RU2518301C1 - Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529) - Google Patents

Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529) Download PDF

Info

Publication number
RU2518301C1
RU2518301C1 RU2012155611/10A RU2012155611A RU2518301C1 RU 2518301 C1 RU2518301 C1 RU 2518301C1 RU 2012155611/10 A RU2012155611/10 A RU 2012155611/10A RU 2012155611 A RU2012155611 A RU 2012155611A RU 2518301 C1 RU2518301 C1 RU 2518301C1
Authority
RU
Russia
Prior art keywords
col2
allele
hex
fam
polymorphism
Prior art date
Application number
RU2012155611/10A
Other languages
Russian (ru)
Inventor
Денис Владимирович Ребриков
Оксана Александровна Зорина
Наталия Борисовна Петрухина
Ольга Андреевна Борискина
Ирина Сергеевна Беркутова
Нелли Камильевна Аймадинова
Original Assignee
Закрытое акционерное общество "Научно-производственная фирма ДНК-Технология"
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Закрытое акционерное общество "Научно-производственная фирма ДНК-Технология" filed Critical Закрытое акционерное общество "Научно-производственная фирма ДНК-Технология"
Priority to RU2012155611/10A priority Critical patent/RU2518301C1/en
Application granted granted Critical
Publication of RU2518301C1 publication Critical patent/RU2518301C1/en

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

FIELD: biotechnology.
SUBSTANCE: invention is a method of determining the human genotype on polymorphism in type II collagen gene COL2A1 C>A (rs1635529). This method can be used in diagnostics of periodontal disease in the oral cavity. The method comprises taking of the melting curves with fluorescently labelled allele-specific oligonucleotide samples. The pair of primers common to all alleles is used, fluorescently labelled allele-specific oligonucleotide samples different for each allele and a universal oligonucleotide labelled with fluorescence extinguisher of the following nucleotide composition: COL2_29s TCTTGCCCAAAGGCTAGGCGGA, COL2_29a CCAGAGGGCGAGAAAGAAACGA, COL2_29p1 AAAAAGGAAAGTTTATC-FAM, COL2_29p2 AAAAAGGAACGTTTATC-HEX, COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3'-(P), where FAM is a fluorescent dye FAM, HEX is a fluorescent dye HEX, BHQ1 is dark fluorescence extinguisher attached to the 5'-terminal nucleotide. The sample refers to homozygote or heterozygote for this allele by analysis of DNA melting curves forms, namely, the maximum of the first derivative of the fluorescence graphs.
EFFECT: proposed invention enables to carry out studies more accessibly to determine the polymorphism in the type II collagen gene COL2A1 of human genotype.
1 dwg, 2 tbl

Description

1. Область техники1. The technical field

Предложенный способ относится к области медицины, биологии и биотехнологии и может быть использован при диагностике заболеваний пародонта в ротовой полости, прогнозирования тяжести и скорости прогрессии заболевания и алгоритма лечения заболевания в зависимости от индивидуального генетического профиля пациента.The proposed method relates to the field of medicine, biology and biotechnology and can be used in the diagnosis of periodontal diseases in the oral cavity, predicting the severity and rate of disease progression and the algorithm for treating the disease depending on the individual genetic profile of the patient.

На протяжении многих лет заболевания пародонта стабильно занимают по распространенности одно из ведущих мест в мире. Несмотря на широкое развитие инструментальных и лабораторных методов исследования ранняя и точная диагностика различных стоматологических заболеваний до сих пор остается крайне актуальным вопросом.Over the years, periodontal disease has consistently occupied one of the leading places in the world in prevalence. Despite the wide development of instrumental and laboratory research methods, early and accurate diagnosis of various dental diseases still remains an extremely urgent issue.

Известно, что развитие и течение любого заболевания бактериальной природы определяется силой ответной реакции организма, которая, в свою очередь, зависит не только от приобретенного иммунитета, но в значительной степени определяется генотипом человека. За последние 10-15 лет получены первые результаты по идентификации генетических маркеров пародонтита. Установлена ассоциация с пародонтитом полиморфных локусов генов цитокинов, коллагена 1 типа, антигенов HLA, рецептора витамина D, ряда ферментов и регуляторных молекул (Brett P.M. et al., 2005; Agrawal A.A. et al., 2006; Tervonen T. et al., 2007; Wagner J. et al., 2007; Pirhan D. et al., 2007; Scarel-Caminaga R.M. et al., 2011).It is known that the development and course of any disease of a bacterial nature is determined by the strength of the body's response, which, in turn, depends not only on the acquired immunity, but is largely determined by the person’s genotype. Over the past 10-15 years, the first results have been obtained on the identification of genetic markers of periodontitis. There has been an association with periodontitis of polymorphic loci of cytokine genes, type 1 collagen, HLA antigens, vitamin D receptor, a number of enzymes and regulatory molecules (Brett PM et al., 2005; Agrawal AA et al., 2006; Tervonen T. et al., 2007 ; Wagner J. et al., 2007; Pirhan D. et al., 2007; Scarel-Caminaga RM et al., 2011).

Коллагены составляют основу соединительной ткани организма и обеспечивают ее прочность и эластичность. Последние работы указывают на возможную взаимосвязь полиморфизма коллагенов с развитием заболеваний соединительной ткани, таких как остеопороз, остеоартрит, фиброз подслизистой и т.п. Kuivaniemi с соавторами проанализировали 278 полиморфных локусов в генах коллагена I, II, III, IX, X и XI типов у 317 пациентов. В результате было сделано заключение, что отдельные варианты коллагена способствуют развитию некоторых заболеваний костей, хрящей и кровеносных сосудов.Collagens form the basis of the connective tissue of the body and provide its strength and elasticity. Recent works indicate a possible correlation of collagen polymorphism with the development of connective tissue diseases such as osteoporosis, osteoarthritis, submucosal fibrosis, etc. Kuivaniemi et al. Analyzed 278 polymorphic loci in genes of type I, II, III, IX, X, and XI collagen in 317 patients. As a result, it was concluded that certain variants of collagen contribute to the development of certain diseases of the bones, cartilage and blood vessels.

Статистически значимые отличия по частоте встречаемости генотипов были обнаружены для полиморфизма в гене коллагена COL2A1 С>A (rs1635529). Частота встречаемости аллеля С была достоверно выше в основной группе по сравнению с контролем. Гомозиготный вариант СС в исследованном локусе у пациентов с пародонтитом встречался в 1,5 раза чаще, чем в группе здоровых лиц (Зорина, 2011).Statistically significant differences in the frequency of occurrence of genotypes were found for polymorphism in the collagen gene COL2A1 C> A (rs1635529). The frequency of occurrence of the C allele was significantly higher in the main group compared with the control. Homozygous SS variant in the studied locus in patients with periodontitis was 1.5 times more likely than in the group of healthy individuals (Zorina, 2011).

2. Уровень техники2. The level of technology

Широко распространен способ определения типа нуклеотида, находящегося в определенном месте ДНК, основанный на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР по окончании реакции с помощью электрофореза. При использовании ПЦР с регистрацией результатов в ходе реакции известны различные способы определения генотипа исследуемого образца.A widespread method for determining the type of nucleotide located at a specific DNA site is based on the use of allele-specific primers with registration of PCR results at the end of the reaction by electrophoresis. When using PCR with recording the results during the reaction, various methods are known for determining the genotype of the test sample.

Существуют различные способы, позволяющие определить тип нуклеотида, находящегося в определенном месте ДНК, основанные на использовании аллель-специфичных праймеров с регистрацией результатов ПЦР непосредственно в ходе реакции с помощью использования флуоресцентно-меченных проб (олигонуклеотидов) (Andreas R. Tobler at all, ″THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping″, Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).There are various methods for determining the type of nucleotide located at a specific DNA site, based on the use of allele-specific primers with PCR results recorded directly during the reaction using fluorescently-labeled samples (oligonucleotides) (Andreas R. Tobler at all, ″ THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping (Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).

Например, в наборах производства Applied Biosystems используют одну пару праймеров для каждого аллеля и два зонда с различными флуорецентными метками, в зависимости от генотипа аллеля фиксируют разгорание различных меток (″TaqMan SNP Genotyping Assays″, Applied Biosistems, Prodakt Bulletin, USA, 06/2006). Недостатком способа, используемого в данных наборах, является сравнительно невысокая достоверность результатов исследования из-за небольшой разницы между получаемыми кривыми флуоресценции для разных аллелей.For example, Applied Biosystems kits use one pair of primers for each allele and two probes with different fluorescence labels, depending on the allele genotype, different labels burn up (″ TaqMan SNP Genotyping Assays ″, Applied Biosistems, Prodakt Bulletin, USA, 06/2006 ) The disadvantage of the method used in these sets is the relatively low reliability of the study results due to the small difference between the obtained fluorescence curves for different alleles.

Предлагаемым подходом к детекции генетического полиморфизма является использование двух аллель-специфичных и меченных разными флуоресцентными метками олигонуклеотидов, а также олигонуклеотида, несущего гаситель флуоресценции и гибридизирующегося на матрицу рядом с аллель-специфичным олигонуклеотидом. Гибридизация аллель-специфичного олигонуклеотида на матрицу ведет к переносу энергии с находящегося на нем флуорофора-донора на гаситель флуоресценции расположенного рядом «гасящего» олигонуклеотида. Регистрацию результатов амплификации ведут по окончании ПНР путем снятия спектра флуоресценции при изменении температуры реакционной смеси в диапазоне от 25 до 80 градусов по Цельсию (так называемые «кривые плавления»). При получении графиков флуоресценции возможен как нагрев, так и охлаждение реакционной смеси в указанном интервале температур.The proposed approach to the detection of genetic polymorphism is the use of two allele-specific and labeled with different fluorescent labels of oligonucleotides, as well as an oligonucleotide carrying a fluorescence quencher and hybridizing to the matrix next to the allele-specific oligonucleotide. Hybridization of the allele-specific oligonucleotide to the matrix leads to the transfer of energy from the donor fluorophore located on it to the fluorescence quencher of the adjacent quenching oligonucleotide. The amplification results are recorded at the end of the NDP by taking the fluorescence spectrum when the temperature of the reaction mixture varies from 25 to 80 degrees Celsius (the so-called "melting curves"). Upon receipt of fluorescence graphs, both heating and cooling of the reaction mixture in the indicated temperature range are possible.

Предлагаемое изобретение делает определение вариабельных позиций в ДНК более надежным и удешевляет подобные исследования благодаря использованию стандартного оборудования.The present invention makes the determination of variable positions in DNA more reliable and cheapens such studies through the use of standard equipment.

3. Раскрытие изобретения3. Disclosure of invention

Техническим результатом, на достижение которого направлено предлагаемое изобретение, является повышение доступности подобных исследований, поскольку способ может быть осуществлен на стандартном известном оборудовании. Также он обеспечивает возможность проводить исследование в одной пробирке, что снижает затраты на исследование.The technical result, the achievement of which the invention is directed, is to increase the availability of such studies, since the method can be implemented on standard known equipment. It also provides the ability to conduct research in one test tube, which reduces research costs.

Использованный нами способ генотипирования является вариантом классического метода «примыкающих проб». При определении замен одиночных нуклеотидов вначале проводили ПЦР с праймерами, общими для обоих вариантов последовательности, затем температуру реакционной смеси снижали для гибридизации полученной матрицы с олигонуклеотидными пробами. Для определения варианта последовательности использовали два типа олигонуклеотидов, гибридизирующихся на матрицу рядом. Один из олигонуклеотидов метили флуорофором, другой - гасителем флуоресценции.The method of genotyping used by us is a variant of the classical method of “adjoining samples”. When determining substitutions of single nucleotides, PCR was first performed with primers common to both variants of the sequence, then the temperature of the reaction mixture was reduced to hybridize the resulting matrix with oligonucleotide samples. To determine the sequence variant, two types of oligonucleotides were used, hybridizing to the matrix side by side. One of the oligonucleotides was labeled with a fluorophore, the other with a fluorescence quencher.

В реакции использовали один общий олигонуклеотид с гасителем флуоресценции и пару аллель-специфичных (сиквенс-специфичных) олигонуклеотидов, несущих флуорофор. Олигонуклеотидные пробы, соответствующие тому или иному варианту последовательности, метили различными флуорофорами, что позволило определять оба варианта в одной пробирке. Определение генотипа проводили после ПЦР и гибридизации путем измерения уровня флуоресценции в ходе температурной денатурации дуплексов олигонуклеотидов и полученных матриц (или наоборот - гибридизации). Данное измерение проводили в режиме реального времени, его результатом являлись кривые плавления.The reaction used one common oligonucleotide with a fluorescence quencher and a pair of allele-specific (sequence-specific) oligonucleotides bearing a fluorophore. Oligonucleotide samples corresponding to one or another variant of the sequence were labeled with various fluorophores, which made it possible to determine both variants in the same tube. The genotype was determined after PCR and hybridization by measuring the level of fluorescence during temperature denaturation of oligonucleotide duplexes and the resulting matrices (or vice versa - hybridization). This measurement was carried out in real time, its result was melting curves.

Условия реакции подбирали так, чтобы максимизировать разницу в температурах плавления совершенного и несовершенного дуплексов. Таким образом, если анализируемый образец содержал только один вариант последовательности, т.е. был гомозиготен по данному полиморфизму, температура плавления для пробы образующей совершенный дуплекс была существенно выше, нежели для пробы образующей несовершенный дуплекс. Если же анализировали гетерозиготный образец, температуры плавления были практически одинаковы.The reaction conditions were chosen so as to maximize the difference in the melting temperatures of perfect and imperfect duplexes. Thus, if the analyzed sample contained only one variant of the sequence, i.e. was homozygous for this polymorphism, the melting temperature for the sample forming the perfect duplex was significantly higher than for the sample forming the imperfect duplex. If a heterozygous sample was analyzed, the melting points were almost the same.

Указанный результат достигается путем использования при постановке ПЦР флуоресцентно-меченных аллель-специфичных олигонуклеотидных проб и праймеров:The indicated result is achieved by using fluorescence-labeled allele-specific oligonucleotide probes and primers during PCR.

COL2J9sCol2j9s TCTTGCCCAAAGGCTAGGCGGATCTTGCCCAAAGGCTAGGCGGA COL2_29aCol2_29a CCAGAGGGCGAGAAAGAAACGACCAGAGGGCGAGAAAGAAACGA COL2_29p1Col2_29p1 AAAAAGGAAAGTTTATC-FAMAAAAAGGAAAGTTTATC-FAM COL2_29p2Col2_29p2 AAAAAGGAACGTTTATC-HEXAAAAAGGAACGTTTATC-HEX COL2_29pqCol2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)BHQ 1-TTTGGATTTTCACTCTCTT-3 ′ - (P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции.FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide.

Состав амплификационной смеси (на одну реакцию)The composition of the amplification mixture (per reaction) КомпонентComponent КонцентрацияConcentration ОбъемVolume ПЦР - буфер*PCR buffer * 1,25 кратный1.25x 18 мкл18 μl смесь dNTPdNTP mixture 0,25 мМ (каждого)0.25 mm (each) 0,24 мкл0.24 μl ПраймерыPrimers 100 пМ/мкл100 pM / μl по 0,14 мкл0.14 μl Олигонуклеотиды, меченные флуорофорамиFluorophore-labeled oligonucleotides 100 пМ/мкл100 pM / μl по 0,07 мкл0.07 μl Олигонуклеотид, меченный гасителем флуоресценцииOligonucleotide labeled with a fluorescence quencher 100 пМ/мкл100 pM / μl 0,14 мкл0.14 μl Тод-полимеразаTod Polymerase 10 ед.
активности/мкл
10 units
activity / μl
0,5 мкл0.5 μl
Н2O (деионизированная)H 2 O (deionized) -- до 30 мклup to 30 μl Геномная ДНКGenomic DNA -- 5 мкл5 μl *Состав буфера для проведения ПЦР
84 mМ Трис-HCl рН 8,6
21 mM(NH4)2SO4
3,1 mМ MgCl2
0,003% Tween-20
0,003% NP-40
6,25% глицерин
* The composition of the buffer for PCR
84 mM Tris-HCl pH 8.6
21 mM (NH 4 ) 2 SO 4
3.1 mM MgCl 2
0.003% Tween-20
0.003% NP-40
6.25% glycerin

4. Осуществление изобретения4. The implementation of the invention

В качестве материала для исследования рекомендуется использовать кровь, соскобы буккального эпителия, биоптаты мягких тканей человека или иной стандартный биологический материал. Выделение ДНК из биоматериала производится с использованием комплекта реагентов для выделения ДНК (не является предметом данного патента).It is recommended to use blood, scrapings of buccal epithelium, biopsy specimens of human soft tissues or other standard biological material as a material for research. Isolation of DNA from biomaterial is performed using a set of reagents for DNA isolation (not the subject of this patent).

Полимеразную цепную реакцию и определение температуры плавления олигонуклеотидных проб проводили с помощью детектирующего амплификатора «ДТпрайм» (ООО «НПО ДНК-Технология», Россия). Использовали следующий температурный режим амплификации: 94°С - 10 с, 64°С - 30 с в течение 50 циклов. По завершении реакции амплификации реакционную смесь остужали до 25°С со скоростью 2°С/сек. Кривые плавления получали следующим образом: температуру реакционной смеси повышали с 25°С до 75°С с шагом 1°С, измеряя уровень флуоресценции на каждом шаге.The polymerase chain reaction and the determination of the melting temperature of oligonucleotide samples were carried out using a DTprime detecting amplifier (NPO DNA-Technology LLC, Russia). The following amplification temperature regime was used: 94 ° C for 10 s, 64 ° C for 30 s for 50 cycles. Upon completion of the amplification reaction, the reaction mixture was cooled to 25 ° C at a rate of 2 ° C / sec. Melting curves were obtained as follows: the temperature of the reaction mixture was increased from 25 ° C to 75 ° C in increments of 1 ° C, measuring the level of fluorescence at each step.

Результаты, т.е. отнесение образца к гомозиготе или гетерозиготе по данному аллелю, оцениваются по форме кривых плавления ДНК (рис 1).Results i.e. the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves (Fig. 1).

Список литературыBibliography

1. Agrawal А.А., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006. - Vol.77. - P.1515-1521.1. Agrawal A.A., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006 .-- Vol.77. - P.1515-1521.

2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J. Dent. Res. - 2005. - Vol.84, №12. - P.1149-1153.2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J. Dent. Res. - 2005. - Vol. 84, No. 12. - P.1149-1153.

3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol.35, №10. - P.862-870.3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol. 35, No. 10. - P.862-870.

4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003. - Vol.30. - P.341-345.4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003 .-- Vol.30. - P.341-345.

5. Tervonen Т., Raunio Т., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol.34. - P.377-383.5. Tervonen T., Raunio T., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.377-383.

6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol.34. - P.823-827.6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.823-827.

7. Зорина O.A. Взаимосвязь качественного и количественного состава биоценозов ротовой полости и индивидуального генетического профиля на фоне воспалительных заболеваний пародонта. // Автореферат диссертации - М., 2011.7. Zorina O.A. The relationship of the qualitative and quantitative composition of the biocenoses of the oral cavity and the individual genetic profile against the background of inflammatory periodontal diseases. // Abstract of the dissertation - M., 2011.

Claims (1)

Способ определения генотипа человека по полиморфизму в гене коллагена II типа COL2A1 С>А (rs1635529), основанный на снятии кривых плавления с флуоресцентно-меченными аллель-специфичными олигонуклеотидными пробами, отличающийся тем, что используют общую для всех аллелей пару праймеров, отличающиеся для каждого аллеля флуоресцентно-меченные аллель-специфичные олигонуклеотидные пробы и универсальный олигонуклеотид, меченный гасителем флуоресценции, следующего нуклеотидного состава:
COL2_29s TCTTGCCCAAAGGCTAGGCGGA COL2_29a CCAGAGGGCGAGAAAGAAACGA COL2_29p1 AAAAAGGAAAGTTTATC-FAM COL2_29p2 AAAAAGGAACGTTTATC-HEX COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3′-(P)

FAM - означает флуоресцентный краситель FAM, HEX - означает флуоресцентный краситель HEX, BHQ1 - означает присоединенный к 5′-концевому нуклеотиду темновой гаситель флуоресценции;
отнесение образца к гомозиготе или гетерозиготе по данному аллелю оценивается по форме кривых плавления ДНК, по максимуму первой производной графиков флуоресценции.
A method for determining the human genotype by polymorphism in the gene of collagen type II COL2A1 C> A (rs1635529), based on the removal of melting curves with fluorescently-labeled allele-specific oligonucleotide samples, characterized in that they use a pair of primers common for all alleles that are different for each allele fluorescently-labeled allele-specific oligonucleotide probes and a universal oligonucleotide labeled with a fluorescence quencher of the following nucleotide composition:
Col2_29s TCTTGCCCAAAGGCTAGGCGGA Col2_29a CCAGAGGGCGAGAAAGAAACGA Col2_29p1 AAAAAGGAAAGTTTATC-FAM Col2_29p2 AAAAAGGAACGTTTATC-HEX Col2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3 ′ - (P)

FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide;
the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves, by the maximum of the first derivative of the fluorescence graphs.
RU2012155611/10A 2012-12-21 2012-12-21 Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529) RU2518301C1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
RU2012155611/10A RU2518301C1 (en) 2012-12-21 2012-12-21 Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
RU2012155611/10A RU2518301C1 (en) 2012-12-21 2012-12-21 Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529)

Publications (1)

Publication Number Publication Date
RU2518301C1 true RU2518301C1 (en) 2014-06-10

Family

ID=51216329

Family Applications (1)

Application Number Title Priority Date Filing Date
RU2012155611/10A RU2518301C1 (en) 2012-12-21 2012-12-21 Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529)

Country Status (1)

Country Link
RU (1) RU2518301C1 (en)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LOUGHLIN J. ET AL., Differential allelic expression of the type octeoarthritis cartilage. Am. J. Hum. Genet. 1995, v.56, р.1186-1199. *
колонка 15. . *
фиг. 2, описание к фиг. 2. *
фиг. 3, описание к фиг. 3. . RU 2249210 C2 (ГУН "РОССИЙСКИЙ НАУЧНО-ИССЛЕДОВАТЕЛЬСКИЙ ИНСТИТУТ ТРАВМАТОЛОГИИ И ОРТОПЕДИИ ИМ. Р.Р. ВРЕДЕНА" (RU)), 27.03.2005, с. 1 описания *

Similar Documents

Publication Publication Date Title
KR20170034833A (en) Genetic polymorphic markers for determining type of white skin and use thereof
US11542556B2 (en) Single nucleotide polymorphism in HLA-B*15:02 and use thereof
JP2013074888A (en) METHOD FOR DETECTING MUTATION AT GENE IL28B (rs8099917) AND ITPA(rs1127354)
KR101536213B1 (en) SNP markers for abdominal obesity and use thereof
WO2011148715A1 (en) Normal-tension glaucoma susceptibility gene and method for using the same
EP1964929B1 (en) Hla-b genotyping method and kit based on real-time pcr
KR101646189B1 (en) Marker for diagnosing intrinsic atopic dermatitis and use thereof
KR101532308B1 (en) SNP markers for abdominal obesity and use thereof
RU2548811C2 (en) METHOD FOR DETERMINING HUMAN GENOTYPE BY POLYMORPHISM IN MATRIX METALLOPROTEINASE MMP9-1562 C>T (rs3918242) GENE
RU2518301C1 (en) Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529)
US10770183B2 (en) Methods of assessing a risk of developing necrotizing meningoencephalitis
RU2739943C1 (en) Diagnostic technique for the 167delt (rs80338942) mutation of the gjb2 gene
JP6245796B2 (en) Markers, probes, primers and kits for predicting the risk of developing primary biliary cirrhosis and methods for predicting the risk of developing primary biliary cirrhosis
US20220017963A1 (en) Methods, Compositions and Systems for Detecting PNPLA3 Allelic Variants
KR102167792B1 (en) Composition for early predicting or diagnosing hypercalcemia in dog
RU2445372C1 (en) METHOD FOR HUMAN GENOTYPE DETERMINATION BY 6174 GENE BRCA2 (617delT) POSITION POLYMORPHISM
RU2556808C2 (en) METHOD FOR DETERMINING HUMAN GENOTYPE BY POLYMORPHOUS POSITION rs1613662 IN GP6 GENE CODING GLYCOPROTEIN VI
JP2008212032A (en) Method for measuring mRNA of protein related to metabolism of sugar, fat and protein in rat, probe and kit therefor
WO2015037681A1 (en) Test method for evaluating the risk of anti-thyroid drug-induced agranulocytosis, and evaluation kit
RU2445368C2 (en) METHOD FOR HUMAN GENOTYPE DETERMINATION BY 5382 GENE BRCA1 (5382insC) POSITION POLYMORPHISM
JP2022157473A (en) Method for determining presence of genetic factor showing high serum uric acid levels after menopause, method for detecting allele of single nucleotide polymorphism (snp), composition, and kit
US20140038835A1 (en) Methods for diagnosing hypertrophic cardiomyopathy
WO2012068245A1 (en) Methods for identifying subjects at risk of developing psychiatric disorders during interferon-alpha treatment
CN104313141A (en) Detecting reagent predicting susceptivity of ankylosing spondylitis

Legal Events

Date Code Title Description
PC43 Official registration of the transfer of the exclusive right without contract for inventions

Effective date: 20170830