RU2518301C1 - Method of determining human genotype on polymorphism in type ii collagen gene col2a1 c>a (rs1635529) - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention is a method of determining the human genotype on polymorphism in type II collagen gene COL2A1 C>A (rs1635529). This method can be used in diagnostics of periodontal disease in the oral cavity. The method comprises taking of the melting curves with fluorescently labelled allele-specific oligonucleotide samples. The pair of primers common to all alleles is used, fluorescently labelled allele-specific oligonucleotide samples different for each allele and a universal oligonucleotide labelled with fluorescence extinguisher of the following nucleotide composition: COL2_29s TCTTGCCCAAAGGCTAGGCGGA, COL2_29a CCAGAGGGCGAGAAAGAAACGA, COL2_29p1 AAAAAGGAAAGTTTATC-FAM, COL2_29p2 AAAAAGGAACGTTTATC-HEX, COL2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3'-(P), where FAM is a fluorescent dye FAM, HEX is a fluorescent dye HEX, BHQ1 is dark fluorescence extinguisher attached to the 5'-terminal nucleotide. The sample refers to homozygote or heterozygote for this allele by analysis of DNA melting curves forms, namely, the maximum of the first derivative of the fluorescence graphs.

EFFECT: proposed invention enables to carry out studies more accessibly to determine the polymorphism in the type II collagen gene COL2A1 of human genotype.

1 dwg, 2 tbl

Description

1. The technical field

The proposed method relates to the field of medicine, biology and biotechnology and can be used in the diagnosis of periodontal diseases in the oral cavity, predicting the severity and rate of disease progression and the algorithm for treating the disease depending on the individual genetic profile of the patient.

Over the years, periodontal disease has consistently occupied one of the leading places in the world in prevalence. Despite the wide development of instrumental and laboratory research methods, early and accurate diagnosis of various dental diseases still remains an extremely urgent issue.

It is known that the development and course of any disease of a bacterial nature is determined by the strength of the body's response, which, in turn, depends not only on the acquired immunity, but is largely determined by the person’s genotype. Over the past 10-15 years, the first results have been obtained on the identification of genetic markers of periodontitis. There has been an association with periodontitis of polymorphic loci of cytokine genes, type 1 collagen, HLA antigens, vitamin D receptor, a number of enzymes and regulatory molecules (Brett PM et al., 2005; Agrawal AA et al., 2006; Tervonen T. et al., 2007 ; Wagner J. et al., 2007; Pirhan D. et al., 2007; Scarel-Caminaga RM et al., 2011).

Collagens form the basis of the connective tissue of the body and provide its strength and elasticity. Recent works indicate a possible correlation of collagen polymorphism with the development of connective tissue diseases such as osteoporosis, osteoarthritis, submucosal fibrosis, etc. Kuivaniemi et al. Analyzed 278 polymorphic loci in genes of type I, II, III, IX, X, and XI collagen in 317 patients. As a result, it was concluded that certain variants of collagen contribute to the development of certain diseases of the bones, cartilage and blood vessels.

Statistically significant differences in the frequency of occurrence of genotypes were found for polymorphism in the collagen gene COL2A1 C> A (rs1635529). The frequency of occurrence of the C allele was significantly higher in the main group compared with the control. Homozygous SS variant in the studied locus in patients with periodontitis was 1.5 times more likely than in the group of healthy individuals (Zorina, 2011).

2. The level of technology

A widespread method for determining the type of nucleotide located at a specific DNA site is based on the use of allele-specific primers with registration of PCR results at the end of the reaction by electrophoresis. When using PCR with recording the results during the reaction, various methods are known for determining the genotype of the test sample.

There are various methods for determining the type of nucleotide located at a specific DNA site, based on the use of allele-specific primers with PCR results recorded directly during the reaction using fluorescently-labeled samples (oligonucleotides) (Andreas R. Tobler at all, ″ THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping (Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).

For example, Applied Biosystems kits use one pair of primers for each allele and two probes with different fluorescence labels, depending on the allele genotype, different labels burn up (″ TaqMan SNP Genotyping Assays ″, Applied Biosistems, Prodakt Bulletin, USA, 06/2006 ) The disadvantage of the method used in these sets is the relatively low reliability of the study results due to the small difference between the obtained fluorescence curves for different alleles.

The proposed approach to the detection of genetic polymorphism is the use of two allele-specific and labeled with different fluorescent labels of oligonucleotides, as well as an oligonucleotide carrying a fluorescence quencher and hybridizing to the matrix next to the allele-specific oligonucleotide. Hybridization of the allele-specific oligonucleotide to the matrix leads to the transfer of energy from the donor fluorophore located on it to the fluorescence quencher of the adjacent quenching oligonucleotide. The amplification results are recorded at the end of the NDP by taking the fluorescence spectrum when the temperature of the reaction mixture varies from 25 to 80 degrees Celsius (the so-called "melting curves"). Upon receipt of fluorescence graphs, both heating and cooling of the reaction mixture in the indicated temperature range are possible.

The present invention makes the determination of variable positions in DNA more reliable and cheapens such studies through the use of standard equipment.

3. Disclosure of invention

The technical result, the achievement of which the invention is directed, is to increase the availability of such studies, since the method can be implemented on standard known equipment. It also provides the ability to conduct research in one test tube, which reduces research costs.

The method of genotyping used by us is a variant of the classical method of “adjoining samples”. When determining substitutions of single nucleotides, PCR was first performed with primers common to both variants of the sequence, then the temperature of the reaction mixture was reduced to hybridize the resulting matrix with oligonucleotide samples. To determine the sequence variant, two types of oligonucleotides were used, hybridizing to the matrix side by side. One of the oligonucleotides was labeled with a fluorophore, the other with a fluorescence quencher.

The reaction used one common oligonucleotide with a fluorescence quencher and a pair of allele-specific (sequence-specific) oligonucleotides bearing a fluorophore. Oligonucleotide samples corresponding to one or another variant of the sequence were labeled with various fluorophores, which made it possible to determine both variants in the same tube. The genotype was determined after PCR and hybridization by measuring the level of fluorescence during temperature denaturation of oligonucleotide duplexes and the resulting matrices (or vice versa - hybridization). This measurement was carried out in real time, its result was melting curves.

The reaction conditions were chosen so as to maximize the difference in the melting temperatures of perfect and imperfect duplexes. Thus, if the analyzed sample contained only one variant of the sequence, i.e. was homozygous for this polymorphism, the melting temperature for the sample forming the perfect duplex was significantly higher than for the sample forming the imperfect duplex. If a heterozygous sample was analyzed, the melting points were almost the same.

The indicated result is achieved by using fluorescence-labeled allele-specific oligonucleotide probes and primers during PCR.

Col2j9s TCTTGCCCAAAGGCTAGGCGGA Col2_29a CCAGAGGGCGAGAAAGAAACGA Col2_29p1 AAAAAGGAAAGTTTATC-FAM Col2_29p2 AAAAAGGAACGTTTATC-HEX Col2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3 ′ - (P)

FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide.

The composition of the amplification mixture (per reaction) Component Concentration Volume PCR buffer * 1.25x 18 μl dNTP mixture 0.25 mm (each) 0.24 μl Primers 100 pM / μl 0.14 μl Fluorophore-labeled oligonucleotides 100 pM / μl 0.07 μl Oligonucleotide labeled with a fluorescence quencher 100 pM / μl 0.14 μl Tod Polymerase 10 units
activity / μl 0.5 μl H ₂ O (deionized) - up to 30 μl Genomic DNA - 5 μl * The composition of the buffer for PCR
84 mM Tris-HCl pH 8.6
21 mM (NH ₄ ) ₂ SO ₄
3.1 mM MgCl ₂
0.003% Tween-20
0.003% NP-40
6.25% glycerin

4. The implementation of the invention

It is recommended to use blood, scrapings of buccal epithelium, biopsy specimens of human soft tissues or other standard biological material as a material for research. Isolation of DNA from biomaterial is performed using a set of reagents for DNA isolation (not the subject of this patent).

The polymerase chain reaction and the determination of the melting temperature of oligonucleotide samples were carried out using a DTprime detecting amplifier (NPO DNA-Technology LLC, Russia). The following amplification temperature regime was used: 94 ° C for 10 s, 64 ° C for 30 s for 50 cycles. Upon completion of the amplification reaction, the reaction mixture was cooled to 25 ° C at a rate of 2 ° C / sec. Melting curves were obtained as follows: the temperature of the reaction mixture was increased from 25 ° C to 75 ° C in increments of 1 ° C, measuring the level of fluorescence at each step.

Results i.e. the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves (Fig. 1).

Bibliography

1. Agrawal A.A., Kapley A., Yeltiwar R.K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006 .-- Vol.77. - P.1515-1521.

2. Brett P.M., Zygogianni P., Griffiths G.S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J. Dent. Res. - 2005. - Vol. 84, No. 12. - P.1149-1153.

3. Pirhan D., Atilla G., Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol. 35, No. 10. - P.862-870.

4. Scarel-Caminaga R.M., Trevilatto P.C., Souza A.P. et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003 .-- Vol.30. - P.341-345.

5. Tervonen T., Raunio T., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.377-383.

6. Wagner J., Kaminski W.E., Aslanidis C. Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol. 34. - P.823-827.

7. Zorina O.A. The relationship of the qualitative and quantitative composition of the biocenoses of the oral cavity and the individual genetic profile against the background of inflammatory periodontal diseases. // Abstract of the dissertation - M., 2011.

Claims (1)

A method for determining the human genotype by polymorphism in the gene of collagen type II COL2A1 C> A (rs1635529), based on the removal of melting curves with fluorescently-labeled allele-specific oligonucleotide samples, characterized in that they use a pair of primers common for all alleles that are different for each allele fluorescently-labeled allele-specific oligonucleotide probes and a universal oligonucleotide labeled with a fluorescence quencher of the following nucleotide composition:
Col2_29s TCTTGCCCAAAGGCTAGGCGGA Col2_29a CCAGAGGGCGAGAAAGAAACGA Col2_29p1 AAAAAGGAAAGTTTATC-FAM Col2_29p2 AAAAAGGAACGTTTATC-HEX Col2_29pq BHQ 1-TTTGGATTTTCACTCTCTT-3 ′ - (P)
FAM - means fluorescent dye FAM, HEX - means fluorescent dye HEX, BHQ1 - means a dark fluorescence quencher attached to the 5'-terminal nucleotide;
the assignment of a sample to a homozygote or heterozygote for a given allele is evaluated by the shape of the DNA melting curves, by the maximum of the first derivative of the fluorescence graphs.