PL235018B1 - Method for producing 17a-oxa-D-homo-androst-4-en-17-one - Google Patents

Description

Description of the invention

The present invention relates to a process for the preparation of 17a-oxa-D-homo-androst-4-ene-3,17-dione.

The method according to the invention may find application in the pharmaceutical industry for the production of a drug used in hormone therapy (Carel JC., Lahlou N., Roger M., Chaussain JL (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147. ).

Steroid drugs are the second largest group of drugs after antibiotics, playing an important role in the treatment and prevention of various diseases (Zhang WQ, Shao ML, Rao ZM, Xu MJ, Zhang X., Yang TW, Li H., Xu ZH (2013) Bioconversion of 4-androstene-3,17-dione to androst-1,4-diene-3,17-dione by recombinant Bacillus subtilis expressing ksdd gene encoding 3-ketosteroid-A1-dehydrogenase from Mycobacterium neoaurum JC-12. J Steroid Biochem Mol Biol 135: 36-42).

17a-oxa-D-homo-androst-4-ene-3,17-dione is a precursor of testolactone - a compound used as an aromatase inhibitor. Thanks to this property, it prevents the growth of breast tumors that are activated by estrogen (Clark RV, Sherins RJ (1989) Treatment of men with idiopathic oligozoospermic infertility using the aromatase inhibitor, testolactone results of a double-blinded, randomized, placebo-controlled trial with crossover J Androl 10, 240-247 Due to its ability to block estrogen production, testolactone has also been found to be effective in preventing premature puberty (Carel JC., Lahlou N., Roger M., Chaussain JL (2004) Precocious puberty and statural growth. Hum Reprod Update. 10, 135-147).

Biotransformations are an ecological alternative to classical chemical synthesis in obtaining active compounds and are increasingly used in the biopharmaceutical industry, especially for the production of steroid drugs (M.-M. Chen, F.-Q. Wang, L.-C. Lin, K. Yao , D.-Z. Wei; Characterization and application of fusidane antibiotic biosynethsis enzyme 3-ketosteroid-A ¹ -dehydrogenase in steroid transformation. Appl Microbiol Biotechnol 96, 2012, 133-142).

There are known microbiological methods of obtaining 17a-oxa-D-homo-androst-4-en-3,17-dione from 3β-hydroxyandrost-5-en-17-one by using the strain: Penicillium simplicissimum WY134-2 with 53% efficiency (B. Yang, Y. Wang, X. Chen, J. Feng, Q. Wu, D. Zhu, Y. Ma (2014) Biotransformations of steroids to testololactone by a multifunctional strain Penicillium simplicissimum WY134-2. Tetrahedron 70, 41 -46); Penicillium lanosocoeruleum with a yield of 91% (A. Świzdor (2013) Baeyer-Villiger Oxidation of Some C19 Steroids by Penicilliumlanosocoeruleum. Molecules 18, 13812-13822).

The essence of the invention is that regioselective lactonization of the D ring is preceded by the oxidation of the hydroxyl group at the third carbon atom and the isomerization of the double bond from 5-en to 4-ene in the substrate, which is 33-hydroxyandrost-5-en-17-one (DHEA ), as a result of these transformations 17a-oxa-D-homo-androst-4-ene-3,17-dione are obtained, it is carried out in an aqueous culture of the strain Penicillium commune KCh W7.

The essence of the invention consists in introducing the Penicillium commune KCh W7 strain into a medium suitable for filamentous fungi. After at least 48 hours, the substrate is introduced into the culture, which is 33-hydroxyandrost-5-en-17-one of the formula I, dissolved in a water-miscible organic solvent. The transformation is carried out at a temperature of 20 to 30 degrees Celsius with continuous shaking for at least 96 hours. Subsequently, the product is extracted with a water-immiscible organic solvent and purified by chromatography.

Preferably, the ratio of the weight of the added substrate to the culture volume is 0.2 g: 1 L.

It is also preferred that the process is carried out at a temperature of 25 degrees Celsius.

Additionally, it is preferred that the transformation is carried out for 96 hours.

In accordance with the invention, as a result of the enzyme system contained in the cells of the Penicillium commune KCh W7 strain, regioselective lactonization of the D-ring takes place, preceded by oxidation of the hydroxyl group at the third carbon atom and isomerization of the 5-ene to 4-ene double bond. The product obtained in this way is separated from the aqueous culture of the microorganism by a known method by extraction with a water-immiscible organic solvent (chloroform).

The main advantage of the invention is the preparation of 17a-oxa-D-homo-androst-4-ene-3,17-dione with an isolated yield of 75% (according to GC> 85%), at room temperature and pH natural for the strain.

The invention is explained in more detail using an exemplary embodiment.

PL 235 018 Β1

Method of isolating the strain Penicillium commune KCh W7

The soil sample collected at Słodowa Island - Wrocław, near the Old Town and the Water Junction was transferred to a sterile thimble. Then, under aseptic conditions, 1 g of the soil was dissolved in 10 ml of sterile water. 1 cm ^{3 of the} supernatant was taken and inoculated from serial dilutions. The agar plates were inoculated with successive dilutions of the material to be tested (sterile plastic plates with 20 ml of solid medium with the following composition: glucose 3%, amino acid 1%, agar 0.8%). From one of the dilutions, a pure culture of Penicillium commune KCh W7 strain was isolated and used for biotransformation. The extracted strain is stored on agar slants at a temperature of + 4 ° C in the collection of the Department of Chemistry, University of Life Sciences in Wrocław, ul. CK Norwida 25, 50-375 Wrocław.

The strain is also available at the Department of Food Biotechnology and Microbiology, Wrocław University of Environmental and Life Sciences, ul. J. Chełmońskiego 37, 51-630 Wrocław.

Example 1. Penicillium commune KCh W7 strain of sequence 1 is introduced into an Erlenmajer flask with a capacity of 2000 cm ³ , containing 500 cm ^{3 of} sterile medium containing 5 g of aminobac and 15 g of glucose. 100 mg of 33-hydroxyandrost-5-en-17-one of formula I, dissolved in 1 cm ^{3 of} tetrahydrofuran, are obtained. The transformation is carried out at 25 degrees Celsius with continuous shaking for 6 days. The reaction mixture was then extracted three times with chloroform, dried with anhydrous magnesium sulfate and the solvent was evaporated. The extract obtained is purified by chromatography using a 2: 1 v / v mixture of hexane and acetone as eluent.

In this way, 75.0 mg of 17a-oxa-D-homo-androst-4-ene-3,17-dione are obtained (yield 75%, according to GC> 85%).

The obtained product is characterized by the following spectral data:

¹ H NMR (600MHz) (ppm) (CDCl) δ: 1.03-1.15 (m, 2H, 7-Hoc, 9 H); 1.14 (s, 3H, 18-H); 1.26-1.32 (m, 1H, 11-Ηβ); 1.32 (s, 3H, 19-H); 1.36-1.43 (m, 2H, 8-H, 14-H); 1.48-1.57 (m, 1H, 15-Ηβ); 1.64 (td, 1H, J = 13.3, 4.2 Hz, 12-Haa); 1.70 (td, 1H, J = 13.9, 5.0 Hz, 1-Ha); 1.77 (dq, J = 13.6, 3.7 Hz, 1H, 11-Ha); 1.96-2.05 (m, 4H, 1-Ηβ, 7-Ηβ, 12-Ηβ, 15-Ha); 2.27-2.36 (m, 3H, 2-Ha, 6-Ha, 6-Ηβ); 2.40 (ddd, 1H, J = 17.0, 14.4, 5.1 Hz, 2-Ηβ); 2.56 (dt, 1H, J = 18.8, 9.1 Hz, 16-Ha); 2.67 (ddd, 1H, J = 19.0, 8.8,

2.2 Hz, 16-Ηβ); 5.72 (br s, 1H. 4-H);

¹³ C NMR (151MHz) (ppm) (CDCb) δ: 17.40 (C-18), 19.82 (C-15), 20.11 (C-19), 21.82 (C-11), 28.53 (C-16), 30.37 (C-7), 32.35 (C-6), 33.84 (C-2), 35.46 (C-1), 37.92 (C -8), 38.46 (C-10), 38.93 (C-12), 45.62 (C-14), 52.45 (C-9), 82.87 (C-13), 124 . 07 (C-4), 169.63 (C-5), 171.44 (C-17), 199.40 (C-3).

CTGATCGAGGTCACCTGGATAAAAATTTGGGTTGATCGGCAAGCGCCGGCC GGGCCTACAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCG GTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGATCGGAGGACGGGGC CCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGGCATG CCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCA CTGAATTTGCAATTCACATTACGTATCGCATTTCGCTGCGTTCTTCATCGATG CCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAAATAATTTATATTTTCACTC AGACTACAATCTTCAGACAGAGTTCGAGGGTGTCTTCGGCGGGCGCGGGC CCGGGGGCGTAAGCCCCCCGGCGGCCAGTTAAGGCGGGCCCGCCGAAGC AACAAGGTAAAATAAACACGGGTGGGAGGTTGGACCCAGAGG

Sequence 1

Claims (4)

1. Method for the production of 17a-oxa-D-homo-androst-4-en-3,17-dione, characterized in that the Penicillium commune KCh W7 strain of sequence 1 is introduced into a medium suitable for filamentous fungi, followed by at least 48 hours, the substrate is introduced into the culture, which is 33-hydroxyandrost-5-en-17-one of formula 1, dissolved in a water-miscible organic solvent, the transformation is carried out at a temperature of 20 to 30 degrees Celsius, with continuous shaking, for at least 3 days, after which the product is extracted with a water-immiscible organic solvent and purified by chromatography. PL 235 018 Β1 2. The method according to p. The method of claim 1, wherein the ratio of the weight of the added substrate to the culture volume is 0.2 g: 1 L. 3. The method according to p. The process of claim 1, wherein the temperature is 25 degrees Celsius. 4. The method according to p. The method of claim 1, wherein the transformation is carried out for 3 days.