RU2548811C2 - METHOD FOR DETERMINING HUMAN GENOTYPE BY POLYMORPHISM IN MATRIX METALLOPROTEINASE MMP9-1562 C>T (rs3918242) GENE - Google Patents

Abstract

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

Description

1. The technical field

The proposed method relates to the field of medicine, biology and biotechnology and can be used in the diagnosis of periodontal diseases in the oral cavity, predicting the severity and rate of disease progression and the algorithm for treating the disease depending on the individual genetic profile of the patient.

Over the years, periodontal disease has consistently occupied one of the leading places in the world in prevalence. Despite the wide development of instrumental and laboratory research methods, early and accurate diagnosis of various dental diseases still remains an extremely urgent issue.

It is known that the development and course of any disease of a bacterial nature is determined by the strength of the body's response, which, in turn, depends not only on the acquired immunity, but is largely determined by the person’s genotype. Over the past 10-15 years, the first results have been obtained on the identification of genetic markers of periodontitis. There has been an association with periodontitis of polymorphic loci of cytokine genes, type 1 collagen, HLA antigens, vitamin D receptor, a number of enzymes and regulatory molecules (Brett PM et al., 2005; Agrawal AA et al., 2006; Tervonen T. et al., 2007 ; Wagner J. et al., 2007; Pirhan D. et al., 2007; Houshmand B. et al., 2009; Chai L. et al., 2009; Erciyas K. et al., 2010; Scarel-Caminaga RM et al., 2011).

For the first time, the relationship between the variant - 1562T (rs3918242) of the MMP9 matrix metalloproteinase gene and the development of chronic generalized periodontitis is revealed, which indicates the participation of the genetically determined system “proteolysis-antiproteolysis” in the pathogenesis of periodontal diseases (Zorina, 2011).

2. The level of technology

A widespread method for determining the type of nucleotide located at a specific DNA site is based on the use of allele-specific primers with registration of PCR results at the end of the reaction by electrophoresis. When using PCR with recording the results during the reaction, various methods are known for determining the genotype of the test sample.

There are methods to determine the type of nucleotide located at a specific DNA site, based on the use of allele-specific primers with the registration of PCR results directly during the reaction using fluorescently labeled samples (oligonucleotides) (Andreas R. Tobler at all, "THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping ", Journal of Biomolecular Techniques, V.16, issue 4, Desember 2005).

For example, Applied Biosystems kits use one pair of primers for each allele and two probes with different fluorescence labels, depending on the allele genotype, different labels burn up ("TaqMan SNP Genotyping Assays", Applied Biosistems, Prodakt Bulletin, USA, 06/2006 ) The disadvantage of the method used in these sets is the relatively low reliability of the study results due to the small difference between the obtained fluorescence curves for different alleles.

The proposed approach to the detection of genetic polymorphism is the use of two allele-specific and labeled with different fluorescent labels of oligonucleotides, as well as an oligonucleotide carrying a fluorescence quencher and hybridizing to the matrix next to the allele-specific oligonucleotide. Hybridization of the allele-specific oligonucleotide to the matrix leads to the transfer of energy from the donor fluorophore located on it to the fluorescence quencher of the adjacent quenching oligonucleotide. Amplification results are recorded at the end of PCR by taking the fluorescence spectrum when the temperature of the reaction mixture varies from 25 to 80 degrees Celsius (the so-called "melting curves"). Upon receipt of fluorescence graphs, both heating and cooling of the reaction mixture in the indicated temperature range are possible.

The present invention makes the determination of variable positions in DNA more reliable and cheapens such studies through the use of standard equipment.

3. Disclosure of invention

The technical result, the achievement of which the invention is directed, is to increase the reliability and accessibility of such studies, since the method can be carried out on standard known equipment. It also provides the ability to conduct research in one test tube, which reduces research costs.

The method of genotyping used by us is a variant of the classical method of “adjoining samples”. When determining substitutions of single nucleotides, PCR was first performed with primers common to both variants of the sequence, then the temperature of the reaction mixture was reduced to hybridize the resulting matrix with oligonucleotide samples. To determine the sequence variant, two types of oligonucleotides were used, hybridizing to the matrix side by side. One of the oligonucleotides was labeled with a fluorophore, the other with a fluorescence quencher.

The reaction used one common oligonucleotide with a fluorescence quencher and a pair of allele-specific (sequence-specific) oligonucleotides bearing a fluorophore. Oligonucleotide samples corresponding to one or another variant of the sequence were labeled with various fluorophores, which made it possible to determine both variants in the same tube. The genotype was determined after PCR and hybridization by measuring the level of fluorescence during temperature denaturation of oligonucleotide duplexes and the resulting matrices (or, conversely, hybridization). This measurement was carried out in real time, its result was melting curves.

The reaction conditions were chosen so as to maximize the difference in the melting temperatures of perfect and imperfect duplexes. Thus, if the analyzed sample contained only one variant of the sequence, i.e. was homozygous for this polymorphism, the melting point for a sample forming a perfect duplex was significantly higher than for a sample forming an imperfect duplex. If a heterozygous sample was analyzed, the melting points were almost the same.

The indicated result is achieved by using fluorescence-labeled allele-specific oligonucleotide probes and primers during PCR.

MMP9-1562s CGAAACCAGCCTGGTCAACG MMP9-1562a TCTGCCTCCCGGGTTCAAGC MMP9-1562r1 GGCGCACGCCTATAA-FAM MMP9-15662r2 GGCGCATGCCTATAA-HEX MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3 '- (P)

FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide.

The composition of the amplification mixture (per reaction):

Component Concentration Volume PCR buffer * 1.25x 18 μl DNTP mix 0.25 mm (each) 0.24 μl Primers 100 pM / μl 0.14 μl Fluorophore-labeled Oligonucleotides 100 pM / μl 0.07 μl Oligonucleotide labeled with a fluorescence quencher 100 pM / μl 0.14 μl Tag polymerase 10 units activity / μl 0.5 μl H ₂ O (deionized) - up to 30 μl Genomic DNA - 5 μl

* The composition of the buffer for PCR

84 mm Tris-HCl pH 8.6

21 mM (NH ₄ ) ₂ SO ₄

3.1 mm MgCl ₂

0.003% Tween-20

0.003% NP-40

6.25% glycerin

4. The implementation of the invention

It is recommended to use blood, scrapings of buccal epithelium, biopsy specimens of human soft tissues or other standard biological material as a material for research. Isolation of DNA from biomaterial is performed using a set of reagents for DNA isolation (not the subject of this patent).

The polymerase chain reaction and the determination of the melting temperature of oligonucleotide samples were carried out using a DTprime detecting amplifier (000 NPO DNA-Technology, Russia). The following amplification temperature regime was used: 94 ° C for 10 s, 64 ° C for 30 s for 50 cycles. Upon completion of the amplification reaction, the reaction mixture was cooled to 25 ° C at a rate of 2 ° C / sec. Melting curves were obtained as follows: the temperature of the reaction mixture was increased from 25 ° C to 75 ° C in increments of GS, measuring the level of fluorescence at each step.

Results i.e. the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves (Fig. 1).

Bibliography:

1. Agrawal A.A., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B 13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006 .-- Vol.77. - P.1515-1521.

2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J.Dent. Res. - 2005. - Vol. 84, No. 12. - P.1149-1153.

3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol. 35, No. 10. - P.862-870.

4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003 .-- Vol.30. - P.341-345.

5. Tervonen T., Raunio T., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.377-383.

6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.823-827.

7. Zorina O.A. The relationship of the qualitative and quantitative composition of the biocenoses of the oral cavity and the individual genetic profile against the background of inflammatory periodontal diseases. // Abstract of the dissertation - M., 2011.

Claims (1)

A method for determining the human genotype by polymorphism in the matrix metalloproteinase gene MMP9-1562 C> T (rs3918242), based on the removal of melting curves with fluorescently-labeled allele-specific oligonucleotide probes, characterized in that they use a pair of primers common to all alleles that differ allele fluorescently-labeled allele-specific oligonucleotide samples and a universal oligonucleotide labeled with a fluorescence quencher of the following nucleotide composition:
MMP9-1562s CGAAACCAGCCTGGTCAACG MMP9-1562a TCTGCCTCCCGGGTTCAAGC MMP9-1562r1 GGCGCACGCCTATAA-FAM MMP9-1562r2 GGCGCATGCCTATAA-HEX MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3 '- (P)
FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide;
the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves (by the maximum of the first derivative of the fluorescence graphs).