RU2744092C1 - Test system for detection of sheeppox virus genome by real-time polymerase chain reaction - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology. Disclosed is a specific and highly sensitive test system for detecting the sheeppox virus genome. Oligonucleotide primers and a fluorescently labeled probe were developed for specific amplification and detection of a fragment of the ORF131-ORF132 sheeppox virus genome:

Forward TCGCATATGGAATTATCGGAAT

Reverse GATTTGACAAACACGTGTACAAA

probe FAM ACGAACATTTTTCCCTCTAAGCTACTTTAC BHQ1

The test system consists of a ready-made PCR mixture (including oligonucleotide primers and a fluorescently labeled probe), Taq-DNA polymerases, positive control and negative control and makes it possible to identify the sheeppox virus genome in the shortest possible time.

EFFECT: invention can be used to detect the DNA of all genetic variants of sheeppox viruses in samples of a wide range of pathological materials and biomaterials in order to make and clarify clinical and laboratory diagnoses in veterinary medicine.

1 cl, 1 dwg, 3 ex, 3 tbl

Description

The invention relates to veterinary virology, to molecular diagnostics, and in particular to the detection of the sheep pox virus genome.

Sheep pox is a transboundary highly contagious viral disease of sheep, which poses a serious threat to livestock not only in the Russian Federation, but also in other countries where raising and raising sheep is a cultural tradition [1, 3]. In naturally susceptible animals, the disease is manifested by fever, shortness of breath, swelling of the eyelids, the release of serous-mucous exudate from the eyes and nose, the development of papular-pustular rash on the skin and mucous membranes, damage to internal organs and high mortality, sometimes reaching 100%. The disease is recorded at any time of the year, while the severity depends on a number of factors: age, breed and individual characteristics of the organism, as well as the impact of environmental conditions [2].

The causative agent is a DNA virus (Sheeppox virus) belonging to the genus Capripoxvirus of the Poxviridae family. The causative agent is species specific and causes disease in only one species of animals [4].

Virological detection of sheeppox virus requires a significant investment of time and consumables. In this regard, the development of a specific and sensitive test system for detecting the sheeppox virus genome is an urgent task. Early diagnosis of disease by real-time PCR is one method that can be used to detect the virus during outbreaks. It can be a valuable addition to the application of basic methods, which should include rapid diagnosis, tracking and control of disease prevalence.

Patent documents of foreign authors mainly relate to multiplex systems designed to detect the genome of pathogens of several diseases of MRS and cattle by PCR. Basically, patents are developed for the diagnosis of capripoxvirus infections: sheep pox, goat pox, infectious bovine nodular dermatitis.

Also, with the help of multiplex PCR test systems, studies are carried out to identify the genomes of pathogens of MRS infections such as bluetongue, foot and mouth disease, pustular pustular dermatitis, and plague of small ruminants. In this case, the test system uses 6 pairs of primers: a pair for detecting bluetongue virus - bTV-F and BTV-R; primers for the detection of foot and mouth disease virus FMDV-F and FMDV-R with; primers for the detection of the plague virus of small ruminants - PPRV-F and PPRV-R; primers for the detection of sheeppox virus - SPPV-F and SPPV-R; primers for the detection of goat pox virus -GTPV-F and GTPV-R .; primers for the detection of pustular pustular dermatitis virus ORFV-F and ORFV-R [5].

The disadvantage of such test systems is their multicomponent nature, which significantly complicates the collection of the reaction mixture and quality control of the components of the test system. Moreover, amplification of several fragments in one tube inevitably inhibits the formation of copies of the DNA template, the concentration of which is the lowest in the test sample.

A known method for detecting the genome of poxviruses using PCR without differentiation for sheep pox [6]. The disadvantage of this method is the inability to confirm or exclude the presence of DNA of the causative agent of sheep pox, which reduces the accuracy of diagnosis.

Closest to the claimed invention is the PCR-OSPA-FACTOR test system (Factor, Troitsk, Russia), which is based on a method for diagnosing sheep and goat pox. The disadvantage of this method is that sheep and goat pox are different nosological units and are caused by different viruses [7].

The aim of the present invention is to provide a test system for the specific detection of the sheeppox virus genome by real-time polymerase chain reaction (RT-PCR).

Thus, the development of a sensitive and specific test system for detecting the genome of all possible genetic variants of the sheeppox virus, with the ability to study a wide range of biological material (internal organs, papular-pustular lesions, blood serum, whole blood, cell culture), is a technical problem. ... This goal is achieved by the fact that the proposed RT-PCR test system contains specific oligonucleotide primers and a fluorescently-labeled probe, and for setting up real-time PCR, a selection of conditions was carried out that provides a minimum risk of contamination in the tested samples and excludes subjectivity in evaluating the results and when conducting research using the developed diagnosticum.

The invention relates to a test system for the specific express identification of the genome of all genetic variants of sheep pox circulating in the Russian Federation, as well as other endemic foci, by the method of polymerase chain reaction in real time, consisting of a mixture of oligonucleotide primers and a fluorescently labeled probe, an enzyme Taq polymerase, positive control and negative control.

Fluorescence is measured by the FAM channel. The intersection of the fluorescence curve of the threshold cycle line (Ct) indicates the presence of sheeppox virus genome in the sample, and the lower the "Ct" value, the higher the concentration of the sheeppox virus genome in the sample under study. The absence of crossing the fluorescence curve of the Ct line indicates the absence of the sheeppox virus genome in the test material.

The invention can be used to detect sheep pox virus DNA in samples of biological material (suspension of parnechimatous organs, lymph nodes, skin lesions, blood serum, whole blood, cell culture), for the purpose of clinical and laboratory diagnostics, as well as research work in veterinary medicine ...

The technical result of the invention consists in the development of a modern, highly specific test system, consisting of oligonucleotide primers and a fluorescently labeled probe, in relation to all possible genetic variants of sheeppox virus circulating in the world; from an extended spectrum of biological material (suspension of parenchymal organs, lymph nodes, skin lesions, blood serum, whole blood, cell culture), suitable for research without obtaining false positive results; with the ability to use a wide range of amplifiers that meet the minimum requirements for setting up RT-PCR; with a reduction in the time for testing samples for the presence of the sheeppox virus genome due to a shortened thermal cycling profile and the use of a ready-made PCR mixture, including during mass research; and expanding the range of diagnostic tools for sheep pox.

The presented method includes sequences of oligonucleotides specific only for sheeppox virus and having the following nucleotide sequence:

Forward TCGCATATGGAATTATCGGAAT

Reverse GATTTGACAAACACGTGTACAAA

probe FAM ACGAACATTTTTCCCTCTAAGCTACTTTAC BHQ1

The essence of the invention lies in the fact that the detection of DNA of sheep pox virus is carried out in the presence of related capripoxviruses (viruses of goat pox and infectious nodular dermatitis) without any influence of the latter on the qualitative result of the reaction. The high degree of specificity of the test system is confirmed by laboratory studies on a panel of samples of homologous and heterologous viruses.

The essence of the invention is illustrated in the graphic image (Fig. 1), which shows a linear graph of the results of RT-PCR when testing 10-fold dilutions of the isolated DNA of the sheep pox virus (strain "ARRIAH"),

The detection of amplification products is carried out by recording the fluorescence generated as a result of the destruction of the hybridization probe located at the 5'-end of the FAM fluorophore, and at the 3'-end of the quencher BHQ1. In the absence of a target, the fluorophore and quencher are close together, and only negligible fluorescence is observed, since the quencher absorbs the radiation emitted by the fluorophore. When specific products accumulate during PCR, the probe hybridizes to the amplicon, which leads to its destruction due to the 5'-exonuclease activity of Taq polymerase. As a result, the fluorophore is separated from the quencher and its radiation can be detected. Thus, the increase in fluorescence is directly proportional to the amount of synthesized PCR product.

The primers and probe are designed to amplify and detect a fragment of the sheeppox genome located between ORF131 and ORF132, conservative and unique only for all variants of the sheeppox virus.

The test system / kit for detecting the sheeppox virus genome in RT-PCR consists of the following components:

No. 1 ready-made PCR mixture, volume 550 µl - 2 tubes;

No. 2 enzyme Taq-DNA polymerase, volume 14 µl - 1 tube;

No. 3 positive control sample, volume 100 µl - 1 tube;

No. 4 negative control sample, volume 100 µl - 1 tube.

RT-PCR is carried out in a programmable amplifier in one stage using a ready-made PCR mixture (No. 1), including for one reaction: 5x buffer for RT-PCR (5 μl), 25 mM magnesium chloride (3.5 μl), deoxyribonucleotide triphosphates ( 0.5 μl 10 pmol), oligonucleotide primers (1 μl of each primer 15 pmol), probe (1 μl 2.5 pmol); and the enzyme Taq-DNA polymerase (No. 2). Before starting the reaction, it is necessary to defrost all the reaction components, shake them on a shaker, then centrifuge for several seconds in a low-speed centrifuge.

The reaction mixture for RT-PCR is prepared in a test tube per reaction (V = 25 μl) as follows:

- ready-made PCR mixture No. 1 20 μl, - enzyme Taq-DNA polymerase No. 2 0.25 μl, - isolated DNA (including negative control No. 3 and positive control No. 4) 5 μl.

Deionized water is used as a negative control, and sheeppox virus DNA is used as a positive control.

The PCR reaction mixture prepared in separate test tubes is transferred by 20 μl into test tubes of the corresponding volume and 5 μl of total DNA is added. The isolated DNA samples of the negative and positive controls are also added to the corresponding samples. The total volume of the mixture is 25 μl.

The tubes are placed in the thermocycler for setting the RT-PCR, the location and characteristics of the samples are noted in the program, the working dye (FAM) is selected, and the temperature-time profile of the reaction is set in the program.

The cycler is programmed according to the manufacturer's instructions. The thermal profile mode should correspond to the indicators described in Table 1.

Samples are considered positive if the Ct value in the sample is <35, which indicates the presence of the sheeppox virus genome. Samples are considered negative if C _t values are not determined / recorded.

If the value of the threshold cycle Ct is in the range from 35 to 37, the result of the detection of the sheeppox virus genome is considered doubtful and should be re-examined. If, when conducting a second study, the Ct value is <37, the result of detecting the sheeppox virus genome is considered positive; if the Ct value is not recorded (no value) or Ct> 37, the detection result of the sheeppox virus genome is considered negative.

The result is considered reliable only if:

- for a positive control with an amplifier on the FAM channel, the value of the amplification threshold cycle is recorded - Ct <35;

- for negative control, the amplifier does not register any value of the threshold cycle on the FAM channel.

The result is considered invalid (not subject to accounting) if:

- for a positive control sample, a Ct value> 35 is recorded;

- any Ct value is recorded for the negative control sample.

The proposed test system developed by the FGBI ARRIAH for identification of the sheeppox virus genome is new and industrially applicable. The test system is created through the design and selection of primers, the layout of the components of the test system, laboratory assessment of the main characteristics and the sharing of information contained in the prior art, as well as the general knowledge of the specialist in the field of biotechnology.

The essence of the invention is illustrated by examples of its use, which do not limit the scope of the invention.

Example 1. Evaluation of the specificity of the test system.

To assess the specificity of the test system, the following DNA samples of the genome of reference homologous and heterologous viruses, as well as the DNA of field isolates of sheep pox virus, ecthyma and infectious nodular dermatitis detected in the Russian Federation in the period 2015-2019, were used. The results of the specificity assessment are presented in Table 2.

Table 2 shows that the test system for detecting the sheeppox virus genome shows high specificity when tested with genetic material from sheeppox viruses of various geographic origins, as well as heterologous cattle and MRS viruses.

The work with DNA was carried out under the conditions regulated by MU 1.3.2569-09 "Organization of the work of laboratories using methods of amplification of nucleic acids when working with material containing microorganisms of I-IV pathogenicity groups".

The procedure for DNA isolation from the test material was carried out using a set of reagents based on membrane columns.

Real-time PCR was carried out in a reaction mixture of the following composition (for 1 study):

- ready-made PCR mixture No. 1 20 μl, - enzyme Taq-DNA polymerase No. 2 0.25 μl, - isolated DNA (including negative control No. 3 and positive control No. 4) 5 μl.

Real-time PCR and registration of results were carried out in an RT-PCR device according to the program described above.

The results were interpreted on the basis of the presence (or absence) of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which corresponds to the presence (or absence) of the Ct value in the corresponding column in the table of results. The result was considered positive if the fluorescence accumulation curve for the corresponding sample had a characteristic "sigmoid" shape and crossed the threshold line (Table 3).

When testing the specificity of the test system using DNA of homologous and heterologous viruses, false positive and false negative results were not detected.

Example 2. Evaluation of the sensitivity of the test system.

To assess the sensitivity of the test system for detecting the genome of the sheeppox virus by the method of polymerase chain reaction in real time, we used the DNA of the sheeppox virus (strain "ARRIAH") with a titer of infectious activity in the cell culture YaDK-04 5.5 lg TCD ₅₀ / cm ³ ... The results obtained showed that the test system detected viral DNA with a sensitivity of 0.05 lg TCD ₅₀ / cm ³ . To evaluate the efficiency of amplification, 3 repeated experiments were carried out. The obtained Ct values were used to calculate the efficiency. As a result, a linear regression was built with an amplification efficiency (E) of 94.84%. The data obtained are shown in a graphical representation (Fig. 1).

Example 3. Evaluation of the reproducibility of the test system.

The reproducibility of the test system for detecting the sheeppox virus genome by real-time polymerase chain reaction was determined using the standard deviation (SD) of the Ct value obtained for each series of dilutions. SD ranged from 0.01 to 0.24 over six 10-fold dilutions. The coefficient of determinism r ² was 0.9987.

Thus, the invention can be used in veterinary practice to detect the genetic material of the sheep pox virus in biological samples; for the purpose of setting and clarifying the diagnosis; for solving research problems; studying the monitoring of the spread of sheeppox virus among susceptible animals. The use of specific primers and a probe makes it possible to identify the genetic material of all circulating genetic variants of sheeppox virus by the method of polymerase chain reaction (PCR) in real time (RT).

Sources of information taken into account in the preparation of the description of the invention to the application for the grant of a patent of the Russian Federation for the invention "Test system for detecting the genome of sheeppox virus by the method of polymerase chain reaction in real time."

1. Konstantinov A.V., Starov S.K., Diev V.I. other. Antigenic and protective activity of the associated virus vaccine against sheep pox, goat pox and plague of small ruminants // Veterinary today, 2017. No. 3 (22). S. 28-32.

2. Nurgaziev RZ, Otorova AA, Akmatova EK, Nurgazieva AR .. Issues of biosafety when working with sheep pox virus in laboratory and field conditions / Bulletin of the Kyrgyz National Agrarian University. K.I. Scriabin. 2017. No. 3 (44). S. 96-102.

3. Order No. 24 on the approval of veterinary rules for the implementation of preventive, diagnostic, restrictive and other measures, the establishment and cancellation of quarantine and other restrictions aimed at preventing the spread and elimination of foci of sheep and goat pox dated January 23, 2018.

4. Guidelines for diagnostic tests and vaccines for terrestrial animals. OIE. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 2017.

5. Patent: CN105331742 (A) - Multiplex-PCR (polymerase chain reaction) kit for detecting six viruses of sheep and goats simultaneously

6. Patent: RU 2658493 - Oligonucleotide primers and fluorescently-labeled probe, real-time PCR method and test system for detecting capripoxvirus genome

7. Patent: CN 103276111 - Kit used for detecting sheep pox virus and detection method thereof

Claims (6)

1. A test system for detecting the sheeppox virus genome by real-time PCR, including a ready-made PCR mixture containing oligonucleotide primers and a fluorescently labeled probe, for amplification and detection of a fragment of the ORF131-ORF132 genome using specific primers and a probe: Forward TCGCATATGGAATTATCGGAAT Reverse GATTTGACAAACACGTGTACAAA probe FAM ACGAACATTTTTCCCTCTAAGCTACTTTAC BHQ1, enzyme Taq-DNA polymerase, positive control, negative control; moreover, carried out PCR-RT consists of the following stages: initial denaturation at 95 ° C for 10 min and thermal cycling at 95 ° C - 15 s, 60 ° C - 60 s - 40 cycles; the sample is considered positive for the presence of the sheeppox virus genome if the value of Ct≤35; the sample is considered negative for the presence of the virus genome if the value of Ct≥37, however, if the value of Ct is in the range from 35 to 37, the result of the detection of the genome of the sheeppox virus is considered doubtful and should be re-examined, and if, during the re-test, the recorded value of Ct < 37, the result of the detection of the sheeppox virus genome is considered positive and the sample is considered negative for the presence of the sheeppox virus genome if its Ct value is absent or more than 37. 2. The test system according to claim 1, characterized in that it has a sensitivity of 0.05 lg TCD ₅₀ / cm ³ , which makes it possible to detect and identify the sheep pox virus genome in an expanded spectrum of biological material.

Images