GB2593010A - Composition and method - Google Patents

Abstract

A kit for determining the presence or absence of SARS-CoV-2 in a sample. The kit comprises a pair of polynucleotide primers having the sequences shown in SEQ ID NOs 1 and 2, as well as a polynucleotide probe having the sequence shown in SEQ ID NO 3. The primers and probe are specific to the ORF1ab gene. The probe can be a DNA probe, a TaqMan® probe, a molecular probe, or a scorpion probe. The probe can be detectably labelled. The probe can be labelled with a fluorescent molecule or dye or 6-carboxyfluorescein (FAM). Further aspects of the invention are methods of detecting SARS-CoV-2 using the kit by conducting a reverse transcription polymerase chain reaction (rtPCR) assay. The rtPCR assay can be a one step rtPCR assay conducted in a tube or vessel. The method can comprise extracting RNA from the sample before conducting the rtPCR assay. The sample can be human. The sample can be a nasopharyngeal sample, a saliva sample, or a blood sample. A further aspect can be a method of measuring the SARS-CoV-2 titre in a sample or a patient. A further aspect can be a method of determining whether a patient is infected with SARS-CoV-2.

Description

COMPOSITION AND METHOD

Field of the Invention

The invention relates to novel primers, probes, kits and methods for determining the presence or 5 absence of SARS-CoV-2.

Back2rotmd to the Invention Coronavimses are members of the subfamily Coronavirinae in the family Coronaviridae and the order Nidovirales. A novel coronavirus, 2019-nCoV or COVID-19, capable of infecting humans was identified in Wuhan, China and then led to a worldwide pandemic. Based on its phylogenetic relationships and genomic structures, the virus belongs to genera Betacoronavirus and has close similarities to severe acute respiratory syndrome-related coronavimses (SARS-CoV). The virus uses ACE2 as the entry receptor-like SARS-CoV. These similarities had lead the Coronavirus Study Group of the International Committee on Taxonomy of Viruses to term the virus SARS-CoV-2. Since the virus is novel, new methods are required to test for the virus and distinguish it from other similar coronaviruses. The sequence of SARS-Cov-2 has been published under accession no. MN908947 (htimiiivww; nebi.nira nib 2ovinuccore/M1C908947.3). Sequence information from around the world nevertheless indicates that numerous variants of the virus exist.

Summary of the Invention

The inventors have surprisingly identified new primers, probes, kits and methods for determining the presence or absence of SARs-CoV-2 in a variety of samples. The new primers, probes, kits and methods target the ORF I ab gene in SARs-CoV-2. The ORE lab gene encodes the ORF1a/ORF lab poly-proteins.

The invention provides: a pair of primers for determining the presence or absence of SARS-CoV-2 in a sample, wherein the forward primer comprises a polynucleotide having the sequence shown in SEQ ID NO: 1 or a variant thereof having at least about 80% homology to SEQ ID NO: 1 based on sequence identity over its entire length and the reverse primer comprises a polynucleotide having the sequence shown in SEQ ID NO: 2 or a variant thereof having at least about 75% homology to SEQ ID NO: 2 based on sequence identity over its entire length: a complementaw DNA (cDNA) amplicon amplified from SARS-CoV-2 cDNA by the pair of primers of the invention; a polynucleotide probe which specifically hybridises to the cDNA amplicon of the invention; a polynucleotide probe for determining the presence or absence of SARS-CoV-2 in a sample, wherein the polynucleotide probe comprises the sequence shown in SEQ ID NO: 3 or a variant thereof having at least about 80% homology to SEQ ID NO: 3 based on sequence identity over its entire length; - a cDNA amplicon amplified from SARS-CoV-2 cDNA and comprising a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3; a target cDNA polynucleotide comprising a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3; a kit for determining the presence or absence of SARS-CoV-2 in a sample, comprising (a) a pair of primers of the invention and (b) a polynucleotide probe of the invention; a method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a pair of primers of the invention and detecting the cDNA amplicon amplified by the primers, if present, and thereby determining the presence or absence of SARS-CoV-2 in the sample; a method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a pair of primers that amplifies a cDNA amplicon of the invention and a polynudeotide 20 probe of the invention and thereby determining the presence or absence of SARS-CoV-2 in the sample; a method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a kit of the invention and thereby determining the presence or absence of SARS-CoV-2 in the sample; - a method for measuring the SARS-CoV-2 titre in a sample, wherein the method comprises conducting a real time RT-PCR method of the invention and, if SARS-CoV-2 is present, evaluating the cycle quantification (Cq) value and thereby measuring the SARS-CoV-2 titre; a method of determining whether or not a patient is infected with SARS-CoV-2, wherein the method comprises conducting a method of the invention on a sample from the patient and thereby determining whether or not a patient is infected with SARS-CoV-2; a method of measuring the titre of SARS-CoV-2 in a patient, wherein the method comprises conducting a method of the invention on a sample from the patient and thereby measuring the viral titre in the patient; a method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method of the invention, comprising administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment and thereby treating the SARS-CoV-2 infection in the patient; a substance or composition for use in a method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method of the invention; a method of treating SARS-CoV-2 in a patient identified as having a high SARS-CoV-2 titre using a method of the invention, comprising administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment and thereby treating the SARS-CoV-2 infection in the patient; a substance or composition for use in a method of treating SARS-CoV-2 in a patient identified as being having a high SARS-CoV-2 titre using a method of the invention.

Description of the Fi2ures

Figure I shows the standard curve of SARS-Cov-2 whole genomic RNA (EvaG) using a real time RT-PCR assay (curves from left to right: 104 copies/Mi. 103 copies/0, 102 copies/p1 and 10 copies/p).

Figure 2 shows the standard curve of SARS-Cov-2 whole genomic RNA (EvaG) using a real time RT-PCR assay (curves from left to right: 104 copies/Mi. 102 copies/til, 10 copies/pi, and 0.59 copies/p).

Figure 3 shows the standard curve of SARS-Cov-2 whole genomic RNA (EvaG) using a real time RT-PCR assay (curves from left to right: I 06 copies/MI, I 04 copies/l, 102 copies/RI, 10 copies/u1 and 5 copies/0)

Description of the Sequence Listing

SEQ ID NO: 1 shows the forward ORF lab gene primer used in the Examples. SEQ ID NO: 2 shows the reverse ORE lab gene primer used in the Examples. SEQ ID NO: 3 shows the ORF lab gene probe used in the Examples.

SEQ ID NO: 4 shows the ORF lab gene cDNA amplified in the Examples.

SEQ ID NO: 5 shows the reverse complement of SEQ ID NO: 3.

SEQ ID NO: 6 shows the Lactococcus lactis (L. lactis) forward primer. SEQ ID NO: 7 shows the L. lactis reverse primer.

SEQ ID NO 8 shows the L. lactis probe 1. SEQ ID NO: 9 shows the L. lactis probe 2.

Detailed Description of the Invention

It is to be understood that different applications of the disclosed products and methods may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only and is not intended to be limiting.

In addition, as used in this specification and the appended claims, the singular forms "a", 'an", fo and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a primer" includes two or more primers, reference to "a probe" includes two or more probes, reference to "a sample-includes two or more such samples, reference to -a patient-includes two or more such patients, and the like.

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

Terminology In all instances herein. SARS-CoV-2 is interchangeable with 2019-nCoV or COVID-19.

In all instances herein, determining is interchangeable with detecting. The new primers, probes, 20 kits and methods of the invention may be for detecting the presence or absence of SARS-CoV-2 in a sample or patient. Also, in all instances, the new primers, probes, kits and methods of the invention may be for determining/detecting/identifying whether or not a sample contains or comprises SARSCoV-2 or whether or not a patient is infected with SARS-CoV-2.

Advantages of the invention The inventors have surprisingly identified new primers, probes, kits and methods for determining the presence or absence of SARS-CoV-2 in a variety of samples. The compositions and methods have several advantages.

First, the new primers, probes, kits and methods are capable of detecting the presence of SARS-CoV-2 with a high degree of sensitivity. As shown in the Examples, the method is capable of detecting of fewer copies of the SARs-CoV-2 RNA genome per ul of sample.

Second, the new primers, probes, kits and methods do not cross react with other human viruses, such as other human coronaviruses. The new primers, probes, kits and methods do not cross react with SARS-CoV. Positive results from the new primers, probes, kits and methods can therefore be trusted as being indicative of the presence of SARS-CoV-2. The new primers, probes, kits and methods therefore do not give false positives.

Third, the new primers, probes, kits and methods are capable of measuring the SARs-CoV-2 titre in sample and distinguishing between a low SARs-CoV-2 titre and a high SARs-CoV-2 titre. This is particularly helpful in determining the level of infection in patients and allowing physicians to tailor their treatments to those levels.

Primers of the invention The present invention provides a pair of primers for determining the presence or absence of SARS-CoV-2 in a sample.

The forward primer comprises a polynucleotide having the sequence shown in SEQ ID NO: 1 or a variant thereof having at least about 80% homology to SEQ ID NO: I based on sequence identity over its entire length.

The reverse primer comprises a polynucleotide having the sequence shown in SEQ ID NO: 2 or a variant thereof having at least about 75% homology to SEQ ID NO: 2 based on sequence identity over its entire length.

A polynucleotide, such as a nucleic acid, is a polymer comprising two or more nucleotides. The nucleotides can be naturally occurring or artificial.

A nucleotide typically contains a nucleobase, a sugar and at least one linking group, such as a phosphate, 2'0-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate group. The nucleobase is typically heterocyclic. Nucleobases include, but are not limited to, purines and pyrimidines and more specifically adenine (A), guanine (G), thymine (T), uracil (U) and cytosine (C). The sugar is typically a pentose sugar. Nucleotide sugars include, but are not limited to, ribose and deoxyribose. The sugar and the nucleobase together form a nucleoside. Preferred nucleosides include, but are not limited to, adenosine, guanosine, 5-methyluridine, uridine, cytidine, deoxyadenosine, deoxyguanosine, thymidine, deoxyuridine and deoxycytidine. The nucleosides are most preferably adenosine, guanosine, uridine and cytidine The nucleotides are typically ribonucleotides or deoxyribonucleotides. The nucleotides are preferably deoxyribonucleotides. The nucleotides typically contain a monophosphate. diphosphate or triphosphate. Phosphates may be attached on the 5' or 3' side of a nucleotide.

Nucleotides include, but are not limited to, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP), 5-methylcytidine monophosphate, 5-methylcytidine diphosphate, 5-methylcytidine triphosphate, 5-hydroxymethylcytidine monophosphate, 5-hydroxymethylcytidine diphosphate, 5-hydroxymethylcytidine triphosphate, cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxythymidine o monophosphate (dTMP), deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxyuridine monophosphate (dUlVfP), deoxyuridine diphosphate (dUDP), deoxyuridine triphosphate (dUTP), deoxycytidine monophosphate (dCMP), deoxycytidine diphosphate (dCDP) and deoxycytidine triphosphate (dCTP), 5-methyl-2'-deoxycytidine monophosphate, 5-methyl-2'-deoxycytidine diphosphate, 5-methyl-2'-deoxycytidine triphosphate, 5-hydroxymethy1-2'-deoxycytidine monophosphate, 5-hydrox-ymethyl-2'-deoxycytidine diphosphate and 5-hydroxymethy1-2'-deoxycytidine triphosphate. The nucleotides are preferably selected from AMP, UMP, GMP, CMP, dAMP, dTMP, dGMP or dCMP. The nucleotides are preferably selected from dAMP, &IMP, dGMP or dCMP.

The nucleotides may contain additional modifications. In particular, suitable modified nucleotides include, but are not limited to, T amino pyrimidines (such as 2'-amino cytidine and 2'-amino uridine), T-hyrdroxyl purines (such as, T-fluoro pyrimidines (such as 2'-fluorocytidine and Tfluoro uridine), hydroxyl pyrimidines (such as 5'-a-P-borano uridine), 2'-0-methyl nucleotides (such as 2'-0-methyl adenosine, 2'-0-methyl guanosine, 2'-0-methyl cytidine and 2'-0-methyl uridine), pyrimidines (such as 4'-thio uridine and 4'-thio cytidine) and nucleotides have modifications of the nucleobase (such as 5-pentynyl-2'-deoxy uridine, 5-(3-aminopropy1)-uridine and 1,6-diaminohexyl-N- 5-carbamoylmethyl uridine).

One or more nucleotides in the polynucleotide may be modified, for instance with a label or a tag. The label may be any suitable label which allows the polynucleotide to be detected. Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g. 125-1, 35S, enzymes, antibodies, antigens, other poly:nucleotides and ligands such as biotin.

The nucleotides in the polynucleotide may be attached to each other in any manner. The nucleotides may be linked by phosphate, 2'0-methyl, 2' methoxy-ethyl, phosphoramidate, methylphosphonate or phosphorothioate linkages. The nucleotides are typically attached by their sugar and phosphate groups as in nucleic acids. The nucleotides may be connected via their nucleobases as in pyrimidine dimers.

The polynucleotide can be a nucleic acid, such as deoxyribonucleic acid (DNA) or a ribonucleic acid (RNA). The polynucleotide may be any synthetic nucleic acid known in the art, such as peptide nucleic acid (PNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), locked nucleic acid (LNA), morpholino nucleic acid or other synthetic polymers with nucleotide side chains. The polynucleotide may comprise any of the nucleotides discussed above including the modified nucleotides.

The polynucleotide may be DNA or RNA. in the context of the invention, a primer o polynucleotide that is RNA has the sequence shown in SEQ ID NO: I or SEQ ID NO: 2 if all of the instances of dAMP, dTMP, dGMP and dCMP are replaced with AMP, UMP, (IMP and CMP respectively. In other words, the DNA nucleotides are replaced with their corresponding RNA nucleotides and T is replaced with U. The polynucleotide is preferably DNA.

The polynucleotide may be single stranded or double stranded. The primer polynucleotide is preferably single stranded.

Any of the polynucleotides discussed herein, such as the primers, probes, cDNA amplicons and target cDNA sequences, may be isolated, substantially isolated, purified or substantially purified. The polynucleotide is isolated or purified if it is completely free of any other components, such as buffer, other polynucleotides, virus material or cells. The polynucleotide is substantially isolated or substantially purified if it is only mixed with carriers or diluents, such as buffers or excipients, which will not interfere with its intended use, such as in a RT-PCR assay. The primer polynucleotides are not naturally occurring.

The primer of the invention may comprise a variant sequence based on SEQ ID NO: I or 2. A variant sequence is a polynucleotide that has a nucleotide sequence which varies from that of SEQ ID NO: 1 or 2 and which retains its ability to specifically hybridise to the target sequence of SEQ ID NO: 1 or 2. A variant sequence is a polynucleotide that has a nucleotide sequence which varies from that of SEQ ID NO: 1 or 2 and which retains its ability to specifically hybridise to a sequence that is complementary to SEQ ID NO: 1 or 2. A variant sequence is a polynucleotide that has a nucleotide sequence which varies from that of SEQ ID NO: I or 2 and which retains its ability to amplify the complementary DNA (cDNA) amplicon amplified from SARS-CoV-2 cDNA by SEQ ID NOs: 1 and 2 (i.e. SEQ ID NO: 4). The term "amplified" refers to the process of making multiple copies of the polynucleotide, such as cDNA, from a single polynucleotide or fewer polynucleotides.

A variant "specifically hybridises" to its target sequence when it hybridises with preferential or high affinity to the partner but does not substantially hybridise, does not hybridise or hybridises with only low affinity to other polynucleotides, especially other sequences in SARS-CoV-2. Conditions that permit the hybridisation are well-known in the art (for example, Sambrook el al., 2001, Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al., Eds., Greene Publishing and Wileylnterscience, New York (1995)). Hybridisation can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaC1 and 1)/)) SDS (sodium dodecyl sulfate) at 37°C followed by a 20 wash in from I X (0.1650 M Na+) to 2X (0.33 M o Na+) SSC (standard sodium citrate) at 50°C. Hybridisation can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaC1, and 1 % SDS at 37°C. followed by a wash in from 0.5X (0.0825 M Na+) to 1X (0.1650 M Na+) SSC at 55 °C. Hybridisation can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 MNaCI, 1% SDS at 37 °C, followed by a wash in IS 0.1X (0.0165 MNa+) SSC at 60°C. A variant "specifically hybridises' if it hybridises to its partner with a melting temperature (Tm) that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C or at least 10 °C, greater than its Tm for other polynucleotides. More preferably, the variant hybridises to its partner with a Tm that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for other polynucleotides.

Preferably, the variant hybridises to its partner with a Tm that is at least 2 °C, such as at least 3 °C, at least 4 °C, at least 5 °C, at least 6 °C, at least 7 °C, at least 8 °C, at least 9 °C, at least 10 °C, at least 20 °C, at least 30 °C or at least 40 °C, greater than its Tm for a polynucleotide which differs from its partner by one or more nucleotides, such as by 1, 2, 3, 4 or 5 or more nucleotides. The variant typically hybridises to its target sequence with a Tm of at least 90 °C., such as at least 92°C or at least 95 °C. Tm can be measured experimentally using known techniques, including the use of DNA microarrays, or can be calculated using publicly available Tm calculators, such as those available over the intemet. The variant sequence may comprise any of the nucleotides discussed above, including the modified nucleotides. The variant sequence is typically the same length as SEQ ID NO: I or 2, but may be longer or shorter. A variant of SEQ ID NO: 1 is preferably at least 20 nucleotides in length, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length. A variant of SEQ ID NO: 2 is preferably at least 19 nucleotides in length, such as 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length.

Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence is at least about 80% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence has at least about 80% identity to that sequence. Homology based on sequence identity and identity are interchangeable herein. This allows for variation, deletion, addition or a combination thereof of five nucleotides within the sequence of SEQ ID NO: 1.

Over the entire length of the sequence of SEQ ID NO: I, a variant sequence is preferably at least about 84% or at least about 86.2% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence preferably has at least about 84% or at least about 86.2% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of Four nucleotides within the sequence of SEQ ID NO: 1.

Over the entire length of the sequence of SEQ ID NO: I, a variant sequence is preferably at least about 88% or at least about 89.2% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence preferably has at least about 88% or at least about 89.2% identity to that sequence. This allows for variation, deletion, IS addition or a combination thereof of three nucleotides within the sequence of SEQ ID NO: 1.

Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence is preferably at least about 92% or at least about 92.5% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence preferably has at least about 92% or at least about 92.5% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of two nucleotides within the sequence of SEQ ID NO: 1.

Over the entire length of the sequence of SEQ ID NO: I, a variant sequence is preferably at least about 96% or at least about 96.1% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 1, a variant sequence preferably has at least about 96% or at least about 96.1% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of one nucleotide within the sequence of SEQ ID NO: I. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence is preferably at least about 79%, at least about 79.16%, at least about 79.17% or at least about 82.7% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence preferably has at least about 79%, at least about 79.16%, at least about 79.17% or at least about 82.7% identity to that sequence. This allows For variation, deletion, addition or a combination thereof of five nucleotides within the sequence of SEQ ID NO: 2.

Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence is preferably at least about 80%, at least about 83.3% or at least about 85.7% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence preferably has at least about 80%, at least about 83.3% or at least about 85.7% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of four nucleotides within the sequence of SEQ ID NO: 2.

Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence is preferably at least about 85%, at least about 87.5% or at least about 88.8% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence preferably has at least about 85%, at least about 87.5% or at least about 88.8% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of three nucleotides within the o sequence of SEQ ID NO: 2.

Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence is preferably at least about 90%, at least about 91.66%, at least about 91.67% or at least about 92.3% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence preferably has at least about 90%, at least about 91.66%, at least about 91.67% or at least about 92.3% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of two nucleotides within the sequence of SEQ ID NO: 2.

Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence is preferably at least about 95%, at least about 95.8% or at least about 96% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 2, a variant sequence preferably has at least about 95%, at least about 95.8% or at least about 96% identity to that sequence.

This allows for variation, deletion, addition or a combination thereof of one nucleotide within the sequence of SEQ ID NO: 2.

Methods of measuring homology based on sequence identity or identity are known in the art. For example the UWGCG Package provides the BESTFTT program which can be used to calculate homology or identity (e.g. used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395).

The PILEUP and BLAST algorithms can also be used to calculate identity, homology or line up sequences (typically on their default settings), for example as described in Altschul S.F. (1993) J Mol Evol 36:290-300; Altschul, S. F et al (1990) J Mol Biol 215:403-10.

Software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information (http://www.ncbi.nlmmih.goW). This algorithm involves first identifying high scoring sequence pair (I-ISPs) by identifying short words of length Win the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl, Acad, Sci, USA 89:10915-10919) alignments (B) o150, expectation (E) of 10, M=5, o N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences, see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

A variant is typically identical to SEQ ID NO: 1 over at least about 20, at least about 21, at least about 22, at least about 23, at least about 24 or at least about 25 consecutive nucleotides. A variant is typically identical to SEQ ID NO: 2 over at least about 19, at least about 20, at least about 21, at least about 22, at least about 23 or at least about 24 consecutive nucleotides.

Each polynucleotide in the primer may be any length. The forward primer is preferably at least 20 nucleotides in length, such as 20, 21, 22, 23, 24, 25, 26, 27, 28,29 or 30 nucleotides in length. The reverse primer is at least 19 nucleotides in length, such as 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length.

The forward primer preferably comprises or consists of the exact sequence shown in SEQ ID NO: 1. The reverse primer preferably comprises or consists of the exact sequence shown in SEQ ID NO: 2.

The forward primer preferably is the exact sequence shown in SEQ ID NO: 1. The reverse primer preferably is the exact sequence shown in SEQ ID NO: 2.

The fonvard primer preferably is DNA and comprises/consist of the exact sequence shown In SEQ ID NO: 1. The reverse primer preferably is DNA and comprises/consists of the exact sequence shown in SEQ ID NO: 2.

The pair of primers may comprise any combination of primers discussed above. The pair of primers may comprise a forward primer that comprises/consist of the exact sequence shown in SEQ ID NO: I and a reverse primer that comprises/consists of a variant of SEQ ID NO: 2 as discussed above. The pair of primers may comprise a forward primer that comprises/consists of a variant of SEQ ID NO: 1 as discussed above and a reverse primer that comprises/consists of the exact sequence of SEQ ID NO: 2. The pair of primers may comprise a forward primer that comprises/consists a variant of SEQ ID NO: 1 as discussed above and a reverse primer that comprises/consists of a variant of SEQ ID NO: 2 as discussed above.

The pair of primers more preferably comprises a forward primer which comprises or consists of the exact sequence shown in SEQ ID NO: I and a reverse primer which comprises or consists of the exact sequence shown in SEQ ID NO: 2. The pair of primers more preferably comprises a forward primer that is the exact sequence shown in SEQ ID NO: I and a reverse primer that is the exact sequence shown in SEQ ID NO: 2.

The pair of primers most preferably comprises a forward primer that is DNA and comprises/ or consists of the exact sequence shown in SEQ ID NO: 1 and a reverse primer that is preferably DNA and comprises/ or consists of the exact sequence shown in SEQ ID NO: 2.

Primers having any of the sequences above may be manufactured using standard techniques. Custom primers having specific sequences are commercially available from various suppliers (such as Biolegio).

cDNA amplicons of the invention The invention also provides a complementary DNA (cDNA) amplicon amplified from SARSCoV-2 cDNA by the pair of primers of the invention. The invention also provides a cDNA amplicon amplified from SARS-CoV-2 cDNA and comprising or consisting of a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3. Specific hybridisation is defined above with reference to the primers of the invention. The cDNA amplicon is preferably amplified from SARS-CoV-2 cDNA and comprises or consists of a sequence which is complementary to the sequence shown in SEQ ID NO: 3.

SARS-CoV-2 cDNA is cDNA produced by the reverse transcription of SARS-CoV-2 RNA, The sequence of SARS-CoV-2 cDNA is published (see above) and methods for reverse transcribing it are known in the art and discussed in the Example. Once the SARS-CoV-2 cDNA has been reversed transcribed, the pair of primers of the invention may be used to amplify the cDNA amplicon of the invention using polymerase chain reaction (PCR). Methods for conducting PCR using primers are known in the art and discussed below and in the Examples. A cDNA amplicon is amplified from SARS-CoV-2 cDNA if it comprises a portionipart of the SARS-CoV-2 cDNA. In other words, it comprises a portion/part of the sequence of the SARS-CoV-2 cDNA.

The term "amplified" refers to the process of making multiple copies of the cDNA from a single polynucleotide or fewer polynucleotides. An amplicon is the cDNA that results from amplification. In the context of the invention, primers, such as the primers of the invention, may be used to amplify a part of the SARS-CoV-2 cDNA resulting in the shorter cDNA amplicons of the invention. These amplicons typically contain the cDNA target sequence being used in the context of the invention.

The cDNA amplicon is typically a polynucleotide comprising nucleotides selected from dAMP, o dTMP, dGMP or dCMP as discussed above. The cDNA may be double stranded or single stranded. The cDNA is preferably single stranded The cDNA amplicon may be any length, such as from about 20 to about 120 nucleotides in the length, such as from about 25 to about 100, from about 30 to about 95 or from about 40 to about 90 nucleotides in length. The cDNA amplicon is preferably 82 nucleotides in length.

The cDNA amplicon preferably comprises or consists of the sequence shown in SEQ ID NO: 4.

The cDNA amplicon preferably comprises or consists of the sequence shown in SEQ ID NO: 5.

The cDNA amplicon may be isolated, substantially isolated, purified or substantially purified as discussed above. The cDNA amplicon is not naturally occurring.

Polvnucleotide probes of the invention The invention also provides polynucleotide probes for determining the presence or absence of SARS-CoV-2 in a sample.

In one embodiment, the polynucleotide probe specifically hybridises to the cDNA amplicon of the invention. The polynucleotide probe comprises or consists of a sequence which specifically hybridises to the cDNA amplicon of the invention. The polynucleotide probe preferably comprises or consists of a sequence which specifically hybridises to a target sequence on the cDNA amplicon of the invention. The target sequence may be any length, such as from 17 to 32 nucleotides in length, such as 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 32 nucleotides in length. Polynucleotides and specific hybridisation are defined above with reference to the primers of the invention. The probe polynucleotide may be any of the polynucleotides discussed above. The polynucleotide probe is preferably DNA. The polynucleotide probe is preferably single stranded DNA. The polynucleotide probe may be any length, such as from 17 to 32 nucleotides in length, such as 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or 32 nucleotides in length. The polynucleotide probe is preferably the same length as the target sequence it detects. The target sequence is preferably specific for SARS-CoV-2. The target sequence is preferably found/present in SARS-Cov-2 cDNA but is not found in the RNA of any other virus or human virus. The target sequence is preferably found/present in SARS-Cov-2 cDNA but is not found in the RNA of any other virus or human virus or in any human RNA. The target sequence is preferably found/present in the cDNA amplicon of the invention. The target sequence is preferably part of SEQ ID NO: 4. The target sequence is preferably the sequence shown in SEQ ID NO: 5.

In another embodiment, the polynucleotide probe comprises or consists of the sequence shown in SEQ ID NO: 3 or a variant thereof having at least about 80% homology to SEQ ID NO: 3 based on o sequence identity over its entire length. Polynucleotides are defined above with reference to the primers of the invention. The probe polynucleotide may be any of the polynucleotides discussed above. The polynucleotide probe is preferably DNA. The polynucleotide probe is preferably single stranded DNA. The polynucleotide probe may be any length, such as from 20 to 30 nucleotides in length, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

A variant sequence is a polynucleotide that has a nucleotide sequence which varies from that of SEQ ID NO: 3 and which retains its ability to specifically hybridise to the target sequence of SEQ ID NO: 5. Specific hybridisation is discussed above. The variant sequence must not recognise or hybridise to any cDNA sequence from any other virus.

The variant sequence may comprise any of the nucleotides discussed above, including the modified nucleotides. The variant sequence is typically the same length as SEQ ID NO: 3, but may be longer or shorter. A variant of SEQ ID NO: 3 is preferably at least 20 nucleotides in length, such as 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence is at least about 80% or at least about 83.3% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence has at least about 80% or at least about 83.3% identity to that sequence. Homology based on sequence identity and identity are interchangeable herein. This allows for variation, deletion, addition or a combination thereof of five nucleotides within the sequence of SEQ ID NO: 3.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence is preferably at least about 84% or at least about 86.2% homologous to that sequence based on nucleotide identity.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence preferably has at least about 84% or at least about 86.2% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of four nucleotides within the sequence of SEQ ID NO: 3.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence is preferably at least about 88% or at least about 89.2% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence preferably has at least about 88% or at least about 89.2% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of three nucleotides within the sequence of SEQ ID NO: 3.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence is preferably at least about 92% or at least about 92.5% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence preferably has at least about 92% or at least about 92.5% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of two nucleotides within the sequence of SEQ ID NO: 3.

Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence is preferably at least about 96% or at least about 96.1% homologous to that sequence based on nucleotide identity. Over the entire length of the sequence of SEQ ID NO: 3, a variant sequence preferably has at least about 96% or at least about 96.1% identity to that sequence. This allows for variation, deletion, addition or a combination thereof of one nucleotide within the sequence of SEQ ID NO: 3.

The polynucleotide probe preferably comprises or consists of the sequence shown in SEQ ID NO: 3.

The polynucleotide probe may be isolated, substantially isolated, purified or substantially purified as discussed above. The polynucleotide probe is not naturally occurring.

The polynucleotide probe is preferably DNA probe, a TaqMan probe, a molecular beacon or a scorpion probe. DNA probes hybridise to the, typically complementary, target sequence and then can be detected. TaqMan probes are known in the art and are polynucleotides that have a fluorescent dye attached to the 5' end and a quencher to the 3' end. The polymerase used in PCR cleaves hybridised probes freeing the fluorescent dye from quenching such it can be detected. Molecular beacon probes are known in the art and are similar to TaqMan probes except (rather than using cleavage to separate the dye from the quencher) hybridisation to the target sequence separates the dye from the quencher. Scorpion probes are known the art and are similar to molecular beacons except the 3' end also contains a sequence that is complementary to the extension product of the primer on the 5' end which opens the probe on hybridisation and allows the dye to be detected. The polynucleotide probe is preferably a TaqMan probe.

The polynucleotide probes of the invention are preferably detectably-labelled. Suitable detectable labels are known in the art. The detectable labels are preferably fluorescent molecules or dyes, such as fluorescein derivatives. Suitable fluorescent molecules or dyes include, but are not limited to, 6-carboxyfluorescein (FAM), 6-Carboxyl-X-Rhodamine (ROX), 2-chloro-7phemr1-1,4-dichloro-6-carboxy-finorescein (VICO, Hexachloro-Fluorescein (HEX) and tetrachloroiluorescein (MT). A suitable quencher for use with these dyes in TaqMan, molecular beacon or scorpion probes is tetramethylrhodamine (TAMRA).

The detectable label is most preferably 6-carboxyfluorescein (PAM).

Polynudeotide probes are also available from commercial sources (such as Biolegio).

Target cDNA sequence The invention also provides a target cDNA polynucleotide comprising or consisting of a o sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3. Specific hybridisation is discussed above. The target cDNA may be any length. It is typically 25 nucleotides in length. The target cDNA polynucleotide preferably comprises or consists of the sequence shown in SEQ ID NO: 5. The target cDNA polynucleotide may be double stranded or single stranded. The target cDNA polynucleotide is preferably single stranded. The target cDNA polynucleotide may be isolated, substantially isolated, purified or substantially purified as discussed above. The target cDNA polynucleotide is not naturally occurring.

Kits of the invention The invention also provides a kit for determining the presence or absence of SARS-CoV-2 in a sample. The kit comprises a pair of primers of the invention. The kit also comprises a polynucleotide probe of the invention. Any of the primers and probes discussed above may be used. The primers and probes may be isolated, substantially isolated, purified or substantially purified as discussed above.

The kit preferably further comprises a positive control polynucleotide comprising or consisting of a cDNA amplicon of the invention and/or a target cDNA polynucleotide of the invention. These may form the basis of a positive control for RT-PCR. Any of the cDNA amplicons and cDNA target sequences discussed above may be used. The kit preferably comprises a polynucleotide comprising or consisting of the sequence shown in SEQ ID NO: 4 or 5. The cDNA polynucleotides may be isolated, substantially isolated, purified or substantially purified as discussed above. The kit preferably contains a negative control, such as DNAase-free and RNAase-free water.

The kit of the invention preferably further comprises a RNA Internal Extraction Control (IEC).

The kit more preferably comprises a set of RNA IEC primers and probe. The RNA IEC primers and probe are preferably DNA. DNA primers and probes are discussed above. The set of RNA IEC primers and probe preferably comprises: * RNA IEC L.lactis Forward primer (SEQ ID NO:6); * RNA IEC L.lactis Reverse primer (SEQ ID NO: 7); * RNA IEC L.lactis Probe 1 (SEQ ID NO: 8); and * RNA IEC L.lactis Probe 2 (SEQ ID NO: 9).

The kit may additionally comprise one or more other reagents or instruments which enable any of the embodiments of the methods below to be carried out. Such reagents or instruments include, but are not limited to, one or more of the following: suitable buffer(s) (aqueous solutions), means to obtain to a sample from a patient (such as a vessel or an instrument comprising a needle or a swab) or tubes in which quantitative reactions can be done. The kit may, optionally, comprise instructions to enable the kit to be used in the methods of the invention or details regarding which patients may be tested. The kit may further comprise any of the reagents required to conduct RT-PCR discussed below, including a reverse transcriptase and/or heat-stable DNA polymerase.

Method of determining the presence or absence of SARS-CoV-2 in a sample The invention provides various methods of' determining the presence or absence of SARS-CoV2 in a sample. All of the methods comprise conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample. Methods for conducting RT-PCR are well known in the art and any suitable conditions may be used. Reverse transcription involves the use of the enzyme reverse transcriptase to convert viral RNA into cDNA. In the context of the invention. PCR involves using the primers to amplify a specific portion of the cDNA, namely the cDNA amplicon, which typically contains the target cDNA of interest.

Methods for reverse transcription are well known in the art and reverse transcriptases are commercially available (e.g. Superscript® If reverse transcriptase (Invitrogen) and Affinity script (Agilent)). Methods typically construct cDNA from random cDNA hexamers included in the reaction mixture.

PCR involves amplifying a cDNA amplicon using a heat-stable DNA polymerase and a pair of forward and reverse polynucleotide primers. Because the newly synthesized cDNA strands can subsequently serve as additional templates for the same primer sequences, successive rounds of primer annealing, strand elongation, and dissociation produce rapid and highly specific amplification of the desired sequence. Many polymerase chain methods are known to those of skill in the art and may be used in the methods of the invention. For example, cDNA can be subjected to 20 to 40 cycles of amplification in a thermocycler as follows: 95°C for 30 sec, 52° to 60°C for 1 mm, and 72°C for 1 min, with a final extension step of 72°C for 5 min. For another example, cDNA can be subjected to 20 to 40 polymerase chain reaction cycles in a thennocycler at a denaturing temperature of 95°C for 30 sec, followed by varying annealing temperatures ranging from 54°C to 58°C for 1 min, an extension step at 70°C for I min, with a final extension step at 70°C for 5 mm. Heat stable DNA polymerases are commercially available (such as GoTaq (12 (Promega)).

The RT-PCR assay may be conducted using the conditions set out in the Examples. The reverse transcriptase is preferably Affinity script (Agilent). The DNA polymerase is preferably GoTaq G2 (Promega). Both enzymes are preferably present in a 2x mastermix. The reaction mix is preferably lOul 2x oasig mastermix, 2u1 primer/probe mix (resuspended in template preparation buffer) and 8u1 sample The RT-PCR assay may be conducted using the conditions set out in the Examples. The reverse transcriptase is preferably Affinity script (Agilent). The DNA polymerase is preferably GoTaq G2 (Promega). Both enzymes are preferably present in an Oasig Onestep mastermix. The reaction mix is preferably lOul Oasig Onestep mastennix resuspended in 525u1 Oasig resuspension buffer, lul primer/probe mix, 4u1 of DNA/RNAase free water and from Sul to 500u1 sample. The concentrations of the primers and probe are preferably 1.75pmolitul forward primer, 1.75pmoblul reverse primer and 2pmol/u1 probe.

Oasig Onestep mastermix components: * dNTPs (100mM) * goTAQ 62 * Affinity Script * SSB4 (10mg/m1 (T7 single stranded binding protein) * iMTrizmapH8.5 * Excipients -Component buffer * Trizmak hydrochloride * Trizmat base * Potassium chloride * EGTA * Magnesium chloride * Ammonium sulphate * DNAse/RNase free water * Glycerol * D-Mannitol * Sucrose * DNTPs 100mM * 10% TritonX-100 * RNAse/DNAse free water * osrHSA (recombinant human serum albumin) The reaction conditions are preferably (1) one cycle of reverse transcription for 10 minutes at 55°C. (2) one cycle of initial denaturation and Taq activation for 2 minutes at 95°C and (3) 45 cycles of denaturation for 10 seconds at 95°C and annealing and extension for 60 seconds at 60°C.

The RT-PCR method is preferably real time RT-PCR. This method is known in the art.

In one embodiment, the method comprises using a pair of primers of the invention and detecting the cDNA amplicon amplified by the primers if present. Any method may be used to detect 15 the cDNA amplicon. For instance, the method may use SYBR Green to detect the cDNA amplicon. When the SYBR Green binds to the cDNA, it emits light and the intensity of the fluorescence increases as the cDNA amplicons accumulate. This technique is easy to use since designing of probes is not necessary given lack of specificity of its binding. The method preferably uses a polynucleotide probe of the invention which specifically hybridises to the cDNA amplicon. The probe may be any of those discussed above. The use of the probe allows the specific cDNA amplicon to be identified if present.

The probe is preferably a TaqMan probe.

In another embodiment, the method comprises using a pair of primers that amplifies a cDNA amplicon comprising (or consisting of) a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3 if present. The cDNA amplicon may be any of those discussed above. The cDNA amplicon preferably comprises or consists of SEQ ID NO: 4. The cDNA amplicon preferably comprises or consists of SEQ ID NO: 5. The method also comprises using a polynucleotide probe of the invention which comprises the sequence shown in SEQ ID NO: 3 or a variant thereof as defined above to detect the cDNA amplicon if present. The polynucleotide probe may be any of those discussed above. The probe is preferably a TaqMan probe. The polynucleotide probe specifically hybridises to cDNA amplicon if present. Detection of the cDNA amplicon indicates that the sample contain SARS-CoV-2 (i.e. indicates the presence of SARS-CoV-2 in the sample). A lack of detection of the cDNA amplicon indicates that the sample does not contain SARS-CoV-2 (i.e. indicates the absence of SARS-CoV-2 from the sample).

In another embodiment, the method comprises using a kit of the invention. The kit comprises a pair of primers of the invention and a polynucleotide probe of the invention. The kit may comprise any of the primers and probes discussed above. The pair of primers preferably comprises a forward primer which comprises or consists of the sequence shown in SEQ ID NO: 1 and a reverse primer which comprises of consists of the sequence shown in SEQ ID NO: 2. The polynucleotide probe preferably comprises or consists of the sequence shown in SEQ ID NO: 3. The pair of primers amplifies a cDNA amplicon of the invention and then this is specifically detected using the polynucleotide probe of the invention. Detection of the cDNA amplicon indicates that the sample contain SARS-CoV-2 (i.e. indicates the presence of SARS-CoV-2 in the sample). A lack of detection of the cDNA amplicon indicates that the sample does not contain SARS-CoV-2 (i.e. indicates the absence of SARS-CoV-2 from the sample).

In all embodiments, detection of the cDNA amplicon (i.e. the presence of the cDNA amplicon) indicates that the sample contain SARS-CoV-2 (i.e. indicates the presence of SARS-CoV-2 in the sample). A lack of detection of the cDNA amplicon (i.e. the absence of the cDNA amplicon) indicates that the sample does not contain SARS-CoV-2 (i.e. indicates the absence of SARS-CoV-2 from the sample). Detection of multiple copies of the cDNA amplicon (i.e. the presence of multiple copies of the cDNA amplicon) indicates that the sample contain SARS-CoV-2 (i.e. indicates the presence of SARS-CoV-2 in the sample). A lack of detection of multiple copies of the cDNA amplicon (i.e. the absence of multiple copies of the cDNA amplicon) indicates that the sample does not contain SARSCoV-2 (i.e. indicates the absence of SARS-CoV-2 from the sample).

In all embodiments, the method preferably comprises (a) reverse transcribing any RNA in the sample, (b) contacting any cDNA produced in (a) with the pair of primers under conditions which allow the primers to amplify their cDNA amplicon and (c) determining the presence or absence of the cDNA amplicon. Step (c) preferably uses a polynucleotide probe as described above.

The RT-PCR assay is preferably a one-step RT-PCR assay conducted in one tube or vessel. Such one-step reactions are routine in the art.

In all the embodiments, the method preferably does not comprise extracting RNA from the sample before conducting the RT-PCR assay. In some instances, the methods may comprise extracting any RNA from the sample before conducting the RT-PCR assay. Suitable kits for doing this are commercial available (such as QIAampR) virus RNA mini kit (Qiagen)).

The sample may be any sample. The invention is typically carried out on a sample that is known to contain or suspected to contain SARS-CoV-2. Alternatively, the invention may be carried out on any sample whose SARS-CoV-2 status is unknown to confirm the presence or absence of SARS-CoV-2. The sample may be a biological sample. The sample may be obtained from or extracted from any organism or microorganism. The organism or microorganism may be archaeal, prokaryotic or eukaryotic and typically belongs to one of the five kingdoms: plantae, animalia, fungi, monera and protista. The sample may be obtained from or extracted from any virus. Typically, the sample is human in origin, but alternatively it may be from another mammal animal such as from commercially farmed animals such as horses, cattle, sheep, fish, chickens or pigs or may alternatively be pets such as m cats or dogs. Alternatively, the sample may be of plant origin, such as a sample obtained from a commercial crop, such as a cereal, legume, fruit or vegetable, for example wheat, barley, oats, canola, maize. soya, rice, rhubarb, bananas, apples, tomatoes, potatoes, grapes, tobacco, beans, lentils, sugar cane, cocoa, cotton. The sample may be derived from human or animal food.

The sample is preferably a fluid sample. The sample typically comprises a body fluid of the patient. The sample may be urine, lymph, saliva, mucus, amniotic fluid, blood, plasma or serum. The sample is preferably a nasopharyngeal sample, a saliva sample or a blood sample.

The sample may be a non-biological sample. Any non-biological sample can be tested. The non-biological sample is preferably a fluid sample. Examples of non-biological samples include, but are not limited to, surgical fluids, water such as drinking water, sea water or river water, reagents for laboratory tests and wet swabs of surfaces or materials.

The sample is typically processed prior to being used in the invention, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells. The sample may be tested immediately upon being taken. The sample may also be typically stored prior to assay, preferably below -70°C.

Methods of measuring the SARS-CoV-2 titre The invention also provides methods for measuring the SARS-CoV-2 titre in a sample The method comprises conducting any of the methods discussed above. Any of the methods for determining the presence or absence of SARS-CoV-2 in a sample as discussed above may be used. The quantitative method uses real time RT-PCR. SARS-CoV-2 is present, the method comprises evaluating the cycle quantification (Cq) value and thereby measuring the SARS-CoV-2 titre. The method preferably comprises evaluating the Cq value against standard Cq values generated from standard dilution curves.

In real time RT-PCR, the threshold line is the level of detection or the point at which a reaction reaches a fluorescent intensity above background levels. The threshold level is preferably 10% of the end point fluorescence. Autocalling may be used to set the threshold level.

The Cq is the PCR cycle number at which the sample reaction curve intersects the threshold line. This value indicates how many cycles it took to detect a real signal from the sample. Real-Time PCR machines typically calculate the Cq value for each of sample.

As is clear from Example 2 (Figures 1 to 3), the Cq value changes depending on the amount of SARS-C oV-2 present in the sample. These standard curves allow the amount of SARS-CoV-2 to be measured in sample. In other words, the Cq is predictive of the amount of the SARS-CoV-2 in the sample.

In a preferred method, a Cq value of about 16.00 to about 20.99, preferably about 18.00 to about 19.99, indicates the sample contains about 106 virions/RI. a Cq value of about 21.00 to about 25.99 indicates the sample contains about 105 virions/pl, a Cq value of about 26.00 to about 28.99, preferably from about 26.00 to about 27.99, indicates the sample contains about 104 virions/pl, a Cq value of about 29.00 to about 31.99, preferably 30.10, indicates the sample contains about 103 virions/RI, a Cq value of about 32.00 to about 33.99, preferably from about 33.00 to about 33.99, indicates the sample contains about 102 virions/pl, a Cq value of above 34.00 or above indicates the sample contains 10 or fewer virions/pl. A Cq value of 38.00, 39.00 or 40.00 or above preferably indicates the sample contains 5 or fewer virions/pl. In all cases, the virions are SARS-CoV-2 virions.

All of the Cq values above are preferably mean Cq values derived from multiple experiments. The Cq values are typically expressed to two significant figures. In all concentration cases in this paragraph, the sample refers to the (undiluted) sample that is added to (and diluted by) the RT-PCR assay mixture. The concentrations do not relate to the final concentration of the virions in the diluted RT-PCR assay mixture. Tithe sample, for instance from a patient, is diluted or concentrated before it is used in the RT-PCR assay, the dilution factor or concentration factor needs to be taken into account when calculating the the amount of SARS-CoV-2 present in the sample.

The invention also provides a method for differentiating between high and low SARS-CoV-2 titres in a sample. The method comprises conducting any of the methods discussed above. Any of the methods for determining the presence or absence of SARS-CoV-2 in a sample as discussed above may be used. The method uses real time RT-PCR. if SARS-CoV-2 is present, the method comprises evaluating the cycle quantification (Cq) value and thereby determining whether the sample has a low or high SARS-CoV-2 titre. Cq measurement and evaluation is discussed above.

As is clear from Example 2 (Figures 1 to 3), the Cq value changes depending on the amount of SARS-CoV-2 in a sample. These standard curves allow the amount of SARS-CoV-2 to be measured in a sample. In other words, the Cq is predictive of the amount of the SARS-CoV-2 in the sample.

In a preferred method, a low SARS-CoV-2 titre is about 102 virions411 or lower and a high SARS-CoV-2 titre is about 103 virions4i1 or higher. In this method, a Cq value of about 32.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 31.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 10 virions/RI or lower and a high SARS-CoV-2 titre is about I 03 virions/1.11 or higher. in this method, a Cq value of about 34.00 or above o indicates the sample has a low SARS-CoV-2 titre and a Cq value of 31.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 102 virions/pl or lower and a high SARS-CoV-2 titre is about I 04 virions/R1 or higher. in this method, a Cq value of about 32.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 28.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 10 virions/RI or lower and a high SARS-CoV-2 titre is about 104 virions/pl or higher. In this method, a Cq value of about 34.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 28.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 102 virions411 or lower and a high SARS-CoV-2 titre is about 105 virions1i1 or higher. In this method, a Cq value of about 32.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 25.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 10 virions/1.11 or lower and a high SARS-CoV-2 titre is about 105 virions/1.11 or higher, in this method, a Cq value of about 34.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 25.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 102 virions/pl or lower and a high SARS-CoV-2 titre is about 10' virions/RI or higher, in this method, a Cq value of about 32.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 20.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a low SARS-CoV-2 titre is about 10 virions/pl or lower and a high SARS-CoV-2 titre is about 106 virions/RI or higher. In this method, a Cq value of about 34.00 or above indicates the sample has a low SARS-CoV-2 titre and a Cq value of 20.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In all cases, the virions are SARS-CoV-2 virions. All of the Cq values above are preferably mean Cq values derived from multiple experiments. The Cq values are typically expressed to two significant figures.

The quantitative methods of the invention preferably use a forward primer which comprises or consists of the sequence shown in SEQ ID NO: 1, a reverse primer which comprises of consists of the sequence shown in SEQ ID NO: 2 and a probe which comprises or consists of the sequence shown in SEQ ID NO: 3. The probe is preferably a TaqMan probe. The method is preferably conducted under o the same conditions as the Examples. These conditions are discussed above.

Method of diagnosis of the invention The invention also provides a method of determining whether or not a patient is infected with SARS-CoV-2. The invention therefore relates to the diagnosis of SARS-CoV-2 infection. The IS diagnostic method of the invention may be carried out in conjunction with other assays or genetic tests.

The method comprises conducting a method of the invention for determining the presence or absence of SARS-CoV-2 on a sample from the patient. Any of the methods discussed above may be used. The presence of SARS-CoV-2 in the sample indicates the presence of SARS-CoV-2 in the patient. The presence of SARS-CoV-2 in the sample indicates the patient is infected with SARS-CoV-2. The absence of SARS-CoV-2 from the sample typically indicates the absence of SARS-CoV-2 in the patient. The absence of SARS-CoV-2 from the sample typically indicates the patient is not infected with SARS-CoV-2. The absence of SARS-CoV-2 from the sample may indicate that the particular sample from the patient does not contain SARS-CoV-2 and does not necessarily mean the patient is not infected. The diagnostic method preferably uses a nasopharyngeal sample or a saliva sample. The absence of SARS-CoV-2 from these samples does typically indicate the patient is not infected with SARS-CoV-2.

The invention also provides a method of measuring the titre of SARS-CoV-2 in a patient. The invention also provides a method for differentiating between high and low SARS-CoV-2 titres in a patient. These methods comprise conducting the quantitative method of the invention for measuring the titre of S ARS-CoV-2 or for differentiating between high and low SARS-CoV-2 titres on a sample from the patient. Low SARS-CoV-2 titres, high SARS-CoV-2 titres and methods for measuring them are discussed above. Any of these may be used on a sample from the patient.

The quantitative method preferably uses a nasopharyngeal sample or a sal v a sample.

The diagnostic and quantitative methods preferably comprise taking a sample from the patient before conducting the RT-PCR assay.

Typically, the patient displays the symptoms of SARS-CoV-2, i.e. the patient is known or expected to be infected with SARS-CoV-2. The patient may be asymptomatic, i.e. the patient's SARS-CoV-2 status is unknown or the patient is expected not to be infected with SARS-CoV-2. The patient may be susceptible to, or at risk from, infection with SARS-CoV-2. The patient is may have underlying health conditions which make infection with SARS-CoV-2 particularly serious.

The patient is generally a human patient. The patient may be a fetus, a newborn, an infant, a juvenile or an adult.

Therapeutic methods of the invention The invention provides a method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method of the invention. The method comprises administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment.

The invention also provides a method of treating SARS-CoV-2 in a patient. The method comprises (a) identifying the patient as being infected with SARS-CoV-2 using a method of the invention and (b) administering to the patient a therapeutically effective amount of an anti-SARS-CoV2 treatment.

The invention also provides a substance or composition for use in a method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method of the invention. The invention also provides a substance or composition for use in a method of treating SARS-CoV-2 in a patient, wherein the method comprises (a) identifying the patient as being infected with SARS-CoV-2 using a method of the invention and (b) administering the substance of composition to the patient. The substance or composition is preferably an anti-SARS-CoV-2 substance or composition.

The invention also provides a method of treating SARS-CoV-2 in a patient identified as having a high SARS-CoV-2 titre using a method of the invention. The method comprises administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment. The invention also provides a method of treating SARS-CoV-2 in a patient comprising (a) identifying the patient as having a high SARS-CoV-2 titre using a method of the invention and (b) administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment, in a preferred method, the high SARS-CoV-2 titre is about 103 virions/u1 or higher. in this method, a Cq value of about 31.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a high SARS-CoV-2 titre is about 104 virions1u1 or higher. In this method, a Cq value of about 25.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a high SARS-CoV-2 titre is about 105 virions/u1 or higher. In this method, a Cq value of about 28.99 or lower indicates the sample has a high SARS-CoV-2 titre.

In a preferred method, a high SARS-CoV-2 titre is about 106 virions411 or higher. In this method, a Cq value of about 20.99 or lower indicates the sample has a high SARS-CoV-2 titre.

The invention also provides a substance or composition for use in a method of treating SARSCoV-2 in a patient identified as being having a high SARS-CoV-2 titre using a method of the invention. The invention also provides a substance or composition for use in a method of treating SARS-CoV-2 in a patient, wherein the method comprises (a) identifying the patient as being having a high SARS-CoV- 2 titre using a method of the invention and (b) administering the substance or composition to the patient. The substance or composition is preferably an anti-SARS-CoV-2 substance or composition Any treatment, substance or composition may be used in the invention. Suitable anti-SARSCoV-2 treatments, substances and compositions are well known. The anti-SARS-CoV-2 treatment, substance or composition may inhibit viral entry into cells by inhibiting ACE2 receptors, such as ACE2 receptor antibodies or arbidol, or inhibiting TMPRSS2, such as camosat mesylate. The anti-SARSCoV-2 treatment, substance or composition may inhibit 3-chymotrypsin-like protease, such as lopinavir or darunavir. The anti-SARS-CoV-2 treatment, substance or composition may inhibit viral replication by inhibiting viral RNA-dependent RNA polymerase (RdRP), such as ribavirin, remdesivir or favipiravir. The anti-SARS-CoV-2 treatment, substance or composition may be an anti-SARS-CoV-2 small interfering RNA (siRNA) designed to inhibit entry of the virus into cells and/or inhibit viral replication by targeting SARS-CoV-2 genes involved in these processes. Some patients infected with SARS-Cov-2, especially patients with a high SARS-Cov-2 titre, suffer serious immune responses, including cytokine storms. IL-6 has been shown to be partly responsible for such c"okine storms. The anti-SARS-CoV-2 treatment, substance or composition may be an anti-IL-6 therapy or antibody, such as tocilicumab or sarilumab. The anti-SARS-CoV-2 treatment, substance or composition may be any anti-inflammatory and inhibitor of immune responses.

The invention also provides a method of treating SARS-CoV-2 in a patient identified as having a high SARS-CoV-2 titre using a method of the invention. The method comprises administering to the patient a therapeutically effective amount of an anti-IL-6 therapy or antibody. The invention also provides a method of treating SARS-CoV-2 in a patient comprising (a) identifying the patient as having a high SARS-CoV-2 titre using a method of the invention and (b) administering to the patient a therapeutically effective amount of an anti-IL-6 therapy or antibody. High SARS-CoV-2 titres and methods of measuring them are discussed above.

The invention also provides an anti-1L-6 therapy or antibody for use in a method of treating SARS-CoV-2 in a patient identified as being having a high SARS-CoV-2 titre using a method of the invention. The invention also provides an anti-IL-6 therapy or antibody for use in a method of treating SARS-CoV-2 in a patient, wherein the method comprises (a) identifying the patient as being having a high SARS-CoV-2 titre using a method of the invention and (b) administering the an anti-1L-6 therapy or antibody to the patient.

The invention concerns administering to the patient a therapeutically effective mount of the treatment, substance or composition to the patient. A therapeutically effective amount is an amount which ameliorates one or more symptoms of the SARS-CoV-2 infection. A therapeutically effective amount is preferably a number which abolishes one or symptoms of the SARS-CoV-2 infection. A therapeutically effective amount may cure or abolish the SARS-CoV-2 infection Suitable amounts are discussed in more detail below.

The composition of the invention may be administered to any suitable patient. Suitable patients are discussed above with reference to the diagnostic embodiments of the invention.

The invention may be used in combination with other means of, and substances for, treating the disease or disorder or providing pain relief In some cases, the treatment, substance or composition may be used in combination with existing treatments for the SARS-CoV-2 infection including intensive care treatment and the use of ventilators.

The treatment, substance or composition of the invention may be formulated using any suitable method. Formulation with standard pharmaceutically acceptable carriers and/or excipients may be carried out using routine methods in the pharmaceutical art. The exact nature of a formulation will depend upon several factors including the composition to be administered and the desired route of administration. Suitable types of formulation are fully described in Remington's Pharmaceutical Sciences, 10 Edition, Mack Publishing Company, Eastern Pennsylvania, USA.

The treatment, substance or composition may be administered by any route. Suitable routes include, but are not limited to, enteral or parenteral routes such as via buccal, anal, pulmonmy, intravenous, intra-arterial, intramuscular, intraperitoneal, intraarticular, topical and other appropriate routes. If the lungs are being treated, the treatment, substance or composition is preferably administered by inhalation.

Pharmaceutical compositions may be prepared together with a physiologically acceptable carrier or diluent. The treatment, substance or composition may be mixed with an excipient which is pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, of the like and combinations thereof.

Liquid dispersions for oral administration may be syrups, emulsions or suspensions. The syrups may contain as carriers, for example, saccharose or saccharose with glycerine and/or mannitol and/or sorbitol.

Suspensions and emulsions may contain as carrier, for example a natural gum, agar, sodium alginate, pectin, methylcellulose, carboxymethylcellulose, or polyvinyl alcohol. The suspensions or o solutions for intramuscular injections may contain, together with the active substance, a pharmaceutically acceptable carrier, e.g. sterile water, olive oil, ethyl oleate, glycols, e.g. propylene glycol, and if desired, a suitable amount of lidocaine hydrochloride.

Solutions for intravenous administration or infusion may contain as carrier, for example, sterile water or preferably they may be in the form of sterile, aqueous, isotonic saline solutions.

For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%.

Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions typically take the form of solutions or suspensions and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the pharmaceutical composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. a suspension. Reconstitution is preferably effected in buffer.

In addition, if desired, the pharmaceutical compositions of the invention may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance effectiveness. The composition preferably comprises human serum albumin. One suitable carrier or diluents is Plasma-Lyte A®. This is a sterile, nonpyrogenic isotonic solution for intravenous administration. Each 100 int contains 526 mg of Sodium Chloride, USP (NaC1); 502 mg of Sodium Gluconate (C6H11Na07); 368 mg of Sodium Acetate Trihydrate, USP 30 (C2H3Na02-3H20). 37 mg of Potassium Chloride. USP (KC1); and 30 mg of Magnesium Chloride, USP (MgC12.6H20). It contains no antimicrobial agents. The pH is adjusted with sodium hydroxide. The pH is 7.4 (6.5 to 8.0).

If the treatment, substance or composition is a siRNA, the most preferred pharmaceutically acceptable carrier or diluent is a pharmaceutically acceptable transfection reagent. A pharmaceutical acceptable transfection reagent is suitable for administration to patients. The pharmaceutical acceptable transfection reagent may be liposomes, preferably cationic liposomes, polymers, preferably cationic polymers, and dendrimers. The pharmaceutical acceptable transfection reagent is more preferably a pharmaceutically acceptable PEI transfection reagent, such as a linear PEI transfection reagent. The most preferred pharmaceutical acceptable transfection reagent is GMP in vivo-jetPEI(k). The composition is administered in a manner compatible with the dosage formulation and in such amount will be therapeutically effective. The quantity to be administered depends on the subject to be treated, capacity of the patient's immune system and the degree of treatment desired. Precise amounts required to be administered may depend on the judgement of the practitioner and may be peculiar to each patient.

Any suitable dose of the treatment, substance or composition may be administered to a patient. The dose may be determined according to various parameters, especially according to the substance used; the age, weight and condition of the patient to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular patient. A typical daily dose is from about 0.01 to 50 mg per kg of body weight, according to the activity of the specific substance, the age, weight and conditions of the subject to be treated and the frequency and route of administration. Preferably, daily dosage levels are from 5 mg to 2g. For example, from about 0.01 to about 50mg per kg of patient of sRNA may administered, such as from about 0.05 to about 40, from about 0.1 to about 30, from about 0.5 to about 20, from about 1 to about 10 or from about 2 to about 5 mg per kg. At least about 0.01 mg per kg of patient may administered, such as at least about 0.05, at least about 0. 1, at least about 0.5, at least about I, at least about 2, at least about 5, at least about 10, at least about 20, at least at least about 30 or at least about 40 mg per kg.

These doses may be provided as a single dose or may be provided as multiple doses, for example taken at regular intervals, for example 2, 3 or 4 doses administered daily. Other suitable regular intervals include, but are not limited to, every day, every week, every fortnight or every month.

The following Examples illustrates the invention.

Examples

Example 1 -RT-PCR

Ten RT-PCR assays were conducted on Human 2019-nCoV RNA (Purified RNA of Coronavirus strain "BetaCoV/Germany/BavPat1/2020 p.1" grown in cell culture obtained from EVAg: haps://ww.europeaii-rus-archi e.cominucleic-acicaiumart-20-19-ncov-rna). in all instances, the primers had the sequences shown in SEQ ID NOs: 1 and 2 and the TaqMan probe had the sequence shown in SEQ ID NO: 3. The probes and primers were sourced from Biolegio. Reverse transcriptase (Affinity script) and DNA polymerase (GoTaq (12 by Promega) were used in a 2x mastermix. The reaction mix was lOul 2x oasig mastermix, 2u1 primer/probe mix (resuspended in template preparation buffer) and 8u1 sample The reaction conditions were as follows: (1) one cycle of reverse transcription For 10 minutes at 55°C, (2) one cycle of initial denaturation and Taq activation for 2 minutes at 95°C and (3) 45 cycles of denaturation for 10 seconds at 95°C and annealing and extension for 60 seconds at 60°C.

The threshold level was 10% of the end point fluorescence. The CFX and Lightcycler autocalling was also used.

The results are shown in Tables 1 and 2.

Table 1 -Average results from RT-PCR Average from Tube 1-10 COVID-19 10^6 copies Cq COVID-19 10 copies Cq 18.12 34.81 18.28 34.88 18.48 34.74 18.39 34.95 18.37 35.2 Table 2-Results of RT-PCR from each tube (Cq for 106 or 10 copies/R1) Tube 1 Tube 2 Tube 3 Tube 4 Tube 5 106 copies Cq 10 copies Cq 106 copies Cq 10 copies Cq 106 copies Cq 10 copies Cq 106 10 copies Cq 106 copies Cq 10 copies Cq copies Cq 18.1 34.6 18 34.8 18.1 35 18.2 34.6 18.3 34.9 18.3 35.4 18.3 34.6 18.2 34.4 18.4 35.1 18.3 35 18.5 35.4 18.4 32.2 18.4 34.9 18.4 35.1 18.8 35 18.2 34.8 18.5 34.8 18.8 35.3 18.2 35 18.1 34.9 18.4 35.1 18.4 35 18.3 35.7 18.4 35.6 18.3 35.2 Tube 6 Tube 7 Tube 8 Tube 9 Tube 10 106 copies Cq 10 copies Cq 106 copies Cq 10 copies Cq 106 copies Cq 10 copies Cq 106 10 copies Cq 106 copies Cq 10 copies Cq copies Cq 18.1 34.6 18.1 34.9 18.1 34.7 18.1 35.2 18.1 34.8 18.3 34.9 18.3 34.7 18.3 35.1 18.2 34.8 18.2 34.8 18.5 35.1 18.5 35.1 18.5 34.5 18.4 34.9 18.4 35.2 18.5 35.2 18.4 34.9 18.5 35 18.3 34.3 18.4 35.3 18.5 35 18.3 35.3 18.4 35 18.4 35.1 18.3 35 Example 2-RT-PCR with dilutions Example 1 was repeated with increasing dilutions of Human 2019-nCoV RNA (Purified RNA of Coronavirus strain "BetaCoV/Germany/BavPat1/2020 p.1" grown in cell culture obtained from EVAg: kbs://www.european-1,thus-arcluve.corninuch. ne-aciti/litariaii-2019-ncov-ma). The concentrations shown relate to the concentrations of RNA before it was added to the RT-PCR reaction mix. The results are shown in Figures 1 to 3. The mean Cq values are shown in Tables 3 to 5 below.

Table 3 -Figure 1 Cq values EvaG dilutions Average Cq 27.1 104 copies/p.1 30.1 103 copies/p1 33.8 102 copies/p1 37.8 10 copies/p.1 Table 4 -Figure 2 Cq values EvaG dilutions Average Cq 104 copies/RI 26.88 10' copies/R1 33.7 copies/RI 36.4 copies/p1 40.69 Table 5 -Figure 3 Cq values Positive control standard curve Average Cq 106 copies/RI 19.34 I 04 copies/RI 26.39 10' copies/R1 32.87 copies/R1 36.6 copies/p1 37.43

SEQUENCE LISTING

SEQ ID NO: 1

GCGAAGAAGCTATAAGACATGTACG

SEQ ID NO: 2

GTACCAACAGCTTCTCTAGTAGCA

SEQ ID NO: 3

CCTCGACATCGAAGCCAATCCATGC

SEQ ID NO: 4

GCGAAGAAGCTATAAGACATGTACGTGCATGGATIGGCTTCGATGTCGAGGGGTGTCATGCTACTAGAG AAGCTGTTGGTAC

SEQ ID NO: 5 (underlined section in SEQ ID NO: 4)

GCATGGATTGGCTTCGATGTCGAGG

SEQ ID NO: 6

GAGGGGACGGAACTTTTGAC

SEQ ID NO: 7

TGCTTGTGACCACGAGAGT

SEQ ID NO: 8

TTCTTTCCACGGGTTGCCATATTGTAATG

SEQ ID NO:9

TTCATGCATGATTCCAAAGGCATTACAATATG

Claims (29)

1. CLAIMS1. A pair of primers for determining the presence or absence of SARS-CoV-2 in a sample, wherein the forward primer comprises a polynucleotide haying the sequence shown in SEQ ID NO: I or a variant thereof haying at least about 80% homology to SEQ ID NO: I based on sequence identity over its entire length and the reverse primer comprises a polynucleotide having the sequence shown in SEQ ID NO: 2 or a variant thereof having at least about 75% homology to SEQ ID NO: 2 based on sequence identity over its entire length.
2. 2. A pair of primers according to claim I, wherein the fonyard primer comprises a polynucleotide haying the sequence shown in SEQ ID NO: I and/or the reverse primer comprises a polynucleotide haying the sequence shown in SEQ ID NO: 2.
3. 3. A complementary DNA (cDNA) amplicon amplified from SARS-CoV-2 cDNA by the pair of primers according to claim I or 2.
4. 4. A polynucleotide probe which specifically hybridises to the cDNA amplicon according to claim 3.
5. 5. A polynucleotide probe for determining the presence or absence of SARS-CoV-2 in a sample, wherein the polynucleotide probe comprises the sequence shown in SEQ ID NO: 3 or a variant thereof having at least about 80% homology to SEQ ID NO: 3 based on sequence identity over its entire length.
6. 6. A polynucleotide probe according to claims, wherein the polynucleotide probe comprises the sequence shown in SEQ ID NO: 3,
7. 7. A polynucleotide probe according to any one of claims 4 or 6 wherein the probe is DNA probe, a TaqMan probe, a molecular beacon or a scorpion probe.
8. 8. A polynucleotide probe according to any one of claims 4 to 7, wherein the polynucleotide probe is detectably-labelled.
9. 9. A polynucleotide probe according to claim 8, wherein the detectable label is a fluorescent molecule or dye, such as 6-carboxyfluorescein (FAM).
10. 10. A cDNA amplicon amplified from SARS-CoV-2 cDNA and comprising a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3.
11. 1 I. A target cDNA polynucleotide comprising a sequence (a) to which the sequence shown in SEQ ID NO: 3 specifically hybridises and/or (b) which is complementary to the sequence shown in SEQ ID NO: 3.
12. 12. A kit for determining the presence or absence of SARS-CoV-2 in a sample, comprising (a) a pair of primers according to claim 1 or 2 and (b) a polynucleotide probe according to any one of claims 4 to 9.
13. 13. A kit according to claim 12, wherein the kit further comprises (a) a positive control polynucleotide comprising a cDNA amplicon according to claim 3 or 10 and/or a target cDNA polynucleotide according to claim 11 and/or (b) a negative control.
14. 14. A method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a pair of primers according to claim I or 2 and detecting the cDNA amplicon amplified by the primers, it' present, and thereby determining the presence or absence of SARS-CoV-2 in the sample.
15. 15. A method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a pair of primers that amplifies a cDNA amplicon according to claim 10 and a polynucleotide probe according to claim 5 or 6 and thereby determining the presence or absence of SARS-CoV-2 in the sample.
16. 16. A method of determining the presence or absence of SARS-CoV-2 in a sample, wherein the method comprises conducting a reverse-transcription polymerase chain reaction (RT-PCR) assay on the sample using a kit according to claim 12 or 13 and thereby determining the presence or absence of SARS-CoV-2 in the sample.
17. 17. A method according to any one of claims 14 to 16, wherein the method comprises (a) reverse transcribing any RNA in the sample, (b) contacting any cDNA produced in (a) with the pair of primers under conditions which allow the primers to amplify their cDNA amplicon and (c) determining the presence or absence of the cDNA amplicon.
18. 18. A method according to any one of claims 14 to 17 xvherein the RT-PCR assay is a one-step RT-PCR assay conducted in one tube or vessel.
19. 19. A method according to any one of claims 14 to 18, wherein the method comprises extracting any RNA from the sample before conducting the RT-PCR assay.
20. 20. A method according to any one of claims 14 to 19, wherein the sample is a human sample.
21. 21. A method according to any one of claims 14 to 20, wherein the sample is a nasophan,tgeal sample, a saliva sample or a blood sample.
22. 22. A method for measuring the SARS-CoV-2 titre in a sample, wherein the method comprises conducting a real time RT-PCR method according to any one of claims 14 to 21 and, if SARS-CoV-2 is present, evaluating the cycle quantification (Cq) value and thereby measuring the SARS-CoV-2 titre.
23. 23. A method of determining whether or not a patient is infected with SARS-CoV-2, wherein the method comprises conducting a method according to any one of claims 14 to 21 on a sample from the patient and thereby determining whether or not a patient is infected with SARS-CoV-2.
24. 24. A method of measuring the titre of SARS-CoV-2 in a patient, wherein the method comprises conducting a method according to claim 22 on a sample from the patient and thereby measuring the viral titre in the patient.
25. 25. A method according to claim 23 or 24, wherein the method comprises taking a sample from the patient before conducting the RT-PCR assay.
26. 26. A method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method according to claim 22 or 23, comprising administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment and thereby treating the SARS-CoV-2 infection in the patient.
27. 27. A substance or composition for use in a method of treating SARS-CoV-2 in a patient identified as being infected with SARS-CoV-2 using a method according to claim 22 or 23.
28. 28. A method of treating SARS-CoV-2 in a patient identified as having a high SARS-CoV-2 titre using a method according to claim 24, comprising administering to the patient a therapeutically effective amount of an anti-SARS-CoV-2 treatment and thereby treating the SARS-CoV-2 infection in the patient.
29. 29. A substance or composition for use in a method of treating SARS-CoV-2 in a patient identified as being having a high SARS-CoV-2 titre using a method according to claim 24.