TW585910B - Streptomyces avermitilis gene directing the ratio of B2:B1 avermectins - Google Patents

Abstract

The present invention relates to polynucleotide molecules comprising nucleotide sequences encoding an aveC gene product, which polynucleotide molecules can be used to alter the ratio or amount of class 2:1 avermectins produced in fermentation cultures of S. avermitilis. The present invention further relates to vectors, host cells, and mutant strains of S. avermitilis in which the aveC gene has been inactivated, or mutated so as to change the ratio or amount of class 2:1 avermectins produced.

Description

585910 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 _____ B7 V. Description of the Invention (i) 1 Field of Invention The present invention is directed to the method and composition for the production of avertin, and basically belongs to the field of animal health care. More specifically, the present invention describes a polynucleotide molecule containing a nucleotide sequence encoding an AV e C gene product. This Ave C gene can be used in fermentation culture of Streptomyces avertinus to adjust species 2: 1 Avert The ratio of streptomycin, and the composition and method of screening this polynucleotide molecule. The present invention further describes a vector, a transformed host cell, and a novel Streptomyces avertinus mutant strain whose a v e C gene has been mutated so that the production ratio of a streptomycin of 2: 1 can be adjusted. 2. Background of the invention 2.1. Streptomyces avermitilis can produce a wide range of secondary metabolites, including streptomycin avermitil, which contains a series of eight related 16-membered macrolides and has worm-repelling properties And the potential of insecticidal activity. These eight different but very related compounds are called Ala, Alb, A2a, A2b, B 1 a, B 1 b, B 2 a and B 2 b. a " series of compounds refer to natural streptavidin, (sulfur) primary and secondary butyl substituted at C 2 5 ', and b 〃 series of compounds refers to compounds substituted at c 2 5 is isopropyl . Regarding the naming of streptomycin, A, and A, and B, respectively, it means that its substitution position is methoxy and hydroxyl at C5, respectively. The numerals, and 1 〃 refer to a double bond at the C 2 2 and C 2 3 positions of streptavidin, and the numerals, and 2 指 refer to a hydrogen bond at the C 2 2 position and a hydroxyl group at the c 2 3 position. Among the related streptomycins, the B 1 type of streptomycin is considered to be the most resistant to paper. The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297), 1 7 ^ (please read the back first) (Notes on this page) Order— · ——Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7__ V. Description of the Invention (2) Insect and insecticide active effects, so it is the most commercially available Streptomycin avertin. Streptomycin avertin and its manufacture by aerobic fermentation of streptomyces avertin are described in United States Patents 4, 3 1 0, 5 1 9 and 4,429, 042. Natural streptomycin Biosynthesis is believed to be endogenous analogs of coenzyme A (C ο A) thioesters of isobutyric acid and thio-(+)-2-methylbutyric acid. A conjugate strain is improved by random mutations, and The use of exogenous fatty acids can lead to the efficient production of streptavidin analogs. The branched 2-chain keto acid dehydrogenase deletion (bkd deletion mutant) mutants of Streptomyces avermitilis provide Streptomycin can only be produced in yeast. Screening and isolation Strains lacking branch chain dehydrogenase activity (eg, streptomycin avermectin ATCC 5 3 5 6 7) are described in European Patent (EP) 276103. Such mutants are exposed to an environment where fatty acids are provided exogenously. At the time of fermentation, only four kinds of avertin are produced based on the fatty acids provided. Therefore, sulfur-(+)-2-methylbutyric acid is provided in S. avertinus ATCC (5 3 5 6 7). It produces natural streptomycin A 1 a, A 2 a, B 1 a and B 2 a when fermented; it produces natural streptomycin Alb, A2b when provided with isobutyric acid. Bib, and B2b; and four novel cycloalphafoamycins Al, A2, B1, and B2 are produced when the fermentative fermentation is performed with cyclopananecarboxylic acid. If other fatty acids are provided, it can be manufactured Novel streptomycin was developed. After screening more than 800 potential precursors, more were identified (please read the precautions on the back before this page)

The paper size of the edition is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) -5- 585910 A 7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (3) 60 other novel Aver Streptomycin (see Dutton et al., 1991, J. Antibiot. 44: 357-365; and Banks et al., 1994, Roy. Soc. Chem. 147: 1 6-26). In addition, a mutant strain of Streptomyces averaverii with defective 5-oxo-methyltransferase activity will only produce a streptavidin of the B analog. Therefore, Streptomyces averaverii mutants lacking branched 2-keto acid dehydrogenase and 5-oxo-methyltransferase activity are commensurate with the fatty acids used in providing fermentative enzymes. . In this way, providing this kind of binomial mutant thio-(+) — 2-butyric acid can only produce natural avertin streptomycin B 1 a and B 2 a, but it provides isobutyric acid or cyclopentanecarboxylate. When acidic, it will produce natural streptavidin B 1 b and B 2 b or novel cyclofluorene B 1 and B 2 streptomycin, respectively. Cyclohexanecarboxylic acid, which provides these two mutant strains, is used in the manufacture of a novel and important streptomycin (streptomycin cyclohexylaverin B 1, Streptomyces dora) which is important in the industry. Isolation and characterization of this two mutant strain (Streptomyces avermitilis ATCC 53692) is described in EP 276103. 2.2. Genes involved in streptomycin biosynthesis In many cases, genes involved in the production of secondary metabolites and genes encoding special antibiotics are clustered on the chromosome, such as Streptomyces polyketide synthase Gene clusters (PKS) (see Hopwood and Sherman, 1990, Ann. Rev. Genet. 24: 37-66). Therefore, one strategy for breeding genes for biosynthetic pathways is to isolate the drug-resistant genes first, and then test their adjacent chromosomes to find genes related to this particular antibiotic biosynthesis. Another strategy for breeding biosynthetic genes contained in important metabolites is complementation of mutant strains. For example: will be taken from Yueneng Manufacturing (please read the precautions on the back and then this page)%, the size of the paper is applicable to China National Standard (CNS) Α4 specification (210X 297 mm) -6-585910 Central Standard of the Ministry of Economic Affairs Printed by the Consumer Cooperative of the Bureau A7 B7 V. Description of Invention (4) A DNA database of a special metabolite organism was introduced into a non-manufacturing mutant strain, and then the transformants capable of producing this metabolite were screened. In addition, methods using probe hybridization libraries derived from other Streptomyces have been used to identify and breed genes involved in biosynthetic pathways. Genes involved in the streptomycin biosynthesis (av gene), such as genes required for the biosynthesis of other secondary metabolites of Streptomyces (like P K S), were found to be clustered on the chromosome. • Using a vector that is complementary to a Streptomyces averaverii mutant strain that blocks the biosynthesis of streptomycin avermectin, some a v e genes have been successfully cloned. The breeding of such genes has been described in U.S. Patent Nos. 5,2 5,2,4 7 4. In addition, Ikeda et al., 1 995, J. Antib 10t. 48: 5 32-5 34 have described the genes involved in the dehydration step (aveC) of Streptomyces avermitilis C 2 2 and C 23 at 4.82 Kb, BamHI fragment on the chromosomal region, and this aveC mutant gene can produce a single component B 2 a producer. Because the potential insecticide ingredient ivermectin can be chemically synthesized from avermectin B 2 a, single-component producers of this type of avermectin B 2 a can be considered for manufacturing Streptomyces Iver. Identification of mutations in the ave C gene can reduce the complexity of the production of streptavidin, for example, the mutation effect of reducing the ratio of streptavidin B 2: B 1 will simplify the manufacture and purification of important streptavidin for commercial use. . 3. Description of the invention The present invention provides a free polynucleotide molecule, including the complete ave C open editing area of Streptomyces avermitilis, or the same part thereof. The size of the free polymer paper is subject to Chinese National Standard (CNS) A4. Specifications (210X 297mm) (Please read the precautions on the back before this page)

Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (5) Nucleotide molecule lacks a complete open editing area downstream of the ave C open editing area on the chromosome of Streptomyces avertinus . The free polynucleotide molecule of the present invention preferably contains a nucleotide sequence encoding a Strecomyces averaverii Av ec gene product in plastid P SE 1 8 6 (ATC C 2 0 96 0 4), or is similar to the figure The nucleotide sequence of the ave C open editing region in 1 (SEQ ID NO: 1) is the same, or the same part thereof. The present invention further provides a polynucleotide molecule, which is similar to the plastid PSE186 (ATCC 209604). The nucleotide sequence encoding the Ave C gene product of Streptomyces avermitilis is homogeneous or the same as the nucleotide sequence of the aveC open reading region presented in FIG. 1 (SEQ ID NO: 1), or the same portion thereof. The present invention further provides a polynucleotide molecule, which comprises an amino acid sequence encoding the product encoding the AveC gene product in the homoplasmic plastid PSE186 (ATCC 209604), or is homologous in FIG. 1 (SEQ ID NO: 2). Amino acid sequences, or homogeneous portions thereof. The invention further provides a free polynucleotide molecule comprising a nucleotide sequence encoding an A v e C homogeneous gene product. In a preferred embodiment, the free polynucleotide molecule contains a ribucic acid sequence encoding a homogeneous gene product of S. hygroscopicus Av e C, and the homogeneous gene product contains SEQ ID NO: The amino acid sequence of 4 or a homogeneous portion thereof. In a preferred embodiment, the free polynucleotide molecule of the present invention encodes the homogeneous gene of Streptomyces hygroscopicus Ave C. The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) (please first Read the notes on the back page)%: Γ1Τ 585910 A 7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (6) The substance contains the nucleotide sequence of SEQ ID NO: 3 or a homogeneous part thereof. The present invention further provides a polynucleotide molecule comprising a nucleotide sequence homologous to Streptomyces hygroscopicus SEQ ID NO: 3. The present invention further provides a polynucleotide molecule, which contains a nucleotide sequence encoding a polypeptide homogeneous to Streptomyces hygroscopicus and Ave C homogeneous gene product, and has an amino acid of SEQ ID N 0: 4. sequence. The present invention further provides oligonucleotides, which can be hybridized to a polynucleotide molecule having the nucleotide sequence of FIG. 1 (SEQ ID NO: 1) or SEQ ID NO: 3: 1 (SEQ ID NO: 1) or a polynucleotide molecule complementary to the nucleotide sequence of SEQ ID NO: 3. The present invention further provides a recombinant colonization vector and a performance vector, which can be used to colonize or express the polynucleotide of the present invention, including the ave C open editing area or the ave C homogeneous open editing area containing Streptomyces avermitilis. Polynucleotide molecule. In a non-limiting example, the present invention provides a plastid PSE186 (ATCC 209604), which contains a complete open editing region of the Streptomyces averaverii av e C gene. The present invention further provides a transformed host cell containing the polynucleotide molecule or recombinant vector of the present invention, and a novel strain or cell strain derived therefrom. The invention further provides an A v e C gene product or an A v e C homogeneous gene product that has been recombinantly expressed, or an essential part thereof has been purified or isolated, and a homogeneous substance therein. The present invention further provides a method for manufacturing a recombinant Ave C gene product, which includes culturing the recombinant expression vector (please read the note on the back 1---> item ^^ write this page) The paper size is applicable to Chinese national standards (CNS) A4 specification (210X297 mm) 585910 A7 B7 V. Description of the invention (7) Shaped host cell, the polynucleic acid molecule contained in the recombinant expression vector has the homogeneity encoding the product of Av e C gene or Av e C The nucleotide sequence of the gene product, and this polynucleotide molecule is operatively linked to one or more regulatory elements, which can control the expression of the polynucleic acid molecule in the host cell, making it in a position beneficial to the production of recombinant Av e C gene Product or Av e C homogeneity gene product, and recover the Ave C gene product or Ave C homogeneity gene product from cell culture. The present invention further provides a polynucleotide molecule containing a nucleotide sequence that is the same as the plastid pSE186 (ATCC 209604) encoding the streptavidin Av e C gene product, or as shown in FIG. 1 (SEQ ID NO: 1) The streptavidin ave C open reading region has the same nucleotide sequence, but this polynucleic acid molecule further contains one or more mutations, so Streptomyces avermitilis strain ATCC 5 3 The 6 9 2 wild-type ave C peer gene has been deactivated, and the expressed polynucleotide molecule contains a mutated nucleotide sequence that makes Streptomyces avermitilis strain ATCC 5 3 6 9 2 cells different. A proportion or amount of streptomycin replaces the wild-type ave C isoform that was previously expressed. According to the present invention, such a polynucleotide molecule can be used to make a novel strain of Streptomyces avertinus, and compared with those of the same strain but showing only the wild-type ave C peer gene, it can show a detectable Changes in the manufacture of avertin. In a preferred embodiment, such a polynucleotide molecule is used to make a novel strain of Streptomyces avertinus, and compared with the same strain but showing only the wild-type ave C equivalent gene, it can reduce the species 2: Production of 1 ratio of streptomycin. Going one step further This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before

印 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 10- 585910 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. In the preferred embodiment of the invention description (8), such polynucleotide molecules are used for manufacturing A novel strain of Streptomyces avermitilis, and compared with those of the same strain but showing only wild-type ave C equivalent genes, can increase the production of streptavidin. In a further preferred embodiment, such a polynucleotide molecule is used to make a novel strain of Streptomyces averaverii, in which the ave C gene has been deactivated. The method provided by the present invention is used to identify a method capable of altering the chain of averaver Mutations in the proportion and / or quantity of S. aureus ave C in the open editing area of S. avertinus. In a preferred embodiment, the present invention provides a method for identifying mutations in the ave C open editing area that can alter the manufacture of streptavidin of type 2: 1, including: (a) decision to pass natural ave C Streptomyces avermitilis strains made from cells of a deactivated equivalent of Streptomyces avermitilis have a 2: 1 ratio of streptavidin, and a polynucleotide molecule containing a nucleotide sequence encoding a mutant Ave C gene product has been Introduced and expressed; (b) Decided to produce a 2: 1 ratio of Streptomyces avermitilis via cells identical to the Streptomyces avermitilis strain in step (a) but showing only wild-type ave C equivalents And the aveC peer gene has the nucleotide sequence of the open reading region of FIG. 1 (SEQ ID NO: 1) or a nucleotide sequence of homogeneity therewith; and (c) the comparison via step (a) Streptomycin of 2: 1 ratio produced by Streptomyces averaverii cell, and Streptomycin of 2: 1 ratio produced by Streptomyces averaverii cell in step (b); if step (A) Streptomyces averaverii and step 2 (b) of Streptomyces averaverii produced by species 2 : 1 ratio of streptavidin is different, and then it can be identified to change the species. 2: 1 ratio of streptomycin ave C. This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) ~ 11. ( Please read the caution page on the back first) ▼ Item Order 585910 A7 ____B7___ V. Description of Invention (9) The mutation of the open editing area. In a preferred embodiment, the streptomycin of a ratio of 2 to 1 can be reduced by mutation. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs (please read the notes on the back and then this page). In a further preferred embodiment, the present invention provides a method for identifying mutations in the ave C open editing area or Contains genetic constructs that can alter the production of streptavidin, including: (a) determining the amount of streptomycin produced by cells of the natural ave C peer gene deactivated Streptomyces avertinus strain, and containing the code A polynucleotide molecule having a nucleotide sequence of the Ave C gene product or a gene construct containing the nucleotide sequence of the Ave C gene product has been introduced and expressed; (b) it is decided to go through the same steps (A) Streptomyces avermitilis strain, but showing only the amount of streptomycin produced by cells of the wild-type ave C equivalent gene, and this aveC equivalent gene has FIG. 1 (SEQ ID NO: 1) And (c) comparing the amount of streptomycin produced by the Streptomyces avertinus cell in step (a) and the step ( b) Streptomyces averaverii If the amount of streptomycin produced by step (a) is different from the amount of streptomycin produced by step (b), then identify if it can change the amount of streptomycin. The amount of mutations or gene construction in the ave C open editing area produced by the prime. In a preferred embodiment, streptavidin can be increased in number via mutations. The present invention further provides a recombinant vector 'which can be used to produce a novel Streptomyces avermitilis strain capable of altering the production of streptomycin. For example, the vector provided by the present invention can be used for any of the polynucleotide molecules containing the mutated nucleotide sequence of the present invention to the 8 vec gene on the chromosome of Streptomyces averaverii. The paper standard is applicable to Chinese National Standard (CNS) A4. Specifications (210X297 mm) _ 〇 585910 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs A7 B7 V. Description of the invention (1〇) Location. A v e C open editing area is inserted or partially replaced by homogeneous recombination. According to the present invention, a polynucleotide molecule of the present invention containing a mutated nucleotide sequence is inserted into a position other than the ave C gene of Streptomyces avermitilis, or is maintained in an extra gene in a cell of Streptomyces averaverii, and has regulation Function of Avertin Streptomycin Biosynthesis. In this way, the present invention also provides a polynucleotide molecule of the present invention containing a mutated nucleotide sequence, and the vector can be used as a polynucleotide molecule inserted into a position other than the Ave C gene of Streptomyces avermitilis, or maintained Streptomyces averaverii. Streptomyces avermitilis strains that have mutated ave C equivalent gene compared with cells of the same strain but showing only wild-type ave C equivalent gene can produce altered species of streptomycin 1: 1, and also Screen this transformed cell. In a preferred embodiment, the novel strain reduces the production of streptomycin of a ratio of 2: 1. In a still further preferred embodiment, the present invention provides a method for manufacturing a novel Streptomyces avermitilis strain, comprising manufacturing cells that alter the amount of streptomycin, including carrying a mutated ave C peer gene Or a Streptomyces averaverii cell transformed with a vector constructed by the ave C equivalent gene, and this transformed cell can produce a changed amount of Aver compared with a cell of the same strain but showing only the wild type ave C equivalent gene Streptomycin, and this transformed cells were also screened. In a still further preferred embodiment, the present invention provides a method for use in additional genes. In a preferred embodiment, the present invention provides a gene replacement vector for inserting a mutated ave C peer gene into the chromosome of Streptomyces avertinus to produce a novel strain, so that the produced streptavidin is more than that of the paper Standards are applicable to China National Standard (CNS) A4 (210 X 297 mm) (Please read the precautions on the back before ^^ this page}%, .1 訏 -13- Printed by the Central Consumers Bureau of the Ministry of Economic Affairs, Consumer Cooperatives 585910 A7 B7 V. Description of the invention (彳 i) The same strain, but showing only the wild type ave C equivalent, reduces the ratio of 2: 1. The present invention further provides a method for manufacturing a novel strain of Streptomyces averaverii, which contains The mutated ave C equivalent gene and cells with the same strain but showing only wild type ave C equivalent gene can change the production ratio and / or quantity of avertin, in a preferred embodiment. The invention provides a method for producing a novel strain of Streptomyces avermitilis, which contains cells expressing a mutant ave C equivalent gene, and cells of the same strain that exhibit only a wild-type ave C equivalent gene. Streptomycin avermectin, which can be modified in a 2: 1 ratio, also contains a novel strain of Streptomyces averaverii transformed with a vector carrying a mutant ave C equivalent gene. This cell contains a deactivated ave C Equivalent genes, including transformation with a vector containing a deactivated ave C equivalent gene into a strain of Streptomyces avermitilis expressing a wild-type ave C equivalent gene, and screening of this transgene containing the ave C equivalent gene that has been deactivated The present invention further provides a novel Streptomyces averaverii strain, comprising cells transformed with a polynucleotide molecule of the present invention or a vector containing the mutated nucleotide sequence of the present invention. In a preferred embodiment In the invention, the present invention provides a novel Streptomyces averaverii strain, comprising cells that have been expressed in a manner of replacing or additionally to the wild-type ave C equivalent gene-a mutant ave C equivalent gene, and the cells of this novel strain are identical to the same strain However, when comparing only cells expressing the wild-type ave C equivalent gene, a streptavidin of a 2: 1 ratio can be produced. In a more preferred embodiment, the cells of this novel strain are related to However, the cell strain showed wild-type gene a v e C than peer (Read Notes on the back page again), τ

This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) -14- Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 _____ B7 V. Description of the invention (12) For the time being, a reduction type 2 can be manufactured: 1 ratio of streptavidin. This novel strain can be used in large quantities to produce commercial streptomycin. In a further preferred embodiment, the present invention provides a novel Streptomyces averaverii strain, which comprises a mutant ave C peer gene cell or When cells containing the ave C equivalent gene are constructed, and cells of this novel strain are compared with cells of the same strain but showing only the wild type ave C equivalent gene, a changed amount of streptavidin can be produced. In a preferred embodiment, the cells of this novel strain can produce an increased amount of streptomycin. In a further preferred embodiment, the present invention provides a novel strain of Streptomyces averaverii, which comprises a deactivated av e C gene. This strain can be used to compare different ranges of streptavidin produced by comparison with wild-type bacteria, and complementary screening assays as described herein to determine whether random or targeted mutations in the ave C gene affect streptavidin. Manufacturing. The present invention further provides a method for manufacturing streptavidin, comprising culturing a streptomyces avertinus strain, and the cell is identical to the same strain but does not express a mutant ave C counterpart and only expresses a wild-type ave C pair. When comparing isogenic cells, this cell can express a mutant ave C equivalent gene encoding a streptavidin of altered type 2: 1 ratio, and also includes the production of avertin chains in permissible or elicited culture medium. Streptozotocin and this avertinin were recovered from the culture broth. In a preferred embodiment, cells exhibiting mutations can produce a reduced amount of streptomycin in a 2: 1 ratio. This manufacturing method can provide commercial streptavidin of avertin, such as multi-zipper mold. The paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) (Please read the precautions on the back before copying this Page) Order _Γ

585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (13) High efficiency. The present invention further provides a method for manufacturing streptavidin, which comprises culturing a streptomyces avertinus strain, and the cell and the same strain do not exhibit a mutant ave C equivalent gene or a structure containing the ave C equivalent gene and only When comparing cells expressing wild-type ave C equivalents, cells expressing mutated ave C equivalents or constructs containing ave C equivalents can produce altered amounts of avertin. In a preferred embodiment, cells exhibiting mutations or gene construction can produce increased amounts of streptomycin. The present invention further provides a novel streptavidin composition produced by a strain of Streptomyces avertin expressing the mutant ave C equivalent gene of the present invention, and the same strain does not express the mutant ave C Equivalent genes but only wild-type ave C equivalents can be compared to produce streptavidin in a reduced 2: 1 ratio. This novel Streptomyces avermitilis component can be produced in fermented broth, or collected from it, or partially or continuously purified from it. 4 · Brief description of the drawing Figure 1 · The DNA sequence (S E Q ID N 0: 1) containing the open reading area of Streptomyces avermitilis a v e C, and the deduced amino acid sequence (SEQ ID NO: 2). Figure 2 · PSE186 (ATCC 209604) plastid vector containing the complete open editing area of Streptomyces averaverii a v e C gene 〇 Figure 3 · Saccharopolyspora (please read the precautions on the back page) Λ

IfI

This paper size applies to China National Standard (CNS) A4 (210X297 mm) -16- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (14) erythraea) e rmE gene inserted into the Affer chain Gene replacement vector PSE180 (ATCC 2 096 0 5) in the open editing region of mold ave C. Figure 4. B am Η I restriction enzymes of five identified repeated adhesion plastids (PSE6 5, pSE66, pSE67, pSE68, pSE69) of the streptavidin polyketide synthase gene cluster of Streptomyces averaver Tu Yu. The relationship between p s E 1 · 18 and p S E 1 1 9 is also pointed out. Figure 5 • High pressure liquid chromatography (HPLC) of fermented products produced by Streptomyces averaverii. Quantitative spikes were compared with the standard cyclohexyl B1. The retention time of cyclohexyl B2 is 7. 4-7. 7 minutes, and the retention time of cyclohex B1 is 11.9-12. 3 minutes. Figure 5A. Streptomyces averaverii strain SE 1 80 — 1 1 has a deactivated a v e C open editing area. Figure 5B. Streptomyces averaverii strain SE180-1 1 transformed with p S E 1 8 6 (ATCC 209604). Figure 5C. Streptomyces averaverii strain SE180-11 transformed with pSE187. Figure 5D. Streptomyces averaverii strain S E 1 8 0-1 1 1 transformed with pSE188. Figure 6 · Comparison of each inferred amino acid sequence encoding the open reading area of ave C, including comparison of Streptomyces averaverii (SEQ ID NO: 2) from S. griseochromogenes (SEQ ID NO: 5) The ave C homogeneity part open editing area, and the ave C homogeneity part open editing area from Streptomyces hygroscopicus (SEQ ID NO: 4). Eggs in bold type inferred valine residues The paper size is in accordance with the Chinese National Standard (CNS) A4 size (210X297 mm) 17 (Please read the precautions on the back before this page),? Τ

585910 A7 B7

Printed by the Consumers' Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs I. Description of Invention (15) The starting position of white matter. If the three sequences are all homogeneous, they are shown in upper case, and if only two of the three sequences are homogeneous, they are shown in lower case. As a result, it was found that the amino acid sequence was about 50% identical. Figure 7. Fusion plastid construction, including inserting the 564bp Bs aAI / Kpn I fragment of the homogeneous gene of Streptomyces griseus aveC into the B s a A I / κ ρ η I position in the open reading area of Streptomyces avercus a v e C. 5. Detailed description of the invention The present invention relates to the identification and characterization of a polynucleotide molecule encoding the nucleotide sequence of the ave C gene product of Streptomyces averaverii. A novel strain of Streptomyces averaverii can be used to screen mutant ave C equivalent genes, because they can affect the production of streptomycin, and also found that some mutant Ave C equivalent genes can reduce the production ratio of B 2: B 1 streptomycin. The following section describes an example of the present invention, which is opened with a plastid p SE 1 8 6 (ATCC 209604) or FIG. 1 (SEQ ID NO: 1) identical to the nucleotide sequence generated by the Av e C gene encoding S. avermitilis Polynucleotide molecules with a nucleotide sequence in the editing region, and polynucleotide molecules with a mutated nucleotide sequence. However, the principles of the present invention can be similarly applied to other polynucleotide molecules, including the ave C homogeneous genes homogeneous to other Streptomyces spp., Including Streptomyces griseus and Streptococcus hygroscopicus. 5.1. Encoding Streptomyces Ave The paper size of the polynucleotide of a certain product is applicable to the Chinese National Standard (CNS) A4 specification (210 'x 297 mm) (Please read the precautions on the back before this page) -Γ Order l · ·

585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

V. Description of the invention (17) Sequence 〃, ~ coding sequence 〃, '' open editing area 〃 and 0 RF 〃 can refer to DNA and RNA molecules, both double-stranded and single-stranded 2 can be transcribed and translated ( DNA), or translation (RNA) into AveC gene products, or Ave C homogeneous gene products as described below, or multiple peptides homologous to Ave C gene products, or may be appropriately regulated in a suitable host expression system Ave C homogeneous gene product. Coding sequences may include, but are not limited to, prokaryotic sequences, c · D N A sequences, genomic D N A sequences, and chemically synthesized D N A and R N A sequences. The nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) contains four different GTG code positions at bp 42, 174, 177, and 180. As described in Section 9 below, the 5 > region in the aveC ORF (Figure 1; SEQ ID NO: 1) is constructed to assist in defining the position in the aveC RF as the starting position for protein expression. Functional password. Deletion of the first GTG at position 42 does not eliminate Αν e C activity. If the additional divisions are all located at the G T G code of b p 1 7 4, 17 and 180, the A v e C activity will be eliminated, indicating that this region is necessary for protein expression. The present invention contains ave COF RF s of different lengths, and the GTG position at which they begin to translate is 174, 177, or 180bp, as shown in FIG. 1 (SEQ ID NO: 1). Peptide. The present invention further provides a polynucleotide sequence having pSE186 (ATCC 209604) homologous to the nucleotide sequence encoding the AveC gene product of Streptomyces avermitilis, or as shown in FIG. 1 (SEQ (Please read the precautions on the back before (This page) l · The size of the paper is applicable to the Chinese National Standard (CNS) A4 (210X 297 mm) -20 · Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (18) ID N〇 : L) * 2aveCO RF nucleotide sequence or a polynucleotide molecule of homogeneous portion therein. The homogeneous 〃 is used for a polynucleotide molecule that is homogeneous to the nucleotide sequence encoding the Ave C gene product of Streptomyces averaverii, that is, the polynucleotide molecule has a nucleotide sequence as: (1) The same pS186 (ATCC 209604) as the plastid encoding the product of the Streptomyces avermitus Av e C gene product, or the same as that shown in FIG. 1 (s EQ ID No: 1) ave C 0 RF nucleotide sequence encoding Ave C gene product, but including one or more silently altered nucleotide sequences are designed based on the degeneracy of the genetic code; or (b) can be hybridized to a complementary This molecule has an amino acid sequence encoded by the plastid PSE186 (ATCC 209604) encoding the Ave C gene product, or the code shown in Figure 1 (SEQ ID NO: 2) Amino acid sequences, and products encoding the Ave C gene, which are functionally equivalent as described above. This hybridization is performed under moderately stringent conditions, such as at 0.5 Molar concentration NaHP04, 7% sodium dodecyl sulfonate (SDS), 1-Mole concentration EDTA, and 65 ° C Hybridize to DNA-bound filter paper, and wash with 0.2 XSSC / 0.1% SDS at 4 2 ° C (see Ausubel et al. (Eds.), 1989, Current Protocols in Molecular Biology, Vo 1.1, Green Publishing Associates, Inc., and John Wiley & Sons, Inc.,

New York, at p. 2.10.3). In a preferred embodiment, the homogeneous polynucleotide molecule can be hybridized to a plastid PSE186 (ATCC 209604) complementary to the nucleotide sequence encoding the Ave C gene product. (Please read the precautions on the back before (This page) — ^ ·, 1T This paper size is applicable to Chinese National Standard (CNS) A4 specification (210 × 297 mm) -21-Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 5. Invention Description (19) or Complementary to the nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) or a homogeneous portion thereof; and this hybridization is performed under highly stringent conditions, such as at 0.5 Molar concentration NaHP〇4, 7% sodium dodecyl sulfonate (SDS), EDTA at 1 millimolar concentration, and hybridized to DNA-bound filter paper at 65 ° C, then mixed with 0.1 XSSC / 0 · 1% SD S at 6 Washed at 8 ° C (Ausubeletal ·, 1 989, supra), and encodes the Ave C gene product with equivalent function as defined above. Analysis of the fermented product by HP LC determines the activity and functional equivalence of the Av e C gene product, as described in the following example. The polynucleotide molecule has a nucleotide sequence that encodes the functional product of Streptomyces averaverii Ave e C, including the ave C gene naturally present in other Streptomyces avermitilis strains, and the ave C gene present in other species of Streptomyces Homogeneous genes, and naturally occurring or genetically engineered mutant ave C peers. The present invention further provides a polynucleotide molecule comprising an amino acid sequence of a polypeptide encoded by a nucleotide sequence, which is homogeneous to the amino acid sequence of pSE186 (ATCC 209604) encoding the AveC gene product. , Or the amino acid sequence in Figure 1 (SEQ ID NO: 2) or a homogeneous portion thereof. As used herein, the homogeneous portion of the amino acid sequence of FIG. 1 (SEQ ID NO: 2) means that it contains at least 70% of the amino acid sequence shown in FIG. 1 (SEQ ID NO: 2), And it constitutes a functionally equivalent Ave C gene product as defined above. This paper size applies to China National Standard (CNS) A4 specification (210X297mm) _ 22-(Please read the precautions on the back before this page)%,

Printed by the Employees 'Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7__ V. Description of the Invention (20) The amino acid sequence used in this article is homogeneous to the amino acid sequence of the Ave C gene product of Streptomyces averaverii,', homogeneity It refers to a peptide that is encoded by the pSE 1 8 6 (ATCC 209604) of the coding sequence of the Ave C gene product, or has the amino acid sequence of Figure 1 (SEQ ID NO: 2) but has been used. Different amino acid residues conservatively replace one or more amino acid residues, and such conservative substitution results in a functionally equivalent gene product as defined above. Conservative amino acid substitutions are well known in the art. The rules for making these substitutions include Dayhof, M.D., 1 978, Nat. Biomed. Res. Found., Washington, D.C., Vol. 5, Sup. 3. More special is that conservative amino acid substitutions often occur in a family of amino acids, such as related families such as acidity, polarity, or large side chains. Genetically formed amino acids are often divided into 4 groups: (1) acidity = aspartic acid, glutamic acid; (2) basic = lysine, arginine, histidine; (3) Non-polar = Alanine, Valine, Leucine, Isoleucine, Proline, Phenylalanine, Methionine, Tryptophan; and (4) No Valence Polarity = Glycine, Asparagus Glycine, glutamate, cysteine, serine, glutamic acid, tyrosine. Phenylalanine, tryptophan, and tyrosine can also be classified together as aromatic amino acids. The exchange of one or more between any particular group usually does not significantly affect the function of the peptide, such as replacing isoleucine or valine with leucine, or glutamic acid aspartate , Or serine substituted for melamine, or any other structurally related amino acid residues, such as a combination of similar acidity, polarity, size or similarity etc. The present invention further provides a free polynucleotide Numerator, including a core This paper is sized for the Chinese National Standard (CNS) A4 (210X 297 mm)

Order 585910 A / ___B7___ V. Description of the invention (21) Please read the notes on the back first

The nucleotide sequence encodes an A v e C homogeneous gene product. The eC homogeneous gene product, as used herein, is defined as a plastid p SE 1 8 having a gene product having at least 50% amino acid sequence identical to the amino acid sequence encoding the Ave C gene product of Streptomyces averaverii. 6 (ATCC

2 0 9 6 0 4), or the amino acid sequence shown in FIG. 1 (SEQ ID N 0: 2). In a non-limiting example,

A v e C homogeneous gene product is obtained from Streptomyces hygroscopicus (described in European Patent 0298423; deposited in FERM BP-1901) and the amino acid sequence of SEQ ID NO: 4, or a homogeneous portion thereof. The `` homogeneous part of the amino acid sequence in SEQ ID NO: 4 means that a polypeptide contains at least 70% of the amino acid sequence of SEQ ID NO: 4 and it constitutes a homogeneous gene with a function equivalent to Ave C product. ~ Functionally equivalent 〃 A Cve homogeneous gene product is defined as a gene product, when it appears in the natural ave C homogeneous equivalent gene inactivated Streptomyces hygroscopicus strain FERM BP-901-01, the center of the Ministry of Economy The ratio and quantity of streptomycin printed by the Consumer Cooperative of the Bureau of Standards are the same as those of the strain FER Μ Β Β -1 9 0 1 when only showing wild type, and this functional a ν e C homogeneous equivalent gene is a hygroscopic chain The mold strain FERM BP — 1 9 0 1 is naturally owned. In a non-limiting example, the Streptomyces hygroscopicus A v e C homogeneous gene product encoded by the free polynucleotide molecule of the present invention comprises a nucleotide sequence of S E Q ID No: 3 or a homogeneous portion thereof. A `` homogeneous part '' of a free polynucleotide molecule, a nucleotide sequence comprising SEQ ID NO: 3 means that a free polynucleotide molecule contains at least 70% of the nucleotides of SEQ ID NO: 3 Acid sequence, and its editing 24-- This paper size applies to Chinese National Standard (CNS) A4 specifications (210X 297 mm) 585910 Printed by A7 B7 of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. The description of the invention (22) code is equivalent Ave C homogeneous gene products are as defined above. The invention further provides a polynucleotide molecule comprising a nucleotide sequence of SEQ ID NO: 3 which is homogeneous to Streptomyces hygroscopicus. The term “a homogeneous” means that a polynucleotide molecule includes a nucleotide sequence homogeneous to the coding sequence SEQ ID NO: 3 of the homogeneous gene product of Streptomyces hygroscopicus Ave C. A nucleotide sequence is: (a) the encoded gene product is the same as the nucleotide sequence of SEQ ID NO: 3, or a homogeneous portion thereof, but including one or more silent changes according to the degenerate gene code Nucleotide sequence; or (b) hybridization to a complementary polynucleotide molecule having a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 4; this hybridization is performed under moderately stringent conditions For example, in the presence of 0.5 Molar NaHP04, 7% sodium dodecylsulfonate (SDS), 1 millimolar EDTA, and 65 ° C hybridization to DNA-bound filter paper, and then to 0 · 2XSSC / 0 · 1% SDS was washed at 42 ° C (see Ausbeletal above). It encodes a functional homogeneous Av e C gene product as defined above. In a preferred embodiment, the homogeneous polynucleotide molecule can be hybridized to a nucleotide sequence complementary to SEQ ID NO: 3 encoding the Ave C homogeneous gene product or a homogeneous portion thereof. This hybridization effect It is performed under highly stringent conditions, such as NaHP04 at 0.5 Molar, 7% sodium dodecyl sulfonate (SS), EDTA at 1 Molar, and hybridization to 65 ° C. DNA-bound filter paper, then washed with 0.1 XSSC / 0 · 1% SDS at 68 ° C (Same as Ausubel et al., 1 989), and the code is as defined above (please read the notes on the back first) (Reappear on this page)

l · The size of the paper is in accordance with the Chinese National Standard (CNS) A4 (210X297 mm). It is printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs. . The present invention further provides a polynucleic acid molecule comprising a nucleotide sequence encoding a polypeptide homogeneous to a homogeneous gene product of Streptomyces hygroscopicus Av e C. As used herein, a polypeptide is homogeneous in the Av e C homogeneous gene product of Streptomyces hygroscopicus SEQ ID NO: 4, and "homogeneity" refers to a polysaccharide having the amino acid sequence of SEQ ID NO: 4 Peptide, but in which one or more amino acid residues have been conservatively substituted with a different amino acid residue, and this conservative substitution results in a functionally equivalent Av e C homogeneous gene product as defined above. The present invention further provides oligonucleotides that can be hybridized to a polynucleotide molecule having the nucleotide sequence of FIG. 1 (SEQ ID NO: 1), or SEQ ID NO: 3 or hybridized to have a complement to the figure 1 (SEQ ID NO: 1) or SEQ ID NO: 3 polynucleotide molecule of the nucleotide sequence. This oligonucleotide is at least about 10 nucleotides in length, and preferably about 15 to 30 nucleotides in length, and can be hybridized to the aforementioned polynucleotide molecule under highly stringent conditions, such as: ~ 14 4 base oligonucleotides were washed at 6 \ 3 3 (: / 0.5% sodium pyrophosphate at 37 ° C, ~ 17 base oligonucleotides were at 4 8 ° C. Wash, ~ 20 base oligonucleotides are washed at 5 5 t, and ~ 23 base oligonucleotides are washed at 60 ° C. In a preferred embodiment, this oligonucleotide Nucleotides are complementary to some of the aforementioned polynucleotide molecules. These oligonucleotides are used for different purposes, including encoding or as anti-strand molecules for gene regulation, or as amplifying codes for ave C or ave C homopolymeric nuclei Primers for the glycosyl acid molecule. (Please read the precautions on the back and then this page) The size of the paper is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) -26-585910 Preparation of A7 B7 V. Description of the Invention (24) Using known conjugation techniques, use the polynucleotide molecules or oligonucleotides disclosed herein to identify them Species or Streptomyces strains, for example, a polymorphism containing a portion of the Streptomyces avertinus nucleotide sequence of Fig. 1 (SEQ ID NO: 1) or a portion of SEQ ID NO: 3 Nucleotide molecules can be identified as detectable and used to screen genomic databases constructed from DNA from interested microorganisms. The stringency of the hybridization status is selected based on reference organism relationships, in this example That is, Streptomyces averaverii or Streptomyces hygroscopicus is relative to the organism of interest. The requirements of different stringency are known to those skilled in the art, and this situation varies depending on the identification sequence derived from the particular organism in the database. The optimal length of such oligonucleotides is at least about 15 nucleotides and includes descriptions of the following examples. Using polymerase chain reaction (PCR) and other amplification techniques, such as standard techniques such as ligation enzyme chain reaction, use these and Other oligonucleotides are amplified by homogeneous genes. Identification of clones containing ave C homogeneous nucleotide sequences can determine their ability to encode functional Ave C homogeneous gene products. To this end For the purpose, the sequence analysis of these selected strains can be analyzed to identify a more suitable editing area and the start and stop signals. In addition, the DNA sequence of this selection can be inserted into a suitable expression vector, such as containing transcription and translation. Vectors for the required elements of the inserted protein coding sequence. Any different host / vector system can be used in the following descriptions, including but not limited to bacterial system plastids, bacteriophages or adhesion plastid expression vectors. Potential ave C homologous coding vector transformed with a suitable host cell, you can use the PLC analysis of fermentation products to analyze Ave C-type activity, such as (please read the precautions on the back before this page) The paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) -27- 585910 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (25) As described in Section 7 below. The techniques used to make and manipulate the polynucleotide molecules disclosed herein can be performed according to genetic recombination techniques described in, for example, Maniatis, et a 1 ·, 1 89, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Ausbel, et al., 1989, Current Protocols In Molecular Biology, Greene Publishing Associates & WileyIntercience, NY; Sambrook, et al., 1 989, Molecular Cloning: A Laboratory Manual , 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY; Innis et al. (Eds), 1 995, PCR Strategies, Academic Press, Inc., San Diego; and Erlich (ed), 1 992, PCR Technology, Oxford University Press, New York, which are incorporated by reference in this article. Polynucleotide clones encoding A v e C gene products or A v e C homogeneous gene products can be identified using any method known in the art, including but not limited to the methods described in Section 7 below. Used described in Benton and Davis, 1977, Science 1 96: 1 80, for bacteriophage libraries, and Grunstein and Hogness, 1 975, Proc. Natl. Acad. Sci. USA, 72: 396 1 -3965, for plasmid libraries and other technologies Methods To screen ave C and ave C homogeneous coding sequences in a genomic DNA database. Polynucleotide molecules with the aveC ORF or plastid PSE119 (described in Section 7 below) nucleotide sequences present in plastid PSE186 (ATCC 209604) can be used as probes in these screening experiments. In addition, the Chinese National Standard (CNS) A4 specification (210X297 mm) _ of 8 _ can be applied from a part of the purified Ave C homogeneous gene product or the finished paper (please read the precautions on the back page) ιτιί 585910 A7 B7 V. Description of the invention (26) The nucleotide sequence deduced from the amino acid sequence is used to synthesize oligonucleotide probes. 5.2. Recombination system 5.2.1 · Selection and expression vectors The present invention further provides recombinant selection vectors and expression vectors, which are useful for the selection or expression of the polynucleotide molecules of the present invention, such as aveC ORF of Streptomyces averaverii. Or any aveC homogeneous ORFs. In a non-limiting example, the present invention provides a plastid pSE186 (ATCC 209604) which contains the complete Streptomyces avermites ave C gene ORF, or all of which is described below from Streptomyces avermitus ave C ORF, or from Streptomyces avermitensis containing 〇RF or part of the polynucleotide molecule, or Ave C gene product of Streptomyces avermitilis, also about ave C homogeneous product and Ave C homogeneous gene product, unless explicitly instructed or as shown in the preceding and following. There are some differences Vectors have been developed specifically for use in the genus Streptomyces, including phage, high replication number plastids, low replication number plastids, and E. coli-streptomyces shuttle vectors, etc. Any of these vectors can be used in the practice of the present invention Many drug resistance genes from Streptomyces have been cloned, and many of them have been incorporated into the vector as screening markers. Examples of vectors currently used for Streptomyces are presented in Hutchinson, 1980, Applied Biochem. Biotech. 1 6: 1 69-1 900 0 The recombinant vector of the present invention, especially the expression vector, is preferably constructed so that the sequence encoding the polynucleotide molecule of the present invention is located in a One or more reels This paper size applies to the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 29-Please read the notes at the back

Printed by the Consumer Standards Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (27) Operational adjustments necessary for the recording and translation of the regulatory elements to produce a multi-peptide sequence for the coding sequence. As used herein, the nucleotide sequence of 'regulatory elements' includes, but is not limited to, encoding inducible and non-inducible promoters, enhancers, operators and other techniques known in the art as driving and / or regulating expression. Nucleotide coding sequence. As used herein, the coding sequence is performed in a related, operationally related manner, with one or more regulatory elements to effectively regulate and transcribe a coding sequence or its m R N A, or both. Typical plastid vectors for genetic engineering containing the polynucleotide molecule of the present invention include pCR — Blunt, pCR2 · 1 (Invitrogen), pGEM3Zf (Promega), and the shuttle vector p W Η Μ 3 (Vara et al., 1 989, J. Bact. 1 7 1: 5872- 588 1) and so on. Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economics Known methods for constructing recombination vectors include placing special coding sequences in appropriate regulatory elements relevant to the operation, and these methods can be used to implement the invention. These methods include in vitro recombination techniques, synthetic techniques, and in vivo gene recombination, see Maniatis et al., 1989, supra; Ausubel et al., 1 989, supra; Sambrook et al., 1 989, supra; Innis et al ·, 1 995, ibid .; and Erlich, 1992, ibid. The regulatory elements of these vectors can change their intensity and specificity. Depending on the host / vector system utilized, any number of suitable transcription and translation elements can be used. Non-limiting examples of bacterial transcriptional regulatory regions or promoters include the / 3-galactose promoter, T7 promoter, TAC promoter, lambda left and right promoters, tryptophan and lactose promoters, and tryptophan-lactose combination Promoters and e rmE, me 1 C, and -30 for Streptomyces-(Please read the precautions on the back before this page) This paper size applies to China National Standard (CNS) A4 (210X 297 mm) 585910 Economy Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry A 7 B7 5. Invention Description (28) ti pA promoter and so on. In a special embodiment described below in Section 11 below, a performance vector is constructed by colonizing av e C 0 R F adjacent to the strong basic promoter er m E from polysaccharide of brown sugar polysaccharide. This vector was transformed into Streptomyces avermitilis, and the fermentation product was analyzed by ΗPLC. It was pointed out that the streptomycin avermitomycin produced had an increased potency than those of the same strain but only exhibited the wild-type ave C equivalent gene. . The combined protein expression vector can be used to express the combined protein of the A v e C gene product. The purified combined protein can be used to produce anti-blood pupa against Av e C gene products, to study the biochemical properties of Av e C gene products, to plan the different biochemical activities of Ave C combined proteins, or to assist in identification or The expressed Ave C gene product was purified. Possible combined protein expression vectors include, but are not limited to, a vector incorporating a sequence encoding a Θ galactosidase and tryptophan E complex, a maltose binding protein complex sequence, a glutathione sulfur transferase complex, and a polyhistamine complex Sequence (carrier area). In a variant embodiment, the Av e C gene product or part thereof may be incorporated into the Av e C homogeneous gene product or part thereof derived from other species of Streptomyces; for example, Streptomyces hygroscopicus or Streptomyces griseus. It is described in a special example in Section 12 below and is depicted in FIG. 7. A chimeric protoplast containing a 5 6 4 bp region of Streptomyces hygroscopicus ave C homogeneous ORF is substituted for Streptomyces avermites ave C 〇RF homogeneity 5 6.4 bp region. Such fusion vectors can be transformed into Streptomyces averaverii cells and tested to determine their effect on the ratio of streptavidin manufactured in the category 2: 1. Ave C combined protein can be planned to contain areas for purification (please read the precautions on the back before this page) The size of the paper is applicable to China National Standard (CNS) 8-4 (210X297 mm) -31-585910 Α7 Β7 Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of Invention (29). For example, Ave C-maltose-binding protein complexes can be purified using amylose resin; Ave C-glutathione sulfur transferase-associated proteins can be purified using glutathione agar beads; and Ave C- The polyhistamine complex can be purified using a divalent nickel resin. Alternatively, antibodies against carrier catalysis or peptides can be used to purify the combined proteins in affinity chromatography. For example, the nucleotide sequence encoding the epitope of the target of a single antibody can be designed to the appropriate position of the regulatory elements of the expression vector of the ~~ operation-related ，, so that the expressed epitope can be combined with the A v c peptide. For example, a FLAG τ M epitope tag (International Biotechnologies Inc.) encoded by a nucleotide sequence is a hydrophilic peptide, which can be inserted into a performance vector through standard techniques and corresponding to Ave C-polypeptide carboxyl terminal position and so on. The expressed Avec peptide-F L A G τ M epitope-associated protein can be detected and affinity-purified using a commercially available anti-F L A G τ M antibody. The expression vector encoding Ave C-associated protein can also be designed to contain multiple junction sequences so that it encodes a specific protease cleavage position for subsequent treatment with a specific protease to enable this expression Ave C peptide to be carried from the carrier region. The joint site is released. For example, the combined protein carrier may contain a DNA sequence encoding a thrombin or factor X a cleavage site. A known method is to process a message sequence upstream from av e COF and the av e COF editing area into the expression vector, which can directly transport and secrete the expressed gene product. The message sequence in the non-limiting example includes taking α-factors, immunoglobulins, outer cell membranes, and paper sizes. Applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) Print A7 _B7 V. Description of the invention (30) White matter, penicillin enzyme, and T-cell receptor. To assist in the selection of host cells transformed or transfected with the expression or selection vector of the present invention, this vector may be further processed to contain a coding sequence for a reporter gene or other selectable marker. Such a coding sequence is preferably within the coding sequence of the adjustment elements of the operation-related frame. Reporter genes which are used in the present invention and are well-known in the art include encoding green fluorescent protein, luminase, X y 1 E, and tyrosinase. Nucleotide sequences encoding selectable markers are well-known in the art, including genes for anti-antibiotics or genes for anti-metabolites, or providing a particularly needed growth factor. Such sequences include codes for anti-erythromycin , Thiostrepton or kanamycin and so on. 5.2.2. Transformation of a host cell The present invention further provides a transformed host cell comprising a polynucleotide molecule or a recombinant vector of the present invention, and a novel strain or cell strain derived therefrom. Although other prokaryotic or eukaryotic cells can be used, the host cell for carrying out the present invention is preferably a Streptomyces cell. Such transformed host cells typically include, but are not limited to, bacteria transformed with recombinant phage DNA, bacteria transformed with plastid DNA or an adherent plastid DNA vector, or yeasts transformed with recombinant vectors . The polynucleotide molecules of the present invention tend to be functional in Streptomyces, but can also be transformed into other bacteria or eukaryotic cells, such as for breeding or performance purposes. E. coli D Η 5α, which is commonly used conventionally, can be obtained from the American Type Cell Culture Center (A T C C), Rockville, MD, USA (registration number 3 1 343) and purchased from manufacturers (31 such as & 261 ^). Better paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) 33-(Please read the precautions on the back before this page) Μ Order

Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the Invention (31) Nuclear host cells include yeast cells, and mammalian or insect cells can also be efficiently used. The recombinant expression vector of the present invention is preferably transformed or transfected into a substantially homogenized cell culture. This expression vector is often introduced into host cells according to known techniques, such as via protoplast transformation, calcium phosphate precipitation, calcium chloride treatment, microinjection, electro-penetration, and contact with recombinant virus. Transfection, microlipid-mediated transfection, DEAE—polyglucose transduction, conduction, splicing, or microprojection impact. The transformants are screened by standard procedures, such as the screening markers shown by screening, as described above for recombinant vectors associated with antibiotic resistance genes. Once the expression vector is introduced into the host cell, the ave C coding sequence will be integrated and maintained on the host cell chromosome or additional genomes, which can be confirmed by standard techniques, such as Southern hybridization analysis, restriction enzyme analysis, PCR analysis, including Reverse transcriptase PCR (rt_PCR), or via immunoassay to detect the expected gene product. Host cells contain and / or express recombinant ave C coding sequences that can be identified by at least four commonly known methods, including: (i) DNA-DNA, DNA-RNA, or RNA-anti-strand RNA hybridization; (作用) Detect the presence of `` marker '' gene functions; (iii) assess the degree of transcription of ave C-specific mRNA transcripts expressed by host cells; and (iv) detect the presence of mature polypeptide products, such as via Immunoassay or via Ave C biological activity (eg, special ratio and quantity of streptomycin produced in Streptomyces avertinus host cells). (Please read the notes on the back before this page)

This paper size applies to China National Standard (CNS) A4 (210 X 297 mm) -34- 585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (32) Expression and specialization of gene products Once the ave C coding sequence is stably introduced into appropriate cells, the transformed host cells will multiply homologously, and these cells can produce the largest amount of A under favorable growth conditions. ve C gene product. This environment typically involves growing cells to high density. The expression vector contains an inducible promoter, which appropriately induces the environment such as temperature transfer, depletion of nutrients, and adds unnecessary elicitors (such as sugar analogs, isopropyl-1 / 3-D-sulfide Galactosides (IPTG)), accumulation of intermediate metabolites, etc. are required to induce performance. t When the expressed Ave C gene product remains in the host cell, collect and decompose the cell, and isolate and purify the product from the decomposed product under known extraction conditions to reduce protein degradation, such as at 4 ° C or protease inhibition. When the expressed AVec gene product is secreted from the host cell, it is sufficient to collect the nutrient-depleted broth and isolate the product therefrom. Therefore, the Ave C gene product can be isolated or continuously purified from cell decomposition products or cell culture fluids, as long as it is through appropriate standard methods, including but not limited to any combination of the following methods: ammonium sulfide precipitation, size Separation, layer ion exchange chromatography, HPLC, density centrifugation, and affinity chromatography. With appropriate analysis, the biological activity exhibited by the expressed A v e C gene product can be monitored at each purification step to increase the purity of the preparation. Regardless of whether the expressed A v e C gene product exhibits biological activity, it can be detected by its size, or the activity of other A v e C specific antibodies or the presence of associated tags. (Please read the notes on the back before this page)

l · order

This paper size applies to China National Standards (CNS) 8-4 specifications (210X 297 mm) -35- 585910 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 ______B7_ V. Invention Description (33) Therefore, the present invention provides a reorganization Streptomyces averaverii Ave CE includes plastid PSE186 (ATCC 209604) encoding the coding sequence for the amino acid sequence of the Ave C gene product, or the amino group in Figure 1 (SEQ ID NO: 2) An acid sequence or a homogeneous portion thereof and a homogenous substance therein. The present invention further provides a recombinantly expressed Streptomyces hygroscopicus AveC homogeneous gene product, including the amino acid sequence in SEQ. ID NO: 4 or a homogeneous portion thereof and a homogeneous substance therein. The present invention further provides a method for manufacturing an Av e C gene product, comprising culturing a host cell transformed with a recombinant expression vector, the vector comprising a polynucleotide molecule having a nucleotide sequence encoding an Ave C gene product, This polynucleotide molecule is within the `` operation-related regulatory elements '' to control its expression in the host cell, allowing it to perform under cyclic cultures that help to produce the recombinant Ave C gene product, and from cell culture This AveC gene product was recovered. The recombinantly expressed Ave C gene product of Streptomyces averaverii is used for many purposes, including screening for compounds that alter the function of Ave C gene products and regulate the biosynthesis of streptomycin, and can also be used to generate products against Ave C genes. Antibodies. Once the Ave C gene product is obtained in sufficient purity, it can be characterized using standard methods, including SDS-PAGE, size exclusion chromatography, amino acid sequence analysis, and fabrication in the Streptomyces averaverii biosynthetic pathway Biological activity of appropriate products and so on. For example, using standard peptide sequencing techniques to determine the amino acid sequence of the A v e C gene product. This (Please read the notes on the back before this page)

-l · order

This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) -36- 585910 A7 B7 V. Description of the invention (34) Ave C gene product can be further characterized by using hydrophilicity analysis (see Hopp and Woods , 1981, Proc. Natl. Acad. Sci. USA 78: 3 824) or analog computer software to identify the hydrophobic and hydrophilic regions of the Ave C gene product. Structural analysis can be used to identify specific secondary structural regions of the hypothetical A v e C gene product. Biophysical methods like X-ray crystallization (Engstrom, 1974, Biochem. Exp. Biol. 11: 7-13), computer simulation (Fletterick and Zoller (eds), 1986), in: Current Communications in Molecular Biology, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY), as well as nuclear magnetic resonance (NMR), can locate and study the position of the Aν e C gene product and its interaction with the mass. The data obtained from these studies can be used to screen for mutation positions in av e COF to assist in the development of new strains of Streptomyces averaverii with more desired streptomycin production characteristics. 5.3. Construction and Use of A v e C Mutant Strains

The present invention provides a polynucleotide molecule comprising a plastid PSE 1 8 6 (ATCC 209604) containing the same nucleotide sequence as that encoded by the product of the Streptomyces avermitus Av e C gene, as shown in FIG. 1 (SEQ ID NO: 1 AveC ORF nucleotide sequence of Streptomyces avermitilis, but further contains one or more mutations, so the wild-type aveC equivalent of Streptomyces avermitilis ATCC 53692 cells has been deactivated, and its expressed Polynucleotide molecules containing mutated nucleotide sequences can produce different proportions or quantities of Streptomyces avermitilis, especially when compared with Streptomyces averaverii, which only exhibits wild-type ave C equivalent genes. This paper is applicable to China. National Standard (CNS) A4 (210X 297 mm) Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 ______B7_ V. Description of Invention (35) 53692 strain comparison. According to the present invention, such a polynucleotide molecule can be used to make a novel strain of Streptomyces averaverii, and this novel strain exhibits a detectable value when compared with the same strain but showing only the wild-type ave C peer gene. Changes in the production of streptomycin. In a preferred embodiment, the polynuclear acid molecule can be used to produce a novel Streptomyces avertinus strain. When compared with the same strain but only showing the wild-type ave C equivalent gene, the Avertin chain can be used. The reduction in the production ratio of type 2 ... In a further preferred embodiment, 'this polynucleotide molecule can be used to produce a novel Streptomyces avertinus strain' can be increased when compared with those of the same strain but showing only wild-type ave C equivalents. The amount of avertin. In a further preferred embodiment, the polynucleotide molecule can be used to produce a novel strain of Streptomyces averaverii in which the av e C gene has been deactivated. Mutations in the av e C coding sequence include the deletion, addition or substitution of any amino acid, or result in a truncated Av e C gene product, or any combination thereof, and can produce the desired result. For example, the present invention provides a plastid PSE186 (ATCC 209604) of a polynucleotide molecule comprising an Ave C gene product coding sequence, or Streptomyces averaverii aveC 0 RF as shown in FIG. 1 (SEQ ID NO: 1). A nucleotide sequence, but further comprising substituting an amino acid residue at the Ave C gene product screening position with a different amino acid residue. In several non-limiting examples, such substitutions can be made at any of the amino acid positions 55, 138, 139, or 230 or a combination of some of them, as follows. This paper size applies the Chinese National Standard (CNS) M specification (210X297 mm) _ 38 _ (Please read the notes on the back before this page) 0 Order — 585910 A7 B7 V. Description of the invention (36) of the ave C coding sequence Mutation can be performed by any known method, including using error-latency PCR, or by expressing cassette mutation effects. For example, oligonucleotide-direct mutation can be used to change the av e COF sequence at a specific position, such as introducing one or more restriction enzyme positions, or introducing a stop code in a specific region in the av e COF sequence. The methods described in U.S. Patent 5,605,793, including random fragmentation, repeated loop mutations, and nucleotide alterations, can be used to generate polynucleotides having a nucleotide sequence encoding ave C mutation Large database of molecules. The mutations printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs can be used to specifically change the conservative amino acid residues of one or more A v e C gene products. For example, compare the Ave C gene products in Streptomyces averaverii (SEQ ID 1 ^ 〇: 2), Streptomyces gray (3 Mad < 3 ID NO: 5) and Streptomyces hygroscopicus (SEQ ID No .: 4). The deduced amino acid sequence of the homogeneous gene product of Ave C (as shown in Figure 6) indicates a significant conservative amino acid residue position between the species. The target mutation can predominantly alter one or more of these conservative amino acid residues, and is particularly effective in producing novel mutant strains of streptavidin that exhibit the desired changes. Random mutagenesis is also useful, either by exposing Streptomyces avermitilis cells to ultraviolet radiation or X-rays, or using nitrogen-methyl-nitrogen-nitroguanosine, ethyl methanesulfonic acid, nitric acid or nitrogen mustard gas, etc. Chemical mutant treatment. See Ausubel, 1 989, for a review of mutagenesis techniques above. Once a mutated polynucleotide molecule is produced, it is screened to determine that this paper size applies the Chinese National Standard (CNS) A4 specification (2i0x 297 mm). ) -39- 585910 A7 B7 printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (37) Whether they can regulate the biosynthesis of streptomycin of streptomyces avertinus. In a preferred embodiment, Polynucleotide molecules with mutated nucleotide sequences were tested via Streptomyces avermitilis, which were complementary to an ave gene that had been deactivated to exhibit an ave C negative (ave C —) background. In a non-limiting method, the mutated polynucleotide molecule is spliced into a regulatory element expressing A-related genes in the plastid, and the plastid preferably contains one or more drug resistance genes to facilitate Screen transformed cells. This vector is then transformed into ave C-host cells using known techniques, and the transformed cells are screened, and then cultured in a suitable fermentation medium to produce avertin or induce avertin Manufacturing of streptomycin. The yeast product is then analyzed using PLLC to determine the ability of this mutant polynucleotide molecule to complement the host cell. Several vectors with mutant polynucleotide molecules can reduce the streptavidin of B 2: B 1 ratios, including PSE188, PSE199, and PS E 2 31. These examples are shown in section 8.3 below. The present invention provides a method for identifying whether the mutated Streptomyces avertinus a v e C ORF can change the production ratio and / or amount of streptomycin. In a preferred embodiment, the present invention provides a method for identifying mutant ave CORF that can change the manufacture of a streptomycin of 2 to 1 ratio, including: (a) determining the natural ave C pair Production ratio of streptomycin avertinomycetin strain 2: 1 which has been deactivated and introduced a polynucleotide molecule encoding the mutated Ave C gene product nucleotide sequence and expressed Streptomyces avertinus strain type 2: 1; b) It is determined that the same strain as step (a), but showing only the nucleotide sequence of the ORF2 ave C equivalent gene of FIG. 1 (SEQ ID NO: 1), or the homogeneous nucleotide sequence therein, the Chinese standard ( CNS) A4 specification (210 X 297 mm) _ 40-585910 A7 B7 V. Description of the invention (38) Production of strains of type 2: 1 Streptomyces averaverii; (c) Comparison steps (a) and (b) The production of streptomycin of Streptomyces avermitilis species 2 ·· 1, if the results of (a) and (b) are different, then it has been identified that the mutant aveC ORF can change the species of aver Streptomyces 2: 1 Manufacturing of mold. Printed in a further preferred embodiment by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economics, the present invention provides a method for identifying mutant aveCORF or gene construction with aveC ORF that can alter the manufacture of avertin Quantities, including: (a) Polynucleotide molecules that determine that the natural ave C peer gene has been deactivated and that introduces a mutated Ave C gene product nucleotide sequence or has a nucleoside encoding the Ave C gene product The amount of streptomycin produced by Streptomyces avermitilis and expressed by the acid sequence; (b) Determine the same strain as step (a) but only show the ave C equivalent gene of ORF in Figure 1 (SEQ ID NO: 1) The amount of streptomycin produced by a nucleotide sequence or a strain having a homogeneous nucleotide sequence therein; (c) comparing the amount of streptomycin produced by Streptomyces avermitilis in steps (a) and (b), If it is not the same, it has been identified that the mutant ave C ORF or gene construction can alter the production of streptomycin. In a preferred embodiment, mutations increase the amount of streptavidin produced. Any of the previously mentioned methods for identifying mutations is performed in a fermentation broth, preferably cyclohexanecarboxylic acid, or any other suitable fatty acid precursor listed in Table 1. Once it is identified that the mutant polynucleotide molecule that can regulate the production of streptomycin is in the desired direction, the position of the mutation on the nucleotide sequence can be determined. This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 Mm) _- 585910 A7 B7 V. Description of the invention (39). For example, a polynucleotide molecule having a nucleotide sequence encoding a mutated A v e C gene product can be isolated via PCR and DNA sequence analysis can be performed using known methods. By comparing the DNA sequences of the mutated av e C peer and the wild-type a v e C peer, the mutation responsible for altering the production of streptavidin was determined. In a particular but non-limiting embodiment of the invention, the Ave C gene product of Streptomyces averaverii contains any single amino acid substituted at residues 55 (S55F), 138 (S138T), 139 (A139T) or 230 (G230D ) Or two substitution positions at 138 (S138T) and 139 (A139T) can change the function of Ave C gene, such as changing the manufacturing ratio of streptomycin of type 2: 1 (see section 8 below). Therefore, the present invention comprises a polynucleotide molecule having a nucleotide sequence encoding a mutant Streptomyces averaverii Av e C gene product, the amino acid of which is substituted at one or more residues 5 5, 1 3 8, 1 3 9 or 2 3 0 or any combination thereof. Printed by the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs (please read the precautions on the back before this page)

The present invention further provides components for the production of a novel Streptomyces avermitilis strain, and this cell contains a mutant av e C equivalent gene that can alter the production of streptomycin avermitil. For example, the recombinant vector provided by the present invention can be used to insert a polynucleotide molecule having the mutated nucleotide sequence of the present invention to the ave C gene position of Streptomyces averaverii to insert or replace ave CORF or via homogeneity. Reorganize some of them. When the polynucleotide molecule with the mutated nucleotide sequence provided by the present invention is inserted outside the ave C gene of the chromosome of Streptomyces aversii, or when it is maintained in the extra gene body of Streptomyces avers, it also has the ability to regulate Aver The function of streptomycin biosynthesis. Therefore, the present invention also provides a polynucleotide copy containing the mutated nucleotide sequence of the present invention. The paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) • 42 · 585910 A7 B7 Staff Consumption of Central Standards Bureau, Ministry of Economic Affairs The cooperative prints a vector of the invention (40). This vector can be used for insertion into the chromosome of Streptomyces avermitus except the ave C gene, or it can be maintained in additional genes. In a preferred embodiment, the present invention provides a gene replacement vector that can be used to insert a mutant ave C peer gene into a Streptomyces avertinus strain, and the resulting novel Streptomyces avertinus strain is the same as this strain but only When comparing wild-type ave C equivalents, it is possible to change the production ratio of streptomycin of type 2: 1. In a preferred embodiment, the cells reduce the production of streptomycin in a ratio of 2: 1. Such gene replacement vectors can be constructed into expression vectors, such as P S E 1 88, PSE199 and PSE231 in Section 8.3 below. In a further preferred embodiment, the vector provided by the present invention can be used to insert a mutant ave C peer gene into a Streptomyces avertinus strain to produce a novel strain, and the cells of the novel strain are the same as those of the same strain but Comparisons with only wild-type ave C equivalents can alter the production of streptomycin. In a preferred embodiment, the cells can increase the production of streptavidin. In a particular but non-limiting embodiment, this vector further comprises a strong promoter known in the art, such as placing the strong nature er m E promoter from polysaccharides of brown sugar saccharomyces upstream of av e C 0 R F. This vector, such as plastid p s E 1 8 9 is described in Example 11 below, or constructed using a mutant a v e C peer gene in plastid p S E 1 8.9. In a still further preferred embodiment, the present invention provides a gene replacement vector that can be used to deactivate the wild-type a v e C peer gene in Streptomyces avertinus. In a non-limiting example, one can use the plastid (please read the notes on the back before

Order

This paper size applies to China National Standard (CNS) A4 (210X297 mm) _ 43-Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (42) Same strains but showing only wild-type ave C pairs When the isogenic strains are compared, the performance results are altered in the amount of streptavidin produced, and the selected transformed cells can produce the altered amount of streptavidin. In a preferred embodiment, the transformed cells produce an increased amount of streptomycin. In a still further preferred embodiment, the present invention provides a method for manufacturing a novel Streptomyces averaverii strain, the cell comprising a deactivated ave C peer gene, including a deactivated av e. C peer gene The vector was transformed into a strain of Streptomyces averaverii expressing a wild-type ave C equivalent gene, and transformed cells in which the ave C equivalent gene had been deactivated were selected. In a preferred but non-limiting embodiment, a gene replacement vector carrying a mutated inactive ave C peer gene or a partial replacement of the ave C peer gene via a heterogeneous gene sequence is transformed into Streptomyces averaverii, and The transformed cells were screened for those native ave C peers that had been replaced by inactive ave C peers. Analysis of the fermented product by Η P L C can determine the deactivated a v e C equivalent. In a particular but non-limiting embodiment, as described in Section 8.1 below, this av e C peer gene is deactivated by inserting the er m E gene from Polysaccharides from brown sugars into a v e COF. The invention further provides a novel Streptomyces averaverii strain transformed with any of the polynucleotide molecules or vectors of the invention. In a preferred embodiment, the present invention provides a novel Streptomyces averaverii strain that expresses a mutant ave C equivalent gene that replaces or additionally to the wild type ave C equivalent gene, and is the same strain but only exhibits wild type ave C When compared with peers, it is possible to produce a streptomycin with a 2: 1 ratio change. In a preferred embodiment, the novel cell reduces manufacturing by changing the species 2: 1 ratio. This (please read the precautions on the back before this page) l · The size of the paper used for this edition is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) -45- 585910 A7 B7 Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economy 2. Description of the invention The novel (43) type of novel strains are suitable for commercial mass production of streptomycin, such as doxorubicin. The primary purpose of the screening analysis described herein was to identify Streptomyces avermitilis cells that exhibit mutations in the a v e C peer gene and alter and reduce species 2: 1 ratio of Streptomyces averaverii. In a preferred embodiment, the novel Streptomyces avermitilis strain expressing the mutant ave C peer gene of the present invention will reduce the type 2: 1 ratio of streptomycin production by avermitomycin and make it B 2: B 1 The streptavidin ratio is between 1.6: 1 and 0: 1; in a more preferred embodiment, the ratio is between 0.84: 1 and 0: 1. In a specific embodiment described below, the ratio of cyclohexyl B 2: cyclohexyl B 1 to a streptomycin produced by the novel streptomycin of the present invention is less than 1.6: 1. In a different specific embodiment described below, the ratio of cyclohexyl B 2: cyclohexyl B 1 avertin streptomycin produced by the novel streptomycin of the present invention is about 0.94: 1. In a further different specific embodiment described below, the ratio of cyclohexyl B 2: cyclohexyl B 1 and avertinomycin produced by the novel cells of the present invention is about 0.88: 1. In a further different specific embodiment described below, the ratio of cyclohexyl B 2: cyclohexyl B 1 and avertinomycin produced by the novel cells of the present invention is about 0.8 4: 1. In a further preferred embodiment, the present invention provides a novel Streptomyces averaverii expressing a mutant ave C peer gene, or a ave C peer gene construct containing a substitution or additional to a wild-type ave C peer gene. Strain, and this novel strain is compared with the same strain but only shows the wild-type ave C equivalent gene, can produce a changed amount of Streptomyces averaverii (please read the precautions on the back before

l · order

This paper size applies to China National Standard (CNS) A4 (210X 297 mm) -46- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 ___B7___ V. Description of Invention (44) In a preferred embodiment, this novel strain can produce increased amounts of streptomycin. In a non-limiting embodiment, the gene construction further includes a strong promoter, such as placing the strong er mE promoter from polysaccharides of brown sugars upstream of the operationally related and av e COF. In a further preferred embodiment, the present invention provides a novel Streptomyces averaverii strain in which the av e C gene has been deactivated. This strain can be used in different ranges of streptomycin produced by comparison with wild-type strains, and the complementary screening analysis described in this article determines the target or random mutation of the ave C gene against streptavidin Manufacturing impact. In a particular embodiment described below, the Streptomyces avermitilis host cell is genetically engineered to inactivate its av e C gene. For example, the strain SE180-11 described in the following example, which is produced by using gene replacement plastid pSE180 (ATCC 2 0 9 6 0 5) (Figure 3), is inserted by inserting the erm E resistance gene into the ave C coding region. Active ave C gene from Streptomyces avermitilis. The present invention further provides a recombinantly expressed mutant Streptomyces averaverii A v e C gene product, which encodes any one of the aforementioned polynucleotide molecules of the present invention, and the preparation method is the same. The present invention further provides a method for manufacturing streptavidin, including cell culture of a streptavidin strain, and the cell exhibits a gene product encoded by a mutant ave C peer gene, and the same strain but only exhibits wild-type ave C When comparing the gene products encoded by the equivalent genes, the production ratio of streptavidin of type 2: 1 can be changed, and the culture condition is under the circumstance that the production of streptomycin is allowed or induced, and can be changed from Recovered from the culture medium (Please read the precautions on the back before this page)-Order

This paper size applies to China National Standard (CNS) A4 (210X297 mm) -47- 585910 Α7 Β7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (45) Avertin. This method provides an effective increase in the production of commercially available avermectin, such as polytetracycline. The present invention further provides a method for manufacturing streptavidin, comprising cell culture of a streptavidin strain, and the cell exhibits a mutant ave C equivalent gene or a gene product encoded by a gene construct containing the ave C equivalent gene, Compared with the same strain but only showing the gene product encoded by the wild-type ave C equivalent gene, the production quantity of Streptomyces avertinus can be changed, and this culture condition is in an environment that allows or induces production of streptomycin, And the avertin can be recovered from the culture solution. In a preferred embodiment, the av e C equivalent gene or gene-constructed cell culture produces increased streptomycin. The invention further provides a novel composition of streptavidin, produced by a strain of streptomyces avertin which can express a mutant ave C equivalent gene that can reduce the production of streptomycin in a ratio of 2: 1. And the manufacture of novel streptavidin is to reduce the ratio of species 2: 1; this is a strain that shows the mutant ave C equivalent gene after comparing with the same strain but only shows the wild type ave C equivalent gene The results show that the novel Streptomyces avermitilis component can appear in or recover nutrient-depleted broth culture medium and can be partially or continuously purified from the culture medium by known biochemical purification techniques. For example, purification by ammonium sulfate precipitation, dialysis, size separation, ion exchange chromatography, ΗPLC, etc. 5.4. The use of streptomycin is a highly active antiparasitic agent, especially used as a snail drive (please read the precautions on the back before this page).

This paper size applies to Chinese National Standard (CNS) A4 (210X 297 mm) -48- 585910 A7 B7 V. Description of the invention (46) Insecticides, ectoparasites, insecticides and pinworms. The streptavidin compound produced according to the method of the present invention can be used for the above purpose. For example, the streptavidin compound produced according to the present invention can be used to treat different human diseases and conditions known in the art, especially those caused by parasitic infection, see Ike da and Omur a,

1 997, Chem. Rev. 97 (7): 259 1 -2609. More specifically, the streptavidin compound produced according to the present invention is effective in treating many diseases or conditions caused by endoparasites, such as those that can infect humans, livestock, pigs, sheep, 'poultry', horses or cattle. Parasitic nematodes. More specifically, the Streptomyces averaverii compound produced according to the present invention is effective against those nematodes that can infect humans and different animals. Such nematodes include the gastrointestinal tract parasite 'Entomophyllum layer', Entomophyllum caninum, Trichomonas, Trichinella, mammalian nematodes, flagellates Ascaris, bloodworms, and parasitic blood Or other tissue or organ parasites, such as the genus Filaria and the parenteral genus Trichinella and Trichinella. Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, the avermectin compound produced according to the present invention is also used to treat ectoparasite infections. Arthropods, such as migratory biwing larvae, infect mammals and birds, and can affect cattle and horses. The streptomycin compound produced according to the present invention is also used as an insecticide against domestic pests, such as cockroaches, stupids, carpet beetles and house flies, etc., as well as storage of pests of pupae and crops, including spiders, Ascaris, aphids, tadpoles and orthoptera locusts, etc. -49- which can be treated with the avertinomycin compound manufactured according to the present invention The paper size is applicable to Chinese National Standard (CNS) A4 (210X297 mm) 585910 Printed by A7 ____ B7 5. Description of the invention (47) Animals include sheep, sheep, horses, deer, goats, pigs, birds, poultry, dogs and cats. The streptomycin compound produced according to the present invention can be designed to give a suitable formulation according to the type of host animal to be treated and the parasite or infected insect. The streptomycin compound produced according to the present invention can be administered orally if it is used as a parasiticidal medicine, such as capsules, big medicine nine, tablets or oral liquids, or it can be poured, injected or injected. The implant pattern is given. Such formulations are prepared according to traditional methods practiced by standard veterinarians. Therefore, capsules, major medicines, or tablets can be prepared by mixing the active ingredient with a suitable finely divided diluent or carrier that additionally contains a disintegrating and / or binding agent, and the binding agent includes starch, lactose, talc Powder, magnesium stearate, etc. The liquid formulation can be prepared by dispersing the active ingredients together in an aqueous solution using a dispersant or a wetting agent. Injectable formulations are prepared by dissolving the active ingredient in a sterile solution containing sufficient salt and / or glucose isotonicity in the blood. Active ingredients of different weights are assigned according to the type of patient or host animal being treated, the severity and type of infection, and the weight of the host. Usually, a dose of about 0.1 mg to 10 mg of an oral active ingredient per kg body weight of a patient or animal may be administered, or a dose of 1 to 5 days may be used. However, the decision to use a higher or lower range can be made on the basis of clinical symptoms by a doctor or veterinarian. In addition, the streptomycin compound produced according to the present invention can also be administered in combination with animal feed. Therefore, it can be prepared by using concentrated feed additives or premixing in normal animal feed. (Please read the notes on the back before this page). L ·, p

This paper size applies the Chinese National Standard (CNS) A4 specification (210X 297 mm) 50 · 585910 A7 B7 V. Description of the invention (48) When used as an insecticide and for treating crop pests, the AA manufactured according to the present invention The streptomycin compound can be applied as a spray, powder, emulsion, etc. according to standard agricultural practices. 6 • Fermentation of protozoan iLL Streptomyces and B 2: B 1 Fermentation of Averpus sp. When branch culture does not provide fatty acids, it lacks branched 2-keto acid dehydrogenase and 5-oxo-formaldehyde. Streptavidin cannot be produced by strains with glycosyltransferase activity. This example demonstrates that if different fatty acids are given at the beginning of biosynthesis, this mutant strain can produce a wide range of B 2: B 1 ratio of streptavidin. 6.1 · Materials and methods Printed by Streptomyces avermitilis ATCC 5 3 6 9 2 from the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs The whole broth is seeded and cultured and stored at 70 ° C. , Laing National)-20 grams; pharmaceutical culture medium (Trader's Protein, Memphis, TN)-1 5 grams; ardamine pH (Yeast Products Inc.)-5 grams; calcium carbonate-1 grams. The final volume was adjusted to 1 liter with tap water, p Η 値 was adjusted to 7.2, and the culture solution was sterilized at 121 ° C for 2 5 minutes. 2 ml of the thawed suspension of the above preparation was inoculated into an Erlenmeyer flask containing 50 ml of the same culture solution. After incubating at 180 ° C for 48 hours at 28 ° C, 2 ml of broth was inoculated into a conical flask containing 50 ml of production culture liquid. The production culture liquid includes: starch-51-this paper The scale is applicable to the Chinese National Standard (CNS) A4 specification (210 X297 mm) 585910 Α7 Β7 V. Description of the invention (49) 80 g; calcium carbonate 7 g; pharmaceutical culture fluid-5 g; dihydrogen phosphate 1 g 1 mg of magnesium sulfate; 0.6 g of glutamic acid; 0. 01 g of ferrous sulfate heptahydrate; 0 · 00 1 g of zinc sulfate; manganese sulfate ~

0 · 00 1 g. Finally, the volume was adjusted to 1 liter with tap water, the pH was adjusted to 7.2, and the culture solution was sterilized at 121 ° C for 2 5 minutes. The different carboxylic acid substrates (see Table 1) were dissolved in methanol 2 g / L. And added to this fermented broth 24 hours after inoculation. Incubate this fermented broth at 28 ° C for 14 days, then centrifuge (2,500 r pm, 2 minutes) and discard the supernatant. The mycelium pellets were extracted with acetone (15 ml), then methylene dichloride (30 ml) was added, and the organic layer was separated, filtered, and naturally evaporated to dryness. The residue was dissolved in methanol (1 ml) and analyzed by a HPLC Hewlett-Packard 1090A liquid chromatography device set at 240 nm with two poles side-by-side vacuum tube detector. Beckman Ultrasphere C_18, 5 μm, 4 · 6 mm x 2 5 cm column was used and maintained at 40 ° C. 25 microliters of the above methanol solution was injected into the column. The separation was in a linear gradient of methanol-water from 80:20 to 95: 5 at 0.85 / ml min for more than 40 minutes. Two standard concentrations of cyclohexyl B 1 were used to calibrate the detector response, and the areas under the B 2 and B 1 astreptomycin curves were measured. 6.2. Results Η P L C residence time observed for streptomycin A 2 and B 1 (Please read the precautions on the back before this page)

.l. Order printed by the Central Consumers Bureau of the Ministry of Economic Affairs, Consumer Cooperatives. The paper size is applicable to the Chinese National Standard (CNS) A4 (210X297 mm) -52- 585910 5. Description of the invention (50), and a 2: 1 ratio display In Table 1. Table 1 HPLC retention time (minutes) Proportion by weight B 2 B 1 B 2: B 1 4-tetrahydropirancarboxylic acid 8. 1 14.5 0.25 isobutyric acid 10.8 18.9 0. 5 3-sugar acid 7.6 14.6 0.62 Sulfur-(+)-2-methylbutanoic acid 12.8 2 1.6 1 · 0 Cyclohexanoic acid 16.9 2 6.0 1. 1.6 3-thiophenecarboxylic acid 8.8 16.0 1. 1.8 Cyclopentanecarboxylic acid 14.2 2 3.0 2 0 3-trifluoromethylbutanoic acid 10.9 18.8 3. 9 2-methylvaleric acid 14.5 2 4.9 4. 2 cycloheptanecarboxylic acid 18.6 2 9.0 15.0 (Please read the precautions on the back before _ 舄 this page) Order

The data printed in Table 1 by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs proves that B 2: B 1 The production ratio of avertin is very wide. It is pointed out that the dehydration conversion of quite different types of 2 compounds is caused by the starting unit of natural fatty acids provided. It is a type 1 compound. It is pointed out that the change in B 2: B 1 ratio may be due to the specific quality change of the Av e C protein. The following example describes the use of cyclohexanecarboxylic acid as a screening substrate. However, this substrate is used for demonstration purposes only and does not limit the present invention. -53- This paper size applies to China National Standard (CNS) A4 (210X297 mm) 585910 A7 B7 Printed by the Consumers' Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs

5. Description of the invention (51) Applicability. 7 · Example: Isolation of a v e C Qingqing This example describes the isolation and characterization of a region encoding A v e C gene product and located on the chromosome of Streptomyces avermitilis. As shown below, the identified av e C gene can modify the ratio of cyclohexyl-B 2 to cyclohexyl-B 1 (B 2: B 1) avertinomycin produced. 7.1. Materials and methods 7.1.1. Growth of Streptomyces to isolate DNA NA The following method is used to grow Streptomyces. A single colony of Streptomyces averaverii ATCC 3 1 272 (single colony isolated oxygen 2) was isolated on 1 / 2-strength YP D-6 medium. YPD-6 includes: Difco yeast extract-5 g; Difco bacteria-protein臃 5 grams; glucose-2.5 grams; M OPS-5 grams; Difco bacterial agar gum-15 grams. Adjust the final volume to 1 liter with water, adjust the pH to 7.0, and sterilize at 121 ° C for 25 minutes. The mycelium growing in the above culture solution was inoculated to 25 mm X 150 mm containing 10 ml of TSB culture solution (Difco Trypsin Soy Broth — 30 g, dissolved in 1 liter of water and sterilized at 121 ° C and 25 ° C). In the test tube, keep shaking (300 rpm) at 28 ° C for 48 -7 2 hours. 7.1-2. Isolate Chromosome D N A from Streptomyces (Please read the precautions on the back before this page)

This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) -54- 585910 A7 B7__ V. Description of the invention (52) Pack the mycelium grown above (0.25 ml or 0.5 ml) ) Into a 1.5 ml microcentrifuge tube and centrifuge the cells at a concentration of 12,000 x g for 60 seconds. Discard the supernatant, and re-dissolve the cells in 0.25 ml TSE buffer (20 ml 1.5 mol sucrose, 2.5 ml 1 mol Tris-HC1, ρΗ8) containing 2 mg / ml lysozyme. · 0, 2 · 5 ml 1 mol EDTA, ρ Η 8 · 0, and 7 5 ml water). This sample was shaken at 37 ° C for 20 minutes, and then loaded into an AutoGen 5 40TM automatic nucleic acid separation instrument (Integrated Separation Systems, Natick, MA), and the genome D N A was isolated using Cycle 159 (software equipment) according to the manufacturer's instructions. Printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs, another method can place 5 ml of hyphae in a 17 mm X 100 mm centrifuge tube, centrifuge the cells at 3, 000 rpm for 5 minutes, and remove the cells Liquid soap. The cells were then re-dissolved in 1 ml of TS buffer, concentrated by centrifugation at 3, 000 r p m for 5 minutes, and the supernatant was removed. The cells were dissolved in 1 ml of T S E buffer containing 2 mg / ml of lysozyme and shaken at 37 ° C for 30-60 minutes. After the effect was completed, 0.5 ml of 10% sodium dodecylsulfonate (SDS) was added, and it was completely decomposed at 37 t. The lysate was reacted at 65 for 10 minutes, and then cooled to room temperature, and then distributed into two 1.5 ml microcentrifuge tubes, and 0.5 ml of phenol / chloroform (50% phenol was first mixed with 0. 5 Molar concentration (Tr is, pH8 · 0: 50% chloroform to reach equilibrium) extraction once. The aqueous phase was removed and extracted 2 to 5 times with chloroform: isobutyl methanol (24: 1). Add 1/10 volume of 3 Molar sodium acetate, PH4. 8 This paper size is applicable to China National Standard (CNS) A4 (210X297 mm) _ 55 Printed by the Central Consumers Bureau of the Ministry of Economic Affairs, Consumer Cooperatives 585910 A7 B7 V. Description of the invention (53) Precipitate DNA, and apply this mixture on ice for 10 minutes, then centrifuge at 15,000: 1 at 5 ° C for 10 minutes, and transfer the supernatant to a solution that has been added to 1 Volume of isopropanol in a clean test tube. This mixture of isopropyl alcohol and isopropyl alcohol was applied on ice for 20 minutes, centrifuged at 15,000 rpm at 5 ° C for 20 minutes, and then the supernatant was removed and washed with 70% alcohol DNA pellets. After the pellets were air-dried, D N A was dissolved in TE buffer (10 millimolar concentration Tris, 1 millimolar concentration EDTA, P Η 8 · 0).

7.1.3. Isolating plastid DNA from Streptomyces Place the aliquoted hyphae (1.0 ml) into a 1.5 ml microcentrifuge tube, and condense the cells by centrifuging at 12,000 0xg for 60 seconds. . After discarding the supernatant, the cells were re-dissolved in 1 ml of a 10 · 3% sucrose solution and concentrated by centrifugation at 12,000 × g for 60 seconds, and the supernatant was discarded. Then, the cells were dissolved in 0.2 ml Ts E buffer containing 2 mg / ml lysozyme, shaken at 37 ° C for 20 minutes, and then loaded into the AutoGen 5 40TM automatic nucleic acid separation instrument. Use Cycle 106 (software device) to separate plastids D A according to the manufacturer's instructions. Alternatively, 1.5 ml of mycelium can be placed in a 1.5 ml centrifuge tube and centrifuged at 12,000 x g for 60 seconds to concentrate. The supernatant was discarded, and the cells were redissolved in 1 ml of a 10 · 3% sucrose solution and concentrated by centrifugation at 12,000 × g for 60 seconds, and the supernatant was discarded. The cells were then dissolved in 0.5 ml T SE buffer containing 2 mg / ml lysozyme and incubated at 37 ° C for 15-30 minutes. After the action, this paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 56_ '~ (Please read the precautions on the back before this page)

585910 A7 B7 V. Description of the invention (54) Add 0.25 ml of basic SDS (0.3 equivalent NaOH, 2% SDS), and act at 5 5 ° C for 15-30 minutes or apply to the solution. . Then add sodium acetate (0.1 ml, 3 Molar concentration, P Η 4 · 8) to the DNA solution, and apply it on ice for 10 minutes, then centrifuge the DNA at 14,000 rpm at 5 ° C. Sample for 10 minutes. Transfer the supernatant solution to a clean test tube, add 0.2 ml of chloroform (50% phenol: 50% chloroform) and mix moderately. The D N A solution was centrifuged at 14,000 r pm for 10 minutes at 5 ° C and the upper layer was transferred to a clean microcentrifuge tube. Add isopropanol (0.75 ml) and mix moderately, then incubate at room temperature for 20 minutes. The D N A solution was centrifuged at 14,000 rpm for 15 minutes at 5 t, the supernatant was removed, and 70% alcohol was added to D N A small nine, air-dried, and then dissolved in TE buffer.

7.1.4. Isolation of plastid DNA from E. coli Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs. A single transformed E. coli colony was inoculated into 5 ml of LB culture solution (bacteria-protein glands-10 g, bacteria-yeast 5 grams of extract and 10 grams of sodium chloride were dissolved in one liter of water at a time, p Η 7 · 0, sterilized at 121 ° C for 2 5 minutes, and then supplemented with 100 μg / ml ampicillin). After the bacterial culture solution is dispensed, aliquot 1ml into a 1.5ml microcentrifuge tube. The culture samples were then loaded into the AutoGen 540TM automated nucleic acid separation instrument and the Cycle 3 (software device) was used to separate the plastid DNA according to the manufacturer's instructions. -57- This paper size applies Chinese National Standard (CNS) A4 specification (210X 297 mm) 585910 A7 B7____ V. Description of the invention (55) 7.1.5. Preparation and transformation of Streptomyces avermitilis A single colony of Streptomyces avermitilis was isolated on 2-strength YPD-6. Then, the mycelium was inoculated into a 250 mm X 150 mm test tube containing 10 ml of T S B culture medium, and then shaken (300 r p m) at 28 ° C for 4 8 hours. Inoculate 1 ml of mycelium into 50 ml of YEME broth. Each liter of YEME culture medium includes: 3 grams of Difco yeast mother extract; 5 grams of Difco bacteria-protein gland; 3 grams of Difco malt extract; 300 grams of sucrose. After sterilizing at 121 ° C for 25 minutes, add 2.5 Molar MgC 1 · 6H20 (separated at 121 ° C for 25 minutes)-2 ml; and glycine (20%) (filter sterilization)-25 ml. The mycelium was grown at 30 ° C for 4 8-7 2 hours and centrifuged in a 50 ml centrifuge tube (Falcon) at 3,000 for 20 minutes to collect the mycelium. Discard the supernatant and re-dissolve the mycelium in p-buffer, including: 205 g of sucrose; 25 g of K2S04-0.25 g; MgC 12 · 6H20; printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 2 · 02 g; 600 ml of H20; K2PO4 (0.5%) -10 ml; trace element solution—20 ml; Ca C 12 · 2 Η 2〇 (3.68%) — 1000 ml; And M ES buffer (1.0 mole, pH 6 · 5) — 10 ml. (Each liter of trace element solution includes: ZnCl2-40 mg; FeCl3 · 6H2 0-200 mg; CuCl2 · 2H2 0-10 mg; MnC 12 · 4H2 10 · 10 mg; Na2B 407 · 10H2 10 · 10 mg ; (NZ4) 6M0704-20.4-10 mg). Ρ Η was adjusted to 6 · 5, and the final volume was adjusted to 1mm-58- This paper size applies to the Chinese National Standard (CNS) M specifications (210 × 297 mm) 585910 A7 B7 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Note (56) liters, and filter the culture solution through a 0.45 micropore filter. The mycelium was centrifuged at 3,000 r pm for 20 minutes, the supernatant was discarded, and the mycelium was redissolved in 20 ml of P buffer containing 2 mg / ml lysozyme. This mycelium was shaken at 35 ° C for 15 minutes, and the degree of formation of the primitive cells was determined by microscopic examination. When the formation of the protoplasmic cells was complete, centrifuge at 8,000 r pm for 10 minutes, remove the supernatant solution and re-dissolve the protoplasmic cells in 10 ml of P buffer. Centrifuge the primordial cells for 10 minutes at 8,000 rpm, remove the supernatant, and dissolve the primordial cells in 2 ml of P buffer solution, and aliquot the primordial cells at about 1 × 109. In a 2.0 ml cryotube (Nalgene). Centrifuge the tube containing lxlO9 primitive cells at 10,000 rpm for 10 minutes, remove the supernatant, and re-dissolve the primitive cells in 0.1 ml of P buffer. Add 2 to 5 µg of DNA to the original cells and immediately add 0.5 ml of the acting T buffer. The T-buffer base includes: PEG—1,000 (Sigma)-25 grams; sucrose — 2.5 grams; H2—83 milliliters. Adjust pp to 8 · 8 with 1N NaOH (filtered and sterilized), and store the filter-sterilized base T buffer at 4 ° C. The effect of T buffer solution is to be made only when using 'T buffer solution-8 · 3 ml; K2P04 (4 millimolar concentration)-1 · 0 ml; CaC 12 · 2Η 2 0 (5 mole concentration) _ 0.2 ml; and TES (1 mole concentration, pH 8)-0.5 ml. The composition of each acting T buffer is individually filtered and sterilized. Within 20 seconds of adding T buffer to the primordial cells, also add 1.0 ml of PBS buffer and centrifuge the cytoplasm at 8,000 r P m (please read the precautions on the back before this page) )

This paper size applies to China National Standard (CNS) A4 (210X297 mm) _ 59-585910 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (57) 10 minutes. Discard the supernatant and dissolve the original cells in 0.1 ml p-buffer. The original cells were then poured onto R M 14 medium, RM14 medium including: sucrose—205 grams; K2S04—25 grams; MgCls · 6H2—10 · 12 grams; glucose—10 grams; Difco casamine Acid (casaminoacid)-0.1 g; Difco yeast extract-5 g; Difco oatmeal agar gel-3 g; Difco bacterial agar gel-22 g; water-8 0 ml, this solution Sterilize at 1 2 1 ° C for 2 5 minutes. After sterilization, add the following sterile materials: K2ρ〇4 (0. 5%)-10 ml; CaCl2 · 2H2 0 (5 mole concentration)-5 ml; L-proline (20%)-15 ml; MES buffer Liquid (1.0 mol concentration, pH 6 · 5)-10 ml; trace element solution (same as above)-2 ml; cyclohexamethyleneimide raw material (25 mg / ml)-40 ml; and 1 equivalent concentration Na〇Η — 2 ml. Each plate was 25 ml of R M 1 4 medium, and the plates were air-dried for 24 hours before use. Primary cells were cultured at 95% humidity and 30 ° C for 20 to 24 hours. To select the thiothrepton-resistant transformants, 1 ml of a coating buffer containing 1.25 micrograms / ml of thiostrepton was added and expanded flat on a RM14 plate. Each 100 ml of coating buffer solution includes: 10 · 3 g of sucrose; 0.2 ml of trace element solution (same as above); and MES (1 mole concentration, pH 6 · 5)-1 concentration. The primordial cells were cultured at 95% humidity and 30 ° C for 7 to 14 days until thiostrepton (Thi /)-resistant colonies were found. This paper size applies Chinese National Standard (CNS) Α4 size (210X 297 mm) (Please read the precautions on the back first and then the page) Μ Order 1 -60- 585910 A7 B7 V. Description of the invention (58 7 · 1 · 6 · The transformation of the original Hffl cells of i. P. The growth methods and components, protoplasmation, and transformation of Streptomyces chlorophyll are described in Hopwood ct 2.1., 1985, Genetic Manipulation of Streptomyces, A Laboratory Manual, John Innes Foundation, Norwich, UK, and among others The description is performed. Isolation of plastid DNA from the Streptomyces graminearum transformants is as described in Section 7 · 1 · 3 · above. 7.1.7. Analysis of the fermentation effect of Streptomyces avermitilis strains will grow at 1/2 intensity YPD-6 4 to 7 days of Streptomyces averaverii strains are inoculated into 1 X 6 inch test tubes containing 8 ml of pre-culture medium and two 5 mm glass beads. The pre-culture medium includes: soluble starch (thin cooked starch Or K 〇 0, Japan Com Starch Co., Nagoya) —20 g / L; medicament medium—15 g / L; amidamine pH—5 g / L (ChamplainInd., Clifton, NJ); C a C 〇3-2 g / L ; 2x bcfa ("bcfa 〃" refers to branched-chain fatty acids) containing 50 ppm 2-(+ /-methyl butyric acid, 60 ppm isobutyric acid and 20 ppm isovaleric acid in the culture broth at the end. Adjust the pH to 7 · 2 and sterilize at 12 1 ° C for 2 5 minutes. Shake the test tube at a 17 ° angle at 2 9 ° C at 2 1 5 rpm for 3 days. Seed cell culture cells divided into 2 ml are seeded to contain 2 5 ml production In a 300 ml Erlenmeyer flask of culture medium, the production culture medium is included; the size of the paper is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) -61-please kj read the notes on the back

Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (59) Powder (thin cooked starch or KOSO) — 160 g / l; nourishing soy beans (Archer Daniels Midland, Decatur, IL) — 10 g / L; ademine pH-10 g / L; K2HP〇4-2 g / L; MgS04 · 4H2Q— 2 g / L; FeS〇7 · 7H20-0 · 02 g / L; MnCl2—〇 · 002 g / L; ZnS〇4 · 7H2〇〇〇〇002 g / L; CaCOs — 14 g / L; 2x be fa (ibid.); And cyclohexanecarboxylic acid (CHC) (made into ρΗ7 20% solution of 0)-800 ppm. Adjust the pH to 6.9 and sterilize at 121 ° C for 25 minutes. After the inoculation, the Erlenmeyer flasks were cultured at 29 ° C for 2 days with shaking at 2000 r p m. After inoculation, remove 2 ml of the sample from the Erlenmeyer flask and dilute and mix with 8 ml of methanol, and centrifuge the mixture at 1,250 x g for 10 minutes. This supernatant was then analyzed via Η PL LC using a Bec kma a η Ultrasphere 〇DS column (25 cm x 4 · 6 mm ID) at a flow rate of 0.75 ml / min and detected at 240 nanometer absorbance. The mobile phase was 86/8 · 9/5 · 1 methanol / water / acetonitrile. Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 7.1.8. Isolation of Streptomyces avermitilis PKS to prepare a database of adherent plastids of chromosomal DNA of Streptomyces avermitilis (ATCC 31272, SC-2) A ketone synthase (KS) probe produced by a polysporic acid synthase (PKS) gene fragment of hybrid spores is hybridized. For a detailed description of the preparation of an adhesive plastid database, see Sambrook et al., 19 89, ibid. A detailed description of the preparation of a Streptomyces chromosomal DNA database can be found in Hopwood et al., 1 985, supra. Since -62- This paper size applies to Chinese National Standard (CNS) A4 specification (210X 297 mm) 585910 Printed by A7 ____B7 from the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (60) from PEX 2 6 (by Di * · P · Leadlay, Cambridge, UK) A 2 7Kb Nde I / Eco47HI fragment was used as a probe hybrid to identify glutamate-containing clones containing ketone synthase. Approximately 5 nanograms of pEX2 6 were decomposed with N d e I and E c 47. This reaction mixture was added to 0.8% SeaPlaque GTG agar gel (FMC BioProducts, Rockland, ME). After running the electrophoresis, the agar gel containing this 2 · 7 Kb NdeI / Eco47m fragment was excised, and D N A was recovered from the colloid using GELaseTM (Epicentre Technologies, Fast Protocol). [A — 3 2 P] dCTP (deoxynucleoside-triphosphate, tetrakis (triethanolamine) salt, [α-3 2 P] using the BRL Nick Translation System (BRL Life Technologies, Inc., Gaithersburg, MD) (NEN-Dupont, Boston, MA) was labeled on the 2.7Kb Nde I / Ec47m fragment. The typical reaction volume was 0.5 ml. After adding 5 μl of stop buffer, G-25 Sephadex Quick Spin ™ was used. Column (Boehringer Mannheim) separated the identified DNA from the unidentified nucleotides according to the instructions provided. Nearly 1,800 cloned plasmids were selected by colony hybridization. Identified 10 clones that can be strongly hybridized to the brown sugar polysaccharide KS probe. E. coli colonies containing adherent DNA are grown in LB liquid culture medium, and AutoGen 540τM automatic nucleic acid is used from each culture The separation instrument used Cycle 3 (software equipment) to isolate the adherent plastid DNA according to the manufacturer's instructions. Restriction enzyme maps and Southern blot hybridization analysis showed that 5 clones contained duplicate chromosomal regions. Five Afbonds Applicable paper size China National Standard (CNS) A4 specification (210 X297 mm) ~ _ 63: 585910 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 ___ B7 V. Description of the invention (61) Streptomyces genome adhesive plastid (PSE65, pSE66, pSE67, pSE6 8, pE69) BamHI restriction enzyme map and construction and analysis of repeated adhesion plastids and hybridization such as (Figure 4) ° 7.1.9. Regulation of avertinomycin B 2 · · B Identification of 1% DNA and identification of aveC ORF The following method was used to test the selected clones derived from the p SE 6 6-adhesion plastid selection strain to modulate streptomycin in the Av e C mutant B2: Ability to B1 ratio. Decompose p SE 6 6 (5 micrograms) with Sa c I and BamHI. Add this reaction mixture to 108% SeaPlaqueTM GTG agar gel (FMC BioProducts) and cut from the gel after electrophoresis A 2 · 9Kb Sa c I / BamHI fragment was produced and DNA was recovered from the colloid using a GELaseTM (Epicentre Technologies) rapid procedure. Approximately 5 micrograms of the shuttle vector PWHM3 (Varaetal., 1 989, J. Bacteriol, 1 7 1: 5 872- 588 1). According to the manufacturer's instructions, approximately 0.5 micrograms of the 2.9Kb insert and 0.5 micrograms of decomposed PWHM3 were mixed together, and 1 unit of ligase (New England Biolabs, Inc, Beverly, ΜΑ) was added to a final volume of 20 Microliters, overnight at 15 ° C. After the reaction, take 5 μl of the ligation reaction mixture at 70 t for 10 minutes, then cool to room temperature, and transform to competent cells E. coli D D 5 a (B R L) according to the manufacturer's instructions. Isolate plastid DNA from ampicillin-resistant transformants, and apply Chinese National Standard (CNS) A4 specifications (210X297 mm) to paper size with restriction enzymes. -64-585910 A7 _ B7 V. Description of the invention (62) The presence of the 2 · 9Kb Sa c I / BamHI insert was determined by analysis. Primer cells of Streptomyces averaverii strain 1 1 0 0 — SC 3 8 (Pfizerin-house strain) were prepared as described in section 7.1.5. SE 1 1 9 performs a turning action. When cyclohexanecarboxylic acid was provided, the mutant strains of avertinomycin cyclohexyl-B 2 produced by mutants 1 1 0 0-SC 3 8 were significantly more than the pattern of avertin streptomycin cyclohexyl B 1 (B 2: B 1 is about 30: 1). P S E 1 1 9 was used for the transformation of Streptomyces avermitilis, and was isolated from the E. coli strain GM2 1 6 3 (available from Dr. B.J. Bachmann, Curator, E. coli Genetic Stock Center,

Yale University), or E. coli strain D M 1 (B R L), or Streptomyces grass green strain T K 6 4. Strain 110-SC38 resistant to Streptococcus mutans was isolated and its fermentation products were analyzed by HPLC. Streptomyces averaverii strain 1 1-00-SC3 containing PSE 1 1 9 can produce a varying proportion of streptavidin cyclohexyl-B 2: cyclohexyl B 1 is approximately 3 · 7 · · 1 (Table 2 ). Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, PSE 1 1 9 can regulate the ratio of streptavidin B 2: B 1 in the Av e C mutant strain. This property has been established and the insertion segment D N A has been sequenced. Approximately 10 micrograms of P S E 1 1 9 were isolated using a plastid DNA separation kit (QUgen, Valencia, CA) according to the manufacturer's instructions, and sequenced using an ABI 373A automatic DNA sequencer (Perkin Elmer, Foster City, CA). The sequence data were assembled and edited using a genetic computer group program (GCG, Madison, WI). This DNA sequence and ave COF are shown in Figure 1 (SEQ ID NO: 1) This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 65-585910 A7 B7 Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs Printing V. Description of the invention (63)) ° A new plastid named PSE 1 1 8 is constructed as follows: Take about 5 micrograms of p SE 6 6 to decompose with S ph I and B am Η I. The reaction mixture was added to 0.8% SeaPlaque GTG agar colloid (FMC Bio Products), and the 2 · 8 Kb S ph I / B am Η I fragment was excised from the colloid after electrophoresis, and recovered from the colloid using GELaseTM (Epicentre Technologies) rapid procedure DNA. Five micrograms of the shuttle vector p W Η M 3 were resolved with S p · h I and B a m Η I. According to the manufacturer's instructions, approximately 0.5 micrograms of the 2 · 8Kb insert and 0.5 micrograms of the decomposed pWH M were mixed together, and 1 unit of ligase (New England Technologies) was added to a final volume of 20 microliters. 5 ° C overnight. After the effect, take 5 microliters of the ligation reaction mixture at 70 ° C for 10 minutes, then cool to room temperature, and transform it into competent cells E. coli D Η 5 α according to the manufacturer's instructions. Plastid DNA was isolated from the ampicillin-resistant transformants, and the presence of the 2.8 Kb Sph I / BamHI insert was determined by restriction enzyme analysis. The inserted DNA repeats in pSEl 1 8 and p SE 1 1 9 are approximately 8 3 8 nucleotides (Figure 4). As described above, p S E 1 1 8 was transformed into the protoplasmic cells of Streptomyces avertinus strain 1 10-S C 3 8. The S. thioni resistant transformant strain 1 10-SC38 was isolated and its fermentation products were analyzed by HPLC. Streptomyces avermitilis strain 1 1 0 — SC 3 8 containing P SE 1 1 8 does not change the ratio of streptomycin cyclohexyl B 2: streptomycin cyclohexyl-B 1 (Table 2 ). (Please read the notes on the back before this page)

-.Lr T

This paper size applies to China National Standard (CNS) A4 (210X297 mm) -66-585910 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs A7 ___B7_ V. Description of the Invention (64) 7.1.10. The chromosomal DNA was based on the P ave C gene using primers designed based on the aforementioned ave C nucleotide sequence, and a segment of ~ 1.2 Kb containing aveC ORF was isolated from the chromosomal DNA of Streptomyces avertinus by P CR amplification. This PCR primer was provided by Genosys Biotechnologies, Inc. (Texas). The right-side primer is: 5'-Ding CACGAAACCGGACACAC-3> (SEQ ID NO: 6); and the left-side primer is ... 5'-CA TGATCGCTGAACCGAG-3 ^ (SEQ ID NO: 7) The PCR reaction was performed using a Perkin-Elmer Cetus thermal cycler, using Deep VentTM Polynuclease (New England Biolabs) in the buffer provided by the manufacturer, and adding 300 μM. Ear concentration dNTP, 10% glycerol, 200 micromolar primers each, 0.1 microgram template, 2.5 unit enzymes in a final volume of 100 microliters. The thermal profile of the first cycle was 95 ° C for 5 minutes (denaturation step), 60 ° C for 2 minutes (bonding step), and 72 ° C for 2 minutes (delay step). The subsequent 24 cycles have similar thermal profiles, except that the denaturation step is shortened to 45 seconds and the joining step is shortened to 1 minute. The P C R product was electrophoresed in a 1% agar gel, and then a single D N A band of about 1.2 Kb was detected. This D N A was purified from the colloid, and this D N A was connected to a 25 nanogram linear blunt-end PCR-B 1 unt vector (Invhrogen) at a one-to-one insertion ratio of the carrier at a ratio of 1:10 Molar according to the manufacturer's instructions. Apply this connection mixture to the Chinese National Standard (CNS) A4 specification (210X297 mm) in accordance with the paper size. -67- Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 585910 A7 B7 V. Description of the invention (65) The manufacturer's instructions are transformed into One ShotTM is competent in E. coli cells (Invitrogen). The plastid DNA was isolated from the ampicillin-resistant transformants and analyzed by restriction enzyme analysis to confirm the presence of a ~ 1 · 2 K b insert. This plastid was named PSE179. The pSE179 was decomposed with BamHI / XbaI to isolate the inserted DNA, purified from the colloid after separation by electrophoresis, and ligated to the shuttle carrier, which had been decomposed with B am Η I / X ba I, and ligated to make it final. The total DN A concentration was 1 microgram in a 1: 5 mole carrier-to-insert ratio. This ligation mixture was transformed into competent cells E. coli D Η 5 α according to the manufacturer's instructions. Plastid DNA was isolated from the ampicillin-resistant transformants and analyzed by restriction enzyme analysis to confirm the presence of a ~ 1.2 kb insert. This plastid was named PSE186 (Figure 2, ATCC 2 096 0 4), was transformed into E. coli D M 1, and plastid D N A was isolated from ampicillin-resistant transformants. 7.2. Results PSE 1 1 9 containing a 2.9 Kb Sac I / BamHI fragment When transformed to Streptomyces averaverii strain 1 1 0 0 -SC 3 8 has been identified to significantly alter B 2: B 1 aver chain Manufacturing ratio of mycin. The B 2: B 1 ratio of normal Streptomyces averaverii strain 1 100-SC38 is about 30: 1, but after transforming a vector containing a 2. 9 K b Sa c I / BamHI fragment, the B2: B1 Affer chain The ratio of mycin was reduced by about 3.7: 1. Post-fermentation analysis of the transformant cell culture has demonstrated the presence of this transformed DNA. This paper size applies to China National Standard (CNS) A4 specification (210X297 mm) (Please read the precautions on the back before this page), 17

585910 A7 ___________B7_ V. Description of the invention (66) Please read the notes on the back before filling out this page. 2 · 9Kb PSE1 19 fragments have been sequenced and one ~ 0.9Kb 〇RF (Figure l) (SEQ ID Ν Ο) : 1) 'Contains a previously mutated Ps t I / SphI fragment and can only produce the B 2 product (Ikeda et al., 1 995, supra). Compared with this ORF or its corresponding polypeptide, in the known data (

GenEMBL, SWISS-PROT) did not find any d NA or protein sequences with strong homogeneity. Table 2 represents the fermentation analysis of Streptomyces avermitilis strain 11 100 s C 3 8 after transformation with different plastids. Table 2 Average number of transformants tested by Streptomyces averaverii strain B 2: (transformed plastids) B 1 ratio 1100-SC38 (none) 9 3 0.66 1100-SC38 (pWHM3) 2 1 3 1.3 1100-SC38 (pSEl 19 ) 12 3.7 1100-SC38 (pSE118) 12 3 0.4 1100-SC38 (pSE185) 14 2 7.9 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 8 Example: Construction of Ave C mutant strain of Streptomyces averaverii This example describes the use of The above composition and method constitute several different mutant strains of Ave C of Streptomyces averaverii. Techniques for introducing mutant genes into Streptomyces are often described in Kieser and Hopwood, 1991, Meth · Enzym. 204: This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm)-Ming-585910 A7 B7 Central Ministry of Economic Affairs Printed by Standards Bureau's Consumer Cooperative

V. Description of the invention (67) 430-458. A more detailed description is provided by Anzai et al., 1 988, J. Antibiot. XLI (2): 226-233, and Stutzman_Engwa11 et al., 1 992, J. Bacteriol. 174 (1): 144- 1 54 offers. These references are fully incorporated into the references for this article. 8-1. Deactivation of av e C gene from Streptomyces averaverii. Several methods were used to construct an A v e C mutant strain containing a deactivated a · v e C gene. Details are as follows. In the first method, the aveC gene located in PSE 1 1 9 (the plastids described in section 7.1.1 · 9 above) was replaced with the rmE gene (erythromycin resistance) from Polysaccharides from brown sugars An internal 640 bp Sphl / Pst I fragment. This ermE gene was isolated from PIJ 4026 (by John Innes Institute, Norwich, UK; see also Bibb et al ·, 1 985, Gene 4 1: 357 · 368), and was degraded by B g 1 Π and E co RI restriction enzymes. Electrophoresis was performed and purified from colloids. This ~ 1 · 7 K b fragment was ligated into p GEM7 Z f (Promega) which had been decomposed with B amH I and E 〇RI, and this ligation mixture was transformed into competent cells E. coli D according to the manufacturer's instructions Η Within 5 α. The plastid D N A was isolated from the ampicillin-resistant transformants and analyzed by restriction enzyme analysis to confirm the presence of a ~ 1.7 Kb insert. This plastid was named PSE27. The pSE118 (described in Sections 7 · 1 · 9 ·) was decomposed with SphI and BamHI, followed by electrophoresis, and the ~ 2.8Kb Sphl / BamHI insert was purified from the colloid. For Ps t I, please read the memorandum of the memorandum before filling in this page.

This paper size applies Chinese National Standard (CNS) A4 (210X297 mm) -70- 585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (68) and E c RI decomposition p SE 1 1 Electrophoresis was performed after 9 and the ~ 1.5 K b P st I / E c RI insert was purified from the colloid. The shuttle vector pWHM3 was decomposed with BamH I and EcoR I. After p S E 2 7 was decomposed with P s t I and S p h I, electrophoresis was performed and purified from the colloid ~ 1 · 7 K b P s t I / S p h I insert. All four fragments (~ 2 · 8Kb, ~ 1 · 5Kb, ~ 7 · 2 Kb, ~ 1 · 7 Kb) are ligated together, and this ligation mixture is transformed into competent cells E. coli D according to the manufacturer's instructions Within 5 α. Plastid DNA was isolated from the ampicillin-resistant transformants and restriction enzyme analysis determined that the correct insert was present. This plastid was named PSE180 (Figure 3, ATCC 2 0 9 6 0 5). P S E 1 0 0 was transformed into Streptomyces lividans T K 64, and the transformed colonies were identified with thiostrepton and erythromycin resistance. P S E 1 8 0 was isolated from Streptomyces lividans and used to transform Streptomyces avermitilis primitive cells. Four thiostrepton-resistant Streptomyces avertinus transformants were identified, and the protoplasmic cells were prepared and poured onto R M 1 4 medium without selection conditions. After the primary cells had grown again, single colonies showing erythromycin resistance and lacking thiostrepton resistance were screened, indicating that the deactivated a v e C gene had been integrated into the chromosome and lost free replicons. An Ern ^ Th os transformant was identified and named this strain SE180-11. All chromosomal DNA was isolated from S180, decomposed with BamHI, Hindm, Pst I or Sph I restriction enzymes, and analyzed with 0.8% agar colloid, transferred to nylon membrane, and hybridized with Erm E probe. These analyses show that the erm E resistance gene is integrated into the chromosome, and the paper size is subject to the Chinese National Standard (CNS) A4 specification (210X 297 mm) -71-Please read the precautions on the back before writing this page Printed by the Employees' Cooperative of the Central Standards Bureau of the Ministry of Education 585910 A7 _____ B7 V. Description of the invention (69) 64 bp pst I / Sph I fragments are made through two exchanges. HPLC analysis of the fermentation product of strain SE180-11 showed that normal streptavidin was no longer produced (Figure 5A). The second method of deactivating the ave C gene is to remove the 1 · 7kb e rmE gene from Streptomyces avermitilis strain SE180-1 1 from the chromosome. . The construction of a base-substitution substance is as follows: Partially decompose p S E 1 8 0 with X b a I and purify a ~ 11 · 4Kb fragment from the colloid. This ~ 11 · 4Kb band lacks a 1 · 7Kb e r m E resistance gene. This DNA was then ligated and transformed into E. coli D Η 5 α cells. The plastid D N A was isolated from the ampicillin-resistant transformants and analyzed by restriction enzymes to confirm the presence of the correct insert. This plastid was named p S E 1 8 4 and was transformed into E. coli D M 1 and the plastid DN A was isolated from the ampicillin-resistant transformants. This plastid was used to transform into the primordial cells of Streptomyces avermitilis S E 1 0 0 — 1 1. Primitive cells were prepared from the thiostrepton-resistant transformants of the strains S E 1 0 0-1 1 and inverted on R M 1 4 with a single colony. After the primordial cells regenerate, a single colony lacking erythromycin resistance and thiostrepton resistance is selected, indicating that the inactive a ν e C gene has been integrated into the chromosome and the free replicon including the rmE gene is lost . An ErmsTh i 〇 'transformant was identified and named SE184 — 1 — 13. SE184— 1-1 3 fermentation analysis showed that it is the same as S E 1 8 0 — 1 1 fermentation and no longer produces normal streptomycin. The third method for deactivation of a v e C gene is to use P C R to join. This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm). 2 _ (Please read the precautions on the back before filling this page)

585910 Printed by A7 __ B7 _ of the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (70) Two G / s after position 47 1 nucleotides to generate a B s pE 1 position and introduce a shift to the chromosome within the ave C gene. The B s p E 1 position can be used to detect gene replacement results. Primers designed to introduce transmutation into the av e C gene were provided by Genosys Biotechnologies, Inc. The right-hand primer is: 5′-GGTTCCGGATG CCGTTCTCG — 3> (SEQ ID NO: 8) and the left-hand primer is: 5, — AACTCCGGTCGACTCC CCTTC-3 ^ (SEQ ID No: 9) ° PCR conditions are as described above Section 7 · 1 · 10 is described. This 6 6 6 b p PCR product was decomposed into two fragments of 278bp and 388bp by SphI. 3 8 8 b p fragments were purified from the colloid. The gene replacement plastid was constructed as follows: The shuttle vector PWHM3 was decomposed with EcoR I and B amH I. After decomposing P S E 1 1 9 with BamHI and Sph I, electrophoresis was performed, and a ~ 8 40 b p fragment was purified from the colloid. After pSEl19 was decomposed with EcoRI and Xnml, electrophoresis was performed, and a ~ 1.7 kB fragment was purified from the colloid. All four fragments (~ 7 · 2Kb, ~ 840bp, ~ 1 · 7Kb, and 338b p) were ligated together, and this ligation mixture was transformed into competent cell E. coli D Η 5α. The plastid DNA was isolated from the ampicillin-resistant transformants, and the presence of the correct insert and DNA sequence analysis were analyzed by restriction enzymes. This plastid was named P S E 1 8 5 and was transformed into E. coli D M 1 and the plastid DN A was isolated from the ampicillin-resistant transformants. Use this plastid to transform into Streptomyces averaverii 1 0 0-S C 3 8 primitive cells. Isolate the thiostrepton-resistant mutants of strain 1 1 0 0-S C 3 8 and read the notes on the back first before ordering

This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) -73- 585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (71) The fermentation products are analyzed by Η PL LC. When p S E 1 8 5 was transformed into Streptomyces avermitris 1100 — SC 3 8 (Table 2), the ratio of Β 2: Β 1 streptomycin was not significantly changed. P S E 1 8 5 was used to transform the primitive cells of Streptomyces avermitilis to create a transmutation in the a ν e C gene of the chromosome. Primitive cells were prepared from thiostrepton-resistant transformants and a single colony was inverted on R M 1 4. After the primordial cells regenerate, single colonies lacking thiostrepton are screened. The chromosome D N A was isolated from thiostrepton-sensitive colonies, and the P C R screen was used to screen shift mutations for integration into the chromosome. P C R primers are designed based on the av e C nucleotide sequence and are provided by Genosys Biotechnologies, Inc. (Texas). The right PCR primer is: 5'-GCAAGGATACGGGGACTA-3> (SEQ ID NO: 10) and the left PCR primer is: 5 -GAACCGACCGCCTGATAC-3 ^ (SEQ ID NO: 1 1). · 1 · 1 0 · as described in section. The resulting PCR product was 5 4 3 bp, and three fragments of 368 bp, 96 bp, and 79 bp were observed by BspEl decomposition, indicating that the inactive aveC gene had been integrated into the chromosome and lost the free replicon. Analysis of the fermentation effect of the mutant strain of Streptomyces averaverii with a shift mutation in the ave C gene has the same HP HP profile as that of SE 1 8 0 — 1 1 and SE 1 84 — 1 — 1 3, showing that it is no longer manufactured Normal streptomycin. A Th i 0 s transformant was identified and named the strain S Ε 1 8 5-5 a. This paper scale applies Chinese National Standard (CNS) A4 specification (210X297 mm) -74- 585910 A7 B7 V. Description of the invention (72) In addition, a mutation in the 3 vec gene changes the nucleotide position 5 2 0 from G to A causes the tryptophan (W) at code position 1 16 to become a stop code. The Streptomyces avermitilis strain with this mutation does not produce normal streptavidin and has the same fermentative profile as SE180-11, SE184-1-13 and 1 8-5-5a. In addition, the mutation of the aveC gene was changed: (i) the change of nucleotide position 9 7 0 from G to A caused the amino acid at position 2 56 to change from glycine (G) to aspartic acid (D), and (Ii) The change of nucleotide position 9 9 6 from T to C caused the amino acid at position 2 7 5 to be changed from tyrosine (Υ) to histidine (Η). Streptomyces avermitilis strains with these mutations (G256D / Y275H) do not produce normal streptavidin and have the same fermentative profile as SE180-11, SE184-1-13, and SE185-5a. Printed by the Staff Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs

Ave C inactivated Streptomyces averaverii mutant strains E 1 8 0 -11, SE184-1-13, SE185-5a and other strains provided herein can be provided as a screening tool to evaluate other loci within the ave C gene The effect of the mutation. P S E 1 8 6 containing the wild-type a v e c gene was transformed into E. coli DM 1 and the plastid DN A was isolated from ampicillin-resistant transformants. Using this p S Ε 1 8 6 DNA-transformed Streptomyces avermitilis SE 1 8 0-1 1 to isolate thiostrepton-resistant S Ε 1 8 0-1 1 transformants, and It was determined to have erythromycin resistance, and the PLC analysis of the fermentation product of this T hi 〇 ^ E r transformant was analyzed. This type of functional aveC gene presented in trans has a recovery strain SE180 — 11 (Figures 5B -75- This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm, 585910 Central Standard of the Ministry of Economic Affairs) Printed by the Consumer Cooperative of the Bureau A7 B7 V. Description of the invention (73)) The ability to produce normal streptomycin. 8.2. Mutation analysis of ave C for a variety of B 2: B 1 ratio changes. Streptomyces averaverii SE 1 8 0 — 11 with active ave C gene can be transformed with pavement (p SE 1 8 6) containing functional ave C gene and complementary. Strain S · E 1 8 0-1 1 can also be used As a host strain to characterize other ave C gene mutations, as described below. Isolate chromosomal DNA from strain 1 100-SC38 and use it as a template for PCR amplification of the ave C gene. Use the avec nucleotide sequence-based design 1.2Kb 〇RF was isolated by PCR amplification. The right-hand primer is SEQ ID NO: 6 and the left-hand primer is SEQ ID NO: 7 (see section 7.1.1.10 ·). PCR and subselection Reproduction conditions are described in Section 7.1.1.10. DNA sequence analysis of 1 · 2 K b 〇RF showed that a mutation in the ave C gene, changing the nucleotide position 3 3 7 from C to T caused the amino acid at position 5 to 5 to be changed from serine (S) Phenylalanine (F). This ave C gene containing the S 5 5 F mutation was subcloned into PWHM3 to produce a plastid named PSE187, which was used to transform Streptomyces averaverii strain SE 1 8 0-1 1 Primary cells. Isolate SE 1 8 0-1 1 transformants with thiostrepton resistance and determine

With erythromycin resistance, analysis of the T H i ○ ^ E r m ^ transformant ferment product Η P L C analysis. This code is monoamino acid residue 5 5 (S 5 5 F) This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) -76 · ---------- (Please read the back first (Please fill in this page again) ^ I _

585910 A7 V. Description of the invention (74)) The altered ave C gene can return to the strain S e 1 0 0-1 1 to produce normal streptavidin (Figure 5 c); however, it is similar to the strain SE180 which has been transformed into PSE186 — 11 (B2: B1 ratio is about 1 4 (please read the precautions on the back before filling in this page). In comparison, the ratio of cyclohexyl B2: cyclohexyl B1 is about 26: 1 (Table 3), which indicates that a single mutation (S55F) can Regulates the yield of cyclohexyl-B 2 relative to cyclohexyl-B 1. Another mutation in the ave C gene is a change in nucleotide position 8 6 2 from G to A, which results in the amino acid at position 2 30 being changed from glycine Acid (G) was changed to aspartic acid (D). Streptomyces averaverii strains with this mutation (G2 3 0D) produced streptavidin B 2: B 1 ratio of about 3 0: 1 8-3. Decrease B 2: The proportion of B 1 mutations is as follows. Constructing several mutations can reduce the yield of cyclohexyl B 2 relative to cyclohexyl B 1. The Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs prints a mutation in the ave C gene to place the nucleotide position. The change from G to A in 5 8 8 caused the amino acid at position 1 39 to be changed from alanine (A) to glutamic acid (T). The aveC gene containing the A139T mutation was sub-selected A plastid produced in PWHM3 was named pSE188, and used to transform the protoplasmic cells of Streptomyces avertinus strain SE 1 8 Q-1 1. Isolate SE 1 8 0 — 1 1 turn And determined to have erythromycin resistance, and analyze the T hi 〇 ^ E rm ^ PLC analysis of the fermented product of the transformant. This encoded monoamino acid residue 1 3 9 (Α1 3 9Τ) The altered a ν e C gene can restore the strain SE 1 80 This paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 77-585910 Printed by the Consumers Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs A7 B7 V. Description of the invention (75) 11 (Fig. 5D) produces streptavidin; however, the ratio of B2: B1 is about 0.94: 1, indicating that this mutation reduces the yield of cyclohexyl-B2 relative to cyclohexylB1. This result is Unexpected, because the mutation results described above or published results only prove that the inactive ave C gene may increase the production of avertinomycin of type B 2 compared to type B 1 (Table 3). Because A1 The 3 9T mutation changes the ratio of B2: .B 1 to the B 1 direction, so an amine group encoding the 1 3 to 8 position is constructed. Mutation from melamine (T) to serine (S). Therefore, P SE 1 8 6 was decomposed with E c ORI and cloned to PGE M 3 Z f (Promega) which had been decomposed with E c oR I Inside. This plastid was named pSE186a. After decomposing with ApaI and κρηΙ, the D N A fragment was separated in the agar gel, and two fragments of ~ 3.8 Kb and ~ 0.4 Kb were purified from the colloid. A ~ 1 · 2 Kb insert DNA from pSE186 was used as the P CR template to introduce a change in the 5th and 5th nucleotide positions of a single base. This PCR primer was designed to have a mutation at nucleotide position 5 8 5 and was provided by Genosys Biotechnologies, Inc. (Texas). The orientation PCR primers are: 5 / -GGGGGCGGGC CCGGGTGCGGAGGCGGAAATGCCCC TGGCGACG-3 / (SEQ ID NO: 12); and the orientation PCR primers are: δ, one GGAACCGACCG CCTGATACA-3 ^ (SEQ ID NO: 13). This CR reaction was performed using the advanced GC genome CR set (Clonetech Laboratories, Palo Alto, CA), and the paper size used by the manufacturer was in accordance with the Chinese National Standard (CNS) A4 specification (210X297 mm) -78-(please first (Read the notes on the back and fill out this page)

585910 Printed by A7 ___ B7____ of the Consumer Cooperatives of the Central Bureau of Standards of the Ministry of Economic Affairs 5. Description of the Invention (76) Provide primers with 200 micromolar concentration dNTP s 200 picomolar, 50 nanogram template DNA, 1.0 mol The final volume of the buffered mixture of GC-Me 1 t and 1 unit of K 1 e η T a Q polymerase was 50 microliters. The thermal profile for cycle 1 is 9 4 ° C for 1 minute; then 94 cycles for 30 seconds and 6 8 t for 2 minutes for 25 cycles; and 68 ° C for 3 minutes for one cycle. The resulting 295 bp PCR product was decomposed with Apa I and Kρ. Η I and released a 2 5 4 b ρ fragment, which was analyzed by electrophoresis and purified from the colloid. All three fragments (~ 3.8Kb, ~ 0.4Kb, and 254bp) are linked together. This ligation mixture was transformed into competent cells E. coli D D5α cells. The plastid D N A was isolated from the ampicillin-resistant transformants and analyzed by restriction enzymes to confirm the presence of the correct insert. This plastid is named PSE198. P SE 1 9 8 was decomposed with E c oR I and cloned into p W Η M 3 which had been decomposed with E c O R I and transformed into E. coli D Η 5 α cells. Plastid DNA was isolated from ampicillin-resistant transformants and restriction enzyme analysis and DNA sequencing analysis were used to confirm the presence of the correct insert. This plastid D N A was transformed into E. coli D M 1, and the plastid D N A was isolated from the ampicillin-resistant transformants, and the presence of the correct insert was determined by restriction enzyme analysis. This plastid was named PSE199 and was used for the protoplasts of Streptomyces avermitilis S E 1 8 0-1 1. The thiostrepton-resistant transformants of the strains S E 1 0 0-1 1 were isolated and determined to have erythromycin resistance, and the P L C analysis of the fermented product of this T h i 〇 ^ e r m r transformant was analyzed. This coded monoamino acid residue 1 3 8 (This paper size applies Chinese National Standard (CNS) A4 specification (210X297 mm) -79-(Please read the precautions on the back before filling in this page}

585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (77) S 1 3 8 T) The altered ave C gene can return to the strain SE 1 8 0-11 to produce normal avertin. The B2 ·· B1 ratio was 0.88: 1, indicating that the mutation reduced the yield of cyclohexyl B2 relative to cyclohexyl B 1 (Table 3). This ratio of B 2: B 1 is even lower than the ratio of 0 · 9 4: 1 observed in the A1 39T mutant SE 1 δΟ-ΐ1 transformed by pSE 1 88 described above. Another mutant construct was the introduction of a melamine at the amino acid positions 138 and 139. Using the ~ 1.2 Kb insert DNA from PSE186 as the P CR template, the 5 8 5 and 5 88 nucleotide positions were introduced as P CR primers designed by mutations, provided by Genosys Biotechnologies. Inc (Texas). The right-side PCR primers are: 5 / — GGGGGC GGGCCCGGGTGCGGAGGCGGAAATG CCCGTGGCGACGACC-3 (SEQ ID NO: 14): and the left-side PCR primers are: 5> — GGAA CATCACGGCATTCACC-3 ^ (SEQ ID NO: 15). The PCR reaction was performed under the same conditions as described in this section. A 449bp PCR product was decomposed with Apa I and Kρη I, and a 2 5 4 b p fragment was released for analysis by electrophoresis. After pSE186a was decomposed with Apa I and κρηΙ, DNA fragments were separated using agaric colloid, and two fragments of ~ 3 · 8Kb and ~ 0 · 4Kb were purified from the colloid. All three fragments (~ 3 · 8Kb '~ 0 · 4Kb and 254bp) were ligated together, and this ligation mixture was transformed into competent cells E. coli D Η 5α. Isolate plastid DNA from ampicillin-resistant transformants and determine the presence of this paper by restriction enzyme analysis. Applicable to China Paper Standard (CNS) A4 (210X297 mm) 80-585910 A7 B7 V. Description of the invention (78) Insert the segment correctly. This plastid is named PSE230. The P S E 2 3 0 was decomposed with E c 〇 R I and then cloned into pWHM3 which had been decomposed with E c 〇 R I and transformed into E. coli D Η 5 α cells. Plastid DNA was isolated from ampicillin-resistant transformants and restriction enzyme analysis and DNA sequencing analysis confirmed the presence of the correct insert. This plastid is named P S Ε 2 3 1 and can be used to transform protoplasts of S. avertinus strain S Ε 1 8 0 — 1 1. The thiostrepton-resistant transformants of the strain S Ε 1 0 0-1 1 were isolated and determined to have erythromycin resistance, and the fermentation product of this T h i ο ^ E r m ^ transformant was analyzed. This double-mutated ave C gene encoding the two mutant amino acid residues S 1 38T / A1 39T can produce normal streptavidin after the strain SE 1 8 0- 1 1; however, the B2: B1 ratio is 0.84 : 1 shows that this mutation further reduced the yield of cyclohexyl B 2 relative to cyclohexyl B 1 (Table 3), more than the reduction 値 provided by the strain S E 1 8 0 — 1 1 transformed with pSE188 or PSE199. (Please read the precautions on the back before ^ this page) i.—Order the paper printed by the Central Consumers ’Association of the Ministry of Economic Affairs, Consumer Cooperatives, and the paper size is applicable to China National Standard (CNS) A4 (210X297 mm) -81- 585910 A7 B7 V. Description of the invention (79) Table 3

Printed by the Consumer Standards Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs. These results are the first to demonstrate that specific mutations in the ave C gene can produce an increased degree of commercial demand relative to species 2 streptomycin and 1 Vegetarian. 9 · Example: Construction of 5 / deleted mutants

As explained in section 5 · 1 · above, the Streptomyces avertinus nucleotide sequence shown in Figure 1 (SEQ ID NO: 1) contains 4 different bp positions 4 2, 1 7 4, 1 7 7 and 1 A GTG password with a potential starting position of 80. This section describes the construction of multiple deletion ave C ORF (Figure 1; SEQ ID NO: 1) 5 / area to assist in defining those passwords that have a starting position function in ave C. This paper standard applies the Chinese National Standard (CNS) A4 specification ( 2ιχχ297 mm) -82-585910 A7 _B7_ V. Description of the invention (80) When the protein of RF is expressed.

Av e C gene fragments with different 5 / terminal deletions were obtained from the chromosome D N A of Streptomyces avertinus using P C R amplification. This p C R primer was designed based on the av C D N A sequence 'and was provided by Genosys Biotechnologies, Inc. This rightward primer is 5 ′ — AACCCATCCG AG CCGCTC — 3 (SEQ ID NO: 16) (D 1 F 1); 5> — TCGGCCTGC CAACGAAC-3 ^ (SEQ ID NO: 17) (D 1 F 2); 5 ^ -CCAACGAACGTGTAG TAG-(SEQ ID NO: 18) (D1F3): and 5 ^-TGCAGGCGTACGTGTTCA GC-3 ^ (SEQ ID NO: 19) (D 2 F 2). The left-hand primer is 5, one catgatcgctgaaccg A-3 ^ (SEQ ID NO: 20); 5 ^-CAT GATCGCTGAACCGAGGA-3 ^ (SEQ ID N 0: 2 1) •, and 5, one AGGAGTGTGG TGCGTCTGGA-3 ^ (SEQ ID N 0: Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs 2 2). This PCR reaction proceeds as described in Section 8.3. The P C R products were separated by 1% agar colloid electrophoresis, and a single DNA band of ~ 1.0 KB or ~ 1.1 KB was detected. The P C R product was purified from the colloid and ligated to a 25 nanometer linear P C R 2 · 1 vector (Invitrogen) in accordance with the manufacturer's instructions at a ratio of 1:10 mol of vector to insert. Follow the manufacturer's instructions to transform the ligation mixture into One ShotTM competent E. coli cells (Invitrogen). From this paper scale, the Chinese National Standard (CNS) A4 specification (210X297 mm) -83-585910 A7 B7 is applied. V. Description of the invention (81) Isolation of plastid DNA in ampicillin-resistant transformants, and analysis of DNA sequence analysis confirmed the presence of the correct insert. These plastids were named PSE190 (obtained from primer D1F1), pSE191 (obtained from primer D 1 F 2), p S E 1 9 2 (obtained from primer D1F3), and PSE193 (obtained from primer D2F2).

Each insert DNA s was decomposed with B amH I / Xb a I and separated by electrophoresis. After purification from the colloid and separately connected to the shuttle vector p W Η Μ 3 which had decomposed B am Η I / X ba I, the total The concentration of DN A was 1 microgram in the ratio of 1: 5 mole carrier to insert. This ligation mixture was transformed into competent E. coli D Η 5 α cells. Plastid DNA was isolated from the ampicillin-resistant transformants and the presence of inserts was determined by restriction enzyme analysis. These vectors were designated as PSE194 (D1F1), PSE195 (D1F2), pSE196 (D 1 F 3), and p SE 1 97 (D 2 F 2), and were transformed into E. coli D M 1 from Ampicillin. Resistant transformants isolated plastid DNA and analyzed with restriction enzymes to confirm the presence of the correct insert. This DNA was transformed into the primitive cells of Streptomyces avermitilis strain S E 1 0 0-1 1. Isolates Strains The thiostrepton-resistant transformants of SE 1 8 0-1 1 were printed by the Consumer Cooperative of the Central Bureau of Standards of the Ministry of Economic Affairs and determined to be erythromycin-resistant. The PLC was used to analyze this T hi ο ^ E r η) 1 The fermented product of the transposon to determine which GTG position is necessary for a ν e C expression. The results indicate that the removal of the GTG password at 4 2 has no effect on the performance of ave C, because the positions 4 2 of PSE194, PSE195, and p SE 1 9 6 lack the GTG position, but they are all included in the paper. ) A4 specification (210X297 mm) -84-585910 A7 B7 V. Description of the invention (82) Contains three GTG positions at 174, 177, and 180 ', so when it is transformed to SE 1 8 0-1 1 Return to making normal avertin. The strain SE 1 80 — 1 1 transformed with pSE 1 9 7 lacking all four G T G positions (Table 4) was unable to replicate back to produce normal avertin. Table 4 Printed Streptomyces averaverii strains (transformed plastids) by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs The number of tested transformants relative to B 2 concentration relative to B 1 average B 2 ·· B 1 ratio SE180-1 1 (none) 6 0 0 0 SE180-1 l (pWHM3) 6 0 0 0 SE180-1l (pSE186) 6 241 152 1.58 SE180-1l (pSE194) 6 35 15 2.43 SE180-1l (pSE195), 6 74 38 1.97 SE180-1l ( pSE196) 6 328 208 1.58 SE180-1l (pSE197) 12 0 0 0 1 10. Example: Selecting ave C homosomes from Streptomyces hygroscopicus and Streptomyces griseus The present invention includes the production of streptavidin or wheat from other The ave C homogene was identified and cloned in Streptomyces than Streptomycin. For example: using the above Streptomyces avermitilis 1 · 2Kb ave C as a probe to hybridize hygroscopic hygroscopic bacteria. The paper size is applicable to the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 85-(Please read the precautions on the back first 4i write this page again)

· Order

585910 A7 _ B7 V. Inventory (83) (fErm bp-1901) of the genomic DNA of the adherent plastid database, identified a number of strong hybridization of adherent plastids. Isolate chromosomal DNA from these adhesive plastids and hybridize with a v c probe to identify a 4.9Kb KρηI fragment. This DNA was sequenced and 10RF (SEQ ID NO: 3) was identified to have significant homogeneity with Streptomyces averaverii a v e c ORF. The amino acid sequence (S E Q ID NO: 4) inferred from the homogeneous OR F of Streptomyces hygroscopicus a v e C is presented in FIG. 6. In addition, the genomic DNA of the adherent plastid database of Streptomyces griseus was hybridized with the above-mentioned Streptomyces averaverii 1.2Kb aveC probe, and several adherent plastid selection strains with strong hybridization strength were identified. Isolate chromosomal DNA from these adhesive plastids and hybridize with a v e C probe to identify a 5 · 4 Kb P s t I fragment. This DNA was sequenced and a part of the ORF was identified to have significant homogeneity with Streptomyces averaverii a v e C ORF. The deduced partial amino acid sequence (S E Q ID N 0: 5) is presented in FIG. 6. Printed and analyzed the DNA and amino acid sequences of Streptomyces hygroscopicus and Streptomyces gray ave C homosomes by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs, and learned that these shares share significant homogeneity (~ 50% sequence is identical to the amino acid stage) The regions are present in each other and in the aveC ORF and Ave gene products of Streptomyces avermitilis (Figure 6). 11 · Example: Construct a plastid with the ave C gene behind the erm E promoter. 1.2Kb aveC of the PSE186 〇RF times. This paper applies the Chinese National Standard (CNS) A4 specification (210X297 mm)-86-585910 Ministry of Economic Affairs Printed by the Consumer Standards Cooperative of the Central Bureau of Standards A7 _B7___ V. Invention Description (84) was cloned into pSE34, which has a 300bp e rmE promoter and inserted into the PW with a Kpn I / BamHI fragment 片断 Μ 3 Κρ η I / B amH The I-position shuttle vector p WHM 3 (see Ward et al., 1986, Mol. Gen. Genet 203: 46 8-478). The p SE 1 8 6 was decomposed with B am Η I and Hind II, and then analyzed by electrophoresis, and a 1.2 K b fragment was separated from the agar gel and connected to PSE 3 4 which had been decomposed with B amH I and Hin dUI. stand up. This ligation mixture was transformed into competent E. coli DD5α. The plastid DNA was isolated from the ampicillin-resistant transformants and analyzed by restriction enzyme analysis to determine the presence of a 1.2 Kb insert. This plastid was named pSE 189 and was transformed into E. coli D M 1 and a small isolate of plastid DNA was transformed from ampicillin resistance. The primary cells of Streptomyces avermitilis strain 1 100-SC38 were transformed with p S Ε 1 8 9, and the strain 1 100-sC 3 8 thiostrepton-resistant transformants were isolated and their fermented products were analyzed by PLC. . Streptomyces avermitilis strain 1 1 0 0 -SC38 containing p SE 1 8 9 can be compared with the strain 1100-SC38 (approximately 34: 1) to change the manufactured avermitomycin cyclohexyl-Β 2 : The ratio of cyclohexyl B 1 (approximately 3: 1), and compared with the strain 1 1 0 0-SC 3 8 transformed with p S Ε 1 1 9, it can increase the total number by almost 2.4 times. Production of streptomycin (Table 5). PS E 1 8 9 was also transformed into the blast cells of a wild-type Streptomyces avermitilis strain. The thiostrepton-resistant transformants were isolated and their fermented products were analyzed with ΗPLC. The paper size of wild type Streptomyces avermitilis transformed with p S Ε 1 8 9 applies the Chinese National Standard (CNS) A4 specification (210X297 mm) _ 87 585910 A7 B7 V. Description of the invention (85) When compared with wild-type Streptomyces avertenii transformed from SE 1 19, it can increase the production of streptavidin by nearly 2.2 times. (table 5). Table 5 Printed Streptomyces averaverii from the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs, the relative average relative strain of B. spp., B 2 concentration, B 1 concentration, all B 2: (transformed plastids) Example of Streptomyces B 1 ratio 1100-SC38 6 155 4.8 176 33.9 1 100-SC38 9 239 50.3 357 4.7 (pSEl 19) 1 100-SC38 16 546 166 849 3.3 (PSE189) Wild type 6 59 42 113 1.41 Wild type 6 248 151 481 1.64 (pSEl 19) wild type 5 545 345 1,071 1.58 (PSE189) 12. Example: a chimeric protoplast containing a homogeneous body from Streptomyces avernerus aveC ORF and a hygroscopicity of Streptomyces hygroscopicus-a mixed plastid named PSE The construction of 3 50 is to replace a section of ave C homogeneous body containing a section of 5 64 bp hygroscopic streptomyces. This paper size applies the Chinese National Standard (CNS) A4 specification (210X297 mm) -88-(Please read the back first (Please fill in this page again)

585910 A7 B7 Printed by the Consumer Cooperatives of the Central Standards Bureau of the Ministry of Economic Affairs

V. Description of the invention (86) The homogeneous part of 564bp Streptomyces averaverii aveC ORF (Figure 7) is as follows. The construction of pSE 3 5 0 uses the B saa I restriction enzyme position at ave C position 2 2 5 of the two bacteria and the κ ρ η I restriction enzyme present in the ave C gene (ave C position 8 1 0) of Streptomyces avermitilis. position. This κ ρ η I position was introduced into Streptomyces hygroscopicus DNA via PCR using right-directed primer 5 CTTCAG GTGTACGTGTTCG-3 '(SEQ id NO: 23) and left-directed primer 5 > — GAACTGGTACC AGTGCCC-3 ^ (SEQ ID N 0: 2 4) (supplied by Genosys Biotechnologies) proceed as described in Section 7 · 1 · 10 · above. After decomposing the PCR products with B sa AI and κ ρ η I, the fragments were separated by 1% agar agar colloid electrophoresis, and the -56 4 bp BsaAI / Kpnl fragment was separated, and pSE179 was decomposed with κρηΙ and HindDI. ···················································································· ········································································································································· ~~~~~~～～ ·· 5 The PSE 1 7 9 was decomposed with H ndm and B s aA I, and the fragments were separated by 1% agar colloid electrophoresis, and a ~ 0 · 2Kb Bs aAI / Kpn I fragment was separated from the colloid, and was separated from 564bp from Streptomyces hygroscopicus. After the BsaAI / Kpnl fragments were ligated together, this ligation mixture was transformed into competent E. coli D Η 5 α cells. The plastid D N A was isolated from the ampicillin-resistant transformants, and the presence of the correct insert was determined using κ ρ η I and A ν a I restriction enzyme analysis. This body can be decomposed with H i n d m and X b a I to release a 1.2 kB insert, which can be used with used Hi ndm and Xba I (please read the precautions on the back before filling this page)

This paper size applies the Chinese National Standard (CNS) A4 specification (210 X297 mm) -89-585910 A7 B7 V. Description of the invention (87) p W Η Μ 3 decomposed and connected together. This ligation mixture was transformed into competent E. coli D Η 5 α cells, and plastid D A was isolated from ampicillin-resistant transformants, and the use of Hi n d Π and Α ν a I restriction enzyme analysis confirmed the presence of the correct insert. This plastid was transformed into E. coli D M 1 'and the plastid D N A was isolated from the ampicillin-resistant transformants, and the correct insert was determined by restriction enzyme analysis and D N A sequencing analysis. This plastid was named P S E 3 5 0 and was used to transform protoplasts of S. avertinus strain S E 1 8 0-1 1. The strain S E 1 0 0 — 1 1 thiostrepton-resistant transformants were isolated, and the erythromycin-resistant transformants were determined and analyzed by Η P L C for this Th i ο ^ ε rmr transformant fermentation product. The results showed that the transformants containing the mixed plastids of Streptomyces avermitilis / S. Hygroscopicus had an average ratio of B 2 ·· B 1 (Table 6). Table 6 Streptomyces averaverii strains (transformed plastids) Number of tested transformants relative to B 2 concentration relative to B 1 concentration average B 2: B 1 ratio SE180-11 (none) 8 0 0 0 SE180-1 l (pWHM3) 8 0 0 0 SE180-1l (pSE350) 16 233 2 109 Printed by the Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs (please read the precautions on the back before filling out this page) Storage of biological materials Collection Office (This paper size applies the Chinese National Standard (CNS) A4 specification (21 × 297 mm)-90-585910 A7 B7. Printed by the Staff Consumer Cooperative of the Central Standards Bureau of the Ministry of Economic Affairs 5. Description of the invention (88) ATCC) 2301 Parklawn Drive, Rockville, MD. 20852, USA stored on January 29, 1998, and its registration number is as follows: plastid registration number plastid PSE180 209605 plastid PSE186 .209604 All patents and patent applications above , And publications are fully incorporated into the references for this article. The scope of the present invention is not limited to the specific embodiments herein, this is only a single illustration of individual aspects of the invention, but functionally equivalent methods and components are within the scope of the invention. Indeed, in addition to those shown and described in this article, many of the modifications in this article, as well as previous descriptions and accompanying drawings, will become apparent to those skilled in the art. Such modification tendencies are included in the scope of additional applications. (Please read the notes on the back before filling out this page) Instrument. Order l · ·

This paper size applies to Chinese National Standard (CNS) A4 (210X297 mm) -91-

Claims (1)

y 9 5 8 范围 Scope of patent application! Part 2 (a): Patent Application No. 8 8 1 02005 Chinese Patent Application Potential Substitution for the Republic of China on February 6, 1993 Amendment 1 · An isolated polynucleotide molecule, which is Consisting of the complete ave C open editing area (〇RF) of Streptomyces avermitilis, the polynucleotide molecule lacks a complete ORF located downstream of the ave C 〇RF in situ on the chromosome of Streptomyces avermitilis, And the ORF has the nucleotide sequence of SEQ ID N 〇: 1 SEQ ID N 〇: 1 (please read the precautions on the back before this page) Printed by tcacgaaacc ggacacacca cacacacgaa ggtgagacag cgtgaaccca tccgagccgc 60 tcggcctgcc caacgaacgt gtagtagaca cccgaccgtc cgatgccacg ctctcacccg 120 aggccggcct gaacaggtca ggagcgctgc cccgtgaa.ct gctgtcgttg ccg gtg 176 Val 1 gtg gtg tgg gcc ggg gtc ggc ctg ctg ttt erg gcc ctg cag geg tac 224 Val Val Trp Ala Gly Val Gly Leu Leu Phe Leu Ala Leu Gin Ala Tyr 5 1C 15 gtg ttc age ege tgg geg gcc gac ggz. Ggc tac egg ctg ate gag aeg 272 Val Phe Ser Arg Trp Ala Ala Asp Gly Gly Gly Tyr Arg Leu lie Glu Thr 20 25 30 geg ggc cag ggt cag ggc ggc age aag gat aeg ggg act acc gat gtg 320 Ala Gly Gin Gly Gin Gly Gly Gly Ser Lys Asp Thr Gly Thr Thr Asp Val 35 40 45 gtc tat : ccc gtg att tee gtc gtc tgc ate acc gcc geg geg geg tgg 368 Val Tyr Pro Val lie Ser Val Val Cys He Thr Ala Ala Ala Ala Tla 50 55 60 65 etc ttc egg agg tgc cgt gtc gaa ega egg ctg ctg ttc gac gcc ett 416 Leu Phe Arg Arg Cys Arg Val Glu Arg Arg Leu Leu Phe Asp Ala Leu 70 75 80 订 -Order · This paper size applies to China National Standard (CNS) A4 specifications (2) 0X297 mm 585910 A8 B8 C8 D8 VI.Application scope etc ttc etc ggg ctg ctg ttc geg age tgg cag age ccg etc atg aac 464 Leu Phe Leu Gly Leu Leu Fhe Ala Ser Trp Gin Ser Pro Leu Met Asn 85 90 95 tgg ttc cat tee gtt etc gtc tee aac geg agt gtg tgg ggc geg gtg 512 Trp Phe His Ser Val Leu Val Ser Asn Ala Ser Val Trp Gly Ala Val 100 105 110 ggt tee tgg ggt ccg tat gtg ccc ggc tgg cag ggg geg ggc ccg ggt 560 Gly Ser Trp Gly Pro Tyr Val Pro Gly Trp Gin Gly Ala Gly Pro Gly 115 120 125 geg gag geg gaa atg ccg ctg geg teg gee tee gtc tgc atg teg get 608 Ala Glu Ala Glu Met Pro Leu Ala Ser Ala Ser Val Cys Met Ser Ala 130 135 140 145 ctg ate gtc acc gtg ctg tgc age aag gca ctg ggg tgg ate aag gee 656 Leu lie Val Thr Val. Leu Cys Ser Lys Ala Leu Gly Trp lie Lys Ala 150 155 160. ege egg ccg gca tgg egg acc tgg egg ctg gtg ctg gee gtg ttc ttc 704 Arg Arg Pro Ala Trp Arg Thr Trp Arg Leu Val Leu Ala Val Phe Phe 165 170 175 ate ggc ate gtg etc ggt ctg tee gag ccg ctg ccg tee gee tee ggg 752 lie Gly lie Val LeuGlu Leu Glyu Leu Pro Ser Ala Ser Gly 180 185 190 ate age gta tgg gee aga geg ctg ccc gag gtg acc ttg tgg agt ggc 800 lie Ser Val Trp Ala Arg Ala Leu Pro Glu Val Thr Leu Trp Ser Gly 195 2C0 205 gag tgg tac cag ttc ccc gtg tat cag geg gtc ggt tee ggc ctg gtc 848 Glu Trp Tyr Gin Phe Pro Vel Tyr Gin Ala Val Gly Ser Gly Leu Val 210 215 220 225 tgc tgc atg ctg ggc teg ctg ege ttc ttc ege gac gga t gag 896 Cys Cys Met Leu Gly Ser Leu Arg. Phe Phe Arg Asp Glu Arg Asp Glu 230 235 240 teg tgg gtg gaa egg gga gee tgg egg ttg ccg caa egg gca geg aac 94 4 Ser Trp Val Glu Arg Gly Ala Trp Arg Leu Pro Gin Arg Ala Ala Asn 245 250 255 tgg geg cgt ttc etc gee gtg gtc ggt ggg gtg aat gee gtg atg ttc 992 Trp Ala Arg Phe Leu Ala Val Val Gly Gly Val Asn Ala Val Met Phe 260 265 270 etc tac acc tgt ttc cat ate etc ctg tee etc gtc ggt gga cag ccg 1040 Leu Tyr Thr Cys Phe His He Leu Leu Ser Leu Val Gly Gly Gin Pro 2 is 280 285 This paper size applies the Chinese National Standard (CNS) A4 see the grid (210X 297) (Please read the notes on the back 1 ϋϋ ^ ϋϋ I this I). Ί · Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 585910 A8 B8 C8 D8 Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 6. Application Patent scope ccc gac caa ctg ccg gac tcc ttc caa gcg ccg gcc get tac tga 1085 Pro Asp Gin Leu Pro Asp Ser Phe Gin Ala Pro Ala Ala Tyr 290 295 300 gttcagggca ggtcggagga gaeggagaag gg gaggegae cggagttccg gtcacctccc 1145 ctttgtgcat gggi: ggacgg ggatcacgct cccatggcgg cgggctcctc cagacgcacc 1205 acactcctcg gttcagcgat catg 1229 2. If the isolated gene of the fungus is further located in the original position, the gene is Cave, and its gene is Ave. Nucleotide sequences ligated on both sides of nature. 3. An isolated polynucleotide molecule consisting of a nucleotide sequence of S E Q ID NO: 3 derived from Streptomyces hygroscopicus. SEQ ID N 〇: 3 gtegaegaag accggccgga ggccgtcggc egggeegata ccgtacgcgg cctgcgg 57 ctg ttc acc ett ccc, gta aca ctg tgg gcg tgt gtc ggc gcg ctg gtg 105 Val Phe Thr Leu Val Val Ala Leu Tu Leu Tv 15 ctg gga ett cag gtg tac gtg ttc gcc gcc tgg etc gee gac age ggc .153 Leu Giy Leu Gin Val Tyr Val Phe Ala Ala Trp Leu Ala Asp Ser Gly 20 25 30 tac ege ate gag aag gcg tec ccg gcc agg ggc gg ggg gac teg gag 201 Tyr Arg lie Glu Lys Ala Ser Pro Ala Arg Gly Gly Gly Asp Ser Glu 35 40 45 egg ate gcc gat gtg ctg ate ccg ctg ctg tec gtg gtg gga gcg gtg 249 Arg He Ala Asp Val Leu lie Pro Leu Ser Val Val Gly Ala Val 50 55 60 gtc etc gca gtg tgt Gtg tac egg agg tgt egg gcc agg agg egg ctg 297 Val Leu Ala Val Cys Leu Tyr Arg Arg Cys Arg Ala Arg Arg Arg Leu 65 70 lb 80 aeg ttc gac gcg teg etc ttc ate ggg ctg erg teg gcc agt tgg cag 345 Thr Phe Asp Ala Ser Leu Phe He Gly Leu Leu Ser Ala Ser Trp Gin 85 90 95 agt ccc ttg atg aac tgg ate aat ccg gtg etc gcg tea aac gtc aat 393 Ser Pro Leu Met Asn Trp lie Asn Pro Val Leu Ala Ser Asn Val Asn 100 105 110 (Please read the precautions on the back before installing-this K) • 177 orders · This paper size applies to China National Standards (CNS ) A4 see each (2 丨 0X29 <? mm) 585910 A8 B8 C8 D8 Printed by the Consumers ’Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs to apply for patents gtg ttc gga geg gtg gee teg tgg ggg ccg tat gtg ccc ggt tgg cag 441 Val Phe Gly Ala Val Ala Ser Trp Gly Pro Tyr Val Pro Gly Trp Gin 115 120 125 ggg geg ggg geg cac cag gag gee gag ctg ccg ctg geg acc ctg age 489 Gly Ala Gly Ala His Gin Glu Ala Glu Leu. Pro Leu Ala Thr Leu Ser 130 135 140 ate tgt atg aeg gee atg atg gee gee gtg gee tge ggc aag ggc atg 537 lie Cys Met Thr Ala Met Met Ala Ala Val Ala Cys Gly Lys Gly Met 145 150 155 160 ggt ett gee gee gee egg tgg ccg egg ctg ggg ccg etc egg ctg ate 585 Gly Leu Ala Ala Ala Arg Trp Pro Arg Leu Gly Pro Leu Arg Leu lie 165 170 175 geg etc g gc rtt ctg etc gtc gtg etc etc gac ate gee gag ccg ctg 633 Ala Leu Gly Phe Leu Leu Val Val Leu Leu Asp lie Ala Glu Pro Leu 180 185 190 gtg tee ttc geg ggc gtc tee gtg tgg aeg egg gcagt 681 Val Ser Phe Ala Gly Val Ser Val Trp Thr Arg Ala Val Pro Glu Leu 195 200 205 acc ate tgg egt ggg cac tgg tat cag ttc ccg ctg tat cag atg gtg 729 Thr He Trp Ser Gly His Trp Tyr Gin Phe Pro Leu Tyr Gin Met Val 210 215 220 get teg geg etc ttc ggc gee tet ttg ggg gee geg ege cac ttt ege Ί1Ί Ala Ser Ala Leu Phe Gly Ala Ser Leu Gly Ala Ala Arg His Phe Arg 225 230 235 240 aac egg ege ggc gaa aeg tgt ctg gag tee ggg geg CCC etc eta ccg 825 Asn Arg Arg Gly Glu Thr Cys Leu Glu Ser Gly Ala Leu Leu Pro 245 250 255 gag ggc ccg agg cca tgg gtc egg ctg ctg geg gtg g: g ggc ggg gee 873 Glu Arg Pro Trp Val Arg Leu Leu Ala Val Val Gly Gly Ala 260 265 270 aac ate age ate gee etc tac acc ggc gca cac ggc gca cac ate ctg 921 Asn lie Ser lie Ala Leu Tyr Thr Gly Ala His Gly Ala His lie Leu 275 280 2 = 5 ttc teg ctg atg gac ggc get ccc ccg gac egg etc ccc gas ttc ttc 969 Phe Ser Leuet Asp Gly Ala Pro Pro Asp Arg Leu Pro Glu Phe Phe 290 295 300 (Please read the notes on the back before this page) Pack-ΤΓΤ Order · This paper size applies to China National Standard (CNS) A4 specification (210 X 297 mm ) 585910 A8 B8 C8 D8 _________ six, patented scope cgt ccg gcg gcc ggc tac tga gaccgccggc accacccacg tacccgatgt 1020 Arg Pro Ala Ala Gly Tyr '305 310 gcgcgatgtg cctgatgcgc ctgatgtacc cggggtgtca tcggctcacc tgtggcgcct 1080 catgcggtga gcgctccgcc tcgtccttgt tccggctcct gggctccacg accatacgga 1140 gcggccgggg 1150 4. An oligonucleotide molecule capable of hybridizing a polynucleotide molecule having a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO ·· 3 under highly stringent conditions, or hybridizing having a complement to SEQ ID N 〇: 1 or nucleotides of the nucleotide sequence of SEQ ID NO: 3 The column polynucleotide molecule, based on the highly stringent conditions at a temperature of 35 to 6 5 ° C, the use of 6 X S S C / 0 · 5% sodium pyrophosphate for rinsing. 5. The oligonucleotide molecule according to item 4 of the patent application, which is complementary to the nucleotide sequence of SEQ ID NO. · 1 or SEQ ID NO: 3, or complementary to the nucleotide sequence having the same sequence as SEQ ID NO: 1. Or, a polynucleotide molecule having a nucleotide sequence of SEQ ID NO: 3 having a complementary nucleotide sequence. Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 6 · A recombination vector, which contains the isolated polynuclear acid molecule in the scope of patent application No. 1. 7 · If the recombination vector of item 6 of the patent application scope further comprises a nucleotide sequence of% {@ or more regulatory elements, the encoding regulatory element {牛 @ @ 岭 酸 电影 系 is operatively linked to the patent application scope The nucleotide sequence of the polynucleic acid molecule of vector 6. 8 · The recombination vector of item 7 of the patent, which further comprises a nucleotide sequence with missing codes and optional marks. The last standard of the book uses the Chinese National Standard (cNs specification (21 to 297: 585910 A8 B8 C8 D8-^ -------------------) VI. Application scope 9 · Such as The recombination vector of the scope of application for the patent No. 8 is plastid PSE186 (CCRC 940239). 1 0 · — a type of Streptomyces avermitilis host cell, which contains the recombination vector of the scope of application for the patent No. 8 1 1 · A recombinant vector , Which contains the isolated polynucleotide molecule in the scope of patent application No. 3. 1 · If the recombinant vector in the scope of patent application No. 11 further comprises a nucleotide sequence encoding one or more regulatory elements, The nucleotide sequence encoding the regulatory element is the nucleotide sequence of a polynucleotide molecule operably linked to the vector of the scope of application for item 11 of the patent. 1 3 · If the recombinant vector of scope of application for the patent, It further comprises a nucleotide sequence encoding a selectable marker. 1 4 · A hygroscopic host cell comprising a recombinant vector in the scope of patent application No. 13 1 · · A recombinantly expressed Streptomyces avermitilis A ve C gene product PSE 186 (CCRC 9 4 0 2 3 9), the amino acid sequence encoded by the nucleotide sequence encoding the Ave C gene product of Streptomyces avermitilis, or SEQ ID NO: printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs Amino acid sequence of system 2. 16 · — A recombinantly expressed Streptomyces hygroscopicus Ave C gene product, which has the amino acid sequence of SEQ ID NO: 4. SEQ ID NO: 4 Applicable to China National Broadcasting Standard (CNS) A4 regulations (2) OX297 mm 585910 A8 B8 C8 D8 VI. Application scope of patent Val Phe Thr Leu Pro Val 1 5 Leil Gly Tyr Arg Arg lie 50 Val Leu 65 Thr Phe Leu Gin Val Tyr 20 lie Glu Lys Ala 35 Ala Asp Val Leu Ala Val Cys Leu 70 Asp Ala Ser Leu 85 Ser Pro to e ο Asn Trp Val Phe Gly Ala 130 lie Cys 145 Gly Leu Ala Leu Val Ser Printed by the cooperative Thr lie 210 Ala Ser 225 Gly Ala Val Ala 115 Gly Ala His Gin Met Thr Ala Met 150 Ala Ala Ala Arg 165 Gly Phe Leu Leu 180 Phe Ala Gly Val 195 Trp Ser Gly His Ala Leu Phe Gly 230 Thr Leu Trp Ala Cys Val Gly Ala Leu Val 10 15 Val Phe Ala Ala Trp Leu Ala Asp Ser Gly 25 30 Ser Pro Ala Arg Gly Gly Gly Asp Ser Glu 40 lie Pro leu Leu Ser Val Val Gly Ala Val 55 60 Tyr Arg Arg Cys Arg Ala Arg Arg Arg Leu 75 80 Phe lie Gly Leu Leu Ser Ala Ser Trp Gin 90 95 lie Asn Pro Val Leu Ala Ser Asn Val Asn 105 110 Ser Trp Gly Pro Tyr Val Pro Gly Trp Gin 120 125 Glu Ala Glu Leu Pro Leu Ala Thr Leu Ser 135 140 Met Ala Ala Val Ala Cys Gly Lys Gly Met 155 160 Trp Pro Arg Leu Gly Pro Leu Arg Leu lie 170 175 Val Val Leu Leu Asp He Ala Glu Pro Leu 185 190 Ser Val Trp Thr Arg Ala Val Pro Glu Leu 200 205 Trp Tyr Gin Phe Pro Leu Tyr Gin Met Val 215 220 Ala Ser Leu Gly Ala Ala Arg His Phe Arg 235 240 (Please read the notes on the back before this page) Too i- This paper is again suitable for China National Standard (CNS) A4C format (21 〇X 297 mm) 585910 B8 C8 D8V, patent application scope Asn Arg Arg Gly Glu Thr Cys Leu Glu Ser Gly Ala Ala Leu Leu Pro 245 250 255 Glu Gly Pro A ^ rg Pro Trp Val Arg Leu Leu Ala Val Val Gly Gly Ala 2 60 265 270 Asn lie Ser lie Ala Leu Tyr Thr Gly Ala His Gly Ala His lie Leu 275 280 285 Phe Ser Leu Met: Asp Gly Ala Pro Pro Asp Arg Leu Pro Glu Phe Phe 290 295 300 Arg Pro Ala Ala Gly Tyr 305 310 Please read Note 17. The method of the product The bacterial host cell nucleoside molecule has a nucleotide sequence and a regulatory element to make a recombinant Av, and is used for making a sequence from the detailed SEQI Val Val Val, which contains cultivation, the recombination table has a coding SE column, the polynucleus, the regulatory element e C gene in the cytogenetic medium DNOTrp Ala Gly 5 Streptomyces avertinus recombinant AV e C gene raised by the recombinant expression vector transformed Streptomyces afferentus vector containing polymer Nucleotide molecule, the amino acid sequence of the polynucleotide Q ID No: 2 is operably linked to one or more pieces to control the polynucleotide molecule in the host under conditions that facilitate preparation. The intracellular expression recovered the Av e C gene product. 2 Val Gly Leu Leu Phe Leu Ala Leu Gin Ala 10 15 Ψ \ Order Printed by the staff of the Intellectual Property Bureau of the Ministry of Economic Affairs, printed by Tyr Val Phe Ser Arg Trp Ala Ala Asp Gly Gly Tyr Arg Leu lie Glu 20 25 30 Thr Ala Gly Gin Gly Gin Gly Gly Ser Lys Asp Thr Gly Thr Thr Asp 35 40 45 Val Val Tyr Pro Val lie Ser Val Val Cys lie Thr Ala Ala Ala Ala 50 55 60 Trp Leu Phe Arc Arg Cys Arg Val Glu Arg Arg Leu Leu Phe Asp Ala 65 70 Ί5 80 Leu Leu Phe Leu Gly Leu Leu Phe Ala Ser Trp Gin Ser Pro Leu Met 85 90 95 This paper size applies to Chinese National Standard (CNS) A4 size (2) 0 × 297 mm 585910 A8 B8 C8 D8 Γ, patent application scope Asn Trp Phe His Ser Val Leu Val Ser Asn Ala Ser Val Trp Gly Ala l〇C 105 110 Val Gly Ser Trp Gly Pro Tyr Val Pro Gly Trp Gin Gly Ala Gly Pro i 15 120 125 Gly Ala Glu Ala Glu Met Pro Leu Ala Ser Ala Ser Val Cys Met Ser 130 135 140 Ala Leu lie Val Thr Val Leu Cys Ser Lys Ala Leu Gly Trp lie Lys 145 150 155 160 Ala Arg Arg Pro Ala Trp Arg Thr Trp Arg Leu Val Leu Ala Val Phe 265 170 175 Phe lie Gly lie Val Leu Gly Leu Ser Glu Pro Leu Pro Ser Ala S er 180 185 190 Gly lie Ser Val Trp Ala Arg Ala Leu Pro Glu Val Thr Leu Trp Ser 195 200 205 Gly Glu Trp Tyr Gin Phe Pro Val Tyr Gin Ala Val Gly Ser Gly Leu 210 215 220 ^ Val Cys Cys Met Leu Gly Ser Leu Arg Phe Phe Arg Asp Glu Arg Asp 225 230 235 240 Glu Ser Trp Val Glu Arg Gly Ala Trp Arg Leu Pro Gin Arg Ala Ala 245 250 255 Α5Π Trp Ala Arg Phe Leu Ala Val Val Gly Gly Val Asn Ala Val Met 260 265 270 Phe Leu Tyr Thr Cys Phe His lie Leu Leu Ser Leu Val Gly Gly Gin 275 280 285 Pro Pro Asp Gin Leu Pro Asp Ser Phe Gin Ala Pro Ala Ala Tyr 290 295 300 (Please read the precautions on the back before this page) Printed by the Consumers' Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs 18. A method for manufacturing a product, which comprises a cultured host cell, the recombinantly expressed nucleoside molecule has a nucleotide sequence encoding SEQ and the polynucleoside regulate Element, the regulatory element of the Streptomyces hygroscopicus recombinant Ave C gene transformed by a recombinant expression vector containing a polynucleotide molecule, the amino acid sequence of the polynuclear ID No: 4 One or more of these molecules can be used to control the operation of the acid molecule molecule system. The size of this paper is applicable to China's standard KCN (CNS) A4 (2! 0X297 mm) 585910 ABCD Intellectual Property Printed by the Consumer Cooperative of the Bureau. 6. Application for a patent application to produce recombinant Ave C gene products in the host cell, and recover the Ave C gene product from the cell culture medium. 19. A polynucleotide molecule consisting of a nucleotide sequence identical to the sequence encoding the product of the Streptomyces averaverii Ave C gene product in plastid pSE186 (CCRC 940239), or an amino acid sequence of SEQ ID NO: 1. Streptomyces averaverii aveC 0 RF consists of the same nucleotide sequence, but the nucleotide sequence further contains one or more mutations selected from (1) the amine encoding the Ave C gene product A 1 a nucleotides of amino acid residues 1 3 9 are substituted with nucleotides encoding T hr, (2) nucleosides of Ser encoding amino acid residues 1 3 8 of Ave C gene product The acid was replaced with a nucleotide encoding Thr, (3) a heterologous nucleotide sequence was inserted, (4) a Pstl / SphI fragment of 640bp was deleted, and (5) a nucleotide C at the nucleotide position 4 71 Then, a shift mutation is introduced, (6) a stop codon is introduced at the nucleotide position of the amino acid residue 1 1 6 of the Ave C gene product, or (7) the Ave C gene product is encoded G 1 y and T yr nucleotides of amino acid residues 2 5 6 and 2 7 5 were substituted with nucleotides encoding Asp and H is, respectively, so that wild-type ave Streptomyces avermitilis strain ATCC 5 3 6 9 2 whose C peer gene has been deactivated and shows a polynuclear uric acid molecule containing the mutated nucleotide sequence is only showing the wild type ave C peer gene Streptomyces averaverii strain A D. CC 5 3 6 9 2 cells reduced the ratio of cyclohexyl B 2: cyclohexyl B 1 streptomycin. 20. For the polynucleotide molecule No. 19 in the scope of patent application, the paper size shall be in accordance with Chinese National Standard (CNS) A4 (210 × 297 mm) 585910 A8 B8 C8 _____; ____ D8 6. Scope of patent application The reduction ratio of cyclohexyl B 2: far hexyl B 1 and avertin is lower than 1.6: 1. 2 1 · The polynucleotide molecule according to item 2 of the patent application scope, wherein the reduction ratio of cyclohexyl B 2: cyclohexyl B 1 avertin is 0.94: 1. 2 2 · As for the polynucleotide molecule No. 20 in the scope of patent application, wherein the reduction ratio of cyclohexyl B 2: cyclohexyl B 1 avertin is 0.88: 1 ° 2 3 · As in the scope of patent application No. 2 Polynucleotide molecule of item 〇, wherein the reduction ratio of cyclohexyl B 2: cyclohexyl B 1 avertin is 0 · 8 4 ·· 1 ° 2 4 · — a polynucleic acid molecule, which is composed of The strong promoter is constructed by operably linking Streptomyces averaverii avec ORF of SEQ ID NO: 1. 25. The polynucleotide molecule according to item 24 of the patent application scope, wherein the strong promoter is an er m E promoter from polysaccharide of brown sugar. 2 6 · The polynucleotide molecule according to item 19 of the patent application, wherein the shift mutation is printed by aveC of SEQ ID No. 1: 1 of the Intellectual Property Bureau of the Ministry of Economic Affairs and the Consumer Cooperatives of the Consumers ’Cooperative. 7 Two C nucleotides are added after the C nucleotide at the 1 position. A recombinant vector comprising a polynucleotide molecule according to any one of claims 19 to 26 in the patent application. 28 · —A recombinant vector, which is pSE180 (CCRC 9 4 0 2 3 5). The size of this paper is applicable to Chinese National Standards (CNS; A4 see grid (2) OX 297 mm) 585910 A8 B8 C8 D8 VI. Application scope of patent 2 9. — Streptomyces host cell, which contains the scope of patent application No. 2 8 Recombinant vector of item 3. 0. — A method for identifying mutations that can reduce the ave C ORF of streptomycin avertin in a ratio of 2: 1 produced, comprising: (a) Decided to produce a 2: 1 ratio of streptomycin 'via natural ave C equivalent gene inactivated Streptomyces avermitilis cells and introduce and express a nucleoside containing a product encoding a mutant Ave C gene product Acid sequence of the polynucleotide molecule, (b) determines the ave C equivalent of the Streptomyces avertinus strain identical to step (a), but expressing only the nucleotide sequence of ORF of SEQ ID NO: 1 Streptomycin of 2: 1 ratio produced by the cell, and (c) comparing Streptomycin of 2: 1 ratio produced by the Streptomyces avertinus cell in step (a), and Streptomyces avermitilis produced by Streptomyces averaverii in step (b) in a ratio of 2: 1, if Streptomyces avermiteri produced by Streptomyces averaverii in step (a) in a ratio of 2: 1 Streptomycin of 2: 1 ratio produced by Streptomyces avermitilis in step (b) is lower than that of step (b), and it has been identified that ave C 〇RF can change the ratio of streptomycin of 2: 1 ratio. Mutation. Printed by the Intellectual Property Bureau Employees' Cooperative of the Ministry of Economic Affairs 31. A method for identifying mutant aveC ORFs or gene constructs containing aveC ORFs that can alter the amount of avertin that is produced, including (a) Decide on the amount of streptomycin produced by the inactivated Streptomyces avermitilis of the natural ave C equivalent gene, and introduce and express the gene construct containing the product encoding the mutant Ave C gene or the product encoding the Ave C gene product Polynucleotide of the nucleotide sequence of the body The paper size is applicable to the Chinese National Standard (CNS) A4 specification (2〗 OX29 < 7 mm) 585910 Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs A8 B8 C8 D8 Glycylic acid molecule, (b) determines the streptavidin produced by a cell identical to the Streptomyces avertinus strain of step (a), but expressing only the nucleotide sequence of the aveC equivalent of SEQ ID NO: 1. Quantity, and (c) comparing the amount of streptavidin produced by the Streptomyces avertinus cell in step (a) with the streptomycin produced by the Streptomyces avertinus cell in step (b) Quantity If the amount of streptomycin produced by step (a) and streptomyces avermitii in step (b) is different, a mutation aveC that can change the amount of streptomycin produced by streptomycin has been identified. RF or genetic construct. 3 2. A method for producing a novel Streptomyces afferinus strain, which includes a strain of Streptomyces aversus that exhibits a mutated ave C equivalent gene and the same strain but that expresses only the wild type ave C equivalent gene When comparing cells, it is possible to produce a reduced strain of a ratio of streptomycin of 2: 1. The method includes transforming a strain of Streptomyces avertinus with a vector carrying a mutant ave C equivalent gene, wherein the same strain but only When comparing cells expressing the wild type ave C equivalent gene, the gene product encoded by the mutant ave C equivalent gene can reduce the production ratio of type 2: 1 avertin, and screen this transformed cell, where The mutation in the ave C peer gene is one or more mutations, the mutation is selected from (1) a nucleotide of A 1 a encoding an amino acid residue 1 3 9 of the Ave C gene product is substituted with Nucleic acid encoding T hr, (2) a nucleotide encoding Ser of amino acid residue 1 38 of Ave C gene product is substituted with a nucleotide encoding T hr, (3) inserted heterologous Nucleotide sequence, (4) delete the 640bp Pstl / SphI fragment, (5) in Please read the note of ιδ for the glycosides. The paper size of the edition is applicable to China National Standards (CNS) A4 specification (2 丨 〇297mm) 585910 8 8 8 8 ABCD VI. Patent application scope Nucleotide C at acid position 4 7 Then, a shift mutation is introduced, (6) a stop codon is introduced at the nucleotide position of the amino acid residue 1 1 6 of the Ave C gene product, or (7) the Ave C gene product is encoded The nucleotides of G 1 y and T yr of amino acid residues 2 5 6 and 2 7 5 are substituted with nucleotides encoding Asp and H is, respectively. 3 3 ·-A method for producing a novel strain of Streptomyces averaverii that can change the amount of streptavidin produced, comprising using a gene bearing the mutant ave C equivalent or containing the ave C equivalent Gene construct-transformed Streptomyces avermitilis strain, in which when compared with cells of the same strain but showing only wild-type ave C equivalent genes, the performance of the mutated ave C equivalent genes can change The amount of auxin produced, and the transformed cells that can change the production amount of avertin, wherein the mutation in the ave C peer gene is one or more mutations, and the mutation is selected from (1 ) A 1 a nucleotide encoding amino acid residue 1 39 of Av e C gene product is substituted with nucleotide encoding T hr, (2) amino acid residue encoding Av e C gene product The nucleotide of Ser of 1 3 8 was replaced with a nucleotide encoding Dhr, (3) inserted. Heterologous nucleotide sequence was inserted, (4) P st I / SphI fragment of 6 4 0 b ρ was deleted (5) After nucleotide C at nucleotide position 471, a shift mutation is introduced, (6) A stop codon was introduced at the nucleotide position of amino acid residue 1 1 6 of the product, or (7) G 1 y of amino acid residues 2 5 6 and 2 7 5 encoding the Av e C gene product T yr nucleotides were substituted with nucleotides encoding As s ρ and Η 1 s, respectively. (Please read the precautions on the back first-this page) Printed by the Intellectual Property Bureau of the Ministry of Economic Affairs, Consumer Cooperatives, China National Standard (CNS) A4 Specification (210 × 297 mm) 585910 A8 B8 C8 D8 VI. Application Patent scope 34 · —Ave C equivalent gene of a novel Streptomyces avermitilis strain used for manufacturing a factor. This ave C equivalent gene is selected from (1) the gene encoding Ave. The nucleotide of A 1 a is replaced by the nucleotide encoding the Ave C gene product, and the T hr acid sequence is replaced, (4) the 6 4 segment is deleted, (5) a shift mutation at the nucleotide position, (6 ) At the nucleotide position of the base 1 1 6 the nucleotides of the amine G 1 y and Ty! · Of the Ave C gene product are coded. 35. If the patent application contains a method that has been removed, the inactive mutant A-C gene is produced as a nucleotide encoding a butylamine residue 0 bp 4 7 1 code A ve into one The active ave C equivalents of the intermediate amino acid residues include the use of cells containing a deactivated Streptomyces sp. Strain and transformed cells, in which one or more mutations, the amino acid residues of the mutant A nucleotide of 139 hr, (2) a nucleus of Ser of 138, (3) After inserting a heterologous nucleoside P st I / S ph I into nucleotide C, the 1 C gene product is introduced. Amino acid residue codons, or (7) the code for 2 5 6 and 2 7 5 encodes Asp and The method of item 34 is printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs, where the carrier is PSE180CCCRC 940235). 3 6 · — a strain of Streptomyces averaverii, including a strain that exhibits a mutant Streptomyces, which can reduce the manufacturing ratio when compared with cells of the same bacterial C equivalent, in which one mutation in the ave C equivalent is one Or multiple mutations selected from (1) the Aver strain of the aveC equivalent of the nucleoside aveC of A 1 a of the amino acid residue 1 39 of the C gene product but showing only wild-type ave species 2: 1 Code of Averstreptomycin A The paper size applies to the Chinese National Standard (CNS) specifications (210X 297 mm) 585910 A8 B8 C8 _ D8 ________ VI. The scope of patent application The acid has been replaced with a nucleotide encoding T hr, (2) a nucleotide encoding Ser of amino acid residue 1 38 of Ave C gene product is substituted with a nucleotide encoding Thr, (3) a heterologous nucleotide sequence is inserted, (4) Delete the 640bp Ps t I / Sph I fragment, (5) introduce a shift mutation after nucleotide C at nucleotide position 4 71, (6) in the amino acid encoding the Ave C gene product A stop codon was introduced at the nucleotide position of residue 1 1 6 or (7) an amino acid encoding the product of the Av e C gene Group 256 and G 1 y 2 7 5 T y r and the nucleotide encoding nucleotides are substituted, and A s p H i s of. 37. If the strain of item 36 in the patent application scope, the cell produced cyclohexyl B 2: the ratio of cyclohexyl B 1 to avertin, is less than 1 · 6 · · 1 ° 3 8 · if applied The strain of item 37 in the patent scope, wherein the ratio of cyclohexyl B 2: cyclohexyl B 1 and avertinomycin produced by the cells is 0.94: 1. 3 9 · If the strain of item 37 in the scope of patent application, the ratio of cyclohexyl B 2: cyclohexyl B 1 avertin streptomycin produced by the cells is 0.88: 1 ° printed by the Consumer Cooperative of Intellectual Property Bureau of the Ministry of Economy System 40 • The strain of item 37 in the scope of the patent application, wherein the ratio of cyclohexyl B 2: cyclohexyl B 1 avertin streptomycin produced by the cells is 0.84: 1. 4 1 · A strain of Streptomyces averaverii, including a strain of Streptomyces averaverii expressing a mutant ave C equivalent gene or a gene construct, which is the same strain but expressing only cells of the wild type ave C equivalent gene-1b -This paper size applies Chinese National Standard (CNS) M specification (21〇X 297 mm) 585910 A8 B8 C8 D8 々 When comparing the scope of patent application, the production quantity of avertin can be increased. The mutation in the isogenic gene is one or more mutations, the mutation is selected from (1) a nucleotide encoding A 1 a encoding an amino acid residue 1 39 of the Ave C gene product is substituted with a nucleotide encoding T hr Nucleotide, (2) a nucleotide encoding Ser of amino acid residue 1 38 of the Av e C gene product is substituted with a nucleotide encoding T hr, and (3) a heterologous nucleotide sequence is inserted (4) delete the 640bp Pstl / Sphl fragment, (5) introduce a shift mutation after nucleotide C at nucleotide position 4 71, (6) in the amine group encoding the Ave C gene product 1 stop codon was introduced at the nucleotide position of acid residue 1 16 or (7) the amine encoding the product of the Av e C gene Acid residue 256 and G 1 y 2 7 5 and T y r are the substituted nucleotide coding and A s p H i s of nucleotides. 4 2 · The strain of item 41 in the scope of patent application, wherein the a v e C gene has been deactivated. Printed by the Consumer Cooperatives of the Intellectual Property Bureau of the Ministry of Economic Affairs 4 3 · A method for producing streptomycin, including culturing Streptomyces aversus in a culture medium under conditions that permit or initiate the production of streptomycin. Strain, which expresses a mutant ave C equivalent gene encoding a gene product. When compared with cells of the same strain but showing only wild-type ave C equivalent, it can reduce the production of type 2: 1 avertin Ratio, and recovering streptavidin from this culture medium, wherein the mutation in the a V e C peer gene is one or more mutations selected from (1) an amine encoding an Ave C gene product The nucleotides of A 1 a of amino acid residues 1 3 9 are substituted with nucleotides encoding T hr, (2) encoding Ave C. This paper size applies the Chinese National Standard (CNS) A4 specification (21 〇χ 297 Mm) 585910 A8 B8 C8 __ D8 6. The nucleotide of Ser of amino acid residue 1 3 8 of the patented gene product was replaced with a ribulic acid encoding T hr and (3) inserted into a heterologous nucleus For the oxalic acid sequence, (4) delete the 640bp Pstl / SphI fragment, (5) in After nucleotide C at nucleotide position 4 71, a shift mutation was introduced. (6) A stop code was introduced at nucleotide position encoding amino acid residue 1 1 6 of Ave C gene product. Or (7) G 1 y and T yr nucleotides encoding amino acid residues 2 5 6 and 2 7 5 of the product of the Av e C gene product are substituted with nucleotides encoding Asp and H is, respectively . Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs 4 4 · A method for producing streptomycin, comprising culturing the streptomyces avermitilis strain in a culture medium under conditions permitting or initiating the manufacture of streptomycin, This strain exhibits a mutant ave C equivalent gene or a gene construct containing this ave C equivalent gene. When compared with cells of the same strain but showing only wild-type ave C equivalent genes, this strain can change the Manufacturing quantity and recovering streptomycin from this culture medium, wherein the mutation in the ave C equivalent gene is one or more mutations selected from (1) the amine group encoding the Ave C gene product The nucleotide of A 1 a of acid residue 1 3 9 is substituted with a nucleotide encoding T hr. (2) of Ser which encodes amino acid residue 1 3 8 of Ave C group & product The nucleotide is replaced with a nucleotide encoding T hr, (3) the heterologous nucleotide sequence is inserted, (4) the 640bp PstI / Sph I fragment is deleted, and (5) the nucleotide position 4 7 1 After nucleotide C, a shift mutation was introduced. (6) The amino acid residues encoding the Ave C gene product 1 stop codon was introduced at the nucleotide position 1 1 6 or (7) the amino acid residue 2 5 6 encoding the A ve C gene product and the size of this paper applies the Chinese National Standard (CNS) A4 specification (public Qing) 585910 A8 B8 C8 D8 6. The nucleotides of G 1 y and T yr in the scope of patent application 2 7 5 were replaced with nucleotides encoding Asp and H is, respectively. 4 5 · The method according to item 44 of the scope of patent application, in which the production amount of avertin is increased by the av e C equivalent gene or gene construction showing the mutation. 4 6 · — a composition of streptavidin, which is produced by a strain of streptavidin, which exhibits a mutated ave C equivalent gene, and the gene product encoded by it can be reduced Type 2: 1 Producing ratio of streptavidin. This shows that Streptomyces averaverii strains that have mutated the ave C equivalent gene are compared with cells of the same strain but showing only wild type ave C equivalent gene, which can reduce the type 2: 1 manufacturing ratio of streptomycin, wherein the mutation in the ave C peer gene is one or more mutations, the mutation is selected from (1) amino acid residues 1 encoding the Av e C gene product The nucleotide of A 1 a of 3 9 is substituted with a nuclear acid encoding T hr, and (2) the nucleotide of Ser which encodes amino acid residue 1 3 8 of Ave C gene product is substituted by encoding T hr nucleotide, (3) insert heterologous nucleotide sequence, (4) delete 6 40 bp P st I / S ph I fragment, (5) nucleoside at nucleotide position 4 71 After the acid c, a shift mutation was introduced, and (6) a stop was introduced at the nucleotide position of the amino acid residue 1 16 of the Ave C gene product. Codons, or (7) G 1 y and T yr nucleotides encoding the amino acid residues 2 5 6 and 2 7 5 of the Ave C gene product are substituted with nuclei encoding A sp and Η 1 s, respectively Glycylic acid. This paper size applies the Chinese National Standard (CNS) Α4 specification (210 X 297 mm) (Please read the precautions on the back before filling this page)% · Printed by the Consumer Cooperative of the Intellectual Property Bureau of the Ministry of Economic Affairs