PL235020B1

PL235020B1 - Method for producing 3?,7?,17?-trihydroxyandrost-5-ene

Info

Publication number: PL235020B1
Application number: PL420193A
Authority: PL
Inventors: Ewa Kozłowska; Monika Dymarska; Anna Kancelista; Cel Ista Anna Kan; Edyta Kostrzewa-Susłow; Monika Urbaniak; Iak Monika Urban; Łukasz Stępień; Tomasz Janeczko; Czko Tomasz Jane
Original assignee: Wrocław University Of Environmental And Life Sciences
Priority date: 2017-01-13
Filing date: 2017-01-13
Publication date: 2020-05-18
Also published as: PL420193A1

Description

Opis wynalazkuDescription of the invention

Przedmiotem wynalazku jest sposób wytwarzania 33,7a,17a-trihydroksyandrost-5-enu.The present invention relates to a process for the preparation of 33.7a, 17a-trihydroxyandrost-5-ene.

Metoda, według wynalazku może znaleźć zastosowanie w przemyśle farmaceutycznym do wytwarzania leków o właściwościach immunomodulujących (Lehman L.R., Stewart J.D., Filamentous fungi: Potentially useful catalysts for the biohydroxylations of non-activated carbon centers Curr. Org. Chem. 2001,5, 439; Wong L.L., Cytochrome P450 monooxygenases. Curr. Opin. Chem. Biol. 1998, 2, 263).The method according to the invention can find application in the pharmaceutical industry for the production of drugs with immunomodulatory properties (Lehman LR, Stewart JD, Filamentous fungi: Potentially useful catalysts for the biohydroxylations of non-activated carbon centers Curr. Org. Chem. 2001,5, 439; Wong LL, Cytochrome P450 monooxygenases. Curr. Opin. Chem. Biol. 1998, 2, 263).

Dane doświadczalne i kliniczne wskazują, że 33,7a,17a-trihydroksyandrost-5-en-17-on jest powstającym z DHEA (dehydroepiandrosteronu) bioaktywnym metabolitem człowieka wykazującym działanie neuroprotekcyjne, przeciwzapalne i antyproliferacyjne względem komórek nowotw orowych (Robinzon B, Michael KK, Ripp SL, Winters SJ, Prough RA: 2003 Glucocorticoids inhibit interconversion of 7-hydroxy and 7-oxo metabolites of dehydroepiandrosterone: a role for 11 |<-hydroxysteroid dehydrogenases? Arch Biochem Biophys 412, 251 -258; Chalbot S, Morfin R: 2005 Human liver S9 fractions: metabolism of dehydroepiandrosterone, epiandrosterone, and related 7-hydroxylated derivatives. Drug Metab Dispos 33, 563-569). 33,7a,17a-trihydroksyandrost-5-en wykazuje wysoką aktywność antynowotworową względem linii komórkowych chłoniaka. Wykazano, że andorostentriole właśnie z takim usytuowaniem grup hydroksylowych wykazują najwyższą aktywność antynowotworową (M.R. Graf, W. Jta, M.L. Lewbart, R.M. Loria (2009) The anti-tumor effects of androstene steroids exhibit a strict structure-activity relationship dependent upon the orientation of the hydroxyl group on carbon-17. Chem Biol Drug Des 2009; 74: 625-629).Experimental and clinical data show that 33.7a, 17a-trihydroxyandrost-5-en-17-one is a bioactive human metabolite produced from DHEA (dehydroepiandrosterone), showing neuroprotective, anti-inflammatory and antiproliferative effects towards oric tumor cells (Robinzon B, Michael KK, Ripp SL, Winters SJ, Prough RA: 2003 Glucocorticoids inhibit interconversion of 7-hydroxy and 7-oxo metabolites of dehydroepiandrosterone: a role for 11 | <-hydroxysteroid dehydrogenases? Arch Biochem Biophys 412, 251 -258; Chalbot S, Morfin R: 2005 Human liver S9 fractions: metabolism of dehydroepiandrosterone, epiandrosterone, and related 7-hydroxylated derivatives. Drug Metab Dispos 33, 563-569). 33,7a, 17a-trihydroxyandrost-5-ene shows high anti-tumor activity against lymphoma cell lines. It has been shown that andorostentriols with such a location of hydroxyl groups show the highest anti-cancer activity (MR Graf, W. Jta, ML Lewbart, RM Loria (2009) The anti-tumor effects of androstene steroids exhibit a strict structure-activity relationship dependent upon the orientation of the hydroxyl group on carbon-17. Chem Biol Drug Des 2009; 74: 625-629).

Znana jest chemiczna metoda otrzymywania 33,7a,17a-trihydroksyandrost-5-enu z 33,17a-dihydroksyandrost-5-enu w wyniku selektywnej oksydacji węgla allilowego i redukcji nowopowstałej grupy karbonylowej (M.R. Graf, W. Jia, M.L. Lewbart, R.M. Loria (2009) The anti-tumor effects of androstene steroids exhibit a strict structure-activity relationship dependent upon the orientation of the hydroxyl group on carbon-17. Chem Biol Drug Des 2009; 74: 625-629).There is a known chemical method for obtaining 33.7a, 17a-trihydroxyandrost-5-ene from 33.17a-dihydroxyandrost-5-ene by selective oxidation of allyl carbon and reduction of the newly formed carbonyl group (MR Graf, W. Jia, ML Lewbart, RM Loria (2009) The anti-tumor effects of androstene steroids exhibit a strict structure-activity relationship dependent upon the orientation of the hydroxyl group on carbon-17. Chem Biol Drug Des 2009; 74: 625-629).

W dostępnej literaturze nie znaleziono mikrobiologicznej metody otrzymywania 33,7a,17a-trihydroksyandrost-5-enu.In the available literature, no microbiological method for the preparation of 33.7a, 17a-trihydroxyandrost-5-ene was found.

Istota wynalazku polega na tym, że regioselektywne wprowadzenie grupy hydroksylowej w cząsteczce substratu, którym jest 33-hydroksyandrost-5-en-17-on (DHEA), w wyniku którego otrzymuje się 33,7a,17a-trihydroksyandrost-5-en, poprzedzone jest enancjospecyficzną redukcją grupy karbonylowej usytuowanej przy C-17, reakcję prowadzi się w wodnej kulturze szczepu Mucor hiemalis KCh W2.The essence of the invention lies in the fact that the regioselective introduction of the hydroxyl group in the substrate molecule, which is 33-hydroxyandrost-5-en-17-one (DHEA), as a result of which 33.7a, 17a-trihydroxyandrost-5-ene is obtained, preceded by is an enantiospecific reduction of the carbonyl group situated at C-17, the reaction is carried out in an aqueous culture of the strain Mucor hiemalis KCh W2.

Istota wynalazku polega na tym, że do podłoża odpowiedniego dla grzybów strzępkowych wprowadza się szczep Mucor hiemalis KCh W2. Po upływie co najmniej 48 godzin do hodowli wprowadza się substrat, którym jest 33-hydroksyandrost-5-en-17-on o wzorze 1, rozpuszczony w rozpuszczalniku organicznym mieszającym się z wodą. Transformację prowadzi się w temperaturze od 20 do 30 stopni Celsjusza, przy ciągłym wstrząsaniu, co naj mniej 24 godziny. Kolejno produkt ekstrahuje się rozpuszczalnikiem organicznym niemieszającym się z wodą i oczyszcza chromatograficznie.The essence of the invention consists in introducing the strain Mucor hiemalis KCh W2 into a medium suitable for filamentous fungi. After at least 48 hours, the substrate is introduced into the culture, which is 33-hydroxyandrost-5-en-17-one of the formula I, dissolved in a water-miscible organic solvent. The transformation is carried out at a temperature of 20 to 30 degrees Celsius with continuous shaking for at least 24 hours. Subsequently, the product is extracted with a water-immiscible organic solvent and purified by chromatography.

Korzystnie jest, gdy stosunek masy dodawanego substratu do objętości hodowli wynosi 0,1 g : 1 L.Preferably, the ratio of the weight of the added substrate to the culture volume is 0.1 g: 1 L.

Korzystnie także jest, gdy proces prowadzi się w temperaturze 25 stopni Celsjusza.It is also preferred that the process is carried out at a temperature of 25 degrees Celsius.

Dodatkowo, korzystnie jest, gdy transformację prowadzi się przez 3 dni.Additionally, it is preferable that the transformation is carried out for 3 days.

Postępując zgodnie z wynalazkiem, w wyniku działania układu enzymatycznego zawartego w komórkach szczepu Mucor hiemalis KCh W2, następuje stereoselektywna hydroksylacja przy atomie węgla C-7, poprzedzona enancjospecyficzną redukcją grupy karbonylowej przy węglu C-17. Uzyskany w ten sposób produkt wydziela się z wodnej kultury mikroorganizmu, znanym sposobem, przez ekstrakcję rozpuszczalnikiem organicznym niemieszającym się z wodą (chloroform).Proceeding according to the invention, as a result of the enzyme system contained in the cells of the Mucor hiemalis KCh W2 strain, stereoselective hydroxylation occurs at the C-7 carbon atom, preceded by an enantiosspecific reduction of the carbonyl group at the C-17 carbon. The product obtained in this way is separated from the aqueous culture of the microorganism by a known method by extraction with a water-immiscible organic solvent (chloroform).

Zasadniczą zaletą wynalazku jest otrzymanie 33,7a,17a-trihydroksyandrost-5-enu z wydajnością izolowaną na poziomie 54% (według GC > 65%), w temperaturze pokojowej i przy pH naturalnym dla szczepu.The main advantage of the invention is the preparation of 33.7a, 17a-trihydroxyandrost-5-ene with an isolated yield of 54% (according to GC> 65%), at room temperature and pH natural for the strain.

Wynalazek jest bliżej objaśniony na przykładzie wykonania.The invention is explained in more detail using an exemplary embodiment.

Metoda izolowania szczepu Mucor hiemalis KCh W2Method of isolating the strain Mucor hiemalis KCh W2

Próbkę gleby pobranej na Wyspa Słodowa - Wrocław, okolice Starego Miasta i Węzła Wodnego przeniesiono do sterylnej gilzy. Następnie w warunkach aseptycznych 1g gleby rozpuszczono w 10 ml sterylnej wody. Pobrano 1 cm³ supernatantu i wykonano posiewy z kolejnych rozcieńczeń. Kolejnymi rozcieńczeniami badanego materiału zaszczepiono płytki agarowe (sterylne plastikoweThe soil sample collected at Słodowa Island - Wrocław, near the Old Town and the Water Junction was transferred to a sterile thimble. Then, under aseptic conditions, 1 g of the soil was dissolved in 10 ml of sterile water. 1 cm ^{3 of the} supernatant was taken and inoculated from serial dilutions. The agar plates (sterile plastic

PL 235 020 Β1 płytki z 20 ml pożywki stałej o składzie: glukoza 3%, aminobak 1%, agar 0,8%). Z jednego z rozcieńczeń wyodrębniono czystą kulturę szczepu Mucor hiemalis KCh W2, który wykorzystano do biotransformacji. Wyodrębniony szczep przechowywany jest na skosach agarowych w temperaturze +4°C w kolekcji Katedry Chemii Uniwersytetu Przyrodniczego we Wrocławiu, ul. C.K. Norwida 25, 50-375 Wrocław.PL 235 020 Β1 plates with 20 ml of solid medium with the following composition: glucose 3%, amino acid 1%, agar 0.8%). From one of the dilutions, a pure culture of the Mucor hiemalis KCh W2 strain was isolated and used for biotransformation. The extracted strain is stored on agar slants at a temperature of + 4 ° C in the collection of the Department of Chemistry, University of Life Sciences in Wrocław, ul. C.K. Norwida 25, 50-375 Wrocław.

Szczep dostępny jest również w Katedrze Biotechnologii i Mikrobiologii Żywności, Uniwersytet Przyrodniczy we Wrocławiu, ul. J. Chełmońskiego 37, 51-630 Wrocław.The strain is also available at the Department of Food Biotechnology and Microbiology, Wrocław University of Environmental and Life Sciences, ul. J. Chełmońskiego 37, 51-630 Wrocław.

PrzykładExample

Do kolby Erlenmajera o pojemności 2000 cm³, w której znajduje się 500 cm³ sterylnej pożywki zawierającej 1 g aminobaku i 3 g glukozy, wprowadza się szczep Mucor hiemalis KCh W2 o sekwencjiTo the Erlenmeyer flask with a capacity of 2,000 cm ^3, which is 500 cm ^{3 of} sterile medium containing 1 g aminobaku and 3 g of glucose, is introduced into a strain of Mucor hiemalis SDS W2 having the sequence

1. Po 72 godzinach jego wzrostu dodaje się 100 mg 33-hydroksyandrost-5-en-17- onu o wzorze 1, rozpuszczonego w 1 cm³ metanolu. Transformację prowadzi się w 25 stopniach Celsjusza przy ciągłym, wstrząsaniu przez 3 dni. Następnie mieszaninę poreakcyjną ekstrahuje się: trzykrotnie chloroformem, osusza bezwodnym siarczanem magnezu i odparowuje rozpuszczalnik. Otrzymany ekstrakt oczyszcza się chromatograficznie, używając jako eluentu mieszaniny heksanu i acetonu w stosunku objętościowym 2:1.1. After 72 hours of its growth, 100 mg of 33-hydroxyandrost-5-en-17-one of formula 1, dissolved in 1 cm ^{3 of} methanol, are added. The transformation is carried out at 25 degrees Celsius with continuous shaking for 3 days. Then the reaction mixture was extracted: three times with chloroform, dried with anhydrous magnesium sulfate and the solvent was evaporated. The extract obtained is purified by chromatography using a 2: 1 v / v mixture of hexane and acetone as eluent.

Na tej drodze otrzymuje się 54,2 mg 33,7a,17a-trihydroksyandrost-5-en (wydajność 54%, według GC > 65%).In this way 54.2 mg of 33.7a, 17a-trihydroxyandrost-5-ene are obtained (yield 54%, according to GC> 65%).

Uzyskany produkt charakteryzuje się następującymi danymi spektralnymi:The obtained product is characterized by the following spectral data:

¹H NMR (600 MHz) (ppm) (CDCb) δ: 0.69 (s, 3H, 18-H); 1.00 (s, 3H, 19-H); 1.14 (td, 1H, J = 13.5, 3.7 Hz, 1-Ha); 1,20-1.29 (m, 2H, 9-H, 12Ha); 1.44-1.70 (m, 6H, 2-Ha, 8-H, 11-Ha, 11-Ηβ, 15- Ha, 16-Ha); 1.78-1.93 (m, 5H, 1-Ηβ, 2-Ηβ, 12-Ηβ, 14-H, 15-Ηβ); 2.21 (m, 1H, 16-Ηβ); 2.29 (br, J= 13.1 Hz, 4-Ha); 2.36 (ddd, 1H, J= 13.1, 5.0, 2.1 Hz, 4-Ηβ); 3.59 (tt, 1H, J= 11.0, 4.7 Hz, 3-Ha); 3.77 (d, 1H, J = 6.0 Hz, 17-Ηβ); 3.88 (br t, 1H, J = 3.7 Hz, 7-Ηβ); 5.62 (dd, 1H, J = 5.3, 1.5 Hz, 6-H). ¹ H NMR (600 MHz) (ppm) (CDCl 2) δ: 0.69 (s, 3H, 18-H); 1.00 (s, 3H, 19-H); 1.14 (td, 1H, J = 13.5, 3.7 Hz, 1-Ha); 1.20-1.29 (m, 2H, 9-H, 12Ha); 1.44-1.70 (m, 6H, 2-Ha, 8-H, 11-Ha, 11-Ηβ, 15-Ha, 16-Ha); 1.78-1.93 (m, 5H, 1-Ηβ, 2-Ηβ, 12-Ηβ, 14-H, 15-Ηβ); 2.21 (m, 1H, 16-Ηβ); 2.29 (br, J = 13.1 Hz, 4-Ha); 2.36 (ddd, 1H, J = 13.1, 5.0, 2.1 Hz, 4-Ηβ); 3.59 (mp, 1H, J = 11.0, 4.7Hz, 3-Ha); 3.77 (d, 1H, J = 6.0Hz, 17-Ηβ); 3.88 (br t, 1H, J = 3.7 Hz, 7-Ηβ); 5.62 (dd, 1H, J = 5.3, 1.5 Hz, 6-H).

¹³C NMR (151 MHz) (ppm) (CDCb) δ: 16,76 (C-18); 18,43 (C-19); 20,43 (C-11); 24,89 (C-15); 31,10 (C-2); 31,51 (C-12); 32,75 (C-16); 37,22 (C-1); 37,60 (C-10); 37,98 (C-8); 42,13 (C-14); 42,19 (C-4); 42,49 (C-9); 45,08 (C-13); 65,63 (C-7); 71,41 (C-3); 80,00 (C-17); 123,99 (C-6); 146,28 (C-5). ¹³ C NMR (151 MHz) (ppm) (CDCb) δ: 16.76 (C-18); 18.43 (C-19); 20.43 (C-11); 24.89 (C-15); 31.10 (C-2); 31.51 (C-12); 32.75 (C-16); 37.22 (C-1); 37.60 (C-10); 37.98 (C-8); 42.13 (C-14); 42.19 (C-4); 42.49 (C-9); 45.08 (C-13); 65.63 (C-7); 71.41 (C-3); 80.00 (C-17); 123.99 (C-6); 146.28 (C-5).

ATATGCTTAAGTTCAGCGGGTAATCCCGCCTGATTTCAGATCAAATTTAAGA ATGATTTATTTGGGAGGCCCCAGAGATAGTCTTTTTACTAGAGCATTCCTTTA TATTAAAAAAATGTTCAGGCAGAAAGAACAATAGTTCAGGCCTAATAATTTTA AAGAATTCAGCAATAAAGCCGAAACTCTCATTTCCATTCACAACAAAATTATG AATGTGGGGTGTTTTTGATACTGAAACAGGCGTGCTCAATGGAATACCATTG AGCGCAAGTTGCGTTCAAAGACTCGATGATTCACTGAATATGCAATTCACAC TAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCG TTGTTAAAAGTTGTTTTATAAGTTTTTTACGCTTATGTTACAATTATAATACTG AATTCTTTTGGTAAATAATTAATAGGATACCAGGCCTAAGCCTGACTTTCAGC TCGGTTAACATTCTAGTAGCCTATCCCTATGGCTAAAAGACATTCCTCAGAC GCTGAAAAATTAAAACAGTTCACAGTAAAAAAGAATGAACCATTCGCTAGAA AACTAGCAAAGGCCATCTAAATTATTTATATATGCTTAAGTTCAGCGGGTAATCCCGCCTGATTTCAGATCAAATTTAAGA ATGATTTATTTGGGAGGCCCCAGAGATAGTCTTTTTACTAGAGCATTCCTTTA TATTAAAAAAATGTTCAGGCAGAAAGAACAATAGTTCAGGCCTAATAATTTTA AAGAATTCAGCAATAAAGCCGAAACTCTCATTTCCATTCACAACAAAATTATG AATGTGGGGTGTTTTTGATACTGAAACAGGCGTGCTCAATGGAATACCATTG AGCGCAAGTTGCGTTCAAAGACTCGATGATTCACTGAATATGCAATTCACAC TAGTTATCGCACTTTGCTACGTTCTTCATCGATGCGAGAACCAAGAGATCCG TTGTTAAAAGTTGTTTTATAAGTTTTTTACGCTTATGTTACAATTATAATACTG AATTCTTTTGGTAAATAATTAATAGGATACCAGGCCTAAGCCTGACTTTCAGC TCGGTTAACATTCTAGTAGCCTATCCCTATGGCTAAAAGACATTCCTCAGAC GCTGAAAAATTAAAACAGTTCACAGTAAAAAAGAATGAACCATTCGCTAGAA AACTAGCAAAGGCCATCTAAATTATTTAT

Sekwencja 1Sequence 1

Claims

Method for the production of 33.7a, 17a-trihydroxyandrost-5-ene, characterized in that the Mucor hiemalis KCh W2 strain of sequence 1 is introduced into a medium suitable for filamentous fungi, then, after at least 48 hours, the substrate is introduced into the culture, which is 33-hydroxyandrost-5-en-17-one of formula 1, dissolved in a water-miscible organic solvent, and the transformation is carried out at a temperature of 20 to 30 degrees Celsius with continuous shaking for at least 72 hours after

The product is then extracted with a water-immiscible organic solvent and purified by chromatography.

2. The method according to p. The method of claim 1, wherein the ratio of the weight of the added substrate to the culture volume is 0.1 g: 1 L.

3. The method according to p. 1., characterized in that the temperature of the process is 25 degrees Celsius.

4. The method according to p. 1., characterized in that the transformation is carried out for 3 days.