PL235399B1 - Method for producing 17a-oxa-D-homo-androst-4-en-17-one - Google Patents
Method for producing 17a-oxa-D-homo-androst-4-en-17-one Download PDFInfo
- Publication number
- PL235399B1 PL235399B1 PL420187A PL42018717A PL235399B1 PL 235399 B1 PL235399 B1 PL 235399B1 PL 420187 A PL420187 A PL 420187A PL 42018717 A PL42018717 A PL 42018717A PL 235399 B1 PL235399 B1 PL 235399B1
- Authority
- PL
- Poland
- Prior art keywords
- androst
- oxa
- homo
- strain
- dione
- Prior art date
Links
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Steroid Compounds (AREA)
Description
Opis wynalazkuDescription of the invention
Przedmiotem wynalazku jest sposób wytwarzania 17a-oxa-D-homo-androst-4-en-3,17-dionu.The present invention relates to a process for the preparation of 17a-oxa-D-homo-androst-4-ene-3,17-dione.
Metoda, według wynalazku może znaleźć zastosowanie w przemyśle farmaceutycznym do wytwarzania leku stosowanego w terapii hormonalnej (Carel J-C, Lahlou N, Roger M, Chaussain JL. (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147).The method according to the invention may find application in the pharmaceutical industry for the preparation of a drug used in hormone therapy (Carel J-C, Lahlou N, Roger M, Chaussain JL. (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147).
Leki steroidowe są po antybiotykach drugą co do wielkości grupą leków, odgrywającą ważną rolę w leczeniu i zapobieganiu różnym chorobom (Zhang WQ, Shao ML, Rao ZM, Xu MJ, Zhang X, Yang TW, Li H, Xu ZH (2013) Bioconversion of 4-androstene-3,17-dione to androst-1,4-diene-3,17-dione by recombinant Bacillus subtilis expressing ksdd gene encoding 3-ketosteroid-A1 -dehydrogenase from Mycobacterium neoaurum JC-12. J Steroid Biochem Mol Biol 135: 36-42).Steroid drugs are the second largest group of drugs after antibiotics, playing an important role in the treatment and prevention of various diseases (Zhang WQ, Shao ML, Rao ZM, Xu MJ, Zhang X, Yang TW, Li H, Xu ZH (2013) Bioconversion of 4-androstene-3,17-dione to androst-1,4-diene-3,17-dione by recombinant Bacillus subtilis expressing ksdd gene encoding 3-ketosteroid-A1 -dehydrogenase from Mycobacterium neoaurum JC-12. J Steroid Biochem Mol Biol 135: 36-42).
17a-oxa-D-homo-androst-4-en-3,17-dion jest prekursorem testolaktonu - związku stosowanego jako inhibitor aromatazy. Dzięki tej właściwości zapobiega wzrostowi nowotworów sutka, które są aktywowane przez estrogen (Clark RV, Sherins RJ. (1989) Treatment of men with idiopathic oligozoospermic infertility using the aromatase inhibitor, testolactone results of a double-blinded, randomized, placebocontrolled trial with crossover. J Androl 10, 240-247). Ze względu na jego zdolność do blokowania wytwarzania estrogenów stwierdzono również skuteczność testolaktonu w zapobieganiu przedwczesnemu pokwitaniu (Carel J-C, Lahlou N, Roger M, Chaussain JL. (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147).17a-oxa-D-homo-androst-4-ene-3,17-dione is a precursor of testolactone - a compound used as an aromatase inhibitor. Thanks to this property, it prevents the growth of breast tumors that are activated by estrogen (Clark RV, Sherins RJ. (1989) Treatment of men with idiopathic oligozoospermic infertility using the aromatase inhibitor, testolactone results of a double-blinded, randomized, placebocontrolled trial with crossover. J Androl 10, 240-247). Due to its ability to block estrogen production, testolactone has also been found to be effective in preventing premature puberty (Carel J-C, Lahlou N, Roger M, Chaussain JL. (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147).
Biotransformacje są ekologiczną alternatywą klasycznej syntezy chemicznej w uzyskiwaniu aktywnych związków i są coraz częściej stosowane w przemyśle biofarmaceutycznym, zwłaszcza do produkcji leków steroidowych (M.-M. Chen, F.-Q. Wang, L.-C. Lin, K. Yao, D.-Z. Wei; Characterization and application of fusidane antibiotic biosynethsis enzyme 3-ketosteroid-A1-dehydrogenase in steroid transformation. Appl Microbiol Biotechnol 96, 2012, 133-142).Biotransformations are an ecological alternative to classical chemical synthesis in obtaining active compounds and are increasingly used in the biopharmaceutical industry, especially for the production of steroid drugs (M.-M. Chen, F.-Q. Wang, L.-C. Lin, K. Yao , D.-Z. Wei; Characterization and application of fusidane antibiotic biosynethsis enzyme 3-ketosteroid-A 1 -dehydrogenase in steroid transformation. Appl Microbiol Biotechnol 96, 2012, 133-142).
Znane są mikrobiologiczne metody uzyskiwania 17a-oxa-D-homo-androst-4-en-3,17-dionu z 33-hydroksyandrost-5-en-17-on w wyniku zastosowania szczepu: Penicillium simplicissimum WY134-2 z wydajnością 53% (B. Yang, Y. Wang, X. Chen, J. Feng, Q. Wu, D. Zhu, Y. Ma (2014) Biotransformations of steroids to testololactone by a multifunctional strain Penicillium simplicissimum WY134-2. Tetrahedron 70, 41-46); Penicillium lanosocoeruleum z wydajnością 91% (A. Świzdor (2013) Baeyer-Villiger Oxidation of Some C19 Steroids by Penicillium lanosocoeruleum. Molecules 18, 13812-13822).There are known microbiological methods for obtaining 17a-oxa-D-homo-androst-4-en-3,17-dione from 33-hydroxyandrost-5-en-17-one by using the strain: Penicillium simplicissimum WY134-2 with 53% efficiency (B. Yang, Y. Wang, X. Chen, J. Feng, Q. Wu, D. Zhu, Y. Ma (2014) Biotransformations of steroids to testololactone by a multifunctional strain Penicillium simplicissimum WY134-2. Tetrahedron 70, 41 -46); Penicillium lanosocoeruleum with a yield of 91% (A. Świzdor (2013) Baeyer-Villiger Oxidation of Some C19 Steroids by Penicillium lanosocoeruleum. Molecules 18, 13812-13822).
Istota wynalazku polega na tym, że regioselektywną laktonizację pierścienia D, poprzedza utlenienie grupy hydroksylowej przy trzecim atomie węgla i izomeryzacją wiązania podwójnego z 5-en do 4-en w substracie, którym jest 33-hydroksyandrost-5-en-17-on (DHEA), w wyniku tych przekształceń otrzymuje się 17a-oxa-D-homo-androst-4-en-3,17-dion, proces prowadzi się w wodnej kulturze szczepu Penicillium chrysogenum KCh S4.The essence of the invention is that regioselective lactonization of the D ring is preceded by the oxidation of the hydroxyl group at the third carbon atom and the isomerization of the double bond from 5-en to 4-ene in the substrate, which is 33-hydroxyandrost-5-en-17-one (DHEA ), as a result of these transformations, 17a-oxa-D-homo-androst-4-ene-3,17-dione are obtained, the process is carried out in an aqueous culture of the strain Penicillium chrysogenum KCh S4.
Istota wynalazku polega na tym, że do podłoża odpowiedniego dla grzybów strzępkowych wprowadza się szczep Penicillium chrysogenum KCh S4. Po upływie co najmniej 48 godzin do hodowli wprowadza się substrat, którym jest 33-hydroksyandrost-5-en-17-on o wzorze 1, rozpuszczony w rozpuszczalniku organicznym mieszającym się z wodą. Transformację prowadzi się w temperaturze od 20 do 30 stopni Celsjusza, przy ciągłym wstrząsaniu, co najmniej 96 godzin. Kolejno produkt ekstrahuje się rozpuszczalnikiem organicznym niemieszającym się z wodą i oczyszcza chromatograficznie.The essence of the invention consists in introducing the Penicillium chrysogenum KCh S4 strain into a medium suitable for filamentous fungi. After at least 48 hours, the substrate is introduced into the culture, which is 33-hydroxyandrost-5-en-17-one of the formula I, dissolved in a water-miscible organic solvent. The transformation is carried out at a temperature of 20 to 30 degrees Celsius with continuous shaking for at least 96 hours. Subsequently, the product is extracted with a water-immiscible organic solvent and purified by chromatography.
Korzystnie jest, gdy stosunek masy dodawanego substratu do objętości hodowli wynosi 0,2 g : 1 L. Korzystnie także jest, gdy proces prowadzi się w temperaturze 25 stopni Celsjusza.It is preferred that the ratio of mass of the added substrate to the volume of culture is 0.2 g: 1 L. It is also preferred that the process is carried out at a temperature of 25 degrees Celsius.
Dodatkowo, korzystnie jest, gdy transformację prowadzi się przez 96 godzin.Additionally, it is preferred that the transformation is carried out for 96 hours.
Postępując zgodnie z wynalazkiem, w wyniku działania układu enzymatycznego zawartego w komórkach szczepu Penicillium chrysogenum KCh S4, następuje regioselektywna laktonizacja pierścienia D poprzedzona utlenieniem grupy hydroksylowej przy trzecim atomie węgla i izomeryzacją wiązania podwójnego z 5-en do 4-en. Uzyskany w ten sposób produkt wydziela się z wodnej kultury mikroorganizmu, znanym sposobem, przez ekstrakcję rozpuszczalnikiem organicznym niemieszającym się z wodą (chloroform).In accordance with the invention, as a result of the enzyme system contained in the cells of the Penicillium chrysogenum KCh S4 strain, regioselective lactonization of the D-ring occurs, preceded by oxidation of the hydroxyl group at the third carbon atom and isomerization of the 5-ene to 4-ene double bond. The product obtained in this way is separated from the aqueous culture of the microorganism by a known method by extraction with a water-immiscible organic solvent (chloroform).
Zasadniczą zaletą wynalazku jest otrzymanie 17a-oxa-D-homo-androst-4-en-3,17-dionu z wydajnością izolowaną na poziomie 60% (według GC > 70%), w temperaturze pokojowej i przy pH naturalnym dla szczepu.The main advantage of the invention is the preparation of 17a-oxa-D-homo-androst-4-ene-3,17-dione with an isolated yield of 60% (according to GC> 70%), at room temperature and pH natural for the strain.
Wynalazek jest bliżej objaśniony na przykładzie wykonania.The invention is explained in more detail using an exemplary embodiment.
PL 235 399 Β1PL 235 399 Β1
Metoda izolowania szczepu Penicillium chrysogenum KCh S4Method of isolating the strain Penicillium chrysogenum KCh S4
Próbkę gleby pobranej na Śmietnisku - Wrocław, dzielnica Nadodrze, ul. Jedności Narodowej przeniesiono do sterylnej gilzy. Następnie w warunkach aseptycznych 1 g gleby rozpuszczono w 10 ml sterylnej wody. Pobrano 1 cm3 supernatantu i wykonano posiewy z kolejnych rozcieńczeń. Kolejnymi rozcieńczeniami badanego materiału zaszczepiono płytki agarowe (sterylne plastikowe płytki z 20 ml pożywki stałej o składzie: glukoza 3%, aminobak 1%, agar 0,8%). Z jednego z rozcieńczeń wyodrębniono czystą kulturę szczepu Penicillium chrysogenum KCh S4, który wykorzystano do biotransformacji. Wyodrębniony szczep przechowywany jest na skosach agarowych w temperaturze +4°C w kolekcji Katedry Chemii Uniwersytetu Przyrodniczego we Wrocławiu, ul. C.K. Norwida 25, 50-375 Wrocław.A soil sample collected in Śmietnisko - Wrocław, Nadodrze district, ul. National Unity was transferred to a sterile thimble. Then, under aseptic conditions, 1 g of the soil was dissolved in 10 ml of sterile water. 1 cm 3 of the supernatant was taken and inoculated from serial dilutions. The agar plates were inoculated with successive dilutions of the material to be tested (sterile plastic plates with 20 ml of solid medium with the following composition: glucose 3%, amino acid 1%, agar 0.8%). From one of the dilutions, a pure culture of Penicillium chrysogenum KCh S4 strain was isolated and used for biotransformation. The extracted strain is stored on agar slants at a temperature of + 4 ° C in the collection of the Department of Chemistry, University of Life Sciences in Wrocław, ul. CK Norwida 25, 50-375 Wrocław.
Szczep dostępny jest również w Katedrze Biotechnologii i Mikrobiologii Żywności, Uniwersytet Przyrodniczy we Wrocławiu, ul. J. Chełmońskiego 37, 51-630 Wrocław.The strain is also available at the Department of Food Biotechnology and Microbiology, Wrocław University of Environmental and Life Sciences, ul. J. Chełmońskiego 37, 51-630 Wrocław.
Przykład. Do kolby Erlenmajera o pojemności 2000 cm3, w której znajduje się 500 cm3 sterylnej pożywki zawierającej 5 g aminobaku i 15 g glukozy, wprowadza się szczep Penicillium chrysogenum KCh S4 o sekwencji 1. Po 72 godzinach jego wzrostu dodaje się 100 mg 33-hydroksyandrost-5-en-17-onu o wzorze 1, rozpuszczonego w 1 cm3 tetrahydrofuranu. Transformację prowadzi się w 25 stopniach Celsjusza przy ciągłym wstrząsaniu przez 6 dni. Następnie mieszaninę poreakcyjną ekstrahuje się trzykrotnie chloroformem, osusza bezwodnym siarczanem magnezu i odparowuje rozpuszczalnik. Otrzymany ekstrakt oczyszcza się chromatograficznie, używając jako eluentu mieszaniny heksanu i acetonu w stosunku objętościowym 2:1.Example. Penicillium chrysogenum KCh S4 strain of sequence 1 is introduced into an Erlenmajer flask with a capacity of 2000 cm 3 , containing 500 cm 3 of sterile medium containing 5 g of aminobac and 15 g of glucose. After 72 hours of its growth, 100 mg of 33-hydroxyandrost are added -5-en-17-one of formula 1, dissolved in 1 cm 3 of tetrahydrofuran. The transformation is carried out at 25 degrees Celsius with continuous shaking for 6 days. The reaction mixture was then extracted three times with chloroform, dried with anhydrous magnesium sulfate and the solvent was evaporated. The extract obtained is purified by chromatography using a 2: 1 v / v mixture of hexane and acetone as eluent.
Na tej drodze otrzymuje się 60,1 mg 17a-oxa-D-homo-androst-4-en-3,17-dionu (wydajność 60%, według GC > 70%).In this way, 60.1 mg of 17a-oxa-D-homo-androst-4-ene-3,17-dione are obtained (yield 60%, according to GC> 70%).
Uzyskany produkt charakteryzuje się następującymi danymi spektralnymi:The obtained product is characterized by the following spectral data:
1H NMR (600 MHz) (ppm) (CDCh) δ: 1.03-1.15 (m, 2H, 7-Ηα, 9-H); 1.14 (s,3H, 18-H); 1.26-1.32 (m, 1H, 11-Ηβ); 1.32 (s, 3H, 19-H); 1.36-1.43 (m, 2H, 8-H, 14-H); 1.48-1.57 (m, 1H, 15-Ηβ); 1.64 (td, 1H, J = 13.3, 4.2 Hz, 12-Hoc); 1.70 (td, 1H, J = 13.9, 5.0 Hz, 1-Ha); 1.77 (dq, J = 13.6, 3.7 Hz, 1H, 11-Ha); 1.96-2.05 (m, 4H, 1-Ηβ, 7-Ηβ, 12-Ηβ, 15-Ha); 2.27-2.36 (m, 3H, 2-Ha, 6-Ha, 6-Ηβ); 2.40 (ddd, 1H, J= 17.0, 14.4, 5.1 Hz, 2-Ηβ); 2.56 (dt, 1H, J= 18.8, 9.1 Hz, 16-Ha); 2.67 (ddd, 1H, J= 19.0, 8.8, 2.2 Hz, 16-Ηβ); 5.72 (brs, 1H, 4-H); 1 H NMR (600 MHz) (ppm) (CDCl 3) δ: 1.03-1.15 (m, 2H, 7-α, 9-H); 1.14 (s, 3H, 18-H); 1.26-1.32 (m, 1H, 11-Ηβ); 1.32 (s, 3H, 19-H); 1.36-1.43 (m, 2H, 8-H, 14-H); 1.48-1.57 (m, 1H, 15-Ηβ); 1.64 (td, 1H, J = 13.3, 4.2 Hz, 12-Hoc); 1.70 (td, 1H, J = 13.9, 5.0 Hz, 1-Ha); 1.77 (dq, J = 13.6, 3.7 Hz, 1H, 11-Ha); 1.96-2.05 (m, 4H, 1-Ηβ, 7-Ηβ, 12-Ηβ, 15-Ha); 2.27-2.36 (m, 3H, 2-Ha, 6-Ha, 6-Ηβ); 2.40 (ddd, 1H, J = 17.0, 14.4, 5.1 Hz, 2-Ηβ); 2.56 (dt, 1H, J = 18.8, 9.1 Hz, 16-Ha); 2.67 (ddd, 1H, J = 19.0, 8.8, 2.2 Hz, 16-Ηβ); 5.72 (br s, 1H, 4-H);
13C NMR (151 MHz) (ppm) (CDCh) δ: 17,40 (C-18), 19,82 (C-15), 20,11 (C-19), 21,82 (C-11), 28,53 (C-16), 30,37 (C-7), 32,35 (C-6), 33,84 (C-2), 35,46 (C-1), 37,92 (C-8), 38,46 (C-10), 38,93 (C-12), 45,62 (C-14), 52,45 (C-9), 82,87 (C-13), 124,07 (C-4), 169,63 (C-5), 171,44 (C-17), 199,40 (C-3). 13 C NMR (151 MHz) (ppm) (CDCl 3) δ: 17.40 (C-18), 19.82 (C-15), 20.11 (C-19), 21.82 (C-11) , 28.53 (C-16), 30.37 (C-7), 32.35 (C-6), 33.84 (C-2), 35.46 (C-1), 37.92 ( C-8), 38.46 (C-10), 38.93 (C-12), 45.62 (C-14), 52.45 (C-9), 82.87 (C-13), 124.07 (C-4), 169.63 (C-5), 171.44 (C-17), 199.40 (C-3).
TGCGGAGGACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCG TGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGG GGGCTTACGCCCCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGGAC GGGGCCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAG GCATGCCCCCCGGAATACCAGGgGGCGCAATGTGCGTTCAAAGACTCGATG ATTTGCGGAGGACATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCG TGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGG GGGCTTACGCCCCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGGAC GGGGCCCAACACACAAGCCGTGCTTGAGGGCAGAAATGACGCTCGGACAG GCATGCCCCCCGGAATACCAGGgGGCGCAATGTGCGTTCAAAGACTCGATG ATT
Claims (4)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PL420187A PL235399B1 (en) | 2017-01-13 | 2017-01-13 | Method for producing 17a-oxa-D-homo-androst-4-en-17-one |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PL420187A PL235399B1 (en) | 2017-01-13 | 2017-01-13 | Method for producing 17a-oxa-D-homo-androst-4-en-17-one |
Publications (2)
Publication Number | Publication Date |
---|---|
PL420187A1 PL420187A1 (en) | 2018-02-26 |
PL235399B1 true PL235399B1 (en) | 2020-07-13 |
Family
ID=61227747
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PL420187A PL235399B1 (en) | 2017-01-13 | 2017-01-13 | Method for producing 17a-oxa-D-homo-androst-4-en-17-one |
Country Status (1)
Country | Link |
---|---|
PL (1) | PL235399B1 (en) |
-
2017
- 2017-01-13 PL PL420187A patent/PL235399B1/en unknown
Also Published As
Publication number | Publication date |
---|---|
PL420187A1 (en) | 2018-02-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP3620528B1 (en) | Use of a mutant lacking the acyl-coenzyme a thiolase gene | |
PL235399B1 (en) | Method for producing 17a-oxa-D-homo-androst-4-en-17-one | |
PL235018B1 (en) | Method for producing 17a-oxa-D-homo-androst-4-en-17-one | |
Zhang et al. | Synthesis and antibacterial activity against MRSA of pleuromutilin derivatives possessing a mercaptoethylamine linker | |
Savinova et al. | Extraction of a mixture of phytosterols from soybean processing by-product and its use in the manufacture of 9α-hydroxyandrost-4-en-3, 17-dione | |
PL235022B1 (en) | Method for producing 6β-hydroxyandrost-4-en-3,17-dione | |
PL235023B1 (en) | Method for producing 3β,6β-dihydroxyandrost-4-en-17-one | |
JP2010531660A (en) | Method for synthesizing 9α-hydroxy-steroids | |
PL235287B1 (en) | Method for producing androst-1,4-dien-3,17-dione | |
PL237135B1 (en) | 3β,17α-Dihydroxy-5α-chloro-6,19-oxidoandrostane and method of preparation of 3β,17α-dihydroxy-5α-chloro-6,19-oxidoandrostane | |
PL237711B1 (en) | 3β-Hydroxy-5α-chloro-6,19-oxidoandrostan-17-one and method of preparation of 3β-hydroxy-5α-chloro-6,19-oxidoandrostan-17-one | |
PL237709B1 (en) | 3β-Hydroxy-5α-chloro-6,19-oxidoandrostan-17-one and method of preparation of 3β-hydroxy-5α-chloro-6,19-oxidoandrostan-17-one | |
ATIF et al. | Solid phase microbial fermentation of anabolic steroid, dihydrotestosterone with ascomycete fungus fusarium oxysporum | |
PL237710B1 (en) | 3β-Hydroxy-5α-chloro-6,19-oxidoandrostan-17-one and method of preparation of 3β-hydroxy-5α-chloro-6,19-oxidoandrostan-17-one | |
Hirashita et al. | Stereoselective allylation of azirines with allylindium reagents | |
PL237134B1 (en) | 3β,11α-Dihydroxy-5α-chloro-6,19-oxidoandrostan-17-one and method of preparation of 3β,11α-dihydroxy-5α-chloro-6,19-oxidoandrostan-17-one | |
PL235020B1 (en) | Method for producing 3?,7?,17?-trihydroxyandrost-5-ene | |
PL228763B1 (en) | Method for producing 7α-hydroxyandrost-4-en-3,17-dione | |
PL239563B1 (en) | 3β-Hydroxy-5α-chloro-17a-oxa-D-homo-6,19-oxidoandrostan-17-one and method of preparation of 3β-hydroxy-5α-chloro-17a-oxa-D-homo-6,19-oxidoandrostane-17-one | |
PL228071B1 (en) | Method for producing 17α-methylandrost-1,4-dien-3-on-17-ole | |
PL236834B1 (en) | 3β,11α-Dihydroxy-5α-chloro-17a-oxa-D-homo-6,19-oxidoandrostan-17-one and method of preparation of 3β,11α-dihydroxy-5α-chloro-17a-oxa-D-homo-6,19 oksidoandrostan-17-one | |
PL239564B1 (en) | 3β-Hydroxy-5α-chloro-17a-oxa-D-homo-6,19-oxidoandrostan-17-one and method of preparation of 3β-hydroxy-5α-chloro-17a-oxa-D-homo-6,19-oxidoandrostane-17-one | |
PL237126B1 (en) | Method for producing 6?-hydroxyandrost-4-en-3,17-dione | |
PL228764B1 (en) | Method for producing 6β-hydroxyandrost-4-en-3,11,17-trione | |
PL228070B1 (en) | Method for producing androst-1,4,6-trien-3-on-17-ole acetate |