RU2737396C1 - Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 - Google Patents
Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 Download PDFInfo
- Publication number
- RU2737396C1 RU2737396C1 RU2020113833A RU2020113833A RU2737396C1 RU 2737396 C1 RU2737396 C1 RU 2737396C1 RU 2020113833 A RU2020113833 A RU 2020113833A RU 2020113833 A RU2020113833 A RU 2020113833A RU 2737396 C1 RU2737396 C1 RU 2737396C1
- Authority
- RU
- Russia
- Prior art keywords
- wnv
- west nile
- 4type
- nile virus
- fluorescence
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
Description
Изобретение относится к биотехнологии, молекулярной биологии и может быть использовано для идентификации вируса Западного Нила 4 генотипа (West Nile virus lineage 4) в пробах биологического материала и клеточных культурах специалистами клинической лабораторной диагностики, службы Роспотребнадзора и в научных исследованиях.The invention relates to biotechnology, molecular biology and can be used to identify West Nile virus lineage 4 (West Nile virus lineage 4) in samples of biological material and cell cultures by specialists in clinical laboratory diagnostics, the Rospotrebnadzor service and in scientific research.
Вирус Западного Нила (ВЗН, West Nile virus) принадлежит к семейству Flaviviridae, роду Flavivirus, антигенному комплексу вируса японского энцефалита (Japanese encephalitis virus group). По принятой в Российской Федерации классификации патогенных биологических агентов ВЗН относят к вирусам II группы патогенности.The West Nile virus (WNV) belongs to the Flaviviridae family, the Flavivirus genus, an antigenic complex of the Japanese encephalitis virus group. According to the classification of pathogenic biological agents adopted in the Russian Federation, WNV is classified as a group II virus of pathogenicity.
ВЗН является возбудителем природно-очаговой арбовирусной инфекции с трансмиссивным механизмом передачи, называемой лихорадкой Западного Нила (ЛЗН). Клинические проявления ЛЗН варьируют от гриппоподобного синдрома до развития тяжелых осложнений в форме менингита и менингоэнцефалита. Летальность при ЛЗН, в зависимости от иммунного статуса заболевших, составляет от 4 до 10%. С 1999 года лабораторно подтвержденные случаи ЛЗН на территории России регистрируют ежегодно. Ареалы ВЗН занимают огромные территории в пределах экваториального, тропического и умеренного климатических поясов в Африке, Европе, Америке, Азии и Австралии. В России ареал распространения ВЗН охватывает территории юга европейской части, регионы Сибири и Дальнего Востока.WNV is the causative agent of a natural focal arbovirus infection with a vector-borne transmission mechanism, called West Nile fever (WNF). The clinical manifestations of WNI vary from influenza-like syndrome to the development of severe complications in the form of meningitis and meningoencephalitis. Mortality in WNV, depending on the immune status of the diseased, ranges from 4 to 10%. Since 1999, laboratory-confirmed cases of WNV in Russia have been registered annually. The VZN areals occupy vast territories within the equatorial, tropical and temperate climatic zones in Africa, Europe, America, Asia and Australia. In Russia, the distribution area of VZN covers the territories of the south of the European part, regions of Siberia and the Far East.
По современным данным штаммы ВЗН разделены на 9 генотипов (генетических линий). В России достоверно зарегистрирована циркуляция 1, 2 и 4 генотипов ВЗН, имеющих разное эпидемическое значение. Так, штаммы ВЗН генотипов 1 и 2 являются высокопатогенными для человека, а патогенность ВЗН 4 генотипа для млекопитающих пока не установлена. Варианты ВЗН 4 генотипа распространены на территории юга Восточно-Европейской равнины. Природными резервуарми ВЗН 4 генотипа являются озерные лягушки Rana ridibunda, а в качестве переносчиков выступают комары Uranotaenia unguiculata. Известны единичные находки ВЗН 4 генотипа в комарах Anopheles hyrcanus, Anopheles messeae и клещах Dermacentor marginatus. Для ВЗН 4 генотипа прототипным является штамм LEIV-Krd88-190, выделенный от иксодовых клещей Dermacentor marginatus, собранных в 1988 году в предгорных районах Северного Кавказа.According to modern data, WNV strains are divided into 9 genotypes (genetic lines). In Russia, the circulation of 1, 2, and 4 WNV genotypes, which have different epidemic significance, has been reliably registered. Thus, WNV genotypes 1 and 2 strains are highly pathogenic for humans, and the pathogenicity of WNV 4 genotype for mammals has not yet been established. VZN variants of genotype 4 are common in the south of the East European Plain. The natural reservoirs of genotype 4 WNV are marsh frogs Rana ridibunda, and mosquitoes Uranotaenia unguiculata act as vectors. Single finds of genotype 4 WNV are known in Anopheles hyrcanus, Anopheles messeae mosquitoes and Dermacentor marginatus ticks. For WNV 4 genotype, the prototype strain is LEIV-Krd88-190, isolated from ixodid ticks Dermacentor marginatus, collected in 1988 in the foothill regions of the North Caucasus.
Генотипирование - комплексный анализ уникального для каждого живого организма генотипа на основе изучения его генома. Циркуляция разных генетических линий вируса на территории Российской Федерации диктует необходимость разработки и совершенствования диагностических методов и тест-систем для выявления и дифференциации штаммов возбудителя лихорадки Западного Нила.Genotyping is a comprehensive analysis of a genotype unique to each living organism based on the study of its genome. The circulation of different genetic lines of the virus on the territory of the Russian Federation dictates the need to develop and improve diagnostic methods and test systems for identifying and differentiating strains of the causative agent of West Nile fever.
Одним из перспективных подходов выявления генотипа ВЗН в пробах биологического материала с высокой чувствительностью и специфичностью является использование полимеразной цепной реакции с обратной транскрипцией в реальном времени (ОТ-ПЦР). ОТ-ПЦР является прямым методом выявления РНК ВЗН. В основе метода ОТ-ПЦР лежит последовательное осуществление двух процессов: реакции обратной транскрипции и полимеразной цепной реакции. Реакция обратной транскрипции представляет собой синтез цепи комплементарной ДНК (кДНК) по матрице РНК посредством фермента ревертазы. Метод ПЦР заключается в амплификации целевых участков полученной кДНК посредством фермента ДНК-полимеразы и праймеров, фланкирующих участки уникальных кДНК-мишеней, существующих только у определенных генотипов вируса.One of the promising approaches to identifying the WNV genotype in samples of biological material with high sensitivity and specificity is the use of real-time reverse transcription polymerase chain reaction (RT-PCR). RT-PCR is a direct method for detecting WNV RNA. The RT-PCR method is based on the sequential implementation of two processes: the reverse transcription reaction and the polymerase chain reaction. The reverse transcription reaction is the synthesis of a complementary DNA strand (cDNA) from an RNA template by the enzyme revertase. The PCR method consists in amplifying the target regions of the obtained cDNA by means of the DNA polymerase enzyme and primers flanking the regions of unique cDNA targets that exist only in certain genotypes of the virus.
Для эффективного проведения ОТ-ПЦР необходимы праймеры -синтетические олигонуклеотиды определенного размера, специфичные для каждого генотипа возбудителя. Праймеры комплементарны последовательностям ДНК специфичного фрагмента и ориентированы таким образом, что достраивание новой цепи ДНК протекает только между ними. В результате ПЦР происходит многократное увеличение числа копий (амплификация) специфичного участка гена, катализируемое ферментом ДНК-полимеразой.For effective RT-PCR, primers are required - synthetic oligonucleotides of a certain size, specific for each genotype of the pathogen. The primers are complementary to the DNA sequences of the specific fragment and are oriented in such a way that the completion of a new DNA strand occurs only between them. As a result of PCR, there is a multiple increase in the number of copies (amplification) of a specific region of the gene, catalyzed by the enzyme DNA polymerase.
При детекции продуктов амплификации использование специальных флуоресцентных меток позволяет отказаться от стадии электрофореза, что не только сокращает время проведения анализа, но и снижает риск контаминации продуктами ПЦР и, соответственно, нивелирует ложноположительные результаты. Поскольку регистрация результатов проводится непосредственно в процессе реакции амплификации, весь анализ можно проводить в двух зонах лаборатории силами одного сотрудника. Этот подход позволяет проводить автоматическую интерпретацию полученных результатов и снимает проблему субъективной оценки электрофореграмм.When detecting amplification products, the use of special fluorescent labels eliminates the stage of electrophoresis, which not only reduces the analysis time, but also reduces the risk of contamination with PCR products and, accordingly, eliminates false positive results. Since the registration of the results is carried out directly during the amplification reaction, the entire analysis can be carried out in two areas of the laboratory by one employee. This approach allows for automatic interpretation of the results obtained and removes the problem of subjective assessment of electrophoregrams.
Известен способ обнаружения вируса лихорадки Западного Нила, предусматривающий проведение реакции обратной транскрипции с РНК вируса и последующей двойной амплификацией (патент РФ №2199589 от 27.02.2003 г.), а также набор олигонуклеотидных праймеров и зондов для идентификации вируса клещевого энцефалита, вируса лихорадки Западного Нила, боррелий и риккетсий методом мультиплексной ПЦР в режиме реального времени (патент РФ №2629604 от 30.08.2017 г.). Однако предложенные в данных патентах олигонуклеотиды не позволяют определять генотип ВЗН.A known method for detecting West Nile fever virus, providing for a reverse transcription reaction with RNA virus and subsequent double amplification (RF patent No. 2199589 dated 02.27.2003), as well as a set of oligonucleotide primers and probes for identification of tick-borne encephalitis virus, West Nile fever virus , borrelia and rickettsia by the method of multiplex PCR in real time (RF patent No. 2629604 dated 30.08.2017). However, the oligonucleotides proposed in these patents do not allow determining the WNV genotype.
В настоящее время известны зарегистрированные на территории РФ коммерческие наборы реагентов для обнаружения РНК ВЗН в биологическом материале: «АмплиСенс WNV-FL» (ФБУН ЦНИИ эпидемиологии Роспотребнадзора, Россия), «ОМ-скрин ЛЗН/ЛДР-РВ» (ЗАО «Синтол» Россия), «ГенНил-РЭФ» (ФКУЗ РосНИПЧИ «Микроб» Роспотребнадзора, Россия). Данные наборы реагентов обладают достаточной чувствительностью и специфичностью, однако с их помощью возможно только выявление генетического материала ВЗН без дифференциации его генетических линий.Currently, commercial kits of reagents registered in the Russian Federation for the detection of RNA VZN in biological material are known: AmpliSens WNV-FL (FBSI Central Research Institute of Epidemiology of Rospotrebnadzor, Russia), OM-screen LZN / LDR-RV (CJSC Syntol Russia ), "GenNil-REF" (FKUZ RosNIPCHI "Microbe" of Rospotrebnadzor, Russia). These sets of reagents have sufficient sensitivity and specificity, however, with their help, it is only possible to detect the genetic material of WNV without differentiating its genetic lines.
Наиболее близким аналогом являются олигонуклеотидные праймеры, разработанные для идентификации la, 1b, 2 и 4 генотипов ВЗН методом секвенирования фрагментов генома [Жуков, К.В. Эпидемиологическая характеристика лихорадки Западного Нила и молекулярно-генетические особенности изолятов, циркулирующих на территории Волгоградской области: диссертация кандидата медицинских наук: 14.02.02 / Жуков Кирилл Вадимович. - Волгоград, 2013. - 133 с.]. Известны специфичные праймеры для определения полногеномной нуклеотидной последовательности штаммов ВЗН 4 генотипа методом секвенирования по Сенгеру, предложенные Прилиповым А.Г. [Прилипов, А.Г. Генетическая характеристика штаммов вируса Западного Нила: диссертация доктора биологических наук: 03.01.03 / 03.02.02 / Прилипов Алексей Геннадьевич. - М., 2015. - 213 с.]. Однако способ генотипирования основанный на секвенировании может быть реализован только для образцов с высокой концентрацией вирусной РНК. Большинство образцов биологического материала имеет низкую вирусную нагрузку, что снижает эффективность применения секвенирования для определения генотипа ВЗН в нативном материале.The closest analogue are oligonucleotide primers designed to identify la, 1b, 2 and 4 WNV genotypes by sequencing genome fragments [Zhukov, K.V. Epidemiological characteristics of West Nile fever and molecular genetic characteristics of isolates circulating in the Volgograd region: dissertation of a candidate of medical sciences: 02.14.02 / Zhukov Kirill Vadimovich. - Volgograd, 2013. - 133 p.]. Known specific primers for determining the genome-wide nucleotide sequence of genotype 4 strains WZN by the method of Sanger sequencing, proposed by A.G. Prilipov. [Prilipov, A.G. Genetic characteristic of West Nile virus strains: dissertation of a doctor of biological sciences: 03.01.03 / 03.02.02 / Prilipov Aleksey Gennadevich. - M., 2015. - 213 p.]. However, the method of genotyping based on sequencing can only be implemented for samples with a high concentration of viral RNA. Most of the biological material samples have a low viral load, which reduces the efficiency of sequencing for determining the WNV genotype in native material.
Целью настоящего изобретения является разработка набора специфичных олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации вируса Западного Нила 4 генотипа методом полимеразной цепной реакции с обратной транскрипцией и гибридизационно-флуоресцентным учетом результатов.The aim of the present invention is to develop a set of specific oligonucleotide primers and a fluorescent-labeled probe for identification of West Nile virus genotype 4 by reverse transcription polymerase chain reaction and hybridization-fluorescent analysis of the results.
Цель достигается созданием набора олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации вируса Западного Нила 4 генотипа (West Nile virus lineage 4) методом полимеразной цепной реакции с обратной транскрипцией и гибридизационно-флуоресцентным учетом результатов, комплементарных фрагментам гена полипротеина вируса Западного Нила 4 генотипа, обладающих активностью прямого и обратного праймеров, и зонда, сконструированного по типу «молекулярного маяка», обеспечивающего флуоресцентную детекцию продукта амплификации размером 147 п. н. в реальном времени, имеющих следующую структуру:The goal is achieved by creating a set of oligonucleotide primers and a fluorescently-labeled probe for identification of West Nile virus lineage 4 by reverse transcription polymerase chain reaction and hybridization-fluorescent accounting of the results complementary to fragments of the West Nile virus genotype 4 polyprotein gene. activity of forward and reverse primers, and a probe designed as a "molecular beacon" providing fluorescent detection of an amplification product of 147 bp. in real time with the following structure:
5'-GCGTGTTGTCCTTAATAG-3' - WNV-4type-F5'-GCGTGTTGTCCTTAATAG-3 '- WNV-4type-F
5'-CACCTCTCCATCTGTCC-3' - WNV-4type-R5'-CACCTCTCCATCTGTCC-3 '- WNV-4type-R
5'-(JOE)CTCGTGGCCTTGTTGACGTTTTTCACGAG(BHQ1)-3' - WNV-4type-P,5 '- (JOE) CTCGTGGCCTTGTTGACGTTTTTCACGAG (BHQ1) -3' - WNV-4type-P,
где:Where:
JOE - 6-карбокси-4',5'-дихлор-2',7'-диметоксифлуоресцеин, флуоресцентный краситель, длина волны поглощения которого составляет 520 нм, а длина волны флуоресценции - 548 нм;JOE - 6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein, a fluorescent dye with an absorption wavelength of 520 nm and a fluorescence wavelength of 548 nm;
BHQ1 - гаситель флуоресценции с диапазоном гашения 480-580 нм.BHQ1 is a fluorescence quencher with a quenching range of 480-580 nm.
Характеристика олигонуклеотидных праймеров, зонда и кДНК мишени для идентификации вируса Западного Нила 4 генотипаCharacterization of oligonucleotide primers, probe and cDNA target for identification of West Nile virus genotype 4
Основываясь на данных, представленных в генетической базе GenBank NCBI (National Center for Biotechnology Information, США), для идентификации ВЗН 4 генотипа (West Nile virus lineage 4), методом полимеразной цепной реакции с обратной транскрипцией были подобраны праймеры, обозначенные WNV-4type-F/WNV-4type-R, комплементарные фрагменту гена полипротеина ВЗН (flavivirus polyprotein gene). Расчетная длина специфичного фрагмента, фланкируемого разработанными праймерами, составила 147 п.н.Based on the data presented in the GenBank NCBI genetic database (National Center for Biotechnology Information, USA), primers designated WNV-4type-F were selected by reverse transcription polymerase chain reaction (PCR) method to identify WNV genotype 4 (West Nile virus lineage 4) / WNV-4type-R, complementary to a fragment of the flavivirus polyprotein gene (WNV polyprotein). The calculated length of the specific fragment flanked by the developed primers was 147 bp.
Для детекции продуктов ОТ-ПЦР в режиме реального времени был сконструирован зонд формата «молекулярный маяк», обозначенный WNV-4type-P, на концах которого расположены флуорофор и гаситель флуоресценции. Подобная структура зонда обеспечивает максимальный эффект тушения и низкую фоновую флуоресценцию, поскольку молекулы флуорофора и гасителя сближены в пространстве.To detect RT-PCR products in real time, a molecular beacon probe, designated WNV-4type-P, was constructed with a fluorophore and a fluorescence quencher at the ends. This structure of the probe provides the maximum quenching effect and low background fluorescence, since the fluorophore and quencher molecules are close together in space.
Апробацию разработанного набора олигонуклеотидов осуществляли с использованием проб биологического материала, инфицированного ВЗН 1, 2 и 4 генотипов. Пробы были получены из Референс-центра по мониторингу за возбудителем лихорадки Западного Нила, функционирующего на базе ФКУЗ Волгоградский научно-исследовательский противочумный институт Роспотребнадзора. Генотип ВЗН во всех использованных образцах дополнительно подтверждали методом секвенирования. В качестве положительного контроля использовали РНК ВЗН 4 генотипа.Testing of the developed set of oligonucleotides was carried out using samples of biological material infected with WNV 1, 2, and 4 genotypes. The samples were obtained from the Reference Center for Monitoring the causative agent of West Nile fever, operating on the basis of the Volgograd Research Anti-Plague Institute of Rospotrebnadzor. The WNV genotype in all samples used was additionally confirmed by sequencing. RNA VZN genotype 4 was used as a positive control.
Для обнаружения ВЗН 4 генотипа методом ОТ-ПЦР в реальном времени оценена возможность использования сконструированного набора праймеров и зонда при анализе различного клинического материала - кровь, сыворотка крови, моча, ткани головного мозга, а также суспензий комаров. Показано, что в реакции амплификации возбудитель детектировали во всех образцах биологического материала, инфицированных и искусственно контаминированных ВЗН 4 генотипа.To detect WNV genotype 4 by RT-PCR in real time, the possibility of using the designed set of primers and a probe in the analysis of various clinical materials - blood, blood serum, urine, brain tissue, and mosquito suspensions was assessed. It was shown that in the amplification reaction the pathogen was detected in all samples of biological material infected and artificially contaminated with WNV 4 genotype.
Примеры конкретного выполненияExamples of specific implementation
Пример 1. Методика конструирования набора олигонуклеотидных праймеров и флуоресцентно-меченого зонда для идентификации кДНК ВЗН 4 генотипа методом ОТ-ПЦР и гибридизационно-флуоресцентным учетом результатов.Example 1. Methodology for constructing a set of oligonucleotide primers and a fluorescent-labeled probe for identification of cDNA WNV 4 genotype by RT-PCR and hybridization-fluorescent accounting of the results.
На основе множественного выравнивания in silico полногеномных нуклеотидных последовательностей различных штаммов ВЗН 4 генотипа, депонированных в генетической базе данных GenBank, для конструирования прямого WNV-4type-F и обратного WNV-4type-R праймеров, предназначенных для идентификации вируса Западного Нила 4 генотипа, был выбран ген, кодирующий полипротеин ВЗН (flavivirus polyprotein gene), в составе последовательности генома West Nile virus lineage 4, длина которой составляет 10845 нуклеотидов (GenBank NCBI, Accession number: FJ159129). Размеры специфичных праймеров WNV-4type-F и WNV-4type-R составили 18 и 17 нуклеотидов, соответственно. Расчетная длина фрагмента кДНК ВЗН, фланкируемого предлагаемыми праймерами - 147 п.н.On the basis of multiple in silico alignment of whole genome nucleotide sequences of different WNV genotype 4 strains deposited in the GenBank genetic database, for the construction of forward WNV-4type-F and reverse WNV-4type-R primers intended for identification of West Nile virus of genotype 4 was chosen the gene encoding the flavivirus polyprotein gene (WNV) in the West Nile virus lineage 4 genome sequence, which is 10,845 nucleotides long (GenBank NCBI, Accession number: FJ159129). The sizes of the specific primers WNV-4type-F and WNV-4type-R were 18 and 17 nucleotides, respectively. The estimated length of the VZN cDNA fragment flanked by the proposed primers is 147 bp.
При использовании компьютерной программы PerlPrimer v 1.1.21 была проанализирована структура выбранной пары праймеров WNV-4type-F/WNV-4type-R (образование димеров, шпилек и других вторичных структур) и показана их теоретическая пригодность для успешной инициации реакции амплификации.Using the computer program PerlPrimer v 1.1.21, the structure of the selected pair of WNV-4type-F / WNV-4type-R primers (formation of dimers, hairpins, and other secondary structures) was analyzed and their theoretical suitability for the successful initiation of the amplification reaction was shown.
Для флуоресцентной детекции продуктов ОТ-ПЦР в режиме реального времени сконструирован специфичный флуоресцентно-меченый олигонуклеотидный зонд, обозначенный WNV-4type-P, размером 29 нуклеотидов, который гибридизуется на участке ампликона между прямым WNV-4type-F и обратным WNV-4type-R праймерами. Комплементарные концевые последовательности зонда образуют «шпильку» по принципу «молекулярного маяка». В качестве метки использовали флуорофор JOE на 5'-конце зонда и гаситель флуоресценции BHQ1 - на 3'-конце. В онлайн-режиме с использованием программы Mfold на интернет-сайте http://unafold.rna.albany.edu оценивали вторичную структуру и термодинамические параметры разработанного зонда.For the fluorescence detection of RT-PCR products in real time, a specific fluorescently labeled oligonucleotide probe, designated WNV-4type-P, 29 nucleotides in size, which hybridizes at the amplicon region between the forward WNV-4type-F and reverse WNV-4type-R primers was constructed ... The complementary terminal sequences of the probe form a "hairpin" according to the principle of a "molecular beacon". A JOE fluorophore was used as a label at the 5'-end of the probe, and a fluorescence quencher BHQ1 at the 3'-end. The secondary structure and thermodynamic parameters of the developed probe were evaluated online using the Mfold program at the website http://unafold.rna.albany.edu.
Характеристика сконструированных олигонуклеотидных праймеров и зонда для выявления кДНК вируса Западного Нила 4 генотипа (West Nile virus lineage 4), представлена в таблице 1.The characteristics of the designed oligonucleotide primers and probe for detecting cDNA of the West Nile virus lineage 4 are presented in Table 1.
Сконструированные праймеры и зонд были проанализированы с помощью компьютерной программы BLAST на web-сервере Национального Центра Биотехнологической Информации (NCBI) (http://www.ncbi.nlm.nih.gov/BLAST/) для установления гомологии между ними и нуклеотидными последовательностями близкородственных вирусов и гетерологичных микроорганизмов, присутствующих в базах данных (GenBank, EMBL, DDBJ). На момент проведения компьютерного анализа, гомологии выявлено не было.The designed primers and probe were analyzed using the BLAST computer program on the web server of the National Center for Biotechnological Information (NCBI) (http://www.ncbi.nlm.nih.gov/BLAST/) to establish homology between them and the nucleotide sequences of closely related viruses and heterologous microorganisms present in databases (GenBank, EMBL, DDBJ). At the time of the computer analysis, no homology was found.
Пример 2. Амплификация и детекция специфичных фрагментов кДНК ВЗН с помощью разработанного набора праймеров WNV-4type-F/WNV-4type-R и флуоресцентно-меченого зонда WNV-4type-P для идентификации вируса Западного Нила 4 генотипа методом ОТ-ПЦР в режиме реального времени.Example 2. Amplification and detection of specific fragments of WNV cDNA using a developed set of primers WNV-4type-F / WNV-4type-R and a fluorescently labeled probe WNV-4type-P for identification of West Nile virus genotype 4 by RT-PCR in real mode time.
Работу с образцами биологического материала проводили согласно требованиям СП 1.3.3118-13 «Безопасность работы с микроорганизмами I-II групп патогенности (опасности)» и МУ 1.3.2569-09 «Организация работы лабораторий, использующих методы амплификации нуклеиновых кислот при работе с материалом, содержащим микроорганизмы I-IV групп патогенности». Выделение РНК ВЗН из биологических образцов осуществляли с помощью наборов реагентов «РИБО-золь-С» и «РИБО-преп» (ФБУН ЦНИИ эпидемиологии Роспотребнадзора, Россия) в соответствии с инструкциями к наборам.Work with samples of biological material was carried out in accordance with the requirements of SP 1.3.3118-13 "Safety of work with microorganisms of I-II groups of pathogenicity (danger)" and MU 1.3.2569-09 "Organization of the work of laboratories using methods of amplification of nucleic acids when working with material, containing microorganisms of I-IV pathogenicity groups ”. Isolation of VZN RNA from biological samples was carried out using the RIBO-sol-S and RIBO-prep reagent kits (FBUN TsNII Epidemiology Rospotrebnadzor, Russia) in accordance with the instructions for the kits.
Для проведения ОТ-ПЦР в режиме реального времени готовили реакционную смесь, в состав которой помимо анализируемой РНК ВЗН, входили: разработанные праймеры WNV-4type-F/WNV-4type-R и флуоресцентно-меченый зонд WNV-4type-P, а также дезоксирибонуклеозид-трифосфаты, буферный раствор, раствор хлорида магния, фермент ревертаза MMlv и фермент Taq-F-ДНК-полимераза. В качестве отрицательного контроля в пробирку вместо образца вносили равный объем дистиллированной воды. В качестве положительного контроля использовали РНК ВЗН 4 генотипа.To carry out RT-PCR in real time, a reaction mixture was prepared, which, in addition to the analyzed WNV RNA, included: developed primers WNV-4type-F / WNV-4type-R and a fluorescently labeled probe WNV-4type-P, as well as deoxyribonucleoside -triphosphates, buffer solution, magnesium chloride solution, MMlv revertase enzyme and Taq-F-DNA polymerase enzyme. As a negative control, an equal volume of distilled water was added to the test tube instead of the sample. RNA VZN genotype 4 was used as a positive control.
Обратную транскрипцию и ПЦР проводили в одной пробирке. Объем реакционной смеси составлял 25 мкл.Reverse transcription and PCR were performed in one tube. The volume of the reaction mixture was 25 μl.
Условия проведения реакции: этап обратной транскрипции при 50°С -30 мин; этап предварительной денатурации при 95°С - 15 мин; первое циклирование (5 повторений) - денатурация при 95°С - 5 с; отжиг праймеров при 56°С - 25 с; элонгация цепи при 72°С - 15 с; второе циклирование (40 повторений) - денатурация при 95°С - 5 с; отжиг праймеров при 56°С - 25 с; элонгация цепи при 72°С - 15 с. Детекцию накопления продуктов реакции осуществляли по каналу Yellow на этапе второго циклирования при температуре 56°С.Reaction conditions: stage of reverse transcription at 50 ° C -30 min; the stage of preliminary denaturation at 95 ° С - 15 min; first cycling (5 repetitions) - denaturation at 95 ° C - 5 s; annealing of primers at 56 ° С - 25 s; chain elongation at 72 ° С - 15 s; second cycling (40 repetitions) - denaturation at 95 ° C - 5 s; annealing of primers at 56 ° С - 25 s; chain elongation at 72 ° С - 15 s. The detection of the accumulation of reaction products was carried out through the Yellow channel at the stage of the second cycling at a temperature of 56 ° C.
Анализ продуктов ОТ-ПЦР осуществляли в режиме реального времени на амплификаторе «Rotor-Gene Q» («QIAGEN», Германия). Регистрацию результатов проводили в табличной и графической форме с помощью программного обеспечения к прибору. Результаты оценивали по наличию или отсутствию пересечения кривой накопления флуоресценции с пороговой линией, что определяется значением порогового цикла «Ct - cycle threshold)) в соответствующей графе в таблице результатов. Положительными считали образцы, для которых значение порогового цикла не превышало 33 на этапе второго циклирования.Analysis of RT-PCR products was carried out in real time on a Rotor-Gene Q amplifier (QIAGEN, Germany). The results were recorded in tabular and graphical form using the software for the device. The results were evaluated by the presence or absence of the intersection of the fluorescence accumulation curve with the threshold line, which is determined by the value of the cycle threshold in the corresponding column in the table of results. Samples for which the value of the threshold cycle did not exceed 33 at the stage of the second cycling were considered positive.
Пример 3. Определение специфичности реакции амплификации с помощью разработанного набора олигонуклеотидных праймеров WNV-4type-F / WNV-4type-R и флуоресцентно-меченого зонда WNV-4type-P для идентификации вируса Западного Нила 4 генотипа методом ОТ-ПЦР в режиме реального времени.Example 3. Determination of the specificity of the amplification reaction using the developed set of oligonucleotide primers WNV-4type-F / WNV-4type-R and fluorescently labeled probe WNV-4type-P for identification of West Nile virus 4 genotype by RT-PCR in real time.
Специфичность ОТ-ПЦР с разработанными праймерами и зондом оценивали при исследовании образцов РНК, выделенных из проб биологического материала, инфицированных вирусом Западного Нила 1, 2 и 4 генотипов. В качестве образцов биологического материала, инфицированного ВЗН 4 генотипа, использовали 2 пробы суспензий комаров Uranotaenia unguiculata и клинические образцы, искусственно контаминированные ВЗН 4 генотипа (2 пробы цельной крови, 2 пробы мочи и 1 пробу суспензии головного мозга). В качестве биологического материала, инфицированного ВЗН 1 генотипа, использовали клинические образцы (4 пробы суспензий головного мозга, 1 пробу цельной крови, 1 пробу сыворотки крови) и 1 пробу суспензии комаров Culex pipiens. Образцами биологического материала, инфицированного ВЗН 2 генотипа, являлись клинические образцы (2 пробы суспензий головного мозга, 2 пробы цельной крови, 1 проба сыворотки крови, 1 проба мочи) и 1 проба суспензии комаров Culex pipiens. Генотип ВЗН во всех использованных образцах был подтвержден методом секвенирования.The specificity of RT-PCR with the developed primers and probe was assessed by studying RNA samples isolated from samples of biological material infected with West Nile virus 1, 2, and 4 genotypes. Two samples of Uranotaenia unguiculata mosquito suspensions and clinical samples artificially contaminated with WNV genotype 4 (2 whole blood samples, 2 urine samples, and 1 brain suspension sample) were used as samples of biological material infected with WNV genotype 4. Clinical samples (4 samples of brain suspensions, 1 sample of whole blood, 1 sample of blood serum) and 1 sample of a suspension of Culex pipiens mosquitoes were used as biological material infected with WNV 1 genotype. Samples of biological material infected with WNV genotype 2 were clinical samples (2 samples of brain suspensions, 2 samples of whole blood, 1 sample of blood serum, 1 sample of urine) and 1 sample of a suspension of Culex pipiens mosquitoes. The WNV genotype in all used samples was confirmed by sequencing.
Пробоподготовку и постановку реакции ОТ-ПЦР осуществляли, как описано в примере 2. При тестировании исследуемых образцов с использованием разработанного набора олигонуклеотидных праймеров WNV-4type-F/WNV-4type-R и зонда WNV-4type-P положительный результат ОТ-ПЦР в режиме реального времени был получен для всех проб, инфицированных вирусом Западного Нила 4 генотипа. С образцами биологического материала, инфицированными вирусом Западного Нила генотипов 1 и 2, в реакции ОТ-ПЦР с разработанным набором праймеров WNV-4type-F/WNV-4type-R и зонда WNV-4type-P получен отрицательный результат в 100% случаев.Sample preparation and RT-PCR reaction were performed as described in example 2. When testing the samples under study using the developed set of oligonucleotide primers WNV-4type-F / WNV-4type-R and probe WNV-4type-P, positive RT-PCR in the mode real-time was obtained for all samples infected with West Nile virus genotype 4. With samples of biological material infected with West Nile virus genotypes 1 and 2, in the RT-PCR reaction with the developed set of primers WNV-4type-F / WNV-4type-R and probe WNV-4type-P, a negative result was obtained in 100% of cases.
На рисунке 1 представлен график кривых нарастания флуоресценции, полученный при исследовании проб биологического материала методом ОТ-ПЦР в реальном времени с помощью сконструированного набора олигонуклеотидных праймеров WNV-4type-F/WNV-4type-R и флуоресцентно-меченого зонда WNV-4type-P. Цифрами 1-7 обозначены пробы, инфицированные ВЗН 4 генотипа (1-2 - пробы суспензий комаров Uranotaenia unguiculata, 3-4 - пробы цельной крови, 5 - проба суспензии головного мозга, 6-7 - пробы мочи). Цифрой 8 отмечен положительный контроль. Отрицательный контроль, а также пробы, инфицированные ВЗН 1 и 2 генотипов, располагаются ниже пороговой линии.Figure 1 shows a graph of fluorescence growth curves obtained in the study of samples of biological material by RT-PCR in real time using a designed set of oligonucleotide primers WNV-4type-F / WNV-4type-R and a fluorescently labeled probe WNV-4type-P. Numbers 1-7 designate samples infected with WNV genotype 4 (1-2 - samples of suspensions of mosquitoes Uranotaenia unguiculata, 3-4 - samples of whole blood, 5 - sample of brain suspension, 6-7 - urine samples). The number 8 marks the positive control. Negative control, as well as samples infected with WNV genotypes 1 and 2, are located below the threshold line.
Таким образом, разработанный набор олигонуклеотидных праймеров WNV-4type-F/WNV-4type-R и флуоресцентно-меченого зонда WNV-4type-P позволяет в короткий срок с высокой специфичностью выявлять вирус Западного Нила 4 генотипа в биологическом материале и может быть использован при проведении эпидемиологического надзора за лихорадкой Западного Нила.Thus, the developed set of oligonucleotide primers WNV-4type-F / WNV-4type-R and a fluorescently labeled probe WNV-4type-P allows in a short time with high specificity to detect West Nile virus genotype 4 in biological material and can be used for epidemiological surveillance of West Nile fever.
Claims (7)
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020113833A RU2737396C1 (en) | 2020-04-03 | 2020-04-03 | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| RU2020113833A RU2737396C1 (en) | 2020-04-03 | 2020-04-03 | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| RU2737396C1 true RU2737396C1 (en) | 2020-11-30 |
Family
ID=73792309
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| RU2020113833A RU2737396C1 (en) | 2020-04-03 | 2020-04-03 | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 |
Country Status (1)
| Country | Link |
|---|---|
| RU (1) | RU2737396C1 (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2629604C1 (en) * | 2016-06-24 | 2017-08-30 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Set of oligonucleotide primers and probes for identification of tick-borne encephalitis virus, west nile fever, borrelia and rickettsia by real time multiplex pcr |
-
2020
- 2020-04-03 RU RU2020113833A patent/RU2737396C1/en active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2629604C1 (en) * | 2016-06-24 | 2017-08-30 | Федеральное бюджетное учреждение науки "Государственный научный центр вирусологии и биотехнологии "Вектор" (ФБУН ГНЦ ВБ "Вектор") | Set of oligonucleotide primers and probes for identification of tick-borne encephalitis virus, west nile fever, borrelia and rickettsia by real time multiplex pcr |
Non-Patent Citations (2)
| Title |
|---|
| THOMAS C, et al., Detection of West Nile virus and tick-borne e encephalitis virus in birds in Slovakia, using a universal primer set, Arch Virol, (2016) 161:1679-1683, DOI: 10.1007/s00705-016-2828-5. * |
| Жуков К.В. Эпидемиологическая характеристика лихорадки Западного Нила и молекулярно-генетические особенности изолятов, циркулирующих на территории, диссертация, Волгоград, 2013, весь документ. * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107849618A (en) | Differentiate and detect the genetic marker of aquatile infectious disease Causative virus and using its Causative virus discriminating and detection method | |
| US20090226895A1 (en) | Method of detecting vibrio parahaemolyticus via real-time PCR-hybridization | |
| Mota et al. | Recombinase polymerase amplification in the molecular diagnosis of microbiological targets and its applications | |
| RU2612137C1 (en) | Method for identification of tularemia pathogen subspecies francisella tularensis subsp tularensis, francisella tularensis subsp mediasiatica and francisella tularensis subsp holarctica | |
| Belák | The molecular diagnosis of porcine viral diseases: a review | |
| RU2715625C1 (en) | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying a west nile virus 1 genotype | |
| RU2715617C1 (en) | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying a west nile virus genotype 2 | |
| RU2550257C2 (en) | METHOD OF DIFFERENTIATING TYPICAL AND ATYPICAL STRAINS Yersinia pestis OF MEDIEVAL BIOVAR BY PCR METHOD WITH HYBRIDISATION-FLUORESCENT RECORDING RESULTS | |
| JP2016019495A (en) | Nucleic acid amplification technique | |
| RU2737396C1 (en) | Set of oligonucleotide primers and a fluorescence-labeled probe for identifying west nile virus lineage 4 | |
| AU2011352801B2 (en) | Compositions and methods for identifying and differentiating viral components of multivalent shipping fever vaccines | |
| Liu et al. | Development of reverse transcription loop-mediated isothermal amplification for rapid detection of Batai virus in cattle and mosquitoes | |
| RU2739333C1 (en) | Bacterial strain escherichia coli jm 109 4-162, producer of recombinant plasmid pwnv4protc, carrying sequence of polyprotein gene segment of west nile virus genotype 4 encoding capsid protein | |
| CN114395643A (en) | Double-channel digital PCR detection kit and method for African swine fever virus | |
| KR102076343B1 (en) | Composition for detecting adenovirus type 55 using Real-time LAMP and uses thereof | |
| JP6226460B2 (en) | Nucleic acid quantification method, primer set used therein, DNA chip and assay kit, and method for determining resident bacteria using the same | |
| RU2644233C2 (en) | Method for leukosis diagnosis in cattle | |
| JP2007325514A (en) | Oligonucleotide set for detecting virus, analysis method and kit for detecting ebv, cmv and hhv-6 | |
| RU2744092C1 (en) | Test system for detection of sheeppox virus genome by real-time polymerase chain reaction | |
| RU2744095C1 (en) | Escherichia coli jm 109 1-430 bacterial strain - producer of the recombinant pwnv1protc plasmid, which carries the sequence of the 5'-untranslated area and a section of the west nile virus 1 polyprotein gene of the genotype encoding the capsid protein | |
| KR102499837B1 (en) | Composition For Detecting Epizootic Ulcerative Syndrome and Method of Detecting Epizootic Ulcerative Syndrome Using the Same | |
| KR20200092653A (en) | Universal Primer Sets for Detecting Flavivirus and Use Thereof | |
| RU2744096C1 (en) | Escherichia coli jm 109 2-428 bacterial strain - producer of the recombinant pwnv2protc plasmid, which carries the sequence of the 5'-untranslated area and a section of the west nile virus 2 polyprotein gene of the genotype encoding the capsid protein | |
| RU2816852C1 (en) | Method for pcr identification of phytopathogenic fungus fusarium oxysporum | |
| RU2772362C1 (en) | TEST SYSTEM FOR DETECTION OF SARS-CoV-2 OF OMICRON LINE BY SINGLE-STEP POLYMERASE CHAIN REACTION WITH REVERSE TRANSCRIPTION |