RU2658493C1

RU2658493C1 - Oligonucleotide primers and fluorescence-labelled probe, method and test system of pcr in real time for detecting capripoxviruses genome

Info

Publication number: RU2658493C1
Application number: RU2017130118A
Authority: RU
Inventors: Александр Владимирович Спрыгин; Александр Владимирович Кононов; Ольга Петровна Бьядовская; Екатерина Евгеньевна Артюхова; Евгения Сергеевна Кострова; Александр Александрович Нестеров; Ирина Николаевна Шумилова
Priority date: 2017-08-24
Filing date: 2017-08-24
Publication date: 2018-06-21

Abstract

FIELD: veterinary science; virology.

SUBSTANCE: invention relates to veterinary virology, namely, to molecular diagnostics. Oligonucleotide primers and a fluorescently-labelled probe were developed to amplify and detect a fragment of the P32 gene of capripoxviruses: CaPV_f_new – 5' ATGAAACCAATGGATGGGATA 3'; CaPV_R_new – 5' CGAAATGAAAAACGGTATATGGA 3'; CaPV_probe – 5' ATGAGCCATCCATTTTCCAA 3'. Method for detecting the genome of capripoxviruses using primers and a probe and a real-time PCR test system are also proposed. For carrying out PCR-RV, amplification of a fragment of the P32 protein gene is used. Highly sensitive kit consisting of a ready-made PCR mixture, Taq-DNA polymerase, positive control and negative control was developed, which makes it possible to identify the genome of capripoxviruses as soon as possible.

EFFECT: invention can be used in veterinary medicine, clinical and laboratory diagnostics to detect the DNA of capripoxviruses in samples of a wide range of pathological and biomaterial.

3 cl, 3 ex, 1 dwg

Description

Изобретение относится к ветеринарной вирусологии, к средствам молекулярной диагностики, а именно к выявлению генома каприпоксвирусов в реакции полимеразной цепной реакции в режиме реального времени (ПЦР-РВ).The invention relates to veterinary virology, to molecular diagnostics, namely, to identify the genome of capricoxviruses in a real-time polymerase chain reaction (PCR-RV).

Заболевания, вызываемые возбудителями, относящимися к роду Capripoxvirus (оспа овец, оспа коз, заразный узелковый дерматит крупного рогатого скота), в соответствии с классификацией МЭБ относятся к категории особо опасных инфекционных болезней, подлежащих обязательной нотификации, способны вызывать эпизоотии и наносить огромный экономический ущерб животноводству, слагающийся из гибели и вынужденного убоя больных животных, снижения продуктивности, абортов, затрат на проведение ветеринарно-санитарных и охранно-карантинных мероприятий [1, 2].Diseases caused by pathogens belonging to the genus Capripoxvirus (sheep pox, goat pox, infectious nodular dermatitis in cattle), according to the OIE classification, are classified as highly dangerous infectious diseases that must be notified, can cause epizootics and cause enormous economic damage to livestock , consisting of the death and forced slaughter of sick animals, reduced productivity, abortion, the cost of veterinary and sanitary and quarantine measures [1, 2].

В настоящее время данные заболевания регистрируются на всех континентах, за исключением Австралии и Океании. Напряженная ситуация остается в странах СНГ Среднеазиатского и Кавказского регионов (Казахстан, Таджикистан, Киргизия, Азербайджан, Грузия), которые представляют наибольшую угрозу для Российской Федерации в отношении заноса возбудителей болезней, так как со многими из них имеется общая граница и тесные экономические связи. В РФ оспа мелких жвачных животных периодически возникает на Дальнем Востоке, а в 2015 году была зарегистрирована вспышка заболевания в Северно-Кавказском регионе РФ [3]. Кроме того, в 2015 году в Российскую Федерацию было занесено новое заболевание - нодулярный дерматит крупного рогатого скота, и наблюдаются тенденции к его распространению [4]. Массовое распространение каприпоксвирусов на территории РФ в 2015-2016 гг. [5] требует разработки высокочувствительных методов диагностики данных заболеваний, позволяющих проводить мониторинг среди латентно-инфицированных восприимчивых животных и в кратчайшие сроки выявлять вирусоносительство с целью применения мер для предотвращения и борьбы с каприпоксвирусами.Currently, these diseases are recorded on all continents, with the exception of Australia and Oceania. The tense situation remains in the CIS countries of the Central Asian and Caucasian regions (Kazakhstan, Tajikistan, Kyrgyzstan, Azerbaijan, Georgia), which pose the greatest threat to the Russian Federation with respect to the introduction of pathogens, since many of them have a common border and close economic ties. In the Russian Federation, smallpox of small ruminants periodically occurs in the Far East, and in 2015, an outbreak of the disease was recorded in the North Caucasus region of the Russian Federation [3]. In addition, in 2015, a new disease was introduced into the Russian Federation - nodular dermatitis in cattle, and there are tendencies for its spread [4]. Mass distribution of capricoxviruses on the territory of the Russian Federation in 2015-2016 [5] requires the development of highly sensitive diagnostic methods for these diseases, allowing monitoring among latently infected susceptible animals and detecting virus carriers as soon as possible in order to apply measures to prevent and control capricoxviruses.

Известен способ диагностики каприпоксвирусов вирусологическим методом, основанном на культивировании возбудителя на чувствительных клеточных культурах, в результате роста которого в культуре клеток проявляется цитопатический эффект от вируса [6]. Недостатками данного метода являются: длительность постановки, трудоемкость и необходимость использования биологических моделей, таких как культуры клеток.A known method for the diagnosis of capricoxviruses by the virological method, based on the cultivation of the pathogen in sensitive cell cultures, the growth of which in the cell culture manifests a cytopathic effect from the virus [6]. The disadvantages of this method are: the duration of the formulation, the complexity and the need to use biological models, such as cell cultures.

Известен способ детекции антигена поксвирусов с помощью иммунодиффузии в геле. Недостатком данного метода является кросс-реактивность с антителами к другим поксвирусам, невозможность отличить каприпоксвирусы от вируса эктимы овец [6].A known method for detecting poxvirus antigen by immunodiffusion in a gel. The disadvantage of this method is cross-reactivity with antibodies to other poxviruses, the inability to distinguish capricoxviruses from sheep ectima virus [6].

Известен способ выявления каприпоксвирусов с помощью электронной микроскопии. Недостатком данного метода является невозможность морфологически отличить вирионы каприпоксвиурсов от ортопоксвирусов [7].A known method for detecting capricoxviruses using electron microscopy. The disadvantage of this method is the inability to morphologically distinguish between capripoxviruses virions and orthopoxviruses [7].

Известен способ выявления вирусных частиц каприпоксвирусов с помощью иммуногистохимиии. Недостатком данного способа является высокая трудоемкость и необходимость получения моноклональных антител [8].A known method for detecting viral particles of capricoxviruses using immunohistochemistry. The disadvantage of this method is the high complexity and the need to obtain monoclonal antibodies [8].

Известен способ выявления генома каприпоксвирусов с помощью классической ПЦР на основе поверхностного белка прикрепления [9]. Недостатком метода является то, что существует риск перекрестной контаминации ввиду необходимости проведения электрофореза для анализа продуктов реакции.A known method for detecting the genome of capricoxviruses using classical PCR based on surface protein attachment [9]. The disadvantage of this method is that there is a risk of cross-contamination due to the need for electrophoresis to analyze reaction products.

Наиболее близким к заявленному изобретению является тест-система «Lumpy Skin Disease, Sheeppox virus, Goatpox virus Real Time PCR Kit» (Liveriver, Китай) [10]. Однако согласно инструкции производителя для данной тест-системы для исследования пригодны только соскобы с нодул, содержимое нодул, лимфоузлы и тканевые поражения. К тому же реакцию можно проводить на ограниченном перечне амплификаторов.Closest to the claimed invention is a test system "Lumpy Skin Disease, Sheeppox virus, Goatpox virus Real Time PCR Kit" (Liveriver, China) [10]. However, according to the manufacturer's instructions, only scrapings from the nodule, contents of the nodules, lymph nodes, and tissue lesions are suitable for the study for this test system. In addition, the reaction can be carried out on a limited list of amplifiers.

Таким образом, технической проблемой является разработка надежного, с возможностью исследования широкого спектра биологического материала, чувствительного и специфичного количественного способа обнаружения генома каприпоксвирусов методом полимеразной цепной реакции в режиме реального времени путем конструирования набора, содержащего специфичные олигонуклеотидные праймеры и ДНК-зонд, а также подбора условий для проведения ПЦР, обеспечивающего минимальный риск контаминации при исследовании и исключающего субъективность при оценке результатов.Thus, a technical problem is the development of a reliable, with the possibility of researching a wide range of biological material, sensitive and specific quantitative method for detecting capripoxvirus genome by polymerase chain reaction in real time by constructing a kit containing specific oligonucleotide primers and a DNA probe, as well as selecting conditions for PCR, which provides a minimal risk of contamination in the study and eliminates subjectivity in the assessment e results.

Изобретение касается тест-системы, состоящей из олигонуклеотидных праймеров и флуоресцентно-меченого зонда для специфичной экспресс-идентификации генома каприпоксвирусов методом ПЦР-РВ. Представленный метод включает последовательности олигонуклеотидов, родоспецифичные для каприпоксвирусов и имеющие следующую нуклеотидную последовательность:The invention relates to a test system consisting of oligonucleotide primers and a fluorescently-labeled probe for specific rapid identification of the genome of capricox viruses by PCR-RV. The presented method includes oligonucleotide sequences genus-specific for capripox viruses and having the following nucleotide sequence:

В качестве источника флуоресценции на 5'-конце зонда применяют краситель FAM, а для тушения флуоресценции на 3'-конце - BHQ1. Флуоресценцию измеряют по каналу FAM. Пересечение кривой флуоресценции линии threshold свидетельствует о наличии в образце генома каприпоксвируса, причем чем меньше показатель «Ct», тем выше количество генома каприпоксвируса в исследуемом образце. Отсутствие пересечения кривой флуоресценции линии threshold свидетельствует об отсутствии генома каприпоксвируса в исследуемом материале.FAM dye is used as a source of fluorescence at the 5'-end of the probe, and BHQ1 is used to quench fluorescence at the 3'-end. Fluorescence is measured by the FAM channel. The intersection of the fluorescence curve of the threshold line indicates the presence of a capripoxvirus genome in the sample, and the lower the "Ct" indicator, the higher the amount of capripoxvirus genome in the test sample. The absence of an intersection of the fluorescence curve of the threshold line indicates the absence of the capricoxvirus genome in the test material.

Изобретение может быть использовано в ветеринарии, клинической и лабораторной диагностике для выявления ДНК каприпоксвирусов в пробах патологического и биоматериала.The invention can be used in veterinary medicine, clinical and laboratory diagnostics to detect capripox viruses in samples of pathological and biomaterial.

Техническим результатом изобретения является: расширенный спектр биологического материала (внутренние органы, нодулы, сыворотка крови, цельная кровь, культура клеток), пригодного для проведения исследований без возможности получения ложноположительных результатов; возможность использования широкого спектра амплификаторов, отвечающих минимальным требованиям для постановки ПЦР; сокращение времени для проведения массовых исследований проб на наличие генома каприпоксвирусов.The technical result of the invention is: an expanded spectrum of biological material (internal organs, nodules, blood serum, whole blood, cell culture) suitable for research without the possibility of obtaining false-positive results; the possibility of using a wide range of amplifiers that meet the minimum requirements for PCR; reduction of time for conducting mass studies of samples for the presence of capricoxvirus genome.

Сущность изобретения состоит в том, что при помощи указанных праймеров (CaPV_f_new, CaPV_R_new) и зонда (CaPV_probe) проводят ПЦР-РВ для выявления генома каприпоксвирусов. В качестве мишени выбран фрагмент гена, кодирующий поверхностный белок Р32, который консервативен для всех каприпоксвирусов. Высокая степень консервативности гена подтверждена сравнением опубликованных в настоящее время последовательностей каприпоксвирусов с аналогичными нуклеотидными последовательностями других каприпоксвирусов (база данных GenBank), а также с помощью лабораторных исследований.The essence of the invention lies in the fact that using these primers (CaPV_f_new, CaPV_R_new) and a probe (CaPV_probe), PCR-RV is performed to detect the capripox viruses genome. As a target, a gene fragment encoding the surface protein P32, which is conservative for all capricox viruses, was selected. A high degree of gene conservatism is confirmed by comparing the currently published capripoxvirus sequences with similar nucleotide sequences of other capripoxviruses (GenBank database), as well as using laboratory tests.

Сущность изобретения пояснена на графическом изображении, на котором представлена линейность результатов ПЦР-РВ при тестировании 10-кратных разведений выделенной ДНК вируса заразного узелкового дерматита, оспы овец или оспы коз.The essence of the invention is illustrated in the graphic image, which shows the linearity of the results of PCR-RV when testing 10-fold dilutions of the isolated DNA of the virus of infectious nodular dermatitis, smallpox of sheep or smallpox of goats.

Детекция продуктов амплификации осуществляется методом регистрации флуоресценции, генерируемой в результате разрушения гибридизационного зонда, с красителем FAM на 5'-конце и гасителем BHQ1 на 3'-конце. В отсутствии мишени краситель и гаситель сближены, и наблюдается лишь незначительная флуоресценция, так как гаситель поглощает испускаемое красителем излучение. При накоплении в ходе ПЦР специфических продуктов зонд гибридизируется на ампликон, что ведет к его разрушению за счет 5'-экзонуклеазной активности Taq-полимеразы. В результате флуорофор отделяется от гасителя, и его излучение может быть детектировано. Таким образом, увеличение флуоресценции прямо пропорционально количеству синтезированного ПЦР-продукта.The amplification products are detected by recording the fluorescence generated as a result of the destruction of the hybridization probe, with a FAM dye at the 5'-end and a BHQ1 quencher at the 3'-end. In the absence of a target, the dye and the quencher are close, and only slight fluorescence is observed, since the quencher absorbs the radiation emitted by the dye. When specific products are accumulated during PCR, the probe hybridizes to an amplicon, which leads to its destruction due to the 5'-exonuclease activity of Taq polymerase. As a result, the fluorophore is separated from the quencher, and its radiation can be detected. Thus, the increase in fluorescence is directly proportional to the amount of synthesized PCR product.

Праймеры и зонды комплементарны консервативной области гена, кодирующего поверхностный белок Р32, и не комплементарны каким-либо участкам генома других поксвирусов.Primers and probes are complementary to the conserved region of the gene encoding the P32 surface protein, and are not complementary to any parts of the genome of other poxviruses.

Для разработки праймеров из базы данных GenBank были получены полногеномные последовательности каприпоксвирусов. Последовательности выравнивали с помощью программы Bioedit, затем визуально оценивали консервативные участки, на основе которых были получены ряд праймеров. В результате тестирования при различных параметрах была получена оптимальная пара праймеров и зонда, которая используется в тест-системе.For the development of primers from the GenBank database, genome sequences of capripox viruses were obtained. The sequences were aligned using the Bioedit program, then conservative sites were visually evaluated, based on which a number of primers were obtained. As a result of testing for various parameters, an optimal pair of primers and probe was obtained, which is used in the test system.

Набор для выявления генома каприпоксвирусов в ПЦР-РВ состоит из следующих компонентов:The kit for detection of capricoxvirus genome in PCR-RV consists of the following components:

№1 - готовая ПЦР-смесь, объем 550 мкл - 2 пробирки;No. 1 - finished PCR mixture, volume 550 μl - 2 tubes;

№2 - фермент Taq-ДНК-полимераза, объем 12,5 мл - 1 пробирка;No. 2 - Taq-DNA polymerase enzyme, volume 12.5 ml - 1 tube;

№3 - положительный контрольный образец, объем 100 мкл - 1 пробирка;No. 3 - positive control sample, volume 100 μl - 1 tube;

№4 - отрицательный контрольный образец, объем 100 мкл - 1 пробирка.No. 4 - negative control sample, volume 100 μl - 1 tube.

ПЦР-РВ проводится в одну стадию с использованием готовой ПЦР-смеси (№1), включающей на одну реакцию буфер 5х для ПЦР-РВ (5 мкл), 25 мМ хлорид магния (3,5 мкл), дезоксирибонуклеотидтрифосфаты (0,5 мкл 10 пмоль), олигонуклеотидные праймеры (1,5 мкл каждого праймера 10 пмоль), зонд (0,8 мкл 5 пмоль) и фермент Taq-ДНК-полимеразу в программируемом амплификаторе. Перед началом постановки реакции необходимо разморозить все необходимые компоненты реакции, встряхнуть на шейкере, затем центрифугировать несколько секунд на низкоскоростной центрифуге.PCR-RV is carried out in one step using the finished PCR mixture (No. 1), which includes 5x PCR-PB buffer (5 μl), 25 mM magnesium chloride (3.5 μl), deoxyribonucleotide triphosphates (0.5 μl) for one reaction 10 pmol), oligonucleotide primers (1.5 μl of each primer 10 pmol), probe (0.8 μl of 5 pmol) and Taq DNA polymerase enzyme in a programmable amplifier. Before starting the reaction, it is necessary to defrost all the necessary components of the reaction, shake on a shaker, then centrifuge for several seconds in a low-speed centrifuge.

Реакционную смесь для проведения ПЦР-РВ готовят в пробирке в расчете на одну реакцию (V=25 мкл) следующим образом:The reaction mixture for PCR-RV is prepared in vitro per reaction (V = 25 μl) as follows:

- готовая ПЦР-смесь №1 - 20 мкл,- finished PCR mixture No. 1 - 20 μl,

- фермент Taq-ДНК-полимераза №2 - 0,25 мкл,the enzyme Taq-DNA polymerase No. 2 - 0.25 μl,

- выделенная ДНК (отриц. контроль №3 или полож. контроль №4) - 5 мкл.- isolated DNA (negative control No. 3 or positive control No. 4) - 5 μl.

Приготовленную в отдельных 1,5 мл пробирках реакционную ПЦР-смесь переносят в 0,2 мл пробирки по 20 мкл и вносят 5 мкл суммарной ДНК. В соответствующие пробы вносят также выделенные образцы ДНК, отрицательного и положительного контролей. Общий объем смеси - 25 мкл.Prepared in separate 1.5 ml tubes, the PCR reaction mixture is transferred to 0.2 ml tubes of 20 μl and 5 μl of total DNA are added. Isolated DNA samples, negative and positive controls are also added to the appropriate samples. The total volume of the mixture is 25 μl.

Устанавливают пробирки в амплификатор для постановки ПЦР-РВ, отмечают в программе расположение и характеристику проб, выбирают рабочий краситель (FAM), устанавливают в программе температурно-временной профиль реакции.Set the tubes in the amplifier for the PCR-RV formulation, note the location and characteristics of the samples in the program, select a working dye (FAM), and set the temperature-time profile of the reaction in the program.

После первоначальной денатурации при 95°C в течение 10 мин ПЦР-РВ проводят в следующих условиях: 95°C - 15 с, 60°C - 60 с - 45 циклов.After initial denaturation at 95 ° C for 10 min, PCR-RV is carried out under the following conditions: 95 ° C - 15 s, 60 ° C - 60 s - 45 cycles.

Результаты интерпретируют на основании наличия или отсутствия пересечения кривой флуоресценции с пороговой линией, что соответствует наличию или отсутствию значения порогового цикла «Ct» в соответствующей графе в таблице результатов реакции, выведенной в результате машинного анализа.The results are interpreted based on the presence or absence of the intersection of the fluorescence curve with the threshold line, which corresponds to the presence or absence of the threshold cycle value "Ct" in the corresponding column in the table of reaction results derived from machine analysis.

Результат считается достоверным только в случае прохождения положительного (Ct<35) и отрицательного (Ct не определен) контролей амплификации.The result is considered reliable only in the case of passing the positive (Ct <35) and negative (Ct not determined) amplification controls.

Образец считается положительным на наличие ДНК каприпоксвируса, если значение Ct не более 35. Однако в случае, если значение Ct для проб находится в пределах от 30 до 35, необходимо повторить реакцию с целью подтвердить или опровергнуть наличие ДНК вируса в исследуемой пробе.The sample is considered positive for the presence of capripoxvirus DNA if the Ct value is not more than 35. However, if the Ct value for the samples is in the range from 30 to 35, it is necessary to repeat the reaction in order to confirm or deny the presence of virus DNA in the test sample.

Образец считается отрицательным на наличие ДНК вируса, если для него значение Ct отсутствует или более 37.A sample is considered negative for the presence of virus DNA if there is no Ct value or more than 37 for it.

Результаты не подлежат учету (считаются недействительными):The results are not subject to accounting (considered invalid):

- в случае отсутствия регистрации роста флуоресценции в пробе с положительным контролем, что может свидетельствовать об ошибках, допущенных на этапе постановки ПЦР-РВ;- in the absence of registration of fluorescence growth in the sample with positive control, which may indicate errors made at the stage of PCR-RV;

- в случае регистрации значения Ct в таблице результатов на экране компьютера для отрицательного контрольного образца, что указывает на наличие контаминации.- if the Ct value is recorded in the table of results on the computer screen for a negative control sample, which indicates the presence of contamination.

В любом из этих случаев необходимо повторить анализ всех проб, а при повторном выявлении контаминации отрицательного контроля - принять меры по выявлению и ликвидации источника контаминации.In any of these cases, it is necessary to repeat the analysis of all samples, and when re-identifying the contamination of the negative control, take measures to identify and eliminate the source of contamination.

Сущность предлагаемого изобретения пояснена примерами его использования, которые не ограничивают объем изобретения.The essence of the invention is illustrated by examples of its use, which do not limit the scope of the invention.

Пример 1. Оценка специфичности тест-системыExample 1. Assessment of the specificity of the test system

Для оценки специфичности тест-системы использовались следующие образцы гетерологичных вирусов, депонированных в коллекции штаммов микроорганизмов ФГБУ «ВНИИЗЖ»: ДНК вируса заразного узелкового дерматита штамма ВНД КРС/Дагестан/2015 (диагностический), ДНК вируса заразного узелкового дерматита штамма НД КРС Э-95, ДНК вакцинного штамма Neethling, ДНК вируса оспы овец штамма «Афганский», ДНК вируса оспы овец вакцинного штамма «ВНИИЗЖ», ДНК вируса оспы коз штамма «Приморский 2003», ДНК вируса оспы коз штамма «ВНИИЗЖ 2003», ДНК вируса чумы мелких жвачных штамма «ВНИИЗЖ», ДНК вируса везикулярного стоматита штамма «ВНИИЗЖ», ДНК вируса оспы коров штамма «ВНИИЗЖ».To assess the specificity of the test system, the following samples of heterologous viruses were deposited in the collection of microorganism strains of the Federal State Budget Scientific Institution VNIIZZH: DNA of the virus of infectious nodular dermatitis of the GNI strain of cattle / Dagestan / 2015 (diagnostic), DNA of the virus of infectious nodular dermatitis of the strain ND of cattle ND E-95, DNA of vaccine strain Neethling, DNA of smallpox virus of sheep vaccine strain "Afghan", DNA of smallpox virus of sheep vaccine strain "ARRIAH", DNA of virus of smallpox goat virus of strain "Primorsky 2003", DNA of smallpox virus of goat virus of strain "ARRIAH 2003", DNA of small-ruminant plague virus strain "ARRIAH" DNA vesicular stomatitis virus strain "ARRIAH" cowpox virus DNA strain "ARRIAH".

Работу с ДНК проводили в условиях, регламентированных Методическими указаниями МУ 1.3. 2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности [11].Work with DNA was carried out under the conditions regulated by the Methodological Instructions of MU 1.3. 2569-09 “Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of pathogenicity groups I-IV [11].

Процедуру выделения ДНК из исследуемого материала проводили с использованием набора реагентов на основе мембранных колонок.The procedure for DNA extraction from the test material was carried out using a set of reagents based on membrane columns.

ПЦР-РВ проводили в реакционной смеси следующего состава (на 1 исследование):PCR-RV was carried out in the reaction mixture of the following composition (for 1 study):

- готовая ПЦР-смесь №1 -20 мкл,- finished PCR mixture No. 1 -20 μl,

ПЦР-РВ и регистрацию результатов проводили в амплификаторе согласно термическому профилю, описанному выше.PCR-RV and registration of the results was carried out in a thermocycler according to the thermal profile described above.

Результаты интерпретировали на основании наличия (или отсутствия) пересечения кривой флуоресценции с установленной на соответствующем уровне пороговой линии, что соответствует наличию (или отсутствию) значения порогового цикла Ct в соответствующей графе в таблице результатов. Результат считали положительным в случаи, если кривая накопления флуоресценции для соответствующего образца имела характерную «сигмовидную» форму и пересекала пороговую линию.The results were interpreted based on the presence (or absence) of the intersection of the fluorescence curve with the threshold line set at the corresponding level, which corresponds to the presence (or absence) of the threshold cycle Ct in the corresponding column in the results table. The result was considered positive if the fluorescence accumulation curve for the corresponding sample had a characteristic "sigmoid" shape and crossed the threshold line.

При тестировании специфичности тест-системы с использованием ДНК гомологичных и гетерологичных вирусов ложноположительных результатов с вирусами, не входящими в род Capripoxvirus, не выявлено.When testing the specificity of the test system using DNA of homologous and heterologous viruses, false-positive results with viruses not belonging to the genus Capripoxvirus were not detected.

Пример 2. Оценка чувствительности и эффективности тест-системыExample 2. Assessment of the sensitivity and effectiveness of the test system

Для оценки чувствительности использовали ДНК вируса заразного узелкового дерматита штамма ВНД КРС/Дагестан/2015 (диагностический) с титром 6,17. Метод ПЦР-РВ выявлял ДНК с чувствительностью 0,17 lg/мл. Для оценки эффективности амплификации было проведено 3 повторных эксперимента и получены значения Ct, которые использовались для вычисления эффективности. С помощью средних значений Ct была получена линейная регрессия со значением эффективности амплификации (Е) 90,2%. Полученные данные приведены на графическом изображении.To assess the sensitivity, the DNA of the virus of infectious nodular dermatitis of the GNI strain of cattle / Dagestan / 2015 (diagnostic) with a titer of 6.17 was used. The PCR-RV method detected DNA with a sensitivity of 0.17 lg / ml. To evaluate the amplification efficiency, 3 repeated experiments were carried out and Ct values were obtained, which were used to calculate the efficiency. Using average Ct values, a linear regression was obtained with an amplification efficiency (E) value of 90.2%. The data obtained are shown in a graphic image.

Пример 3. Оценка воспроизводимости тест-системыExample 3. Evaluation of the reproducibility of the test system

Воспроизводимость определяли с помощью величины стандартного отклонения (SD) для каждой серии разведений, используя полученные значения Ct. Стандартное отклонение SD варьировало от 0,12 до 0,32 на протяжении 6 10-кратных разведений.Reproducibility was determined using the standard deviation (SD) for each dilution series using the obtained Ct values. SD standard deviation ranged from 0.12 to 0.32 over 6 10-fold dilutions.

Таким образом, изобретение может быть использовано в ветеринарной практике для выявления генетического материала каприпоксвирусов в биологических и культуральных образцах для постановки и уточнения диагноза, для решения научно-исследовательских задач по мониторингу распространения каприпоксвирусов среди восприимчивых и латентно-инфицированных животных. Использование специфических праймеров и зонда позволяет выявить генетический материал каприпоксвирусов в исследуемых образцах методом полимеразной цепной реакции (ПЦР) в режиме реального времени (РВ).Thus, the invention can be used in veterinary practice to identify the genetic material of capripoxviruses in biological and cultural samples for making and clarifying the diagnosis, for solving research problems in monitoring the spread of capripoxviruses among susceptible and latently infected animals. The use of specific primers and a probe makes it possible to identify the genetic material of capripox viruses in the studied samples by the method of polymerase chain reaction (PCR) in real time (RV).

Источники информации, принятые во внимание при составлении описания изобретения к заявке на выдачу патента РФ на изобретение «Олигонуклеотидные праймеры и флуоресцентно-меченый зонд, способ и тест-система ПЦР в режиме реального времени для выявления генома каприпоксвирусов»Sources of information taken into account when drawing up the description of the invention to the application for the grant of a patent of the Russian Federation for the invention “Oligonucleotide primers and fluorescently-labeled probe, real-time PCR method and test system for detecting capripox viruses genome”

1. Beard, P.M. Lumpy skin disease: a direct threat to Europe // Vet Rec., 2016, v. 28, p. 557-558.1. Beard, P.M. Lumpy skin disease: a direct threat to Europe // Vet Rec., 2016, v. 28, p. 557-558.

2. Tuppurainen ES, Venter EH, Shisler JL, Gari G, Mekonnen GA, Juleff N, Lyons NA, De Clercq K, Upton C, Bowden TR, Babiuk S, Babiuk LA. Capripoxvirus Diseases: Current Status and Opportunities for Control // Transbound Emerg Dis., 2015.2. Tuppurainen ES, Venter EH, Shisler JL, Gari G, Mekonnen GA, Juleff N, Lyons NA, De Clercq K, Upton C, Bowden TR, Babiuk S, Babiuk LA. Capripoxvirus Diseases: Current Status and Opportunities for Control // Transbound Emerg Dis., 2015.

3. http://www.fsvps.ru/fsvps/print/news/15919.html.3.http: //www.fsvps.ru/fsvps/print/news/15919.html.

4. Бирюченкова M.В., Тимина A.M., Зиняков H.Г., Щербаков A.B. Результаты генодиагностики нодулярного дерматита в Дагестане и Чеченской Республике - первое официальное подтверждение болезни на территории Российской Федерации // Ветеринария сегодня. - 2015. - №4. - С. 43-45.4. Biryuchenkova M.V., Timina A.M., Zinyakov H.G., Shcherbakov A.B. Genodiagnostic results of nodular dermatitis in Dagestan and the Chechen Republic - the first official confirmation of the disease in the Russian Federation // Veterinary medicine today. - 2015. - No. 4. - S. 43-45.

5. Кононов А.В., Кононова С.В., Шумилова И.Н. [и др.] Культурально-биологические свойства возбудителя нодулярного дерматита крупного рогатого скота, выделенного на территории Российской Федерации в 2015 году: научное издание // Ветеринария сегодня. - 2016. - №3. - С. 8-18.5. Kononov A.V., Kononova S.V., Shumilova I.N. [and others] Cultural and biological properties of the causative agent of nodular dermatitis in cattle isolated on the territory of the Russian Federation in 2015: scientific publication // Veterinary Medicine today. - 2016. - No. 3. - S. 8-18.

6. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.4.13 // Lumpy skin disease. 2017.6. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals. Chapter 2.4.13 // Lumpy skin disease. 2017.

7. Kitching RP, Smale C. Comparison of the external dimensions of capripoxvirus isolates // Res Vet Sci. – 1986. - 41(3) - Р. 425-427.7. Kitching RP, Smale C. Comparison of the external dimensions of capripoxvirus isolates // Res Vet Sci. - 1986.- 41 (3) - R. 425-427.

8. Babiuk S1, Parkyn G, Copps J, Larence JE, Sabara MI, Bowden TR, Boyle DB, Kitching RP. Evaluation of an ovine testis cell line (OA3.Ts) for propagation of capripoxvirus isolates and development of an immunostaining technique for viral plaque visualization // J Vet Diagn Invest. 2007. - 19(5). - p. 486-491.8. Babiuk S1, Parkyn G, Copps J, Larence JE, Sabara MI, Bowden TR, Boyle DB, Kitching RP. Evaluation of an ovine testis cell line (OA3.Ts) for propagation of capripoxvirus isolates and development of an immunostaining technique for viral plaque visualization // J Vet Diagn Invest. 2007 .-- 19 (5). - p. 486-491.

9. Ireland DC1, Binepal YS. Improved detection of capripoxvirus in biopsy samples by PCR // J Virol Methods. 1998. V. 74(1). P. 1-7.9. Ireland DC1, Binepal YS. Improved detection of capripoxvirus in biopsy samples by PCR // J Virol Methods. 1998. V. 74 (1). P. 1-7.

10. http://www.biosb.com/wp-content/uploads/AD-0111-02-Lumpy-Skin-Disease-Virus-Sheeppox-Virus-and-Goatpox-virus-Real-Time-PCR-Kit.pdf.10. http://www.biosb.com/wp-content/uploads/AD-0111-02-Lumpy-Skin-Disease-Virus-Sheeppox-Virus-and-Goatpox-virus-Real-Time-PCR-Kit. pdf.

11. МУ 1.3.2569-09 Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности.11. MU 1.3.2569-09 Organization of the work of laboratories using nucleic acid amplification methods when working with material containing microorganisms of I-IV pathogenicity groups.

Claims

1. Oligonucleotide primers and fluorescently-labeled probe for amplification and detection of a fragment of the P32 gene of capricoxviruses:

CaPV_f_new-5 'ATGAAACCAATGGATGGGATA 3',

CaPV_R_new-5 'CGAAATGAAAAACGGTATATGGA 3',

CaPV_probe-5 'ATGAGCCATCCATTTTCCAA 3'.

2. A method for detecting capricoxvirus genomes using oligonucleotide primers and a probe according to claim 1 in a PCR-PB reaction consisting of the following steps: initial denaturation at 95 ° C for 10 min and thermal cycling at 95 ° C for 15 s, 60 ° C - 60 s - 45 cycles.

3. A test system for detecting the capricoxvirus genome in a PCR-RV reaction, including a ready-made PCR mixture, Taq-DNA polymerase enzyme, a positive control sample, a negative control sample containing oligonucleotide primers and a probe according to claim 1.