RU2772362C1 - TEST SYSTEM FOR DETECTION OF SARS-CoV-2 OF OMICRON LINE BY SINGLE-STEP POLYMERASE CHAIN REACTION WITH REVERSE TRANSCRIPTION - Google Patents

Abstract

FIELD: molecular biology; virology; biotechnology.

SUBSTANCE: test system for detection of SARS-CoV of Omicron line by a single-step polymerase chain reaction with reverse transcription is described. The specified test system includes oligonucleotide primers and a fluorescent probe with the following structure:

direct primer Ins214EPESARS-CoV-2 –

reverse primer Ins214EPESARS-CoV-2 –

fluorescent probe Ins214EPESARS-CoV-2 –

EFFECT: ensuring the possibility of effective and accurate detection of SARS-CoV-2 of Omicron line.

3 cl, 2 dwg, 2 tbl, 1 ex

Description

The invention relates to the field of molecular biology, virology and biotechnology, in particular, to the diagnosis of infectious diseases, namely to a test system for the detection of SARS-CoV-2 of the Omicron line by a one-step reverse transcription polymerase chain reaction.

November 26, 2021 The World Health Organization has designated a new strain of SARS-CoV-2 virus, Omicron (Classification of the Omicron variant (B.1.1.529) as a SARS-CoV-2 variant of concern. World Health Organization website, URL: https ://www.who.int/ru/news/item/26-11-2021-classification-of-omicron-(b.1.1.529)-sars-cov-2-variant-of-concern, date of access – December 28, 2021). This variant of the new coronavirus has a large number of mutations, which explains the increased attention and concern regarding the new line. According to the data already obtained, the differences between the new line of Omicron can be called a high risk of re-infection and the relatively low effectiveness of existing vaccines. Ensuring the possibility of high-throughput screening of SARS-CoV-2 of the Omicron line is an extremely important and urgent task facing the developers of test systems today.

A known test system for detecting SARS-CoV-2 virus RNA (Test system for detecting SARS-CoV-2 virus RNA in biomaterial from animals, food products and environmental objects by real-time polymerase chain reaction: patent RU2756474, Russian Federation, application RU2021114811, application 05/24/2021, published 09/30/2021), including a PCR mixture containing oligonucleotide primers and a fluorescently labeled probe for amplification and detection of the N gene region of the SARS-CoV-2 virus: forward GGACCCCAAAAATCAGCGAAA, reverse CTGGTTATCG, fluorescent probe ROXCACCCCGCATTACGTTTGGTGGAC. Moreover, a real-time PCR reaction is carried out, consisting of the following steps: reverse transcription 42°C - 15 min, denaturation at 95°C for 5 min and thermal cycling at 95°C - 15 s, 55°C - 15 s; 72°C - 20 s - 40 cycles, the sample is considered positive for the presence of SARS-CoV-2 virus RNA if the Ct value is ≤35, the sample is considered negative for the presence of SARS-CoV-2 virus RNA if the Ct value is absent/not registered, however, if the Ct value for the samples is in the range of 35 to 40, the result of detection of SARS-CoV-2 virus RNA is considered doubtful and is subject to re-examination, while if the recorded value of Ct ≤ 40 during the re-examination, the result of RNA detection SARS-CoV-2 virus is considered positive; if the Ct value is not recorded, the SAPvS-CoV-2 RNA detection result is considered negative.

Also known is a kit for detecting the SARS-CoV virus by real-time RT-PCR (Kit for detecting the SARS-CoV virus by real-time RT-PCR: patent RU2744198, Russian Federation, application RU2020118246, application 25.05.2020, publ. 03.03 .2021), which includes oligonucleotide primers limiting a fragment of the RNA dependent RNA polymerase gene, and an oligonucleotide labeled with a fluorescent label (fluorescent probe), having the following structure:

CoV2-f tca caa ttc aga agt agg acc tg; CoV2-r agc ctc caa agg caa tag tgc CoV2-pr R6G - tct tgc cga ata cca taa tga atc caa – BHQ1

Closest to the claimed invention is a test system for the detection of SARS-CoV-2, Influenza virus A and Influenza virus B (Test system for the detection of SARS-CoV-2, Influenza virus A, Influenza virus B by a one-step reverse transcription polymerase chain reaction: patent RU2761481, Russian Federation, application 2021126293, filed 07.09.2021, published 08.12.2021), which includes oligonucleotide primers and fluorescent probes with the following structure: influenza virus forward primer B ATTCTTCAATgAAgAAggAAC; influenza virus reverse primer B CTCCCAACACggTAgATA; fluorescent probe of influenza virus B (R6G)-TCCCATCATCATyCCAgg-(BHQ-1); Influenza A direct primer CACCAAAyCATgArggAATA; influenza A virus reverse primer gCTCATgTTgATTCCCAC; fluorescent probe of influenza A virus (ROX)-TgCAggTCCTrTAgAATCTrTCCACTC-(BHQ-2); forward primer SARS-CoV-2 AgAgCTATgAATTgCAgAC; SARS-CoV-2 reverse primer gggAAATACAAAATTTggACA; fluorescent probe SARS-CoV-2 (FAM)-AATTggCAAAgAAATTTgACACCTTCA-(BHQ-1).

To date, no test systems are known that are suitable for the effective detection of SARS-CoV-2 of the Omicron line.

The technical problem is the need to develop an effective and accurate test system for the detection of SARS-CoV-2 Line Omicron - Ins214EPE.

The technical result consists in providing the possibility of effective and accurate detection of SARS-CoV-2 Omicron Line.

The technical result is achieved by the fact that the test system for the detection of SARS-CoV-2 line Omicron by the method of one-step reverse transcription polymerase chain reaction contains oligonucleotide primers and a fluorescent probe with the following structure:

forward primer Ins214EPESARS-CoV-2, ATATTTCTAAGCACACGCCTATT (SEQNO:1);

reverse primer Ins214EPESARS-CoV-2, GGCAAATCTACCAATGGTTCTA (SEQNO:2);

fluorescent probe Ins214EPESARS-CoV-2 –

ROX-TGCGTGAGCCAGAAGATCTCCCT-BHQ-2 (SEQ NO:3).

To solve the problem of detecting the Omicron variant, the genomes of all SARS-CoV-2 variants were processed in the GISAID database (https://www.gisaid.org) in order to find unique indels that would be found in most genomes of the Omicron variant and would not be found. never in other variants of SARS-CoV-2. The claimed test system was obtained by constructing diagnostic primers and a probe for the detection of the SARS-CoV-2 Omicron line by selecting a fluorescently labeled hydrolyzable probe highly specific to the unique Ins214EPE insertion sequence. This insertion is not found in any SARS-CoV-2 variant, but is present in most genomes of the B.1.1.529 BA.1 lineage.

To optimize the operation of the test system, a series of experiments was carried out to select the working concentration of primers and an experiment was set up with the primer annealing temperature gradient to select the optimal value under multiplex reaction conditions. According to the experimental results, the optimal concentration of primers and probes was 400 nM, the optimal annealing temperature was 61°C.

The analysis of the results was performed using the software of the instrument used for PCR with hybridization-fluorescence detection in real time. The results were interpreted based on the presence or absence of the intersection of the fluorescence curve with the threshold line set at the appropriate level, which corresponds to the presence or absence of the Ct cycle threshold value, and the result was considered positive if the fluorescence accumulation curve for the corresponding sample had a characteristic sigmoid shape and crossed the threshold line .

The claimed invention is illustrated by an example

Checking the effectiveness of the test system.

The test was validated for Omicron variant RNA, kindly provided by the Laboratory of Variability of Pathogenic Microorganisms (Dr. Vladimir Gushchin, Gamaleya Institute, Moscow, Russia), and RNA from the collection of the Research Institute of Influenza. Smorodintsev.

Table 1 - Virus samples used in test validation

No. p / p Name of the virus Number in the global European virus archive (GISAIDIsolateID) one hCoV-19/Russia/MOW-Moscow_PMVL-O11/2021 EPI_ISL_7263932 2 hCoV-19/Russia/MOW-Moscow_PMVL-O16/2021 EPI_ISL_7263933 3 hCoV-19/Russia/SPE-RII-MH44356S/2021 EPI_ISL_7717296

As a result, samples 1, 2 and 3 were assay positive as expected. Negative controls (not shown in Table 1) were considered negative. 10-fold serial dilutions of Omicron RNA were used to evaluate the amplification efficiency of the ins214EPE assay. The efficiency was 98.9% (R2 = 0.99). Amplification efficiency data is shown in FIG. 1 and the amplification curve is shown in FIG. 2.

The developed test system demonstrates high specificity. It has been tested on 26 clinical specimens (RNA isolated from oropharyngeal swabs) with previously characterized viruses belonging to 8 different SARS-CoV-2 lineages (including DeltaB.1.617.2 + AY.*). A specific signal was found only in samples with SARS-CoV-2 RNA of the Omicron line (confirmed by whole genome sequencing). Specificity was further tested on clinical specimens positive for other respiratory viruses from the collection of the Research Institute of Influenza. Smorodintsev - influenza, parainfluenza, seasonal human coronaviruses (OC43, NL63, 229E, HKU1), hRSV, rhinoviruses, bocaviruses, metapneumoviruses (33 in total) - without false positive results. The analytical specificity of the test was tested on 26 samples from 8 different SARS-CoV-2 strains (Table 2).

Table 2 - results of testing the analytical specificity of the test

No. p / p Samples Recombinant protein analysis,
C value SARS-CoV-2 N HKU gene analysis, Ct value ins214EPE gene analysis, Ct value one hRV 32.85 2 hRV 33.76 3 hRV 27.75 4 hRSV B 31.49 5 hRSV B 30.98 6 hRSV B 32.33 7 hRSV A 28.76 eight hRSV A 30.56 nine hRSV A 27.7 ten hPIV4 23.9 eleven hPIV3 27.01 12 hPIV2 24.72 thirteen hPIV1 28.63 fourteen hCoV OC43 30.34 fifteen hCoV OC43 30.69 sixteen hCoV OC43 28.64 17 hCoV NL63 32.2 eighteen hCoV NL63 30.42 nineteen hCoV NL63 24.95 20 hMPV 30.12 21 hCoV HKU1 30.06 22 hCoV HKU1 28.3 23 hCoV HKU1 30.73 24 Human influenza A (H3N2) 28.16 39.06 25 Human influenza A (H3N2) 29.13 26 Human influenza A (H3N2) 28.45 27 SARS-CoV-2 B.1.1.529 34.15 26.61 28.44 28 hBoV 32.26 29 hBoV 30.75 thirty hBoV 27.25 31 hAdV 29.47 32 hCoV 229E 29.11 33 hCoV 229E 32.52 34 hCoV 229E 29.37

--->

Sequence listing

<110> FEDERAL STATE BUDGETARY INSTITUTION

"RESEARCH INSTITUTE OF FLU NAMED AFTER A.A.

SMORODINTSEVA" OF THE MINISTRY OF HEALTH OF THE RUSSIAN FEDERATION

<120>Test system for detection of the Omicron line in SARS-CoV-2 by the method

one-step reverse transcription polymerase chain reaction

<130>Test system for detection of the Omicron line in SARS-CoV-2 by the method

one-step reverse transcription polymerase chain reaction

<160>3

<170>PatentIn version 3.5

<210> 1

<211>21

<212> DNA

<213>SARS-CoV-2

<400> 1

atattctaagcacacgcctatt 22

<210> 2

<211>22

<212> DNA

<213>SARS-CoV-2

<400> 2

ggcaaatctaccaatggttc ta 22

<210> 3

<211> 23

<212> DNA

<213>SARS-CoV-2

<400>3

tgcgtgagccagaagatctccct 23

<---

Claims (7)

1. Test system for detection of the Omicron line in SARS-CoV-2 by a one-step reverse transcription polymerase chain reaction, including oligonucleotide primers and a fluorescent probe with the following structure: direct primer Ins214EPE SARS-CoV-2 – ATATTCTAAGCACACGCCTATT, reverse primer Ins214EPE SARS-CoV-2 - GGCAAATCTACCAATGGTTCTA, fluorescent probe Ins214EPE SARS-CoV-2 – ROX-TGCGTGAGCCAGAAGATCTCCCT-BHQ-2. 2. Test system according to claim 1, characterized in that the optimal concentration of primers and probe is 400 nM. 3. The test system according to claim 1, characterized in that the optimum annealing temperature for the primers and the probe is 61°C.

Images