CN114717139B

CN114717139B - Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof

Info

Publication number: CN114717139B
Application number: CN202210025532.5A
Authority: CN
Inventors: 吴益花; 高江云; 陈德赟; 李能奇
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2022-01-11
Filing date: 2022-01-11
Publication date: 2023-08-04
Anticipated expiration: 2042-01-11
Also published as: CN114717139A

Abstract

The invention provides a tumor mycorrhizal fungi (Epulothia sp.) strain TP-13 with the capacity of promoting the growth of new roots of dendrobium and application thereof, belonging to the technical field of microorganisms. Oncomelania mycorrhizal strain TP-13 with capacity of promoting growth of new dendrobium nobile roots, and the preservation number is CCTCC NO: m20211285. The strain TP-13 is obtained by separating and screening from the roots of the dendrobium candidum seedlings induced in the field, can obviously promote the growth of new roots of the dendrobium candidum seedlings, can promote the growth of leaves and tillers of the seedlings, and can improve the seedling and dry weight. The strain TP-13 is utilized to mycorrhize dendrobium seedlings, high-quality symbiotic seedlings with strong adaptability and high survival rate can be obtained, a new thought is provided for efficient cultivation of dendrobium populations and medicinal dendrobium, and the dendrobium nobile cultivation method has a large application value.

Description

Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a tumor mycorrhizal fungus strain TP-13 with a capacity of promoting growth of new roots of dendrobium nobile and application thereof.

Background

The genus Dendrobium (Dendrobium Sw.) is an epiphyte, dendrobium nobile, also known as Wanhua. Pseudobulb clusters, extending to form multiple sections; the upper node of the stem of the overall inflorescence is provided with a plurality of flowers or only 1 flower; the flowers are big and gorgeous, the inflorescence sheets are developed, the wide base parts of the side sepals are planted on the coleus bases, and the wide base parts and the base parts of the labial lobes form sepal sacs together; the labial flap 3 is broken. The plant belongs to the species group with small stems and flowers in the country, such as dendrobium candidum, dendrobium hooked, dendrobium huoshanense and the like, which are the original plants of traditional Chinese medicine dendrobium; the large-sized flowers with thick stems can be used as flowers for ornamental purposes. Wherein, the dendrobium candidum (Dendrobium officinale) is praised by the Tibet as the first of the Chinese Mesona herb, and has various pharmacological actions. However, the dendrobium plants have low reproduction rate under natural conditions, long growth period and serious ecological environment damage, so that wild resources are extremely deficient, and a method for artificially cultivating dendrobium is urgently needed.

Dendrobium officinale seedlings can be obtained through two modes of non-symbiotic germination culture and symbiotic germination culture, and the seedlings obtained through the method have higher seedling rate though the non-symbiotic germination culture, but are transplanted to natural environment, and due to the lack of fungus partners establishing symbiotic relation with the seedlings, the seedlings are weak in adaptability, poor in pathogenic microorganism resistance, slow in growth and low in survival rate, and subsequent growth is seriously hindered. The symbiotic germination culture technology refers to that plant seeds and symbiotic fungi which are infected and promote seed germination are simultaneously sown in a specific matrix (culture medium), and the method can improve the germination rate and seedling formation rate of the seeds. However, as the orchid plant and fungus partners form complex and various plants, the seedlings are short after being built, the capability of resisting external resistance is weak, and the growth is often hindered and stopped or directly killed, so that the later growth of the seedlings needs to form symbiosis with more proper fungi, and the seedlings are stimulated to continue to grow. Therefore, determining effective fungi which can form symbiotic relation with dendrobium candidum seedlings and promote the growth of the dendrobium candidum seedlings is a key link for cultivating and protecting the dendrobium candidum. The acquisition of mycorrhizal seedlings is the basis for developing dendrobium candidum protection, regression and population reconstruction practices and developing dendrobium candidum recovery friendly cultivation. The fungus types of the dendrobium candidum needed in each growth stage are different, and the physiological indexes of the dendrobium candidum protocorm and the tissue culture seedlings are detected, so that the endophytic fungus mainly regulates the growth and development of the dendrobium candidum by generating endogenous hormone. However, the prior art reports fungus strains separated from dendrobium candidum seedlings, some strains can kill dendrobium candidum seeds and protocorms, and some strains can promote dendrobium candidum growth, and the main aspects are that the seedling growth, chlorophyll content, nutrient element absorption and the like are improved. The growth of the new root is an important influencing factor for influencing the transplanting survival rate of the seedling, so that the provision of the endophytic strain of the new root of the dendrobium seedling can greatly help the artificial cultivation of the dendrobium seedling.

Disclosure of Invention

Therefore, the invention aims to provide the Oncomelania mycorrhizal fungi strain TP-13 which has the capability of promoting the growth of new roots of dendrobium candidum, thereby realizing the efficient cultivation of dendrobium candidum.

The invention provides a tumor mycorrhizal fungi (Epulothia sp.) strain TP-13 with the capacity of promoting the growth of new roots of dendrobium, and the preservation number is CCTCC NO: m20211285.

Preferably, the ITS sequence of the Rhizopus arvensis strain TP-13 is shown as SEQ ID NO. 1.

The invention provides a product for dendrobium cultivation, which comprises the tumor mycorrhizal fungi strain TP-13 and acceptable auxiliary materials.

Preferably, the product comprises a microbial agent and a bacterial fertilizer for dendrobium cultivation.

The invention provides an application of the tumor mycorrhizal fungi strain TP-13 or the product in dendrobium cultivation.

Preferably, the dendrobium growth comprises dendrobium new root growth, promotion of growth of seedling leaves and tillers, and improvement of seedling dry weight.

Preferably, the dendrobium comprises dendrobium candidum.

The invention provides a method for improving growth of new root of dendrobium, which comprises the following steps:

symbiotic cultivation is carried out on dendrobium seedlings and the tumor mycorrhizal fungi strain TP-13.

Preferably, the symbiotic culture medium is oat culture medium.

Preferably, the temperature of the symbiotic culture is 23-27 ℃, the light-dark period L/D=12/12 of the symbiotic culture, and the illumination intensity is 2000-3000 Lx.

The invention provides a tumor mycorrhizal fungus strain TP-13 with the capacity of promoting the growth of new roots of dendrobium, and the preservation number is CCTCC NO: m20211285. The strain TP-13 is obtained by separating and screening seedling mycorrhiza forming symbiotic relation obtained by induction of dendrobium candidum seedlings in situ. The strain TP-13 and the dendrobium plants are subjected to symbiotic culture, and compared with other strains separated in the same batch, the strain TP-13 is used for mycorrhizal treatment of the dendrobium plants, so that the growth of new roots of dendrobium candidum seedlings is remarkably promoted, an effective way is provided for obtaining high-quality dendrobium candidum seedlings with strong adaptability and high survival rate, and the reconstruction of dendrobium candidum populations and the efficient cultivation of medicinal dendrobium candidum are hopeful to be realized. Meanwhile, the strain TP-13 can promote growth of leaves and tillers of seedlings to different degrees, and improve dry weight of seedlings, so that growth of dendrobium seedlings is promoted.

The method for improving the growth of the new root of the dendrobium nobile is simple, easy to operate, low in cost and suitable for popularization and application, and has great popularization value in the aspects of regression protection of rare endangered orchid plants, population reconstruction practice, ecological cultivation of medicinal orchid plants, solving of the bottleneck problem of high-quality seedling sources in the dendrobium nobile cultivation industry and the like.

Drawings

FIG. 1 is a morphology diagram of the new root growth capacity of the strain TP-13 and dendrobium candidum seedlings after symbiotic culture.

Biological material preservation information

Oncorhiza fungi (Epulothia sp.) were deposited at China Center for Type Culture Collection (CCTCC) at 10 and 15 days 2021 at the deposit address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: CCTCC NO: M20211285, strain number is TP-13.

Detailed Description

The invention provides a tumor mycorrhizal fungi strain TP-13 with the capacity of promoting the growth of new roots of dendrobium, and the preservation number is CCTCC NO: m20211285.

In the invention, the strain TP-13 is obtained by separating and screening seedling mycorrhiza which is obtained by induction of dendrobium candidum seedlings in a transitional manner and forms a symbiotic relationship. The morphological characteristics of the strain TP-13 are as follows: culturing on PDA plate for 10 days, and the colony is white blanket, has developed aerial hyphae, regularly and circularly divergent growth, and has rough and dry surface. The hyphae of the strain TP-13 are characterized as follows: culturing in dark for 10 days in an incubator at 25+/-2 ℃ and observing under an optical microscope, wherein the mycelium is thick and 3.51-4.65 mu m, branches are nearly right angles, new mycelium is planted in old mycelium, the new mycelium has more obvious diaphragms, the number of the diaphragms is more, the cell walls of the old mycelium have thickening phenomenon, and the compartment is longer. Molecular identification is carried out by adopting ITS gene fragments, the ITS sequence of the Rhizobium strain TP-13 is preferably shown as SEQ ID NO. 1, and the strain TP-13 is most similar to fungus Epulothia sp (accession number: KC 154064.1) and the maximum similarity is 97.28%. Comprehensive morphological, physiological and biochemical and molecular identification results show that strain TP-13 belongs to the genus Rhizopus (Epulothia sp.).

In the present invention, the method for the expanded culture of the Rhizopus arvensis strain TP-13 is preferably as follows:

the Rhizobium strain TP-13 is inoculated on a PDA culture medium and is cultivated in the dark until hyphae grow on a culture dish.

The inoculum size of the Rhizobium strain TP-13 is not particularly limited in the present invention, and can be any inoculum size known in the art. The temperature of the dark culture is preferably 23 to 27℃and more preferably 25 ℃. The invention has no special limit to the time of the dark culture, and the culture is carried out until the hypha grows to be full of the culture medium. The dark culture is preferably carried out in a climatic chamber.

In the invention, an experiment of promoting the growth of new roots of dendrobium candidum seedlings by the strain TP-13 is carried out, other mycorrhizal bacterial strains and non-mycorrhizal bacterial strains which are separated in the same batch are taken as control strains, symbiotic culture is carried out for 30d and 90d, and the result shows that each bacterial strain has different degrees of improvement on the new roots of the seedlings in the symbiotic culture for 30d and has obvious difference compared with a blank control (PDA group), however, in the symbiotic culture for 90d, the strain TP-13 has obvious advantages in the aspect of the new roots of the seedlings compared with the blank control (PDA group) and has the effect of obviously promoting the new roots of the seedlings compared with other bacterial strains. Therefore, the TP-13 strain has the most obvious effect of promoting the growth of new roots of dendrobium candidum seedlings.

In the invention, the product preferably comprises a microbial agent and a bacterial fertilizer for dendrobium cultivation. The invention relates to the microbial agentThe preparation method of (2) is not particularly limited, and can be any method known in the art for preparing a fungus agent. In the preparation method of the microbial agent, hypha of the strain TP-13 obtained by the amplification culture is preferably inoculated on a culture medium, and after the hypha grows in the culture medium, the hypha is mixed to obtain the microbial agent. The plant bacterial fertilizer is preferably obtained by inoculating hypha of the strain TP-13 obtained by the amplification culture on a culture medium, and mixing the hypha with nutrient components after the hypha grows on the culture medium. The culture medium comprises wheat bran, rice bran, 10% glucose solution and the like. The volume ratio of the wheat bran to the rice bran to the glucose solution with the mass concentration of 10% is 2:3:3. 10 pieces of 0.5cm were added per 500ml of medium ³ Size-sized pieces of bacteria. The temperature of the culture is preferably 23 to 27℃and more preferably 25 ℃. The culture is preferably a dark culture. The time of the culture is preferably 14 to 16 days, more preferably 15 days, until the auxiliary material has a large amount of hypha attached. The nutrient components also preferably comprise nutrient elements or organic fertilizers and the like.

In view of the most obvious promotion effect of the TP-13 strain on the growth of new roots of dendrobium seedlings, and the effect of promoting the growth of leaves and tillers of the seedlings and improving the dry weight of the seedlings, the invention provides the application of the Rhizobium strain TP-13 or the product in dendrobium cultivation.

In the present invention, the dendrobium growth preferably comprises dendrobium new root growth, promotion of growth of seedling leaves and tillers, and improvement of seedling dry weight. The invention is not particularly limited in the variety of cultivated dendrobium, and can be any dendrobium known in the art, such as dendrobium candidum, dendrobium meju, dendrobium hooked, and dendrobium huoshanense. In the embodiment of the invention, the symbiotic effect of the strain TP-13 is illustrated by taking dendrobium candidum as an example.

In the present invention, the medium for symbiotic culture is preferably oat medium. The oat medium is preferably4g·L ^-1 Oat and 10 g.L ^-1 Agar, pH of the culture medium is 5.6-5.8. The temperature of the symbiotic culture is preferably 23 to 27℃and more preferably 25 ℃. The symbiotic culture time is preferably 60 to 120d, more preferably 90d. The photoperiod L/D=12/12 of the symbiotic culture preferably has an illumination intensity of 2000 to 3000Lx, more preferably 2500Lx. The inoculation sequence of the dendrobium seedlings and the Rhizopus strain TP-13 is not particularly limited, and the inoculation sequence of symbiotic culture well known in the art can be adopted. In the embodiment of the invention, dendrobium seedlings are transplanted into a culture medium preferentially, and then the strain TP-13 is inoculated.

The present invention provides a Rhizopus arvensis strain TP-13 with the ability to promote the growth of new roots of Dendrobium nobile and its application in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Isolation, purification and identification of a strain of Rhizopus fungi (Epulothia sp.) TP-13

Isolation and purification of TP-13 Strain

1. Ground-moving induction of dendrobium candidum seedling mycorrhiza

(1) From 7 months to 9 months in 2018, the team investigated local pickers in the field, and finally confirmed that the six places of Yunnan Guangnan (23°58'N,105°11' E;1428m alt.), hunan mountain karst landform (26°30'N,111°10' E;340m alt.), danxia landform (26°20'N,110°46' E;45 m alt.)), chongqing Rofield (30°31'N,108°33' E;1200m alt.)), sichuan ludine (29°23'N,102°21' E;1382m alt.)) and asbestos (29°22'N,105°11' E;3596m alt.)) were dendrobium candidum habitat because historically picked up by the pickers. Six primordial matrixes are collected and brought back to a laboratory, the matrixes brought back from the field are mixed with sterile mixed matrixes (bark, peat soil and volcanic rocks are mixed according to the proportion of 2:1:1) in equal volume, and then the mixture is irrigated to saturation by sterile water and then split-packed into plastic flowerpots (radius 5cm and height 10 cm) for standby.

(2) Selecting sterile dendrobium candidum seedlings with good growth vigor, transplanting the five seedlings into a plastic flowerpot filled with an induction matrix, culturing the seedlings under illumination (the photoperiod is 12/12h L/D) at the room temperature of 25+/-2 ℃, keeping the humidity of the matrix in the flowerpot, collecting root tissues of the seedlings every 15 days, and checking whether the root tissues are colonized by fungi or not under a microscope.

(3) After 60 days of transplanting, hypha groups are found on seedling root tissues, seedling root samples are collected and used for subsequent fungus separation experiments

2. Isolation, purification and preservation of the Rhizobium TP-13 Strain

(1) Obtaining root samples: seedling mycorrhiza for forming symbiotic relation obtained by in-situ induction of dendrobium candidum seedlings

(2) Inducing, separating, purifying and preserving the root-like endophytic fungi: root samples for fungal isolation were rinsed clean under tap water. Placing the root sample on an ultra-clean workbench, sterilizing for 30s by 75% alcohol, then transferring the root sample into a sterile flat plate containing 2% sodium hypochlorite (NaClO) solution, slightly stirring and sterilizing for 3min, taking out by using sterile tip forceps, and flushing for 3-4 times by using sterile water. The root samples were cut into about 0.1mm root pieces using a sterile scalpel and placed in PDA medium in a 25℃incubator for dark culture. After fungus hypha grows around the root segment, continuously cutting the tip of the hypha to a new PDA culture medium for serial transfer, and obtaining pure bacterial colony after 3-5 times of transfer, thus obtaining 27 symbiotic fungi.

(3) Fungus preservation: the purified fungi were preserved using a conventional tube-slope method. The prepared appropriate amount of PDA medium was poured into a glass test tube of 18X 20mm in size, and the amount of medium poured was about 1/3 of the volume of the test tube. After the silica gel plug, the silica gel plug is put into an autoclave for sterilization (121 ℃ C., 20 min). Placing the test tube into an ultra-clean workbench to form an inclined plane for standby after sterilization. On an ultra-clean workbench, picking the edge hyphae of the purified strain by using a sterile inoculating needle, inoculating the edge hyphae on a PDA inclined plane, and marking strains, numbers and dates. The inoculated test tube is placed in a climatic chamber for dark culture at 25+/-2 ℃. When hyphae grow on the inclined surface of the PDA, the test tube is taken out and stored in a refrigerator at 4 ℃.

(II) identification method

1. Molecular characterization

Extraction of fungi by CTAB methodExtracting total DNA, carrying out PCR amplification by using primers ITS1 and ITS4, and carrying out a PCR reaction system and conditions by referring to corresponding product specifications; sequencing the amplified product by Shanghai biological engineering Co., ltd; the sequencing sequences were compared and analyzed in the national center for biotechnology information database, and their taxonomic status was confirmed in combination with morphological features. Specifically, the following is described. Extracting fungus DNA by adopting a CTAB method, wherein primers used for PCR amplification are ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO: 2) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 3); the PCR reaction system (25. Mu.l) included: 2.5. Mu.l 10 XPCR buffer, 0.4. Mu.l dNTPs, 1.5. Mu.l Mg ²⁺ 1.5. Mu.l ITS1, 1.5. Mu.l ITS4, 0.2. Mu.l Taq enzyme, 15.4. Mu.l ddH ₂ O, 2. Mu.l DNA template; the amplification reaction was performed on a PCR instrument Perkin Elmer, with the following PCR cycles: pre-denaturation at 94 ℃ for 3min, and circulation for 1 time; denaturation at 94℃for 1min, annealing at 51℃for 1min, extension at 72℃for 1min,30 cycles; finally, the mixture is extended for 10min at 72 ℃; sequencing PCR amplified products of Shanghai Bioengineering Co., ltd; the sequenced sequences are submitted to the national center for biotechnology information database for comparison, and the classification status is primarily confirmed.

The strain identification result shows that the strain TP-13 is most similar to Epulothia sp (accession number: KC 154064.1) fungi, and the maximum similarity is 97.28%.

2. The morphology of strain TP-13 is characterized as follows:

the morphological characteristics of the strain TP-13 are as follows: culturing on PDA plate for 10 days, and the colony is white blanket, has developed aerial hyphae, regularly and circularly divergent growth, and has rough and dry surface.

The hyphae of the strain TP-13 are characterized as follows: culturing in dark for 10 days in an incubator at 25+/-2 ℃ and observing under an optical microscope, wherein the mycelium is thick and 3.51-4.65 mu m, branches are nearly right angles, new mycelium is planted in old mycelium, the new mycelium has more obvious diaphragms, the number of the diaphragms is more, the cell walls of the old mycelium have thickening phenomenon, and the compartment is longer.

The fungi related to the invention are identified as the fungus of the genus Oncomelania according to colony, morphological characteristics and molecular biological means.

The isolated strain TP-13 is preserved in a mycorrhizal fungi library of orchid in a key laboratory of plant propagation adaptation and evolution ecology of Yunnan university in 12 th and 5 th of 2018, and the strain is classified and named as the mycorrhizal fungi (Epulothia sp.) TP-13; and has been deposited at the China center for type culture Collection, with a deposit address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: cctccc NO: m20211285.

Comparative example 1

Of the 27 strains isolated in example 1, TP-3, TP-6, TP-11, TP-15, TP-23 and TP-27 strains were identified, respectively, and the identification method was the same as that described in example 1.

Strains TP-1 (SEQ ID NO: 4), TP-3 (SEQ ID NO: 5), TP-6 (SEQ ID NO: 6) were identified as a fungus of the genus Tulasnella (Tulasnella sp.), TP-11 (SEQ ID NO: 7) was identified as a fungus of the genus Rhizopus (Epulothia sp.), strain TP-15 (SEQ ID NO: 8) was identified as a fungus of the genus Sebacilus sp., TP-23 (SEQ ID NO: 9) was identified as a fungus of the genus Trichoderma (Trichoderma sp.), and strain TP-27 (SEQ ID NO: 10) was identified as a fungus of the genus Muscovitum sp.

Example 2

Effectiveness test of promoting growth of new root of dendrobium candidum seedling by using Rhizobium fungus TP-13 strain

Verifying whether the fungus has a promoting effect on the growth of new roots of seedlings or not by utilizing a symbiotic experiment of the sterile dendrobium candidum seedlings and the fungus in a culture medium, and comparing differences of promoting effects of different fungi on the growth of the new roots:

(1) Preparing symbiotic culture medium: the symbiotic germination medium is oat agar medium comprising 4g.L ^-1 Oat and 10 g.L ^-1 Agar, the pH of the culture medium is 5.6-5.8;

(2) Taking out 26 symbiotic fungi for verifying the growth promoting function and the fungus Epulothia sp.TP-13 of the Rhizobium according to the invention, inoculating the fungus on a PDA culture medium, placing the PDA culture medium in an artificial climatic chamber, and culturing and activating the fungus in the dark at the temperature of 25+/-2 ℃ until fungus mycelia grow on a culture dish to obtain a symbiotic strain material;

(3) Transplanting sterile dendrobium candidum seedlings with approximately consistent growth vigor (4-5 leaves, 2 roots, 1.7-2.5cm in plant height and 1.2-1.5mm in stem thickness) into tissue culture bottles filled with oat agar culture medium, and treating 230 seedlings in each group for 46 times;

(4) Inoculating the symbiotic strain into a tissue culture bottle planted with sterile seedlings, then placing the bottle in a tissue culture room, and culturing at constant temperature at 25+/-2 ℃ with illumination period L/D=12/12 and illumination intensity of 2500Lx;

(5) The promoting effect of fungi on new roots of dendrobium candidum seedlings and statistical analysis of data: counting two periods (30 days and 90 days of symbiosis), counting the number of seedling roots each time, and calculating a new root number (R) according to a formula I;

r=mean (Rt-R0) ±se formula I

Where Rt is the number of roots of seedlings at each stage, R0 is the initial number of roots of seedlings, and SE is the standard deviation.

When symbiotic culture is carried out for 90 days, the influence of different fungus inoculation treatments on new root numbers is compared by using a Generalized Linear Model (GLMs), and average values of the treatments are compared by using a Least Significant Difference (LSD), wherein P is less than 0.05; any inoculation treatment has different degrees of promotion effects on the growth of new roots of dendrobium candidum seedlings (Table 1).

TABLE 1 influence of different fungi on the growth of new root of Dendrobium officinale seedlings (30 days, 90 days statistics)

Note that: lowercase letters indicate significance between different fungal treatments.

As can be seen from Table 1, after 30 days of symbiotic cultivation of dendrobium candidum seedlings and symbiotic fungi, PDA controls with different fungi treatment including non-inoculation treatment all have new root growth, especially the treatments of inoculating TP-27, TP-1 and TP-13 strains, and the average value of the new root numbers is obviously higher than that of other fungi inoculation treatments, and is respectively up to 2.227+/-0.192, 1.724 +/-0.112 and 1.62+/-0.189. The new root number of all fungus treatment groups is obviously higher than that of a control in the 90-day-cut experiment of symbiotic culture, but the average new root number of the treatment group inoculated with TP-13 is highest and is as high as 2.688 +/-0.298, and the effect of promoting the growth of new roots is optimal on the basis of 30 days, so that TP-13 fungus has the most obvious promoting effect on the growth of new roots of dendrobium candidum seedlings.

The fungus has different growth promoting effects on new roots of dendrobium candidum seedlings, most fungus treatments have continuous positive effects on the growth of the new roots of the seedlings, but TP-27 strain is very specific, the effect on the new roots of the seedlings is optimal in the early stage, and the count of the new roots is found to be less than that in the early stage by 90 days, and the root systems of the seedlings treated by the fungus treatments are found to have yellowing and withering and root system fracture in the culture process and are left in a symbiotic culture medium, so that the fungus treatment has no application value; while the effect of TP-1 in the early stage is equivalent to that of TP-13, the effect of TP-13 in the later stage is not good. The seedling inoculated with TP-13 strain has the best effect of promoting the growth of new roots, the effect can be continuously maintained, and the number of new leaves, the number of tillers and the dry weight of the seedling have obvious promoting effect compared with a control group which is not inoculated with bacteria. The dendrobium candidum seedlings and the strain TP-13 of the invention show a beneficial symbiotic relationship, and the dendrobium candidum seedlings are mycorrhized by utilizing the symbiotic relationship of the TP-13 strain and the dendrobium candidum seedlings, so that the dendrobium candidum seedlings can be used as a biological microbial inoculum raw material for dendrobium candidum cultivation.

Example 3

In order to further study the influence on the growth of dendrobium candidum seedlings when TP-13 strain and dendrobium candidum seedlings are symbiotic, the new leaf number, the tillering number and the dry weight index data of the seedlings are respectively determined, wherein the tillering is as follows: counting for 90 days, and forming newly sprouted buds; new leaf number: counting the number of leaves after 90 days, and subtracting the initial number of leaves of the seedling to obtain the new number of leaves; dry weight: at 90 days of statistics, the seedlings are put into an 80-degree oven and baked to dryness, during which the weight check number of the dry weight is changed, until the number of the dry weight of the seedlings is unchanged, and all the dry weight of the seedlings is weighed.

The results are shown in Table 2.

TABLE 2 influence of different fungi on Dendrobium officinale seedling growth (90 days statistics)

Compared with a blank control, the TP-13 strain has remarkable growth promoting effect on new leaf trees, tillering numbers and seedling dry weight of dendrobium candidum seedlings. Compared with other species strains (TP-1, TP-3, TP-23, TP-6, TP-27 and TP-15), the TP-13 microbial inoculum has equivalent growth promoting effect. Compared with the same strain (TP-11), the TP-13 strain is obviously lower than the TP-11 in promoting new leaf tree of seedlings, the TP-13 strain has equivalent growth promoting effect with the TP-11 in promoting tillering number, and the TP-13 strain is obviously better than the TP-11 strain in dry weight of seedlings. Therefore, the TP-13 strain also has the effects of promoting new leaf trees and tillering numbers of dendrobium candidum seedlings and improving the dry weight of the seedlings.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> an Oncomelania mycorrhizal fungi strain TP-13 with the capability of promoting the growth of new roots of dendrobium nobile and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 610

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggctgggtaa gtctttgagt tcgctttttc cgttgtcctc gggacgttaa tgcgctctgg 60

tcgaggataa acgacccctc tgaccgaggt aaaacccgtc gctctgtgtt acctcgacga 120

ggcacacgtt aaagatcgtt ccgcgttgtg agtctaacac cagttgtata aactttttac 180

aaccggtagc gatggatccc ttggcacgtc attcgatgaa aaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaaaccggc tgcggtatgc ccctttgagc gtcattgtat cccttcggga 360

gtccttttcc aaaggacccg agttcagagt cctcggtcct cttctggatc gtgttctctt 420

agatgcgtcg caccgatcgc ctgatgggtc ctctaatgcc taagcgtgga gttccttcag 480

agtccgaaac gtgcttgacc gggtgttgag ctcgcgtcgc caagtctgcc ttaaccaaca 540

ggactacaac acatgacctc attggggtag gacaacccgc tagacttaag catatcaata 600

agcggaggaa 610

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

<210> 4

<211> 614

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

tatgcttaag tctagcgggt tgtcctaccc caatgaggtc atgtggttgt agtaccaaac 60

ggtcctgacg gacgttggac ttgccgacac aggtctcacc acccggtcaa gcgcgtctcg 120

gcttcagagg gactccacgc tcaggcatta gagtgaccca tcaaagcgat cggcgcgatg 180

catctgagag aacacgatcc caaaggaccg aggactccga actcgggtct cacagcaaag 240

gagactcccg aaggatgtaa tgacgctcaa aggggcatac cgcagccggt ttagggcgcg 300

gtgcaatgcg ttcaacaact cgatgattca cgtataagtg gtggacttgc gcatcacatc 360

actttatcgc aatttgcaac ggtcttcatc gaatgacatg ccaagggatc cagcgctacc 420

ggttgtaaac tgttttttac aaccagtaag actcacaacg cggaacgatc tttaacgtgt 480

gcccacggag ggtaacacgg aatgcatgac aggttagcct cggtcagagg ggtcgtttat 540

cctcgaccag agcaccttaa cgtccggagg acaacggaac gaagcgtgcg tcagagacgt 600

ttactatgat cctt 614

<210> 5

<211> 611

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ctgcggaagg atcatagtaa acgtctttga cgcacttcgt tccgtcgtcc tccggacgtt 60

aaggcgctct ggtcgaggat aaacgacccc tctgaccgag gctaacccgt cgcgcttccg 120

tgttaccgtc cgcggcacac gttaaagatc gttccgcgtt gtgagtcttg ctggttgtaa 180

taaactgttt acaaccggta gcgctggatc ccttggcacg tcattcgatg aagaccgttg 240

caaattgcga taaagtgatg tgatgcgcaa gtccaccact tatacgtgaa tcatcgagtt 300

gttgaacgca ttgcaccgcg ccctaaaccg gctgcggtat gcccctttga gcgtcattac 360

atccttcggg agtctccttt tctggagacc cgagttcgga gtcctcggtc ccttgggatc 420

gtgttctctc agatgcatcg cgccgatcgc tttgatgggt cactctaatg cctgagcgtg 480

gagtccctct gaagtcgaga cgcgtttgac cgggtggtga gcccgcgtcg gcaagtccac 540

gtccgctgcg acgtcggtac tacaaccaca tgacctcatt ggggtaggac aacccgctag 600

acttaagcat a 611

<210> 6

<211> 609

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

aaaaaactgg ggtgtctccc caatgaggtc atgcgttgta gtaccgacgt cccagaggaa 60

cgcggacttg gcgacacgag ctcaacgctc ggtcaagcgc atctccactc cgagggactc 120

cacgctcagg cattagagtg acccatcaga caatcagcgc gacgcatcta agagaacacg 180

gtccacagac cgaggactcc gaactcgggt ctaagaaaga ctcccgaagg gatacaatga 240

cgctcaaagg ggcataccgc agccggatta gggcgcggtg caatgcgttc aacaactcga 300

tgattcacgt ataagtggtg gacttgcgca tcacatcact ttatcgcaat ttgcaacggt 360

cttcatcgaa tgacgtgcca agggatccag cgctaccggt tgtaattgtt tttacaactg 420

gtgttagact cacaacgcgg aacgatcttt aacgtgtgcc tcggcaaaga ggtaacacca 480

ggacggattc acctctgtca gaggggtcgt ttatcctcga ccagagcacc ttaacgtccc 540

gaggacgatg gaaacagcac gtcaaagacg attacttatg atccttccgc aggtaccctt 600

acggaaagc 609

<210> 7

<211> 1042

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

gaggtggttc gtctttgacg ttctatctcc atcgtcctcg ggacgttaag gcgctctggt 60

cgaggataaa ggacccctct gaccgaggct aaacggtcgc ttgcctgtgt tacctctttg 120

gaggcacacg ttaaagatcg ttccgcgttg tgagtctaac accagttgta aactttctac 180

aaccggcagc gctggatccc ttggcacgtc attcgatgaa gaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaatccggc tgcggtatgc ccctttgagc gtcattgtat tccttcggga 360

gtctttcctt gctgaaagac ccgagctcgg agtcctcggt cctttggatc gtgttctctc 420

agatgcgtcg cgccgatcgc ctgatgggta ctctaatgcc tgagcgtgga gtccctttga 480

gcttgagacg cgcatgaccg gccgttgggc tcgcgtcacc aagtccgcgt ccttctggac 540

gtcggtacta caacgcatga cctcattggg gtaggacaac ccgctagact taagcatatc 600

aataagcgga ggaaacggaa gccacttctc agcgacccgc cttctaatta catatctgta 660

gggagtgcac tagcaaggga tctccctctg gactgctacc gaccctatcg cacctagcgt 720

cggagctgac cagaggggat gccctcgccc tcgctatcct acccgatctc tactcgtatg 780

tacactatac gtgctattct tcccgaccta cacactcgtc tacgacaagt gtaattgcaa 840

ttccaagtta gagctcatag gctattactc gtaactaatc caaccgactg actggggtta 900

gatcaataat tccaaaaacc tagcatcctc tctattactg cgaatgctgc aagaagtgga 960

ctgtcctaat cttcaataac gtaaagcttg acttaatagc taccatcctt tcatcttggt 1020

aaagttcctt aaaccccaac gc 1042

<210> 8

<211> 618

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

tatgcttaag ttcagcgggt agtcccaccc gatttgaggt caaattgtca aacttgtcac 60

aaagacggtt cgcagcgcag agcccacttt gcttacgtgt ccataaggaa ctttgatcag 120

tgaagatgtt tatcacactg aagacgctgc aacagcaggg tacactcatg catttaaggc 180

cagtcgtmat tacacgacat tgcccaagtc cacttcytay racaaaagtc gtagaggtga 240

gattacaatg acactcaaac gggcgtaccc ttcggaatac caaagggtgc aaggtgcgtt 300

caaagattcg atgattcact gaattctgca attcacatta cttatcgcat ttcgctgcgt 360

tcttcatcgg tgcgagagcc aagagatccg ttgttgaaag ttgtatttat atgcgttatg 420

caaagacatt ccattacatt cagagtgtgt aaaaatacca tgagacccca gtcaaacacg 480

acgttcaacc agctgctcgt cagagacaag cggacctcac agtcaaaggt gcacaggtgt 540

gtggatttgc aatcgacgtg cacatgtgtt tccaccagca cagacgaccg cttatgattc 600

attaatgatc cttccgca 618

<210> 9

<211> 553

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

ttaccgagtt tacaactccc aaacccaatg tgaacgttac caaactgttg cctcggcggg 60

gtcacgcccc gggtgcgtaa aagccccgga accaggcgcc cgccggagga accaaccaaa 120

ctctttctgt agtcccctcg cggacgtatt tcttacagct ctgagcaaaa attcaaaatg 180

aatcaaaact ttcaacaacg gatctcttgg ttctggcatc gatgaagaac gcagcgaaat 240

gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcacattgc 300

gcccgccagt attctggcgg gcatgcctgt ccgagcgtca tttcaaccct cgaacccctc 360

cgggggatcg gcgttgggga tcgggacccc tcaccgggtg ccggccctga aatacagtgg 420

cggtctcgcc gcagcctctc ctgcgcagta gtttgcacaa ctcgcaccgg gagcgcggcg 480

cgtccacgtc cgtaaaacac ccaacttctg aaatgttgac ctcggatcag gtaggaatac 540

ccgctgaact taa 553

<210> 10

<211> 567

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

tatgcttaag ttcagcgggt attcctacct gatccgaggt caacctttat ataaggggtt 60

ttacggcagg ggccggaacc actacaaaag cgagatatag ttactacgct tagagtgaga 120

accaactccg ccaatcactt taaggagcta cgggctatgc cgtaggctcc caacgctaag 180

caacagggct taagtggtga aatgacgctc gaacaggcat gcccactaga atgctaatgg 240

gcgcaatgtg cgttcaaaga ttcgatgatt cactgaattc tgcaattcac attacttatc 300

gcatttcgct gcgttcttca tcgatgccag aaccaagaga tccgttgttg aaagttttaa 360

ctaattaagt ttatgattca gaattccaaa gaaaacagag tttagttggc cgccggcggg 420

gatgactacc gggtaacaaa tgtacctggg actgcagggt aatcactaag tggtaatccc 480

ccgcagggta gcctccgccg ccgaagcaac aaaggtaagt tcacataggg ttgggagttt 540

agaaaactct gtaatgatcc ctccgca 567

Claims

1. Oncomelania mycorrhizal fungi capable of promoting growth of new roots of dendrobium candidumEpulorhiza sp.) The strain TP-13 is characterized in that the preservation number is CCTCC NO: m20211285.

2. A product for dendrobium candidum cultivation, which is characterized by comprising the Oncomelania mycorrhizal fungi strain TP-13 and acceptable auxiliary materials.

3. The product according to claim 2, wherein the product comprises a microbial agent and a bacterial fertilizer for dendrobium candidum cultivation.

4. Use of the mycorrhizal fungi strain TP-13 according to claim 1 or the product according to claim 2 in dendrobium officinale cultivation.

5. The use according to claim 4, wherein the dendrobium officinale cultivation comprises promoting the growth of new roots of dendrobium officinale, promoting the growth of leaves, tillers of seedlings and increasing the dry weight of seedlings.

6. The method for improving the growth of the new root of the dendrobium candidum is characterized by comprising the following steps of:

symbiotic cultivation is carried out on dendrobium candidum seedlings and the Oncorhynchi bacterial strain TP-13 according to claim 1.

7. The method of claim 6, wherein the symbiotic medium is an oat medium.

8. The method according to claim 6 or 7, wherein the symbiotic culture is carried out at a temperature of 23-27 ℃, and the light-dark period of the symbiotic culture is L/d=12/12, and the light intensity is 2000-3000 Lx.