US20030049274A1 - PRRSV vaccines - Google Patents

PRRSV vaccines Download PDF

Info

Publication number
US20030049274A1
US20030049274A1 US09/948,747 US94874701A US2003049274A1 US 20030049274 A1 US20030049274 A1 US 20030049274A1 US 94874701 A US94874701 A US 94874701A US 2003049274 A1 US2003049274 A1 US 2003049274A1
Authority
US
United States
Prior art keywords
prrsv
replicon
nucleic acid
protein
virus
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
US09/948,747
Other languages
English (en)
Inventor
Janneke Meulenberg
Helene Verheije
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Boehringer Ingelheim Vetmedica GmbH
Original Assignee
ID Lelystad Instituut voor Dierhouderij en Diergezondheid BV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ID Lelystad Instituut voor Dierhouderij en Diergezondheid BV filed Critical ID Lelystad Instituut voor Dierhouderij en Diergezondheid BV
Assigned to ID-LELYSTAD, INSTITUUT VOOR DIERHOUDERIJ EN DIERGEZONDHEID B.V. reassignment ID-LELYSTAD, INSTITUUT VOOR DIERHOUDERIJ EN DIERGEZONDHEID B.V. ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: VERHEIJI, HELENE, MEULENBERG, JANNEKE
Publication of US20030049274A1 publication Critical patent/US20030049274A1/en
Assigned to BOEHRINGER INGELHEIM VETMEDICA GMBH reassignment BOEHRINGER INGELHEIM VETMEDICA GMBH ASSIGNMENT OF ASSIGNORS INTEREST (SEE DOCUMENT FOR DETAILS). Assignors: ID-LELYSTAD, INSTITUUT VOOR DIERHOUDERIJ EN DIERGEZONDHEID B.V.
Priority to US11/422,970 priority Critical patent/US8790656B2/en
Abandoned legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/04—Immunostimulants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5256—Virus expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10041—Use of virus, viral particle or viral elements as a vector
    • C12N2770/10043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/10011—Arteriviridae
    • C12N2770/10061—Methods of inactivation or attenuation

Definitions

  • the invention relates to the field of PRRS viruses and infectious clones obtained from PRRS viruses. Furthermore, the invention relates to vaccines and diagnostic assays obtainable by using and modifying such infectious clones of PRRS viruses.
  • Porcine reproductive and respiratory syndrome virus is a positive-strand RNA virus that belongs to the family of arteriviruses together with equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever virus (Meulenberg et al., 1993).
  • EAV equine arteritis virus
  • LDV lactate dehydrogenase-elevating virus
  • simian hemorrhagic fever virus Meulenberg et al., 1993.
  • the International Committee on the Taxonomy of Viruses has decided to incorporate this family in a new order of viruses, the Nidovirales, together with the Coronaviridae (genomic length 28 to 30 kb), and Toroviridae (genomic length 26 to 28 kb).
  • the order Nidovirales represents enveloped RNA viruses that contain a positive-stranded RNA genome and synthesize a 3′ nested set of subgenomic RNAs during replication.
  • the subgenomic RNAs of coronaviruses and arteriviruses contain a leader sequence which is derived from the 5′ end of the viral genome.
  • the subgenomic RNAs of toroviruses lack a leader sequence.
  • the ORFs 1a and 1b, encoding the RNA dependent RNA polymerase are expressed from the genomic RNA
  • the smaller ORFs at the 3′ end of the genomes of Nidovirales, encoding structural proteins are expressed from the subgenomic mRNAs.
  • a replicon herein is defined as derived from a recombinant nucleic acid.
  • genomic information regarding PRRSV is now emerging, it is for example not known where deletions or modifications in the PRRSV genome can be located so that the resulting recombinant nucleic acid can be used as a functional replicon allowing in vivo RNA replication, be it in (complementary) cells expressing essential (PRRS) viral proteins (such as polymerase or structural (envelope) proteins or not, or allowing independent in vivo RNA replication in animals, such as pigs, after vaccination with a vaccine comprising a nucleic acid encoding such a PRRS replicon.
  • PRRS essential viral proteins
  • PRRSV porcine reproductive respiratory syndrome
  • PRRSV preferentially grows in alveolar lung macrophages (Wensvoort et al., 1991).
  • a few cell lines, such as CL2621 and other cell lines cloned from the monkey kidney cell line MA-104 are also susceptible to the virus.
  • Some well known PRRSV strains are known under accession numbers CNCM I-1102, I-1140, I-1387, I-1388, ECACC V93070108, or ATCC VR 2332, VR 2385, VR 2386, VR 2429, VR 2474, and VR 2402.
  • the genome of PRRSV is 15 kb in length and contains genes encoding the RNA dependent RNA polymerase (ORF1a and ORF1b) and genes encoding structural proteins (ORFs 2 to 7; Meulenberg et al., 1993 and Meulenberg et al., 1996).
  • ORF5 encodes the major envelope glycoprotein, designated GP 5 .
  • the ORFs 2, 3, and 4 encode glycoproteins designated GP 2 , GP 3 , and GP 4 , respectively. These glycoproteins are less abundantly present in purified virions of the Lelystad virus isolate of PRRSV.
  • the GP 5 protein forms a di-sulfide-linked heterodimer with the membrane protein M encoded by ORF6.
  • the nucleocapsid protein N is encoded by ORF7.
  • ORF7 The analysis of the genome sequence of PRRSV isolates from Europe and North America, and their reactivity with monoclonal antibodies has proven that they represent two different antigenic types. The isolates from these continents are genetically distinct and must have diverged from a common ancestor relatively long ago (Murtaugh et al., 1995).
  • Pigs can be infected by PRRSV via the oronasal route.
  • Virus in the lungs is taken up by lung alveolar macrophages and in these cells replication of PRRSV is completed within 9 hours.
  • PRRSV travels from the lungs to the lung lymphnodes within 12 hours and to peripheral lymphnodes, bone marrow and spleen within 3 days. At these sites, only a few cells stain positive for viral antigen.
  • the virus is present in the blood during at least 21 days and often much longer. After 7 days antibodies to PRRSV are found in the blood.
  • the combined presence of virus and antibody in PRRS infected pigs shows that the virus infection can persist for a long time, albeit at a low level, despite the presence of antibody.
  • the population of alveolar cells in the lungs is different from normal SPF lungs.
  • PRRSV needs its envelope to infect pigs via the oronasal route and the normal immune response of the pig thus entails among others the production of neutralising antibodies directed against one or more of the envelope proteins; such antibodies can render the virus non-infective.
  • the virus once in the alveolar macrophage, the virus also produces naked capsids, constructed of RNA encapsidated by the M and/or N protein, sometimes partly containing any one of the glycoproteins. The intra- and extracellular presence of these incomplete viral particles or (partly) naked capsids can be demonstrated by electron microscopy. Sometimes, naked capsids without a nucleic acid content can be found.
  • the naked capsids are distributed through the body by the bloodstream and are taken up from the blood by macrophages in spleen, lymphnodes and bonemarrow. These naked but infectious viral capsids can not be neutralised by the antibodies generated by the pig and thus explain the persistence of the viral infection in the presence of antibody. In this way, the macrophage progeny from infected bonemarrow cells is spreading the virus infection to new sites of the body. Because not all bonemarrow macrophage-lineage cells are infected, only a small number of macrophages at peripheral sites are infected and produce virus.
  • PRRSV capsids consisting of ORF7 proteins only, can be formed in the absence of other viral proteins, by for instance infection of macrophages with a recombinant pseudorabies-ORF7 vector virus.
  • the PRV virus was manipulated to contain ORF7 genetic information of PRRSV. After 18 hours post infection, the cytoplasm of infected cells contains large numbers of small, empty spherical structures with the size of PRRS virus nucleocapsids.
  • the existing vaccines can in general not be distinguished from wild type field virus, illustrating the need for a so-called marker vaccine, obtained for example by mutagenesis of the genome, so that vaccinated pigs can be distinghuished from field virus-infected pigs on the basis of differences in serum antibodies.
  • PRRS vaccines being so widely used throughout the world, and being in general not infectious to other animals but pigs, would be attractive candidate vaccines to carry foreign antigens derived from other (porcine) pathogens to provide for protection against those other pathogens, illustrating the need for PRRSV carrier or vector vaccines allowing vaccination against those other pathogens or allowing positive marker identification.
  • PRRSV vaccines combining one or more of these features would be preferred. It is an object of the present invention to provide solutions to these needs.
  • the invention provides a porcine reproductive and respiratory syndrome virus (PRRSV) replicon having at least some of its original PRRSV nucleic acid deletions, herein also comprising substitutions, said replicon capable of in vivo RNA replication, said replicon further having been deprived of at least some of its original PRRSV nucleic acid and/or having been supplemented with nucleic acid derived from a heterologous micro-organism.
  • PRRSV porcine reproductive and respiratory syndrome virus
  • PRRSV can be deprived of quite a large amount of its nucleic acid.
  • An independent and functional PRRSV replicon capable of independent in vivo RNA replication can still exist if the stretch, or fragments thereof, of nucleic acid encoding the ORF2-ORF6, but not an essential element from the ORF7 protein, is deleted and/or modified. Having a replicon wherein such a large stretch of nucleic acid has been deleted or modified opens up a large capacity for the addition to said replicon of heterologous nucleic acid from any other organism than PRRSV, thereby providing a PRRSV vector replicon with large carrier capacities.
  • the inventor provides identification of specific nucleic acid regions in the genome of porcine reproductive and respiratory syndrome virus, that are important for attenuation of the virus, for making it non- or little spreading or for the introduction of a marker, without crippling the viral nucleic acid so much that it can no longer provide in vivo RNA replication. Furthermore, the inventor demonstrates that a PRRSV replicon can be used as vector for the expression of foreign antigens, preferably derived from other (porcine) pathogens, allowing vaccination against those other pathogens and allowing positive marker identification.
  • the minimal sequence requirements for a PRRSV replicon or PRRSV vector replicon as provided by the invention are essential elements comprising the 5′ noncoding region-ORF1a-ORF1b-ORF7-3′ noncoding region, (e.g. from the PRRSV polymerase region) whereby the ORF7 coding region can be deleted further for example according to the data shown in FIG. 2.
  • the invention provides a PRRSV replicon or vector at least comprising essential elements from the PRRSV polymerase region for example as described below and/or comprising at least nucleic acid derived from a essential region of 44 nucleotides between nucleotides 14642 to 14686 in the ORF7 gene (as identified in the nucleic acid sequence of the Lelystad virus isolate of PRRSV, however, the skilled person can easily determine by alignment wherein in any other PRRSV genome said essential element is located).
  • the invention provides a PRRSV replicon comprising at least nucleic acid derived from essential sequence elements from ORF1a and ORF1b, or from the PRRSV polymerase region and having nucleic acid from ORF2, ORF 3, ORF 4, ORF 5, ORF 6, or non-essential elements from ORF7 deleted, allowing insertion of foreign nucleic acid, thereby providing a PRRSV vector replicon having foreign antigen coding capacities.
  • the replicase polyprotein of PRRSV encoded by ORF1 is thought to be cleaved in 13 processing end-products (designated nonstructural proteins—nsps) and a large number of intermediates.
  • the polyprotein is cleaved by protease domains located in nsp1 ⁇ , nsp1 ⁇ , nsp2 and nsp4.
  • Essential PRRSV RNA-dependent RNA polymerase and nucleoside triphosphate-binding/RNA Helicase motifs were identified in nsp9 and nsp10, respectively.
  • Another conserved (essential) domain was found in nsp11, a conserved Cys/His-rich domain was found in nsp10. It has for example been shown that the latter protein plays a role in subgenomic mRNA synthesis.
  • the invention provides a PRRSV replicon capable of independent in vivo RNA replication wherein said replicon is a RNA transcript of an infectious copy cDNA. It has been shown for many positive strand RNA viruses that their 5′ and/or 3′ noncoding regions contain essential signals that control the initiation of plus- and minus-strand RNA synthesis. It was not determined for PRRSV whether these sequences alone are sufficient for replication. As for most RNA viruses, PRRSV contains a concise genome and most of the genetic information is expected to be essential. Furthermore, the maximum capacity for the integration of foreign genes into the PRRSV genome is not yet known. An extra limitation is that the ORFs encoding the structural proteins of PRRSV are partially overlapping. The introduction of mutations in these overlapping regions often results in two mutant structural proteins and therefore is more often expected to produce a nonviable virus.
  • RNA does not express (all) the proteins required for packaging and the production of new particles, the replicon can not spread further, creating an extremely efficient, but safe and not-spreading recombinant vaccine effective against PRRSV and/or heterologous pathogens.
  • the invention provides a replicon according to the invention incapable of N-protein capsid formation.
  • two Cys residues are present at positions 27 and 76 in the N protein sequence and mutating or deleting Cys-27 and Cys-76 from the N protein inhibits the production of infectious particles of PRRSV.
  • the ORF7 gene encoding the N protein was mutated as such that the Cys residues were substituted for Asn and Leu residues, respectively, however, substitution with another amino acid, or deletion of the coding sequence, leads to the desired result as well, as for example can be seen below.
  • infectious particles were not secreted, since the transfer of the supernatant of the transfected BHK-21 cells to macrophages did not result in the production of viral proteins in the macrophages nor in the induction of a cpe.
  • these residues are essential for a proper structure or function or both of the N protein in virus assembly of PRRSV.
  • the N protein is involved in the first steps in virus assembly, the binding of the viral genomic RNA and formation of the capsid structure. Since transcripts of genomic length cDNA clones containing the Cys-27 and/or Cys-76 deletion replicated at the wild type level, the mutations in the Cys residues destroy the binding of the RNA by the N protein. Alternatively, they induce a different structure of the N protein that inhibits the formation of proper capsids.
  • the defect in the encapsidation of the viral RNA genome can be complemented by wild type N protein transiently expressed or continuously expressed in a (BHK-21) cell line. In this way a virus is produced that is able to complete only one round of infection/replication. Therefore such a virus is considered to be a very safe vaccine for protection against PRRSV in pigs.
  • the invention provides a replicon incapable of N-protein capsid formation wherein substitutions in the genome encoding the N protein area containing two antigenic regions designated B and D inhibited the production of infectious virus particles.
  • the B region comprises amino acids 25-30 (QLCQLL), D region; amino acids 51-67 (PEKPHFPLAAEDDIRHH) and amino acids 80-90 (ISTAFNQGAGT) of the N protein of PRRSV.
  • the corresponding sites in VR2332 and other American strains are found when the N proteins of these strains are aligned. Since RNA replication and subgenomic mRNA synthesis appeared to be at the wild type level, these mutations most likely prevented the formation of proper capsids by the N protein.
  • the invention furthermore provides a replicon according to the invention wherein a marker allowing serological discrimination has been introduced.
  • a marker allowing serological discrimination has been introduced.
  • mutagenesis of a single amino acid in the D region (Asp-62 or a.a. corresponding thereto) of protein N results in a replicon that has a different MAb binding profile from PRRSV and all other PRRSV viruses.
  • Such a replicon induces a different spectrum of antibodies in pigs, compared to these other PRRSV isolates. Therefore it can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.
  • a PRRSV replicon lacking one or more (antigenic) fragments of these structural proteins has the advantage that no immune respons, more specifically no antibodies, against these deleted fragments will be formed, for example after vaccination with a vaccine comprising such a replicon.
  • a replicon induces a different spectrum of antibodies in pigs, compared to wild type PRRSV. Therefore it can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.
  • the invention provides a replicon comprising a nucleic acid modification in a virulence marker of PRRSV.
  • Virulence markers of PRRSV have not been elucidated, despite the fact that various differences in virulence have been observed. However, for successfully attenuating a PRRSV or replicon thereof, such knowledge helps in selecting the least virulent, but most immunogenic replicon or virus possible. Now that it is known that deleting or modifying the ORF2 to ORF 6 region is possible without effecting the in vivo RNA replicative properties, such virulence markers can easily be detected.
  • the invention provides replicon comprising a nucleic acid modification in ORF 6 encoding the membrane spanning M-protein. It has been found that the membrane protein is influencing the virus assembly, the stability of the virus, or the virus entry in macrophages, all factors contributing to the virulence of PRRSV.
  • the M protein is the most conserved structural protein among arteriviruses and coronaviruses.
  • the protein is an integral membrane protein containing three N-terminal hydrophobic membrane spanning domains (Rottier, 1995). The protein spans the membrane three times leaving a short N-terminal domain outside the virion and a short C-terminal domain inside the virion.
  • the invention provides a replicon wherein said modification modifies protein M in between its second and third membrane spanning fragment, essential in determining virulence of a specific PRRSV isolate.
  • the invention provides a replicon comprising vABV575.
  • a Thr-59 ⁇ Asn mutation is located between the second and third membrane spanning fragment of M in vABV575. This mutation influences virus assembly, the stability of the virus, or virus entry in the PAMs.
  • the invention furthermore provides a replicon according to the invention wherein said heterologous micro-organism comprises a pathogen.
  • PRRSV specifically infects macrophages, it can be used as a vector for the delivery of important antigens of other (respiratory) agents to this specific cell of the immune system.
  • the infectious cDNA clone enables us to introduce site specific mutations, deletions and insertions into the viral genome.
  • the invention provides a replicon wherein said pathogen is a virus.
  • PRRSV as a vector for the expression of a foreign protein anigen, an HA epitope of the haemagglutinin of influenza A virus.
  • Recombinant PRRSV vector replicons were engineered that produced the HA tag fused to the N- or C-terminus of the N protein.
  • an PRRSV mutant was created that contained the HA-tag as well as the protease 2A of foot-and-mouth-disease virus (FMDV) fused to the N terminus of the N protein.
  • FMDV foot-and-mouth-disease virus
  • the invention provides a vaccine comprising a replicon or vector replicon according to the invention.
  • PRRSV vaccines are now provided with specified antigenicity or immunogenicity that are in for example in addition safe enough for specific groups of pigs, i.e. for young piglets or sows in the third trimester of pregnancy.
  • the invention provides non-spreading PRRSV vaccines, comprising a replicon or vector replicon for example incapable of N-protein capsid formation, or incapable of further infection due to the absence of (fragments of) structural proteins encoded by ORF 2 to 6, without hampering its in vivo RNA replication properties, thereby allowing the production of proteins against which an immune response is desired.
  • the invention provides a vaccine that can be distinguished from wild type field virus, a so-called marker vaccine, obtained for example by mutagenesis of the genome, so that vaccinated pigs can be distinguished from field virus-infected pigs on the basis of differences in serum antibodies.
  • PRRS vaccines being so widely used throughout the world, and being in general not infectious to other animals but pigs, are now provided as vector vaccines to carry foreign antigens derived from other (porcine) pathogens, allowing vaccination against those other pathogens and allowing positive marker identification.
  • a vaccine according to the invention is especially useful for vaccinating pigs, sine the PRRSV is in general very host specific and replicates in macrophages of pigs, thereby targeting an important antigen presenting cell of the immune system.
  • the nucleocapsid protein N (expressed by ORF7) is present as a monomer in purified virions of PRRSV. However, in some experiments we also detected a homodimer of N. For instance when the N protein was immunoprecipitated from purified virions with N-specific MAbs and electrophorezed on a sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE), a protein of 15 kDa was predominantly observed under reduced conditions, whereas a homodimer of 30 kDa was predominantly observed under nonreduced conditions (Meulenberg et al., 1996).
  • SDS-PAGE sodium dodecyl sulfate polyacrylamide gel
  • the N protein of PRRSV contains 4 antigenic sites, designated A-D (Meulenberg et al., 1998). Two sites, B and D, contain epitopes that are conserved in European and North American isolates of PRRSV.
  • A-D The N protein of PRRSV contains 4 antigenic sites.
  • B and D Two sites, B and D, contain epitopes that are conserved in European and North American isolates of PRRSV.
  • B and D contain epitopes that are conserved in European and North American isolates of PRRSV.
  • mutations in the B and D domain that disrupt the binding of N-specific MAbs were introduced in the infectious cDNA clone of PRRSV. Transcripts of the resulting mutant full length cDNA clones were analyzed for RNA replication by detecting the expression of structural proteins and production of infectious virus.
  • Positive strand RNA viruses contain 5′ and 3′ noncoding regions which are essential for replication.
  • the RNA sequences at the 5′ and 3′ end usually have a specific secondary structure which is recognized by the viral RNA dependent RNA polymerase to initiate positive and negative strand synthesis and in the case of arteriviruses subgenomic RNA synthesis.
  • the ORF7 gene was precisely deleted, without affecting the 3′ noncoding region of the virus.
  • RNA of this deletion mutant did not replicate in BHK-21 cells. This suggested that RNA replication signals are present in the coding region of ORF7. The purpose of this study was to further localize these replication signals. By expensive deletion analysis of the coding region and upstream sequences of ORF7 we were able to identify a region of 44 nucleotides in the ORF7 gene that is important for replication of RNA of PRRSV.
  • PRRSV infectious cDNA clone of PRRSV
  • the aim of this study was to identify regions in the PRRSV genome that allow the introduction of foreign antigens that will be exposed to the immune system of the pig after infection with the mutant virus.
  • a first approach we have selected a small epitope of 9 amino acids of human haemagglutinin of influenza A for expression in PRRSV.
  • BHK-21 cells were grown in BHK-21 medium (Gibco BRL), completed with 5% FBS, 10% tryptose phosphate broth (Gibco BRL), 20 mM Hepes pH 7.4 (Gibco BRL) and 200 mM glutamine, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin.
  • Porcine alveolar lung macrophages (PAMs) were maintained in MCA-RPMI-1640 medium, containing 10% FBS, 100 ⁇ g/ml kanamycin, 200 U/ml penicillin and 200 ⁇ g/ml streptomycin.
  • Virus stocks were produced by serial passage of recombinant PRRSV viruses secreted in the culture supernatant of tranfected BHK-21 cells on PAMs. Virus was harvested when PAMs displayed cytopathic effect (cpe) usually 48 hours after infection. Virus titers (expressed as 50% tissue culture infective doses [TCID 50 ] per ml) were determined on PAMs using end point dilution (Wensvoort et al., 1986).
  • the Cys-27 was mutated to Asn by PCR-directed mutagenesis with primers LV108 and LV97.
  • the sequences of primers used in this study are listed in Table 1 .
  • the generated PCR fragment was digested with HpaI and PflmI and inserted in the ORF7 gene in pABV431 digested with the same enzymes. This resulted in plasmid pABV451
  • the Cys-76 was mutated to Leu by PCR-directed mutagenesis with primers LV108 and LV100.
  • the generated fragment was digested with HpaI and ClaI and inserted in the ORF7 gene in pABV431 digested with the same enzymes.
  • pABV452 The mutated ORF7 genes were subsequently transferred to the genomic-length cDNA clone pABV437(Meulenberg et al., 1998) with the unique HpaI (nt 14581) and PacI (nt 14981) site, to create plasmids pABV534-536 (Cys-27 ⁇ Asn) and plasmids pABV472-475 (Cys-76 ⁇ Leu; FIG. 1).
  • Antigenic sites B (amino acids 25-30) and D (amino acids 51-67 and 80-90) of the N protein of PRRSV were mutated by substitution of the amino acids in this region for the corresponding amino acids of respectively EAV and LDV. Plasmids pABV455, pABV463, and pABV453 containing these respective mutation were described previously in Meulenberg et al. (1998). In addition, the Asp at position 62 in the D region of the N protein was mutated to a Tyr in a PCR with primers LV108 and LV188. The sequences of these primers are shown in Table 1.
  • the PCR fragment was digested with HpaI and ClaI and inserted in the ORF7 gene in pABV431 digested with the same enzymes. This resulted in pABV582.
  • the ORF7 genes containing the mutations were inserted in pABV437 using the unique HpaI (nt 14581) and PacI (nt 14981) (FIG. 1).
  • the infectious full-length cDNA clone pABV442 that contains a SwaI restriction site directly downstream of the stopcodon of ORF7 was digested with HpaI and SwaI and ligated. This resulted in clone plasmid pABV521.
  • PCR-mutagenesis was performed with primers LV198 and LV199. The primers used in PCR-mutagenesis are listed and described in Table 1.
  • the generated product was digested with HpaI and NheI and ligated in the corresponding sites of pABV437. This resulted in plasmid pABV627.
  • Primer LV182 contains an AseI site. AseI and NdeI have compatible ends, but ligation of their ends to each other destroys both restriction sites.
  • the PCR fragment was digested with NdeI and AseI and ligated in pABV437 digested with NdeI.
  • the full length clone pABV575 (FIG. 3) that contained the PCR fragment in the proper orientation, lacked the NdeI site at position 14265 and had no other mutations between 12559 and 14265 due to PCR errors was selected for further analysis.
  • PCR-mutagenesis was used to create mutants in the infectious clone of PRRSV.
  • a sequence of 27 nucleotides encoding an epitope of the human haemagglutinin of influenza A (HA-tag; Kolodziej et al., 1991) was introduced directly downstream of the start codon of ORF7 in the PacI mutant of the genome-length cDNA clone of Lelystad Virus (pABV437; Meulenberg et al., 1998).
  • Two sequential PCRs were performed with primers LV192 and LV112 and with primers LV193 and LV112. Primers used to create the PCR-fragments are listed and described in Table 1.
  • both this HA-tag and a sequence of 51 nucleotides encoding the protease 2A of FMDV were introduced directly downstream of the startcodon of ORF7.
  • Two sequential PCR-reactions were performed with primers LV139 and LV112 and with LV140 and LV112.
  • the HA-tag was introduced at the 31 end of the ORF7 gene in a PCR with primers LV108 and LV194.
  • the three PCR fragments obtained were digested with HpaI and PacI and ligated into pABV437 digested with the same enzymes. Standard cloning procedures were performed essentially as described in Sambrook et al., (1989).
  • Plasmids were transformed into Escherichia coli DH5 ⁇ and grown at 32° C. and 20 ⁇ g kanamycin per ml. For each construct two clones containing fragments of two independent PCRs were sequenced to confirm the correct sequence of the clones.
  • Introduction of the HA epitope at the 5′ end of ORF7 resulted in the generation of clone pABV525, introduction of both the HA-tag and the protease 2A at the 5′ end of ORF7 resulted in clone pABV523, and the introduction of the HA-epitope at the 3′ end of ORF7 resulted in clone pABV526 (FIG. 4).
  • BHK-21 cells were seeded in 35-mm wells (approximately 10 6 cells/well) and were transfected with 2.5 ⁇ g in vitro transcribed RNA mixed with 10 ml lipofectin in optimem as described earlier (Meulenberg et al., 1998).
  • RNA was introduced in BHK-21 cells in 20-mm wells with 0.5 ⁇ g in vitro transcribed RNA mixed with 2 ml lipofectin in optimem.
  • the medium was harvested 24 h after transfection, and transferred to CL2621 cells or PAMs to rescue infectious virus.
  • IPMA immunoperoxidase monolayer assay
  • a panel of MAbs (122.17, 125.1, 126.9, 126.15, 130.2, 130.4, 131.7, 131.9, 138.22, WBE1, WBE4, WBE5, WBE6, SDOW17, NS95, and NS99) directed to four different antigenic sites A-D were used to study the expression of the N protein (Meulenberg et al., 1998).
  • MAb 12CAS was used to detect the expression of the HA-epitope and was purchased from Boehringer Mannheim.
  • PRRSV proteins were analyzed by metabolic labeling of transfected or infected cells, followed by immunoprecipitation using specific monoclonal antibodies or peptide sera directed to the structural proteins of PRRSV, as described by Meulenberg et al (1996).
  • the culture supernatant of the PAMs infected with passage 3 of the HA-expressing viruses was used to analyze viral RNA by RT-PCR.
  • a volume of 500 ⁇ l proteinase K buffer (100 mM Tris-HCl [pH 7.2], 25 mM EDTA, 300 mM NaCl, 2% [wt/vol] sodium dodecyl sulfate) and 0.2 mg Proteinase K was added to 500 ⁇ l supernatant. After incubation for 30 minutes at 37° C., the RNA was extracted with phenol-chloroform and precipitated with ethanol. The RNA was reverse transcibed with primer LV76.
  • PCR was performed with primers LV37 and LV112 to amplify fragments of vABV523 and vABV525 and with primers LV37 and LV75 to amplify fragments of vABV526 (Table 1). Sequence analysis was performed to determine whether the mutant viruses at passage 4 still contained the inserted foreign sequences.
  • the N protein expressed by pABV472-475 (Cys-76 ⁇ Leu) resembled the wild type N protein and was mainly detected as a dimer, whereas the N protein expressed by pABV534-536 (Cys-27 ⁇ Asn) was detected as a monomer. This indicated that the Cys residue at position 27 was responsible for the formation of nonspecific disulfide bonds.
  • the production of other structural proteins such as GP 3 , GP 4 , and M was also detected in IPMA and immuno precipitation after transfection of full length RNA from plasmids pABV534-536 (Cys-27 ⁇ Asn) and pABV472-475 (Cys-76 ⁇ Leu: FIG. 1).
  • Site B amino acids 25-30
  • D amino acids 51-67 and 80-90
  • Site B and D amino acids 51-67 and 80-90
  • pABVS27-533 containing a mutated B site (amino acids 25-30), pABV537-539 containing a mutated D domain (amino acids 51-67), and pABV512-515 containing a mutated D domain (amino acids 80-90) (FIG. 1).
  • RNA of these full length clones was transfected to BHK-21 cells, these cells stained positive with N-specific MAbs at 24 h after transfection.
  • the N protein expressed by pABV527-533 was recognized by A-, C-, and D-specific MAbs, but not by B-specific MAbs.
  • the N protein expressed by pABV537-539 and pABV512-515 was recognized by A-, B-, and C-specific MAbs but not by D-specific MAbs.
  • the supernatant of the BHK-21 cells transfected with transcripts from pABV600 was transferred to PAMs, cpe was detected at 2-3 days after inoculation.
  • the mutant virus VABV600 was further typed with a panel of N-specific MAbs (Table 2).
  • pABV575 RNA and pABV437 RNA an equal number of cells stained positive in IPMA with M-specific and N-specific MAbs (FIG. 3). Furthermore, the intensity of the staining was similar.
  • HA-tag An epitope of the haemagglutinin of influenza A (HA-tag; Kolodziej et al., 1991) was expressed by different recombinant PRRSV viruses.
  • the HA epitope was chosen as foreign antigen for expression in PRRSV mainly for two reasons; First, the tag has a limited size (27 nucleotides), which reduces the chance to disturb the replication of the virus or the expression or function of the protein to which it is fused. Second, antibodies to detect the expression of this epitope are available.
  • the HA-tag was introduced at the 5′ end of ORF7 (pABV525), and at the 3′ end of ORF7 (pABV526; FIG.
  • PAMs not only stained positive with MAbs directed against the PRRSV proteins GP 3 , GP 4 , M protein and N protein in IPMA, but also with MAb 12CA5 directed against the HA epitope.
  • PAMs were double stained, both with MAbs against the HA-tag and the N protein, we also detected PAMs which could only be stained with the MAb against the N protein but not with that against the HA-tag.
  • the percentage of cells that stained only with N-specific Mabs was higher than for the viruses derived form pABV523, which contained the additional protease 2A.
  • HA-tag directly attached to the N- or C-terminus of the N protein disturbed to some extent either the packaging of the viral RNA or the infectivity of the virus.
  • protease 2A was introduced to cleave the HA-tag from the N protein by the protease 2A, the fitness of the resulting virus (vABV523) was not or hardly reduced (FIG. 4).
  • the recombinant viruses were designated vABV523, vABV525 and vABV526.
  • protease 2A activity in vABV523 The activity of the protease 2A was further analyzed by radioimmunoprecipitation. Besides a 15 kDa protein, an additional protein of approximately 18 kDa was immunoprecipitated with N-specific MAb 122.17 from cells transfected with transcripts of pABV523. The 15 kDa protein was similar in size to the wild type N protein; the 18 kDa protein resembled the expected size of the polyprotein of HA-protease 2A-N. These data indicated that protease 2A of FMDV is able to cleave the HA-protease 2A-N polyprotein in the cell, which results in the release of the HA-tag from the N protein.
  • the amount of virus produced by BKH-21 cells transfected with transcripts from pABV437 and pABV523 was generally higher than that produced by BHK-21 cells transfected with transcripts from pABV525 and pABV526.
  • the defect in the encapsidation of the viral RNA genome can be complemented by wild type N protein transiently expressed or continuously expressed in a (BHK-21) cell line. In this way a virus is produced that is able to complete only one round of infection/replication. Therefore such a virus is considered to be a very safe vaccine for protection against PRRSV in pigs.
  • the aim of this study was to create mutant PRRS viruses that can be serologically differentiated from field virus and therefore may be promising mutants for marker vaccine development against PRRSV.
  • the N protein was chosen as a first candidate for mutagenesis to create a virus with a serologic marker since many studies have shown that the N protein is the most antigenic protein of PRRSV. For example, pigs infected with PRRSV develop strong antibody responses against the N protein of PRRSV (Meulenberg et al., 1995). In addition, the N protein contains two antigenic regions designated B and D that are conserved in European and US PRRSV isolates and MAbs directed to these regions are available (Meulenberg. et al., 1998).
  • vABV600 mutagenesis of a single amino acid in the D region (Asp-62 ⁇ Tyr) resulted in virus vABV600 that had a different MAb binding profile from PRRSV and all other PRRSV Viruses.
  • vABV600 induces a different spectrum of antibodies in pigs, compared to these other PRRSV isolates. Therefore vABV600 can be differentiated from field virus on the basis of serum antibodies and is an excellent mutant for further development of marker vaccines against PRRSV.
  • RNA of PRRSV A more systematic deletion analysis showed that a region of 44 nucleotides between nucleotides 14644 to 14687 in the ORF7 gene was important for replication of RNA of PRRSV. This was an essential interesting finding, since the sequences essential for replication of most positive strand RNA viruses are present in the 5′ and 3′ noncoding regions. It is also an important finding for studies who's aim is to develop viral replicons which can only be rescued in complementing cell lines expressing the deleted ORFs. The minimal sequence requirements for these RNAs are 5′ noncoding region-ORF1a-ORF1b-ORF7-3′ noncoding region.
  • Viral RNA s or replicons containing these sequence elements supplemented with a selection of fragments from other PRRSV open reading frames or fragments of open reading frames expressing antigens of other (heterologous) pathogens can be packaged into virus particles when the proteins essential for virus assembly are supplied in trans. When these particles are given to pigs, for example as vaccine, they will enter specific host cells such as macrophages and virus- or heterologous antigens are expressed and induce immune responses because of the replicating RNA.
  • RNA does not express (all) the proteins required for packaging and the production of new particles
  • the replicon can not spread further, creating an extremely efficient, but safe and not-spreading recombinant vaccine effective against PRRSV and/or heterologous pathogens.
  • the M protein is the most conserved structural protein among arteriviruses and coronaviruses.
  • the protein is an integral membrane protein containing three N-terminal hydrophobic membrane spanning domains (Rottier, 1995). The protein spans the membrane three times leaving a short N-terminal domain outside the virion and a short C-terminal domain inside the virion.
  • the M protein of coronaviruses was shown to play an important role in virus assembly (Vennema et al., 1996).
  • the Thr-59 ⁇ Asn mutation is located between the second and third membrane spanning fragment of M in AB575. This mutation influences virus assembly, the stability of the virus, or virus entry in the PAMs.
  • PRRSV as a vector for the expression of a foreign antigen, an HA epitope of the haemagglutinin of influenza A virus.
  • Recombinant PRRSV viruses were engineered that produced the HA tag fused to the N- or C- terminus of the N protein.
  • a PRRSV mutant was created that contained the HA-tag as well as the protease 2A of FMDV fused to the N terminus of the N protein.
  • the protease 2A was functionally active in the context of the PRRSV virus, and cleaved the HA-tag from the N protein.
  • the ORF7 gene was selected for insertion of the HA-tag mainly for two reasons; (I) The subgenomic RNA7 expressing this gene is the most abundant subgenomic RNA produced in infected cells and (II) the HA-tag could be inserted without mutating other ORFs since ORF7 has very little overlap with ORF6 at the 5′ end and no overlap with other ORFs at the 3′ end. However, similar constructs can be made by introducing the HA-tag and protease 2A at the 5′ end of ORP2 and at the 5′ end of ORF5 without affecting other ORFs.
  • FIG. 1 Properties of full length cDNA clones of PRRSV containing mutations in the ORF7 gene.
  • the mutated ORF7 genes were inserted in infectious cDNA clone pABV437 with the unique HpaI and PacI site that are indicated.
  • the plasmid (pABV) numbers of the resulting constructs are shown.
  • RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones in BHK-21 cells. N protein production was determined in IPMA or immunoprecipitation. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMs and detection of cpe.
  • FIG. 2 Properties of full length cDNA clones of PRRSV containing deletions in the region encoding the structural proteins of LV in order to elucidate the presence of replication signals in this region.
  • the deleted regions (dotted bars), the regions of ORF7 still present (dark bars) and the plasmid (pABV) numbers of the resulting clones are shown.
  • RNA replication was determined by detecting the expression of structural proteins, and the expression of the N-protein in particular, both in IPMA. Production of infectious virus was established by infecting PAMs with the supernatant of transfected BHK-21 cells. IPMA was performed to detect the expression of LV-proteins.
  • FIG. 3 Properties of infectious cDNA clone pABV575. This clone was constructed by mutation of the NdeI site at position 14265 in ORF6. RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones in BHK-21 cells. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMs and detection of cpe.
  • FIG. 4 Introduction of an antigenic marker in the infectious clone of PRRSV.
  • the insertion of the HA tag and protease 2A sequence in plasmids pABV 525, 523 and 526 is indicated.
  • RNA replication was determined by detecting the expression of structural proteins in IPMA after transfection of the transcripts of the full length cDNA clones.
  • the expression of N and HA was also determined in IPMA. Production of infectious virus was established by transfer of the supernatant of transfected BHK-21 cells to PAMS and detection of cpe.
  • 5′ORF7 LV189 (14796) 5′ACGTGC GTTAAC TAAATCCGGCACCACCTCACCCA 3′ + ⁇ 198 nt.
  • 5′ORF7 LV190 (14885) 5′ACGTGC GTTAAC TAAGGGAAGGTCAGTTTTCAGGT 3′ + ⁇ 297 nt.
  • 5′ORF7 LV191 (14936) 5′ACGTGC GTTAAC TAACGCCTGATTCGCGTGACTTC 3′ + ⁇ 348 nt.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
US09/948,747 1996-10-30 2001-09-07 PRRSV vaccines Abandoned US20030049274A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US11/422,970 US8790656B2 (en) 1996-10-30 2006-06-08 PRRSV vaccines

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP99200668.4 1999-03-08
EP99200668 1999-03-08
PCT/NL2000/000152 WO2000053787A1 (en) 1999-03-08 2000-03-08 Prrsv vaccines

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
PCT/NL2000/000152 Continuation WO2000053787A1 (en) 1996-10-30 2000-03-08 Prrsv vaccines
US09/874,626 Continuation-In-Part US20020098573A1 (en) 1996-10-30 2001-06-05 Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US11/422,970 Continuation US8790656B2 (en) 1996-10-30 2006-06-08 PRRSV vaccines

Publications (1)

Publication Number Publication Date
US20030049274A1 true US20030049274A1 (en) 2003-03-13

Family

ID=8239954

Family Applications (2)

Application Number Title Priority Date Filing Date
US09/948,747 Abandoned US20030049274A1 (en) 1996-10-30 2001-09-07 PRRSV vaccines
US11/422,970 Expired - Fee Related US8790656B2 (en) 1996-10-30 2006-06-08 PRRSV vaccines

Family Applications After (1)

Application Number Title Priority Date Filing Date
US11/422,970 Expired - Fee Related US8790656B2 (en) 1996-10-30 2006-06-08 PRRSV vaccines

Country Status (7)

Country Link
US (2) US20030049274A1 (pl)
EP (1) EP1157121B1 (pl)
JP (1) JP3961222B2 (pl)
AU (1) AU3198200A (pl)
CA (1) CA2366072C (pl)
PL (1) PL204373B1 (pl)
WO (1) WO2000053787A1 (pl)

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040197872A1 (en) * 1996-10-30 2004-10-07 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US20040224327A1 (en) * 1996-10-30 2004-11-11 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US20050137705A1 (en) * 1999-10-22 2005-06-23 Reiley Mark A. Facet arthroplasty devices and methods
US20060240041A1 (en) * 1996-10-30 2006-10-26 Meulenberg Johanna J M PRRSV Vaccines
US20070042000A1 (en) * 1999-04-22 2007-02-22 Mengeling William L Porcine reproductive and respiratory syndrome vaccine based on isolate ja-142
US20080311143A1 (en) * 2007-06-15 2008-12-18 Protatek International, Inc. Construction of chimera prrsv, compositions and vaccine preparations
US20090130143A1 (en) * 2005-02-25 2009-05-21 Dongwan Yoo N protein mutants of porcine reproductive and respiratory syndrome virus
US20100035276A1 (en) * 2004-06-18 2010-02-11 Regents of of the University of Minnesota Identifying virally infected and vaccinated organisms
US20110059126A1 (en) * 2009-09-02 2011-03-10 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in pcv-2 compositions and pcv-2 compositions with an improved immunogenicity
US20110117129A1 (en) * 2008-08-25 2011-05-19 Boehringer Ingelheim Vetmedica, Inc. Vaccine Against Highly Pathogenic Porcine Reproductive and Respiratory Syndrome (HP PRRS)
US20110195088A1 (en) * 2004-09-21 2011-08-11 Boehringer Ingelheim Vetmedica, Inc. Porcine Reproductive and Respiratory Syndrome Isolates and Methods of Use
US8765142B2 (en) 2011-02-17 2014-07-01 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US9080143B2 (en) 2005-06-24 2015-07-14 University Of Minnesota PRRS viruses, infectious clones, mutants thereof, and method of use
US9187731B2 (en) 2011-07-29 2015-11-17 Boehringer Ingelheim Vetmedica Gmbh PRRS virus inducing type I interferon in susceptible cells
US9315781B2 (en) 2011-07-29 2016-04-19 Boehringer Ingelheim Vetmedica Gmbh Infectious CDNA clone of european PRRS virus and uses thereof
US9579373B2 (en) 2013-03-15 2017-02-28 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome virus, compositions, vaccine and methods of use
US9944902B2 (en) 2011-02-17 2018-04-17 Boehringer Ingelheim Vetmedica Gmbh Commercial scale process for production of PRRSV
US10010601B2 (en) 2013-12-20 2018-07-03 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, European PRRS virus cDNA clone, and uses thereof
CN114395583A (zh) * 2021-11-01 2022-04-26 扬州大学 一种表达分泌型荧光素酶的猪繁殖与呼吸综合征病毒的cDNA克隆及其构建方法与应用

Families Citing this family (16)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1156111A1 (en) * 2000-05-19 2001-11-21 Stichting Dienst Landbouwkundig Onderzoek Chimeric arterivirus-like particles
SK11282003A3 (sk) * 2001-03-09 2004-02-03 Boehringer Ingelheim Vetmedica Gmbh Oslabený európsky PRRS vírus, nukleotidová sekvencia kódujúca vírus, spôsob generovania infekčného živého oslabeného PRRS vírusu, bunková línia a farmaceutický prostriedok s jeho obsahom a jeho použitie
EP1397498A1 (en) * 2001-05-21 2004-03-17 ID-Lelystad, Instituut voor Dierhouderij en Diergezondheid B.V. Delections in arterivirus replicons
US7595054B2 (en) * 2003-06-09 2009-09-29 Healthbanks Biotech Co., Ltd. Fusion antigen used as vaccine
US8206950B2 (en) * 2003-06-09 2012-06-26 Animal Technology Institute Taiwan Fusion antigen used as vaccine and method of making them
WO2006093797A2 (en) 2005-02-28 2006-09-08 Mj Biologics, Inc. Method and kit for detecting porcine reproductive and respiratory syndrome virus
KR20080064813A (ko) * 2005-08-30 2008-07-09 보드 오브 리젠츠 오브 디 유니버시티 오브 네브라스카 면역원성이 증강된 ｐｒｒｓｖ 항원을 사용하는 동물의백신화 방법 및 조성물
CN101848995A (zh) * 2007-06-25 2010-09-29 南达科他州立大学 重组的北美1型猪繁殖与呼吸综合征病毒及使用方法
US20090246226A1 (en) * 2008-03-28 2009-10-01 Zeon Corporation Avian vaccines possessing a positive marker gene
CN101748125B (zh) * 2008-12-11 2012-05-30 中国科学院动物研究所 用于治疗和/或预防猪繁殖与呼吸综合征的siRNA片段及其应用
CA2800824A1 (en) 2010-06-02 2011-12-08 Virginia Tech Intellectual Properties, Inc. Novel modified live-attenuated vaccines (mlv) and subunit vaccines created by dna shuffling against porcine reproductive and respiratory syndrome virus (prrsv)
EP2714077B1 (en) * 2011-06-01 2018-02-28 Merial, Inc. Needle-free administration of prrsv vaccines
CN103087996B (zh) * 2013-01-18 2014-07-16 中国农业大学 重组猪繁殖与呼吸综合征病毒及其制备方法与应用
CN104991061B (zh) * 2015-06-12 2017-04-12 中国农业科学院哈尔滨兽医研究所 基于ipma的小反刍兽疫病毒抗体检测试剂盒
US10279031B2 (en) 2016-05-11 2019-05-07 Phibro Animal Health Corporation Composition comprising antigens and a mucosal adjuvant and a method for using
CN111748530B (zh) * 2020-07-20 2023-08-15 河南省农业科学院 一种提高猪繁殖与呼吸综合征病毒体外培养感染量的方法及其应用

Citations (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3137631A (en) * 1959-12-01 1964-06-16 Faberge Inc Encapsulation in natural products
US3959457A (en) * 1970-06-05 1976-05-25 Temple University Microparticulate material and method of making such material
US4015100A (en) * 1974-01-07 1977-03-29 Avco Everett Research Laboratory, Inc. Surface modification
US4205060A (en) * 1978-12-20 1980-05-27 Pennwalt Corporation Microcapsules containing medicament-polymer salt having a water-insoluble polymer sheath, their production and their use
US4452747A (en) * 1982-03-22 1984-06-05 Klaus Gersonde Method of and arrangement for producing lipid vesicles
US4606940A (en) * 1984-12-21 1986-08-19 The Ohio State University Research Foundation Small particle formation and encapsulation
US4744933A (en) * 1984-02-15 1988-05-17 Massachusetts Institute Of Technology Process for encapsulation and encapsulated active material system
US4921706A (en) * 1984-11-20 1990-05-01 Massachusetts Institute Of Technology Unilamellar lipid vesicles and method for their formation
US4927637A (en) * 1989-01-17 1990-05-22 Liposome Technology, Inc. Liposome extrusion method
US4944948A (en) * 1989-02-24 1990-07-31 Liposome Technology, Inc. EGF/Liposome gel composition and method
US5008050A (en) * 1984-06-20 1991-04-16 The Liposome Company, Inc. Extrusion technique for producing unilamellar vesicles
US5009956A (en) * 1987-02-24 1991-04-23 Univ Minnesota Phospholipase A2-resistant liposomes
US5132117A (en) * 1990-01-11 1992-07-21 Temple University Aqueous core microcapsules and method for their preparation
US5476778A (en) * 1991-08-26 1995-12-19 Boehringer Ingelheim Animal Health, Inc. Method of growing and attenuating a viral agent associated with mystery swine disease
US5510258A (en) * 1993-02-08 1996-04-23 Bayer Corporation Porcine reproductive and respiratory syndrome virus antigen and processes for the preparation and use of said antigen in vaccines and diagnostics
US5620691A (en) * 1991-06-06 1997-04-15 Stichting Centraal Diergeneeskundig Instituut Causative agent of the mystery swine disease, vaccine compositions and diagnostic kits
US5677429A (en) * 1991-08-26 1997-10-14 South Dakota State University Monoclonal antibodies to the Mystery Swine Disease virus
US5690940A (en) * 1995-06-21 1997-11-25 Regents Of The University Of Minnesota Low pathogencity PRRS live virus vaccines and methods of preparation thereof
US5695766A (en) * 1992-10-30 1997-12-09 Iowa State University Research Foundation Highly virulent porcine reproductive and respiratory syndrome viruses which produce lesions in pigs and vaccines that protect pigs against said syndrome
US5840563A (en) * 1991-08-26 1998-11-24 Boehringer Ingelheim Animal Health, Inc. Method for growing swine infertility and respiratory syndrome virus
US5998601A (en) * 1994-08-05 1999-12-07 Regents Of The University Of Minnesota VR-2332 viral nucleotide sequence and methods of use
US6251397B1 (en) * 1992-10-30 2001-06-26 Iowa State University Research Foundation, Inc. Proteins encoded by polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus and immunogenic compositions containing the same
US6495138B1 (en) * 1997-05-06 2002-12-17 Stichting Dienst Landbouwkundig Onderzoek PRRSV antigenic sites identifying peptide sequences of PRRS virus for use in vaccines or diagnostic assays
US6500662B1 (en) * 1998-12-22 2002-12-31 Pfizer Inc. Infectious cDNA clone of North American porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof
US20030157689A1 (en) * 1998-12-22 2003-08-21 Calvert Jay G. Infectious cDNA clone of North American porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof

Family Cites Families (72)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3080291A (en) * 1960-06-10 1963-03-05 Jensen Salsberg Lab Inc Serial passage of distemper virus in tissue cultures of chick embryo and canine tissue and vaccine therefrom
US4122167A (en) * 1977-02-09 1978-10-24 Merck & Co., Inc. Respiratory synctial vaccine
US4224412A (en) * 1979-05-01 1980-09-23 Dorofeev Viktor M Living virus culture vaccine against canine distemper and method of preparing same
US4554159A (en) * 1981-11-12 1985-11-19 Institute Merieux Vaccine and method of immunizing against herpes simplex virus (types 1 and 2)
US4468346A (en) * 1983-10-27 1984-08-28 The United States Of America As Represented By The Secretary Of Agriculture Monoclonal antibodies to porcine immunoglobulins
DE3405100A1 (de) * 1984-02-14 1985-08-14 Drägerwerk AG, 2400 Lübeck Pt-katalysator auf einem traeger als luftreinigungsmittel
US5206163A (en) * 1985-07-08 1993-04-27 Chiron Corporation DNA encoding bovine diarrhea virus protein
US4753884A (en) * 1986-01-28 1988-06-28 Novagene, Inc. Pseudorabies virus mutants, vaccines containing same, methods for the production of same and methods for the use of same
FR2602791B1 (fr) 1986-08-18 1988-11-10 Ministere Agri Direction Quali Procede de culture du virus de la rhinotracheite infectieuse de la dinde, et vaccin prepare a partir du virus ainsi obtenu
NZ222465A (en) 1986-11-07 1992-11-25 Pasteur Institut Nanb (non a, non b hepatitis viral) antigen
DE3833925A1 (de) 1988-03-11 1989-09-21 Inst Angewandte Biotechnologie Verfahren und herstellung von virus und viralem antigen und vorrichtung hierzu
US5213759A (en) * 1988-05-05 1993-05-25 Elopak Systems A.G. Sterilization
AU7007491A (en) 1990-02-02 1991-08-08 Schweiz. Serum- & Impfinstitut Bern Cdna corresponding to the genome of negative-strand rna viruses, and process for the production of infectious negative-strand rna viruses
US6982160B2 (en) * 1991-08-26 2006-01-03 Boehringer Ingelheim Vetmedica, Inc. Immunogenic compositions that include SIRS virus
US6080570A (en) * 1991-08-26 2000-06-27 Boehringer Ingelheim Vetmedica, Inc. Method of producing a vaccine for Swine Infertility and Respiratory Syndrome
US6042830A (en) 1992-08-05 2000-03-28 Boehringer Ingelheim Vetmedica, Inc. Viral agent associated with mystery swine disease
WO1993006211A1 (en) 1991-09-16 1993-04-01 Collins James E Vaccine for mystery swine disease and method for diagnosis thereof
DE69206631T2 (de) 1991-10-14 1996-05-15 Akzo Nobel Nv Impfstoff gegen das Fortpflanzungs- und Atmungssyndrom bei Schweinen (PRRS) und Diagnose.
FR2686097B1 (fr) 1992-01-14 1994-12-30 Rhone Merieux Preparation d'antigenes et de vaccins de virus de la mystery disease, antigenes et vaccins obtenus pour la prevention de cette maladie.
US5338543A (en) * 1992-02-27 1994-08-16 Ambico, Inc. Thimerosal inactivated mycoplasma hyopneumoniae vaccine
TW289731B (pl) * 1992-07-09 1996-11-01 Akzo Nv
US6773908B1 (en) * 1992-10-30 2004-08-10 Iowa State University Research Foundation, Inc. Proteins encoded by polynucleic acids of porcine reproductive and respiratory syndrome virus (PRRSV)
US6592873B1 (en) * 1992-10-30 2003-07-15 Iowa State University Research Foundation, Inc. Polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus (PRRSV) and proteins encoded by the polynucleic acids
US6380376B1 (en) * 1992-10-30 2002-04-30 Iowa State University Research Foundation Proteins encoded by polynucleic acids of porcine reproductive and respiratory syndrome virus (PRRSV)
US5419907A (en) * 1992-11-10 1995-05-30 Iowa State University Research Foundation, Inc. Pathogenic porcine respiratory coronavirus
ES2074950B1 (es) 1993-09-17 1996-03-16 Iberica Cyanamid Vacuna para la prevencion de la enfermedad reproductiva y respiratoria de la cerda.
EP0659885A1 (en) * 1993-12-21 1995-06-28 Akzo Nobel N.V. Vaccine against viruses associated with antibody-dependent-enhancement of viral infectivity
DE4407489A1 (de) * 1994-03-07 1995-09-14 Bayer Ag Vakzine zur Prävention von Respirations- und Reproduktionserkrankungen des Schweines
EP0676467B1 (en) * 1994-04-11 2001-10-04 Akzo Nobel N.V. European vaccine strains of the porcine reproductive respiratory syndrome virus (PRRSV)
WO1995028227A1 (en) 1994-04-15 1995-10-26 Temple University Aqueous solvent encapsulation method, apparatus and microcapsules
GB2289279B (en) 1994-05-13 1998-09-16 Iberica Cyanamid Diagnostic kits and vaccines containing recombinant PRRSV proteins
DE69632658T2 (de) 1995-03-14 2005-06-09 Akzo Nobel N.V. Expression in der selben Zelle von Polypeptide vom schweinen reproduktiven und respiratorischen Syndrom
ES2102971B1 (es) * 1996-01-25 1998-03-01 Hipra Lab Sa Nueva cepa atenuada del virus causante del sindrome respiratorio y reproductivo porcino (prrs), las vacunas y medios de diagnostico obtenibles con la misma y los procedimientos para su obtencion.
US6015663A (en) * 1996-03-01 2000-01-18 The United States Of America As Represented By The Secretary Of Agriculture Restriction enzyme screen for differentiating porcine reproductive and respiratory syndrome virus strains
US5866401A (en) * 1996-03-01 1999-02-02 Schering Corporation Porcine reproductive and respiratory syndrome vaccine
JP3135069B2 (ja) 1996-03-01 2001-02-13 シェーリング コーポレイション ブタ生殖および呼吸症候群ワクチン
US5976537A (en) * 1996-07-02 1999-11-02 The United States Of America As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine
ATE199022T1 (de) * 1996-10-09 2001-02-15 Akzo Nobel Nv Europäische vakzinstämme des fortplanzungs- atmungs-syndromsvirus des sweins (prrsv)
US20040224327A1 (en) * 1996-10-30 2004-11-11 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
EP0839912A1 (en) * 1996-10-30 1998-05-06 Instituut Voor Dierhouderij En Diergezondheid (Id-Dlo) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
WO1998035023A1 (en) 1997-02-07 1998-08-13 Origen, Inc. Method for growing porcine reproductive and respiratory syndrome virus for use as vaccines and diagnostic assays
AU7960598A (en) * 1997-06-05 1998-12-21 Origen, Inc. Recombinant porcine reproductive and respiratory syndrome virus (prrsv) for use as a vaccine
US7211379B2 (en) * 1997-10-03 2007-05-01 Merial Sas Prevention of myocarditis, abortion and intrauterine infection associated with porcine circovirus-2
US6391314B1 (en) * 1997-10-03 2002-05-21 Merial Porcine circoviruses vaccines diagnostic reagents
US7618797B2 (en) 1998-12-22 2009-11-17 Pfizer Inc Infectious cDNA clone of North American porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof
US7691389B2 (en) 1998-12-22 2010-04-06 Pfizer Inc Infectious cDNA clone of north american porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof
FR2789695B1 (fr) * 1999-02-11 2003-03-07 Merial Sas Vecteurs et vaccins viraux a base d'adenovirus porcins recombines et replicatifs
CA2366072C (en) 1999-03-08 2007-07-10 Id-Lelystad, Instituut Voor Dierhouderij En Diergezondheid B.V. Prrsv vaccines
CA2650236C (en) 1999-04-22 2016-01-12 United States Of America, As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine, based on isolate ja-142
US20040213805A1 (en) * 1999-10-12 2004-10-28 Verheije Monique Helene Deletions in arterivirus replicons
US20020012670A1 (en) * 2000-01-26 2002-01-31 Knut Elbers Recombinant attenuation of porcine reproductive and respiratory syndrome (PRRSV)
EP1255815B1 (en) 2000-02-08 2006-07-19 Regents Of The University Of Minnesota Porcine reproductive and respiratory syndrome virus and methods of use
EP1156111A1 (en) 2000-05-19 2001-11-21 Stichting Dienst Landbouwkundig Onderzoek Chimeric arterivirus-like particles
US7018638B2 (en) * 2000-12-19 2006-03-28 Wyeth Mycoplasma hyopneumoniae bacterin vaccine
EP1397498A1 (en) 2001-05-21 2004-03-17 ID-Lelystad, Instituut voor Dierhouderij en Diergezondheid B.V. Delections in arterivirus replicons
US7279166B2 (en) * 2001-12-12 2007-10-09 Virginia Tech Intellectual Properties, Inc. Chimeric infectious DNA clones, chimeric porcine circoviruses and uses thereof
US6841364B2 (en) 2002-01-22 2005-01-11 Protatek International, Inc. Infectious cDNA clones of porcine reproductive and respiratory syndrome virus and expression vectors thereof
ATE557082T1 (de) * 2002-04-05 2012-05-15 Boehringer Ingelheim Vetmed Sequenz positionen zur anpassung bei prrsv
US7335361B2 (en) 2003-06-09 2008-02-26 Animal Technology Institute Taiwan Fusion antigen used as vaccine
US7722878B2 (en) 2004-06-17 2010-05-25 Boehringer Ingelheim Vetmedica, Inc. PRRSV subunit vaccines
RU2007101725A (ru) 2004-06-18 2008-07-27 Риджентс Оф Дзе Юниверсити Оф Миннесота (Us) Идентификация инфицированных вирусом и вакцинированных вирусом организмов
US7632636B2 (en) 2004-09-21 2009-12-15 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome isolates and methods of use
US20060063151A1 (en) 2004-09-21 2006-03-23 Michael Roof Porcine reproductive and respiratory syndrome isolates and methods of use
CN101189027A (zh) * 2005-01-13 2008-05-28 贝林格尔·英格海姆维特梅迪卡有限公司 改良的prrs疫苗
CA2903542C (en) 2005-11-29 2019-11-26 Iowa State University Research Foundation, Inc. Identification of protective antigenic determinants of porcine reproductive and respiratory syndrome virus and uses thereof
US8563313B2 (en) 2007-02-13 2013-10-22 Washington State University Research Foundation Macrophage cell-lines for propagation of porcine reproductive and respiratory syndrome virus
WO2008121958A1 (en) 2007-04-02 2008-10-09 Boehringer Ingelheim Vetmedica, Inc. Use of prrsv vaccines to reduce pcv2 viremia
US20100003278A1 (en) 2008-07-03 2010-01-07 Boehringer Ingelheim Vetmedica, Inc. Immunological Compositions Effective for Lessening the Severity or Incidence of PRRSV Signs and Methods of Use Thereof
WO2010025109A1 (en) 2008-08-25 2010-03-04 Boehringer Ingelheim Vetmedia, Inc. Vaccine against highly pathogenic porcine reproductive and respiratory syndrome (hp prrs)
US20100129398A1 (en) 2008-11-26 2010-05-27 Boehringer Ingelheim Vetmedica, Inc. Materials and Methods for Control of Porcine Reproductive and Respiratory Syndrome
EP2558118B1 (en) 2010-04-16 2019-06-05 Universiteit Gent Cross-protecting vaccine for porcine reproductive and respiratory syndrome virus
US8728487B2 (en) 2011-01-20 2014-05-20 Hua Wu Attenuated live vaccine for prevention of porcine reproductive and respiratory syndrome

Patent Citations (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US3137631A (en) * 1959-12-01 1964-06-16 Faberge Inc Encapsulation in natural products
US3959457A (en) * 1970-06-05 1976-05-25 Temple University Microparticulate material and method of making such material
US4015100A (en) * 1974-01-07 1977-03-29 Avco Everett Research Laboratory, Inc. Surface modification
US4205060A (en) * 1978-12-20 1980-05-27 Pennwalt Corporation Microcapsules containing medicament-polymer salt having a water-insoluble polymer sheath, their production and their use
US4452747A (en) * 1982-03-22 1984-06-05 Klaus Gersonde Method of and arrangement for producing lipid vesicles
US4744933A (en) * 1984-02-15 1988-05-17 Massachusetts Institute Of Technology Process for encapsulation and encapsulated active material system
US5008050A (en) * 1984-06-20 1991-04-16 The Liposome Company, Inc. Extrusion technique for producing unilamellar vesicles
US4921706A (en) * 1984-11-20 1990-05-01 Massachusetts Institute Of Technology Unilamellar lipid vesicles and method for their formation
US4606940A (en) * 1984-12-21 1986-08-19 The Ohio State University Research Foundation Small particle formation and encapsulation
US5009956A (en) * 1987-02-24 1991-04-23 Univ Minnesota Phospholipase A2-resistant liposomes
US4927637A (en) * 1989-01-17 1990-05-22 Liposome Technology, Inc. Liposome extrusion method
US4944948A (en) * 1989-02-24 1990-07-31 Liposome Technology, Inc. EGF/Liposome gel composition and method
US5132117A (en) * 1990-01-11 1992-07-21 Temple University Aqueous core microcapsules and method for their preparation
US6455245B1 (en) * 1991-06-06 2002-09-24 Stichting Centraal Diergeneeskundig Instituut Mystery swine disease diagnostic kits
US6197310B1 (en) * 1991-06-06 2001-03-06 Stichting Centraal Diergeneeskundig Instituut Causative agent of the mystery swine disease, vaccine compositions and diagnostics kits
US5620691A (en) * 1991-06-06 1997-04-15 Stichting Centraal Diergeneeskundig Instituut Causative agent of the mystery swine disease, vaccine compositions and diagnostic kits
US5846805A (en) * 1991-08-26 1998-12-08 Boehringer Ingelheim Animal Health, Inc. Culture of swine infertility and respiratory syndrome virus in simian cells
US5476778A (en) * 1991-08-26 1995-12-19 Boehringer Ingelheim Animal Health, Inc. Method of growing and attenuating a viral agent associated with mystery swine disease
US5683865A (en) * 1991-08-26 1997-11-04 South Dakota State University Method for diagnosis of mystery swine disease
US5677429A (en) * 1991-08-26 1997-10-14 South Dakota State University Monoclonal antibodies to the Mystery Swine Disease virus
US5840563A (en) * 1991-08-26 1998-11-24 Boehringer Ingelheim Animal Health, Inc. Method for growing swine infertility and respiratory syndrome virus
US5695766A (en) * 1992-10-30 1997-12-09 Iowa State University Research Foundation Highly virulent porcine reproductive and respiratory syndrome viruses which produce lesions in pigs and vaccines that protect pigs against said syndrome
US6110467A (en) * 1992-10-30 2000-08-29 Iowa State University Research Foundation Isolated porcine respiratory and reproductive virus, vaccines and methods of protecting a pig against a disease caused by a porcine respiratory and reproductive virus
US6251397B1 (en) * 1992-10-30 2001-06-26 Iowa State University Research Foundation, Inc. Proteins encoded by polynucleic acids isolated from a porcine reproductive and respiratory syndrome virus and immunogenic compositions containing the same
US5510258A (en) * 1993-02-08 1996-04-23 Bayer Corporation Porcine reproductive and respiratory syndrome virus antigen and processes for the preparation and use of said antigen in vaccines and diagnostics
US5998601A (en) * 1994-08-05 1999-12-07 Regents Of The University Of Minnesota VR-2332 viral nucleotide sequence and methods of use
US5690940A (en) * 1995-06-21 1997-11-25 Regents Of The University Of Minnesota Low pathogencity PRRS live virus vaccines and methods of preparation thereof
US6495138B1 (en) * 1997-05-06 2002-12-17 Stichting Dienst Landbouwkundig Onderzoek PRRSV antigenic sites identifying peptide sequences of PRRS virus for use in vaccines or diagnostic assays
US6500662B1 (en) * 1998-12-22 2002-12-31 Pfizer Inc. Infectious cDNA clone of North American porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof
US20030157689A1 (en) * 1998-12-22 2003-08-21 Calvert Jay G. Infectious cDNA clone of North American porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof

Cited By (36)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8790656B2 (en) 1996-10-30 2014-07-29 Boehringer Ingelheim Vetmedica Gmbh PRRSV vaccines
US20040224327A1 (en) * 1996-10-30 2004-11-11 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US8546124B2 (en) 1996-10-30 2013-10-01 Boehringer Ingelheim Vetmedica Gmbh Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US20060205033A1 (en) * 1996-10-30 2006-09-14 Boehringer Ingelheim Vetmedica Gmbh Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US20060240041A1 (en) * 1996-10-30 2006-10-26 Meulenberg Johanna J M PRRSV Vaccines
US20040197872A1 (en) * 1996-10-30 2004-10-07 Meulenberg Johanna Jacoba Maria Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US8741309B2 (en) 1999-04-22 2014-06-03 The United States Of America As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine based on isolate JA-142
US8747859B2 (en) 1999-04-22 2014-06-10 The United States Of America, As Represented By The Secretary Of Agriculture Porcine reproductive and respiratory syndrome vaccine based on isolate JA-142
US20070042000A1 (en) * 1999-04-22 2007-02-22 Mengeling William L Porcine reproductive and respiratory syndrome vaccine based on isolate ja-142
US20110104201A1 (en) * 1999-04-22 2011-05-05 Mengeling William L Porcine Reproductive and Respiratory Syndrome Vaccine Based on Isolate JA-142
US20050137705A1 (en) * 1999-10-22 2005-06-23 Reiley Mark A. Facet arthroplasty devices and methods
US20100035276A1 (en) * 2004-06-18 2010-02-11 Regents of of the University of Minnesota Identifying virally infected and vaccinated organisms
US8399187B2 (en) 2004-06-18 2013-03-19 Regents Of The University Of Minnesota Identifying virally infected and vaccinated organisms
US20110195088A1 (en) * 2004-09-21 2011-08-11 Boehringer Ingelheim Vetmedica, Inc. Porcine Reproductive and Respiratory Syndrome Isolates and Methods of Use
US8383131B2 (en) 2004-09-21 2013-02-26 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome isolates and methods of use
US20090226486A1 (en) * 2005-02-25 2009-09-10 Pfizer Inc N protein mutants of porcine reproductive and respiratory syndrome virus
US20090130143A1 (en) * 2005-02-25 2009-05-21 Dongwan Yoo N protein mutants of porcine reproductive and respiratory syndrome virus
US8128937B2 (en) 2005-02-25 2012-03-06 Pfizer Inc. N protein mutants of porcine reproductive and respiratory syndrome virus
US7544362B1 (en) * 2005-02-25 2009-06-09 Pfizer Inc. N protein mutants of porcine reproductive and respiratory syndrome virus
US20100136051A1 (en) * 2005-02-25 2010-06-03 Pfizer Inc. N Protein Muants of Porcine Reproductive and Respiratory Syndrome Virus
US9080143B2 (en) 2005-06-24 2015-07-14 University Of Minnesota PRRS viruses, infectious clones, mutants thereof, and method of use
US7666585B2 (en) 2007-06-15 2010-02-23 Protatek International, Inc. Construction of chimera PRRSV, compositions and vaccine preparations
US20080311143A1 (en) * 2007-06-15 2008-12-18 Protatek International, Inc. Construction of chimera prrsv, compositions and vaccine preparations
US20110117129A1 (en) * 2008-08-25 2011-05-19 Boehringer Ingelheim Vetmedica, Inc. Vaccine Against Highly Pathogenic Porcine Reproductive and Respiratory Syndrome (HP PRRS)
US20110059126A1 (en) * 2009-09-02 2011-03-10 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in pcv-2 compositions and pcv-2 compositions with an improved immunogenicity
US9561270B2 (en) 2009-09-02 2017-02-07 Boehringer Ingelheim Vetmedica, Inc. Methods of reducing virucidal activity in PCV-2 compositions and PCV-2 compositions with an improved immunogenicity
US9944902B2 (en) 2011-02-17 2018-04-17 Boehringer Ingelheim Vetmedica Gmbh Commercial scale process for production of PRRSV
US8765142B2 (en) 2011-02-17 2014-07-01 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US10668144B2 (en) 2011-02-17 2020-06-02 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US10039821B2 (en) 2011-02-17 2018-08-07 Boehringer Ingelheim Vetmedica Gmbh European PRRSV strain
US9187731B2 (en) 2011-07-29 2015-11-17 Boehringer Ingelheim Vetmedica Gmbh PRRS virus inducing type I interferon in susceptible cells
US9315781B2 (en) 2011-07-29 2016-04-19 Boehringer Ingelheim Vetmedica Gmbh Infectious CDNA clone of european PRRS virus and uses thereof
US9579373B2 (en) 2013-03-15 2017-02-28 Boehringer Ingelheim Vetmedica, Inc. Porcine reproductive and respiratory syndrome virus, compositions, vaccine and methods of use
US10010601B2 (en) 2013-12-20 2018-07-03 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, European PRRS virus cDNA clone, and uses thereof
US10639364B2 (en) 2013-12-20 2020-05-05 Boehringer Ingelheim Vetmedica Gmbh PRRS virus variant, european PRRS virus cDNA clone, and uses thereof
CN114395583A (zh) * 2021-11-01 2022-04-26 扬州大学 一种表达分泌型荧光素酶的猪繁殖与呼吸综合征病毒的cDNA克隆及其构建方法与应用

Also Published As

Publication number Publication date
CA2366072A1 (en) 2000-09-14
JP2002537845A (ja) 2002-11-12
WO2000053787A1 (en) 2000-09-14
AU3198200A (en) 2000-09-28
EP1157121A1 (en) 2001-11-28
PL204373B1 (pl) 2010-01-29
EP1157121B1 (en) 2013-04-24
CA2366072C (en) 2007-07-10
JP3961222B2 (ja) 2007-08-22
US20060240041A1 (en) 2006-10-26
US8790656B2 (en) 2014-07-29
PL351486A1 (en) 2003-04-22
WO2000053787A9 (en) 2012-04-26

Similar Documents

Publication Publication Date Title
US8790656B2 (en) PRRSV vaccines
AU719991B2 (en) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
US7273617B2 (en) Infectious cDNA clones of porcine reproductive and respiratory syndrome virus and expression vectors thereof
EP1018557B1 (en) Infectious cDNA clone of north american porcine reproductive and respiratory syndrome (PRRS) virus and uses thereof
AU754938B2 (en) PRRSV antigenic sites identifying peptide sequences of PRRS virus for use in vaccines or diagnostic assays
US7122347B2 (en) Chimeric Arterivirus-like particles
US20040213805A1 (en) Deletions in arterivirus replicons
WO2002095040A1 (en) Delections in arterivirus replicons
CA2424400C (en) Adaptation sites of prrsv
Welch et al. Construction and evaluation of genetically engineered replication-defective porcine reproductive and respiratory syndrome virus vaccine candidates
US20040224327A1 (en) Infectious clones of RNA viruses and vaccines and diagnostic assays derived thereof
MXPA99003967A (en) Infectious clones of rna viruses and vaccines and diagnostic assays derived thereof

Legal Events

Date Code Title Description
AS Assignment

Owner name: ID-LELYSTAD, INSTITUUT VOOR DIERHOUDERIJ EN DIERGE

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNORS:MEULENBERG, JANNEKE;VERHEIJI, HELENE;REEL/FRAME:012592/0944;SIGNING DATES FROM 20010901 TO 20010911

AS Assignment

Owner name: BOEHRINGER INGELHEIM VETMEDICA GMBH, GERMANY

Free format text: ASSIGNMENT OF ASSIGNORS INTEREST;ASSIGNOR:ID-LELYSTAD, INSTITUUT VOOR DIERHOUDERIJ EN DIERGEZONDHEID B.V.;REEL/FRAME:015785/0487

Effective date: 20041011

STCB Information on status: application discontinuation

Free format text: ABANDONED -- FAILURE TO RESPOND TO AN OFFICE ACTION