NL2033084A - Ganoderma strain and cultivation method of fruiting body of ganoderma shanxiense thereof - Google Patents
Ganoderma strain and cultivation method of fruiting body of ganoderma shanxiense thereof Download PDFInfo
- Publication number
- NL2033084A NL2033084A NL2033084A NL2033084A NL2033084A NL 2033084 A NL2033084 A NL 2033084A NL 2033084 A NL2033084 A NL 2033084A NL 2033084 A NL2033084 A NL 2033084A NL 2033084 A NL2033084 A NL 2033084A
- Authority
- NL
- Netherlands
- Prior art keywords
- ganoderma
- shanxiense
- strain
- medium
- base medium
- Prior art date
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H15/00—Fungi; Lichens
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01G—HORTICULTURE; CULTIVATION OF VEGETABLES, FLOWERS, RICE, FRUIT, VINES, HOPS OR SEAWEED; FORESTRY; WATERING
- A01G18/00—Cultivation of mushrooms
- A01G18/20—Culture media, e.g. compost
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Abstract
The present disclosure provides a Ganoderma strain, named Ganoderma shanxiense, which is deposited at China General Microbiological Culture Collection Center (CGMCC) on August ll, 202l under accession number 23077. A fruiting body cultivation method is further provided: adding glucose to a carbon base medium to achieve a glucose concentration of 30 g/L, adjusting the medium to pH 4.0, adding a yeast powder to a nitrogen base medium to achieve a yeast powder concentration of 2 g/L, and adjusting the medium to pH 4.0 to obtain suitable carbon and nitrogen base media for mycelial growth of Ganoderma shanxiense; and inoculating the Ganoderma strain into media for mycelial growth of Ganoderma shanxiense, and cultivating the Ganoderma strain in the dark at 30°C for inducement to primordium to obtain the fruiting body of Ganoderma shanxiense. The Ganoderma shanxiense provided by the present disclosure has a strong natural selenium enrichment capability.
Description
GANODERMA STRAIN AND CULTIVATION METHOD OF FRUITING BODY OF
GANODERMA SHANXIENSE THEREOF
The present disclosure relates to the technical field of
Ganoderma strains, in particular to a Ganoderma strain and a cultivation method of a fruiting body of Ganoderma shanxiense thereof.
Ganoderma {(lingzhi) is one of the most famous medicinal fungi in China and has a long history of medicinal use in China. Modern scientific research has confirmed that Ganoderma has a wide range of pharmacological activities, including immunity-boosting, anti- tumor, antidiabetic, anti-HIV-1, hypoglycemic, and hepatoprotective activities.
Most of the existing Ganoderma varieties belong to medium and high temperature varieties, and their cultivation methods mainly include cultivation on sterilized substance and cut-log cultivation. During the cultivation process, Ganoderma spawns easily degenerate generation by generation. The phenomena include reduced content of Ganoderma lucidum polysaccharides, organic selenium and other active pharmaceutical ingredients generation by generation, and increasingly insignificant health care and medicinal effects, resulting in relative lagging in the efficient development of medicinal products.
There are few Ganoderma species with natural selenium enrichment capability, and it is particularly important to vigorously develop Ganoderma varieties with natural selenium enrichment capability. The Chinese Nutrition Society lists selenium as one of the 15 essential nutrients for the human body.
A large number of clinical experiments inside and outside of China have shown that human selenium deficiency can cause the dysfunction of some important organs, leading to the occurrence of a plurality of serious diseases. More than 40 countries around the world are in selenium-deficient areas, and hundreds of millions of people in 22 provinces in China are in selenium-deficient or low- selenium areas. The incidence of tumors, liver disease, and cardiovascular disease is very high in these areas. Studies have shown that people with low selenium or selenium deficiency who receive moderate selenium supplement can not only prevent the occurrence of tumors and liver diseases, but also boost the immunity of the body, maintain the normal functions of the heart, liver, lungs, stomach, and other important organs, and prevent the occurrence of senile cardiovascular and cerebrovascular diseases.
The technical problem to be solved by the present disclosure is to provide a Ganoderma strain and a cultivation method of a fruiting body of Ganoderma shanxiense thereof in view of the deficiencies in the above-mentioned prior art. The G. shanxiense has a strong natural selenium enrichment capability.
To solve the above-mentioned technical problem, the technical solution adopted in the present disclosure is: a Ganoderma strain, where the Ganoderma strain is named G. shanxiense and is deposited at China General Microbiological Culture Collection Center (CGMCC) on August 11, 2021 under accession number 23077.
Preferably, the Ganoderma strain may have an ITS nucleotide sequence shown in SEQ ID NO: 1.
The present disclosure further provides a cultivation method of a fruiting body of G. shanxiense using the foregoing Ganoderma strain, where the method is achieved by the following steps: adding glucose to a carbon base medium to achieve a glucose concentration of 30 g/L, and adjusting the medium to pH 4.0 to obtain a medium for growth of G. shanxiense; alternatively, adding a yeast powder to a nitrogen base medium to achieve a yeast powder concentration of 2 g/L, and adjusting the medium to pH 4.0 to obtain a medium for growth of G. shanxiense; and inoculating the Ganoderma strain into the media for growth of
G. shanxiense, and cultivating the Ganoderma strain in the dark at 30°C for inducement to primordium to obtain the fruiting body of
G. shanxiense.
Preferably, the fruiting body of &. shanxiense may have an average selenium content of 2.75-2.83 mg/kg.
Preferably, the carbon base medium may be composed of raw materials with the following mass concentrations: 3.0 g/L peptone, 1.0 g/L KH:PO,, 0.45 g/L MgSO,, and 12.0 g/L agar; the nitrogen base medium may be composed of raw materials with the following mass concentrations: 20.0 g/L glucose, 2.0 g/L KH,PO,, 0.45 g/L
MgSO4, and 15.0 g/L agar.
Preferably, the inducement to primordium may last for 1.5-3.0 days.
Compared with the prior art, the present disclosure has the following advantages:
The G. shanxiense provided by the present disclosure has a strong natural selenium enrichment capability, and the average selenium content in the fruiting body thereof is 2.75-2.83 mg/kg.
The present disclosure will be further described in detail below with reference to the accompanying drawings and examples.
FIG. 1 illustrates a colonial morphology of G. shanxiense in
Example 1 of the present disclosure.
FIG. 2 illustrates a phylogenetic tree of G. shanxiense in
Example 1 of the present disclosure.
FIG. 3 illustrates effects of different temperatures on mycelial growth rate of G. shanxiense in Example 5 of the present disclosure.
FIG. 4 illustrates effects of different pH values on mycelial growth rate of G. shanxiense in Example 5 of the present disclosure.
FIG. 5 illustrates fruiting bodies of G. shanxiense in
Example 5 of the present disclosure.
Example 1
A Ganoderma strain was provided. The Ganoderma strain was named Ganoderma shanxiense and was deposited at CGMCC on August
11, 2021 under accession number 23077.
On September 12, 2018, wild Ganoderma strains were collected in Sijiao Town, Xia County, Shanxi Province, and pure spawns (F1 progeny) were obtained by tissue isolation at the Institute of
Edible Fungi, Shanxi Academy of Agricultural Sciences. The strain was a new species after morphological and ITS analyses, named
Ganoderma shanxiense L. Fan & H. Liu sp. nov.
From September to October 2018, the wild strain was purified and rejuvenated at the Institute of Edible Fungi, Shanxi Academy of Agricultural Sciences, and the specificity of the strain was preliminarily confirmed by mycelial antagonism.
From November to December, 2018, a biological incubator was used for fruiting and domestication in the laboratory of the
Institute of Edible Fungi, Shanxi Academy of Agricultural
Sciences, and it was successful; in January 2019, A new strain (F2 progeny) was cultivated by the tissue isolation method using the newly germinated fruiting body as a material in the Institute of
Edible Fungi, Shanxi Academy of Agricultural Sciences; it was confirmed as a new cultivable strain by ITS sequencing and alignment in January 2019.
From May to October 2019, demonstration and stable cultivation was carried out in three different ecological regions, including Pingding Lvyang Agricultural Development Co., Ltd.,
Qinshui Baiyun Mushroom Planting Professional Cooperative, and
Lvdingyuan Afforestation Professional Cooperative In Jiaocheng
County, Yangguan City, Shanxi Province. Fruiting bodies having a pileus with an obvious lacquer-like luster and a reddish-brown context were obtained, and a new strain (F3) was separated and formed; subsequently, a new Ganoderma strain was formed after testing for purity and vitality, which was named G. shanxiense;
The ITS nucleotide sequence of the Ganoderma strain is shown in
SEQ ID NO: 1.
The mycelium of G. shanxiense in this example was white and filamentous, and the colonies had concentric striae, and the mycoderm was not easily formed (LH676 in FIG. 1). It was significantly different from the control Ganoderma strain (Ganoderma lucidum) (GLO003 in FIG. 1). The phylogenetic tree of G.
shanxiense in this example is shown in FIG. 2. The sequences of G. shanxiense are clustered on a single branch and have high support.
Example 2
The example provided a cultivation method of a fruiting body 5 of G. shanxiense using the Ganoderma strain in Example 1, where the method was achieved by the following steps: a carbon base medium was supplemented with glucose to achieve a glucose concentration of 30 g/L, and the medium was adjusted to pH 4.0 to obtain a suitable carbon base medium for mycelial growth of G. shanxiense; the Ganoderma strain was inoculated into the medium for growth of G. shanxiense, and cultivated in the dark at 30°C for inducement to primordium for 1.5 days to obtain the fruiting body of G. shanxiense; the carbon base medium was composed of raw materials with the following mass concentrations: 3.0 g/L peptone, 1.0 g/L KH;PO0,, 0.45 g/L MgSO4, and 12.0 g/L agar.
Example 3
The example provided a cultivation method of a fruiting body of G. shanxiense using the Ganoderma strain in Example 1, where the method was achieved by the following steps: a nitrogen base medium was supplemented with a yeast powder to achieve a yeast powder concentration of 2 g/L, and the medium was adjusted to pH 4.0 to obtain a suitable nitrogen base medium for mycelial growth of G. shanxiense; the Ganoderma strain was inoculated into the medium for growth of G. shanxiense, and cultivated in the dark at 30°C for inducement to primordium for 3.0 days to obtain the fruiting body of G. shanxiense; the nitrogen base medium was composed of raw materials with the following mass concentrations: 20.0 g/L glucose, 2.0 g/L
KH,PO;, 0.45 g/L MgS0,, and 15.0 g/L agar.
Example 4
The fruiting bodies of G. shanxiense cultured in Examples 2 and 3 and the fruiting bodies of the control G. lucidum strain were dried, pulverized and sieved (through a 60-mesh sieve). Three fruiting bodies were determined from each group of fruiting bodies of Ganoderma. The trace elements were determined by atomic absorption spectrophotometry. The zinc content was determined with reference to GB5009.14-2017, the iron content was determined with reference to GB5009.90-2016, the calcium content was determined with reference to GB5009.92-2016, the magnesium content was determined with reference to GB5009.241-2017, the germanium content was determined with reference to GB 5009.151-2003, the chromium content was determined with reference to GB 5009.123- 2014, and the selenium content was determined with reference to GB 5009.93-2017. The results are shown in Table 1. The G. shanxiense provided by the present disclosure had a strong natural selenium enrichment capability, and the natural selenium enrichment was 13- 18 times that of the control G. lucidum:
Table 1 The content of trace element (mg/kg) in the fruiting bodies of G. shanxiense provided by the present disclosure and control G. Lucidum
NOTE: The difference is not significant when the letters are the same (P < 0.05).
Example 5
The present example is the conditional screening of the fruiting bodies of G. shanxiense cultivated by the Ganoderma strain in Example 1: (I) Screening of culture medium: The suitable carbon source for G. shanxiense was 30 g/L glucose, and the suitable nitrogen source was 2.0 g/L yeast powder. 1. The carbon base medium was supplemented with four different carbon sources, glucose (P), sucrose (2), lactose (R) and mannitol (G), respectively, and the concentration gradient of each carbon source was divided into 10 g/L. 20 g/L and 30 g/L, namely, 12 test carbon source formulations were formed. Using a completely sterilized perforator (@ = 6 mm), inoculum plugs grown consistently were cut out from the Petri dish with G. shanxiense spawn and placed in the center of the Petri dish with test carbon base medium, and cultivated in the dark at 25°C for 6 days. The colony diameter was measured with a vernier caliper according to the cross method, the mycelial growth rate was calculated, and the mycelium growth vigor was observed. Five replicates were set for each treatment; the carbon base medium was composed of raw materials with the following mass concentrations: 3.0 g/L peptone, 1.0 g/L KH;PO,;, 0.45 g/L MgSO;, and 12.0 g/L agar. It can be seen from Table 1 that the mycelial growth rate of G. shanxiense is maximal in the presence of 30 g/L glucose.
Table 1 Effects of different carbon sources on the mycelial growth of G. Shanxiense
Different carbon sources 4
Color of mycelium | Mycelium growth vigor | Growth rate/mm-day and addition amount 10 g/L Glucose Milky white 2.99 + 0.03e 20 g/L Glucose Milky white 3.55 + 0.12b 30 g/L Glucose Milky white 3.87 £0.05a 10 g/L Sucrose Milky white 2.71 + 0.07f 20 g/L Sucrose Milky white 2.94 +0.07e 30 g/L Sucrose Milky white 3.51 £ 0.01b 10 g/L Mannitol 2+ 2.80 + 0.07f 20 g/L Mannitol 2 3.300.02¢
NOTE: +, 2+, and 3+ indicate that the mycelium growth vigor gradually increases. The difference is not significant when the letters are the same (FP < 0.05). 2. The nitrogen base medium was supplemented with four nitrogen sources, urea (addition amounts of 1.0 g/L, 2.0 g/L and
3.0 g/L), (NH4).S0; (addition amounts of 1.0 g/L, 2.0 g/L and 3.0 g/L), peptone (addition amounts of 1.0 g/L, 3.0 g/L and 5.0 g/L) and yeast extract powder (addition amounts of 2.0 g/L, 4.0 g/L and 6.0 g/L), respectively, and 12 test formulations were formed. The test spawns of G. shanxiense with the same size were inoculated into the center of the above-mentioned test medium and cultivated in the dark at 25°C for 5 days; the mycelium growth vigor was observed, and the mycelial growth rate was determined. Others were the same as those in the carbon source test; the nitrogen base medium was composed of raw materials with the following mass concentrations: 20.0 g/L glucose, 2.0 g/L KH;PO;, 0.45 g/L MgSO, and 15.0 g/L agar. It can be seen from Table 2 that the mycelial growth rate of G. shanxiense is maximal in the presence of 2.0 g/L yeast powder.
Table 2 Effects of different nitrogen sources on the mycelial growth of G. Shanxiense
Different nitrogen sources and Mycelium nr
Color of mycelium Growth rate addition amount growth vigor
Urea 2.0 g/L
Crs
Peptone 3.0 g/L
NOTE: +, 2+, and 3+ indicate that the mycelium growth vigor increases gradually, and - indicates no statistical data. The difference is not significant when the letters are the same (P < 0.05). (IT) Suitable conditions for the mycelial growth of G.
shanxiense: The suitable cultivation temperature of G. shanxiense mycelia was 30°C, and they could grow at pH 3.0-8.0; the optimum pH value was 4.0. 1. Temperature characteristic test: The test spawns were inoculated on PDA, and cultivated in the dark at 10°C, 15°C, 20°C, 25°C, 30°C, and 35°C, respectively. Other operations were the same as those in the carbon source test. As shown in FIG. 3, the mycelial growth rate of G. shanxiense grown in the dark at 30°C was the fastest, which reached 4.69 mm day’. 2. Substrate pH test: With PDA as a basic formulation, seven test formulations with pH values of 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 were individually prepared with 1.0 M NaOH solution and 1.0 M HCl solution in a clean bench before pouring the plate. The test spawns were inoculated on the test formulations and cultivated in the dark at 25°C for 5 days; the mycelium growth vigor was observed and the growth rate was measured; other requirements were the same as those in the carbon source test. As shown in FIG. 4, at pH 4.0, the mycelial growth rate was the fastest, which reached 4.96 mm ‘day. (ITI) When G. shanxiense was induced to primordium at different temperatures, the inducement to primordium at 26°C lead to the fact that the pilei of G. shanxiense were not differentiated and easily formed a staghorn shape; at 30°C, both pilei and stipes could differentiate normally.
As shown in FIG. 5, the surface of the pileus and the flesh of G. shanxiense are reddish brown, the pileus is smooth, with an obvious lacquer luster (LH676 in FIG. 5). Compared with the control G. lucidum (GL003 in FIG. 5), there is a significant difference.
The above descriptions are merely preferred examples of the present disclosure, and are not intended to limit the present disclosure in any way. Any simple modifications, changes and equivalent variations made to the above examples according to the technical essence of the present disclosure should fall within the protection scope of the technical solutions of the present disclosure.
Sequence Listing Information:
DTD Version: V1 3
File Name: HKJP20220800691.xml
Software Name: WIPO Sequence
Software Version: 2.1.2
Production Date: 2022-09-05
General Information:
Current application / Applicant file reference: HKJP20220800691
Earliest priority application / IP Office: CN
Earliest priority application / Application number: 202111111300 .3
Earliest priority application / Filing date: 2021-09-23
Applicant name: Shanxi Institute for Functional Food, Shanxi
Agricultural University
Applicant name / Language: en
Invention title: GANODERMA STRAIN AND CULTIVATION METHOD OF FRUITING
BODY OF GANODERMA SHANXIENSE THEREOF ({ en })
Sequence Total Quantity: 1
Sequences:
Sequence Number (ID): 1
Length: 643
Molecule Type: DNA
Features Location/Qualifiers: - source, 1..643 > mol type, other DNA > note, ITS nucleotide sequence of the Ganoderma strain > organism, synthetic construct
Residues: gcatacaggt tttegtaggt gacctgcgga ggtcattatc gagttttgac tgggttgtag 60 ctggccttece gaggcatgtg cacgccctgc tcatccactc tacacctgtg cacttactgt 120 gggtttcagg tcgcgaagcg ggctctgtac gggcttgtga agcgcatctg tgcctgcgtt 180 tatcacaaac tccataaagt attagaatgt gtattgcgat gtaacgcatc tttatacaac 240 tttcagcaac ggatctcttg gctctcgcat cgatgaagaa cgcagcgaaa tgcgataagt 300 aatgtgaatt gcagaattca gtgaatcatc gaatctttga acgcaccttg cgctccttgg 360 tattccgagg agcatgcctg tttgagtgtc atgaaatctt caacctacaa gctttgtagg 420 cttggacttg gaggcttgtt ggccgttatt ggtcagctcc tcttaaacaa attagcttga 480 ttecttgtgg atcggctctc ggtgtgataa tgtctacgcc gcgaccgtga agcgtttggc 540 gagcttctaa ccgtcccatt cggagacaac tttatgacct ctgacctcaa atcaggtagg 600 actacccgct gaacttaagc atatcaatag gccggaggaa aga 643
END.
This XML file does not appear to have any style information associated with it. The document tree is shown below.
STiBSaguencelisting didversion=s"V1 3" {iloname="HKIPZO226808591 xml" softwareNames"WIFO Sequence” softwaravarsion="2.1.2" produectionate="2822-¢9- es" > <ApplicantFilezReference>HKIP20220800691«/AnplicantFilaReizrances vEarliestPriorityapplicationïdentificatiens <IPDFTicelodesCN:/IPOFficeiade;x <ApplicationMumberText>202111111360 .3:/AsniicationNumberYext> <FilingDate>2021-09-23</Filingdate> </EarliestPriorityvaAppliicationIdentification: <Applicantdame languagelode="en">Shanxi Institute for Functional Food,Shanxi Agricultural University</Appiicantismes <Inventiontitle languagelode="en™> GANODERMA STRAIN AND CULTIVATION METHOD OF FRUITING BODY OF GANODERMA SHANXIENSE THEREOF</Inventiontitlier <SeguencetotalQuantivysle/SequenceTotal Quantity <Sequancadata sagquencaliiumibar="1"> <INSDSeq> <INSDSeg iength:643</INSDSag lengtn \INSDSeg moltype DNAS INSDSeq moltype> <INSDSeg divisionsPAT</INSDSeq divisions <INSDSea foaturs-table>
CINSDFasturae> <INSDFzature koy>sourced/INSDreature keys <INEDFeature lovation>sl.. 643 /IN5"Festure locatien> <INEDFeature guslss <INSDQualifiers <INSDQuslifienr namexmol type: /INSOQuaslifier names <INSDgualifier vaiuesother DNA</INSDQualifier values </INSDQualijier> “INSDQualifier idvvg?ós
LINSDQvalifier nasmednoted/INSDQualivier names <iNSDQualifier valus>ITS nucleotide sequence of the Ganoderma strain</INSDQuslifier values <SINSDQualifier> <INSDgualifier id="gil™>
LINSDQuUalifisr namevorganism</INSDQualifisr names \INSDQvalifier valusssynthetic constructe/INshualiifier values </INSDQualifiers /INSDFesture gusis> </INSDFzature> </INSDSeg Teature table: \INSDSeg sequencesgcatacaggttttcgtaggtgacctgcggaggtcattatcgagttttgactgggttgtagctggcettcegaggcatgtgcacgccctgctcatccactctacacctgtgcacttactgtgggt <EINSDSeg> “/Seguencelats> <iST26Seguencelisting>
Claims (6)
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111111300.3A CN113767812B (en) | 2021-09-23 | 2021-09-23 | Ganoderma lucidum strain and method for culturing red-meat ganoderma lucidum fruiting body |
Publications (2)
Publication Number | Publication Date |
---|---|
NL2033084A true NL2033084A (en) | 2023-03-29 |
NL2033084B1 NL2033084B1 (en) | 2023-06-30 |
Family
ID=78852682
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NL2033084A NL2033084B1 (en) | 2021-09-23 | 2022-09-20 | Ganoderma strain and cultivation method of fruiting body of ganoderma shanxiense thereof |
Country Status (3)
Country | Link |
---|---|
CN (1) | CN113767812B (en) |
NL (1) | NL2033084B1 (en) |
ZA (1) | ZA202209318B (en) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114214208B (en) * | 2021-12-14 | 2023-06-09 | 江南大学 | High selenium-resistant ganoderma lucidum mutant strain and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107213173A (en) * | 2017-04-26 | 2017-09-29 | 独山县军鹏农产品有限责任公司 | A kind of processing method of the high ganoderma lucidum of polyoses content |
Family Cites Families (12)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2001005938A1 (en) * | 1999-07-15 | 2001-01-25 | Quancai Li | A method for producing mycelia of ganoderma lucidum containing selenium and other trace elements |
CN102475033A (en) * | 2010-11-24 | 2012-05-30 | 金勇� | Method for producing ganoderma lucidum mycelia rich in selenium |
CN104488565B (en) * | 2015-01-12 | 2017-06-06 | 西藏自治区农牧科学院蔬菜研究所 | A kind of Tibet plain boiled pork ganoderma lucidum cultivation method |
CN106305135A (en) * | 2016-08-17 | 2017-01-11 | 吴庆旺 | Coriolus and lucid ganoderma edible mushroom and preparation method thereof |
CN106631344A (en) * | 2016-09-30 | 2017-05-10 | 桂林淮安天然保健品开发有限公司 | Lucid ganoderma bag cultivation culture medium capable of increasing content of ganoderan and selenium |
CN107047060A (en) * | 2017-03-31 | 2017-08-18 | 四川省农业科学院土壤肥料研究所 | Justify No. 1 ganoderma lucidum new strains of sesame and its propagation method in river |
CN107466672A (en) * | 2017-06-22 | 2017-12-15 | 兰溪市奥而特农业科技有限公司 | A kind of cultural method of ganoderma lucidum |
CN107853077A (en) * | 2017-12-05 | 2018-03-30 | 罗成喜 | A kind of solid Se-rich lucid ganoderma culture medium and its method for producing ganoderma lucidum |
CN108901598A (en) * | 2018-08-02 | 2018-11-30 | 通道通宝灵芝专业合作社 | A kind of cultural method of Se-rich lucid ganoderma |
KR20200061556A (en) * | 2018-11-26 | 2020-06-03 | 정성동 | A Method for Cultivating a White Shiitake Mushroom Containing a Selenium |
CN110741873B (en) * | 2019-08-21 | 2022-01-04 | 山东省农业科学院农业资源与环境研究所 | Method for domesticating and cultivating tropical palm lucid ganoderma and controlling growth of tropical palm lucid ganoderma |
CN112690170A (en) * | 2020-12-24 | 2021-04-23 | 山西农业大学 | Culture medium for cultivating black fungus and preparation method thereof |
-
2021
- 2021-09-23 CN CN202111111300.3A patent/CN113767812B/en active Active
-
2022
- 2022-08-19 ZA ZA2022/09318A patent/ZA202209318B/en unknown
- 2022-09-20 NL NL2033084A patent/NL2033084B1/en active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN107213173A (en) * | 2017-04-26 | 2017-09-29 | 独山县军鹏农产品有限责任公司 | A kind of processing method of the high ganoderma lucidum of polyoses content |
Non-Patent Citations (5)
Title |
---|
DATABASE EMBL [online] 27 August 2019 (2019-08-27), "Ganoderma sp. LF-2019 voucher HSA 539 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence.", retrieved from EBI accession no. EM_STD:MK764269 Database accession no. MK764269 * |
FRYSSOULI VASSILIKI ET AL: "A global meta-analysis of ITS rDNA sequences from material belonging to the genus Ganoderma (Basidiomycota, Polyporales) including new data from selected taxa", MYCOKEYS, vol. 75, 1 December 2020 (2020-12-01), pages 71 - 143, XP093032350, ISSN: 1314-4057, Retrieved from the Internet <URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7723883/pdf/mycokeys-75-071.pdf> DOI: 10.3897/mycokeys.75.59872 * |
LIU HONG ET AL: "Ganoderma shanxiense, a new species from northern China based on morphological and molecular evidence", PHYTOTAXA, vol. 406, no. 2, 14 June 2019 (2019-06-14), pages 129 - 136, XP093032356 * |
XU MENGMENG ET AL: "Influence of Selenium Biofortification on the Growth and Bioactive Metabolites of Ganoderma lucidum", FOODS, vol. 10, no. 8, 12 August 2021 (2021-08-12), pages 1860, XP093032453, DOI: 10.3390/foods10081860 * |
ZÁRATE-CHAVES CARLOS ANDRÉS ET AL: "Optimizing a culture medium for biomass and phenolic compounds production using Ganoderma lucidum", BRAZILIAN JOURNAL OF MICROBIOLOGY, vol. 44, no. 1, 1 January 2013 (2013-01-01), BR, pages 215 - 223, XP093032456, ISSN: 1517-8382, Retrieved from the Internet <URL:https://www.scielo.br/j/bjm/a/JfHqnWqRZvZdsTKtvVKGLMC/?format=pdf&lang=en> DOI: 10.1590/S1517-83822013005000032 * |
Also Published As
Publication number | Publication date |
---|---|
ZA202209318B (en) | 2022-11-30 |
NL2033084B1 (en) | 2023-06-30 |
CN113767812B (en) | 2023-04-25 |
CN113767812A (en) | 2021-12-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US11078456B2 (en) | Fusarium solani and use of same in prevention and treatment of southern blight of Dendrobium officinale Kimura et Migo | |
CN107460133B (en) | Dark color has every endogenetic fungus HS40 and its application in dendrobium candidum production | |
NL2033084B1 (en) | Ganoderma strain and cultivation method of fruiting body of ganoderma shanxiense thereof | |
Park et al. | In vitro propagation of myco-heterotrophic Gastrodia elata | |
CN109943488B (en) | Ganoderma lucidum polysaccharide high-yield strain RWHBW-1 and application thereof | |
CN102703333B (en) | Mycorrhizal fungi strain efficiently growing with rhododendron seedling | |
KR101056952B1 (en) | Mass production method of black scale mushroom using lumber cultivation | |
CN115537346A (en) | Mucillus mucilaginosus for promoting growth and differentiation of sansevieria trifasciata and application thereof | |
CN107475133B (en) | A kind of pale purple purple spore bacterium and its application in promotion bletilla striata growth | |
KR101905674B1 (en) | Novel Mycena purpureofusca NIFOS101 strain having excellent germination property of Gastrodia elata seeds and its use | |
Wang et al. | First report of Botryosphaeria dothidea causing leaf spot and wilt on Celtis sinensis in China | |
CN110713956B (en) | Lysine bacillus S12 and application thereof | |
CN108719336B (en) | Method for promoting growth of orchids by using basidiomycetes fungi | |
CN101914457B (en) | Fungus for promoting germination of bletilla striata seeds | |
CN114317281B (en) | High-yield ganoderma lucidum strain and molecular marking method and artificial cultivation method thereof | |
CN108094047B (en) | Strain suitable for infecting parent strain with hepialus armoricanus larvae and cordyceps militaris cultivation method | |
Ho et al. | Isolation, growth and sporophore development of Ganoderma boninense from oil palm in Malaysia | |
CN114317280B (en) | Boletus sinesis strain and method for inducing fruiting body | |
CN101953261B (en) | Application of jewel orchid endophytic fungi to jewel orchid seedlings | |
CN114085781B (en) | Ganoderma GZ and application thereof | |
CN107099465B (en) | Growth-promoting bacterial strain and its microorganism seedling medium for promoting cuttage tea shoot to take root | |
CN110305795B (en) | Hirsutella sinensis and application thereof | |
Chen et al. | First report of soft rot caused by Pectobacterium versatile on Hydrangea macrophylla in China | |
CN114717139B (en) | Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof | |
CN110172411A (en) | A kind of scab shape Xylaria strain ZJ1811 and its cultural method and application |