprise, consist of, or consist essentially of.” The transition term“comprise” or“comprises” means includes, but is not limited to, and allows for the inclusion of unspecified elements, steps, ingredients, or components, even in major amounts. The transitional phrase“consisting of” excludes any element, step, ingredient or component not specified. The transition phrase“consisting essentially of” limits the scope of the embodiment to the specified elements, steps, ingredients or components and to those that do not materially affect the embodiment. A material effect, in this context, results in a statistically relevant change in the effectiveness of the method of composition to treat cancer.

[0200] Unless otherwise indicated, all numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term“about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. When further clarity is required, the term“about” has the meaning reasonably ascribed to it by a person skilled in the art when used in conjunction with a stated numerical value or range, i.e. denoting somewhat more or somewhat less than the stated value or range, to within a range of ±20% of the stated value; ±19% of the stated value; ±18% of the stated value; ±17% of the stated value; ±16% of the stated value; ±15% of the stated value; ±14% of the stated value; ±13% of the stated value; ±12% of the stated value; ±1 1 % of the stated value; ±10% of the stated value; ±9% of the stated value; ±8% of the stated value; ±7% of the stated value; ±6% of the stated value; ±5% of the stated value; ±4% of the stated value; ±3% of the stated value; ±2% of the stated value; or ±1 % of the stated value.

[0201] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0202] The terms“a,”“an,”“the” and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. Recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g.,“such as”) provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.

[0203] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0204] Certain embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations on these described embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventor expects skilled artisans to employ such variations as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0205] Furthermore, numerous references have been made to patents, printed publications, journal articles and other written text throughout this specification (referenced materials herein). Each of the referenced materials are individually incorporated herein by reference in their entirety for their referenced teaching.

[0206] It is to be understood that the embodiments of the invention disclosed herein are illustrative of the principles of the present invention. Other modifications that may be employed are within the scope of the invention. Thus, by way of example, but not of limitation, alternative configurations of the present invention may be utilized in accordance with the teachings herein. Accordingly, the present invention is not limited to that precisely as shown and described.

[0207] The particulars shown herein are by way of example and for purposes of illustrative discussion of the preferred embodiments of the present invention only and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of various embodiments of the invention. In this regard, no attempt is made to show structural details of the invention in more detail than is necessary for the fundamental understanding of the invention, the description taken with the drawings and/or examples making apparent to those skilled in the art how the several forms of the invention may be embodied in practice.

[0208] Definitions and explanations used in the present disclosure are meant and intended to be controlling in any future construction unless clearly and unambiguously modified in the examples or when application of the meaning renders any construction meaningless or essentially meaningless. In cases where the construction of the term would render it meaningless or essentially meaningless, the definition should be taken from Webster's Dictionary, 3rd Edition or a dictionary known to those of ordinary skill in the art, such as the Oxford Dictionary of Biochemistry and Molecular Biology (Ed. Anthony Smith, Oxford University Press, Oxford, 2004).

Claims

LISTING OF CLAIMS

1. A method of treating cancer in a subject in need thereof comprising:

administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide comprising:

a 5' end triphosphate group, and

the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10), thereby treating the cancer in the subject.

2. A method of treating cancer in a subject in need thereof comprising:

administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide comprising:

a 5' end triphosphate group, and

the sequence shown in SEQ ID NO: 1 1 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17,

thereby treating the cancer in the subject.

3. The method of claim 1 or claim 2, wherein the cancer comprises melanoma, adenocarcinoma, carcinoma, or a metastatic cancer.

4. The method of claim 1 or claim 2, wherein the cancer comprises lung cancer, colon cancer, or prostate cancer.

5. The method of claim 1 or claim 2, wherein the sequence of the synthetic oligonucleotide consists of the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10).

6. The method of claim 1 or claim 2 , further administering at least one second anti-cancer agent.

7. A method of inducing death of cancerous cells in a subject, comprising:

administering to the subject a therapeutically effective amount of a synthetic oligoribonucleotide comprising:

a 5' end triphosphate group, and

the sequence shown in M8 (SEQ ID NO: 13), r M5 (SEQ ID NO: 10), SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17,

thereby inducing death of cancerous cells in the subject.

8. The method of claim 7, wherein the cancerous cells comprise melanoma cells, adenocarcinoma cells, carcinoma cells, or metastatic cells.

9. The method of claim 7, wherein the cell death is dependent on caspase 3.

10. The method of claim 7, wherein the cell death is dependent on type I interferon (IFN-I).

11 . The method of claim 7, wherein death of cancerous cells comprises: an increase in expression of chemokines CCL2, CXCL1 , CXCL10, and/or IFNp in the cancerous cells; an increase in surface exposure of calreticulin on the cancerous cells; an increase in secretion of High Mobility Group Box 1 (HMGB1 ) from the cancerous cells; and/or an increase in release of ATP from the cancerous cells, as compared to the corresponding parameter in cancerous cells from the subject prior to the administering.

12. The method of claim 7, wherein administering further elicits immune reactivation in the subject.

13. The method of claim 12, wherein the immune reactivation comprises: an increase in NK activating ligands on the cancerous cells; induction of expression of an NK inhibiting marker on the cancerous cells; induction of antigen processing machinery (APM) genes in the cancerous cells; an increase in expression of CD80, CD86, and/or HLA-DR on dendritic cells from the subject; and/or an increase in IL-12 expression in dendritic cells from the subject, as compared to the corresponding parameter in cancerous cells or dendritic cells from the subject prior to the administering.

14. The method of claim 7, wherein the sequence of the synthetic oligonucleotide consists of the sequence shown in M8 (SEQ ID NO: 13) or M5 (SEQ ID NO: 10).

15. The method of claim 7, further administering at least one second anti-cancer agent.

16. The method of any one of claims 1 , 2, or 6, wherein the therapeutically effective amount comprises at least 0.2 milligrams to at least 5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.2-5 mg/kg/wk).

17. The method of any one of claims 1 , 2, or 6, wherein the therapeutically effective amount comprises at least 0.5 milligrams to at least 2.5 milligrams of the synthetic oligoribonucleotide per kilogram of the subject's body weight per week (0.5-2.5 mg/kg/wk).

18. The method of any one of claims 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered to the subject for at least 1 -52 weeks.

19. The method of any one of claims 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered to the subject 1 -6 times per week.

20. The method of any one of claims 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered 1 -6 times during the first week and 1 time each subsequent week.

21 . The method of any one of claims 1 , 2, or 6, wherein the synthetic oligoribonucleotide is administered in a total weekly dose of any of 10 mg, 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, 500 mg, 525 mg, 550 mg, 575 mg, 600 mg, 625 mg, 650 mg, 675 mg, 700 mg, 725 mg, or 750 mg.

22. The method of any one of claims 1 , 2, or 6, wherein the effective amount is administered at a rate of 5 nM/kg to 100 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body.

23. The method of claim 22, wherein the therapeutically effective amount comprises 15.5 nM/kg to 77.5 nM/kg of the synthetic oligoribonucleotide per kilogram of the subject's body.

24. A cancer vaccine composition comprising

a tumor antigen;

an adjuvant; and

a pharmaceutically acceptable carrier,

wherein the adjuvant comprises a synthetic oligoribonucleotide comprising:

a 5' end triphosphate group, and

the sequence shown in M8 (SEQ ID NO: 13), M5 (SEQ ID NO: 10), SEQ ID NO: 11 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17

25. The cancer vaccine composition of claim 24, wherein the tumor antigen is derived from tumors found in melanoma, skin cancer, prostate cancer, lung cancer, pancreatic cancer, or breast cancer.

26. The cancer vaccine composition of claim 24, wherein the tumor antigen is part of a tumor cell lysate.

27. The cancer vaccine composition of claim 24, wherein the tumor antigen is part of an inactivated cancer cell population.

28. The cancer vaccine composition of claim 24, wherein the tumor antigen is part of an antigen presenting cell (APC) population.

29. The cancer vaccine composition of claim 28, wherein the APC population comprises dendritic cells.

30. The cancer vaccine composition of claim 24, wherein the adjuvant further comprises mineral oil, bacterial toxins, aluminum salts, squalene, virosomes, mineral oil in water emulsions, CpG, lipopolysaccharide (LPS), monophosphoryl lipid A (MPLA), QS21 or AS02, flagellin, peptidoglycans, inactivated bacterial pathogens, and/or RNAse inhibitors.

31 . The cancer vaccine composition of claim 24, wherein the synthetic oligoribonucleotide is in a nanoparticle formulation.

32. The cancer vaccine composition of claim 24, wherein the tumor antigen and the adjuvant are formulated together.

33. The cancer vaccine composition of claim 24, wherein the tumor antigen and the adjuvant are not formulated together.

34. A method for stimulating an immune response against a tumor antigen in a subject at risk of having or having a cancer comprising the tumor antigen, comprising administering to the subject a therapeutically effective amount of the cancer vaccine composition of claim 24.

35. The method of claim 34, further administering at least one second anti-cancer agent.

36. The method of claim 35, wherein the second anti-cancer agent is low dose chemotherapy.

37. The method of claim 36, wherein the second anti-cancer agent is an immune checkpoint inhibitor that blocks programmed cell death protein 1 (PD-1 ).

38. A method of activating antigen presenting cells (APC) ex vivo comprising contacting the APC with the cancer vaccine composition of claim 24.

39. The method of claim 38, further administering the contacted APC to a subject at risk of having or having a cancer comprising the tumor antigen.

40. An immunization kit comprising the cancer vaccine composition of claim 24.