CN113684135B

CN113684135B - Chaetomium fortunei, application and screening method

Info

Publication number: CN113684135B
Application number: CN202110358646.7A
Authority: CN
Inventors: 郑培和; 张晶晶; 张宁; 侯微; 曲正义; 李亚丽; 华霜
Original assignee: Institute Special Animal and Plant Sciences CAAS
Current assignee: Institute Special Animal and Plant Sciences CAAS
Priority date: 2021-04-01
Filing date: 2021-04-01
Publication date: 2022-12-30
Anticipated expiration: 2041-04-01
Also published as: CN113684135A

Abstract

The invention relates to the technical field of biological control, in particular to chaetomium fortunei, application and a screening method. The invention provides chaetomium fortunei (C.subaffine) which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms at 1 month and 15 days in 2021, with the preservation number of CGMCC NO.21452 and the preservation address of No.3 Hospital No.1 North road of the sunward district of Beijing, china academy of sciences. The chaetomium fortunei has antagonistic action on fusarium solani, can be used for biological control of ginseng root rot, only introduces one microorganism, reduces the damage to soil microecology to the maximum extent, maintains the soil microecology balance and realizes control of diseases.

Description

Chaetomium fortunei, application and screening method

Technical Field

The invention relates to the technical field of biological control, in particular to chaetomium fortunei, application and a screening method.

Background

Ginseng (Panax ginseng Meyer) is a perennial herb of Panax of Araliaceae, is a traditional and precious Chinese medicinal material in China, has perennial roots as medicinal parts, and is severely restricted in quality and yield due to long growth period and much soil diseases. At present, the disease control of ginseng mainly depends on chemical pesticides in production, but the unreasonable use of pesticides can cause the problems of pathogenic bacteria such as drug resistance enhancement, drug residue, food safety, environmental pollution and the like.

Biological control has the advantages of environmental protection, safety, no residue, strong specificity and the like, and a plurality of strains for biological control of ginseng root rot are provided at present, for example, bellgary and the like (bellgary, zhang Suhong, wei Shuqin, and the like. Screening of biological agents for controlling ginseng root rot [ J ]. Hubei agricultural science, 2015,54 (21): 5296-5298.) report that six strains such as bacillus subtilis, bacillus thuringiensis, EM bacterial manure, phosphate solubilizing bacteria, laterospore mold thermophilus, trichoderma harzianum and the like have obvious inhibition effect on ginseng root rot germs, the bacillus subtilis has the best effect, and Gonglonglong dragon and the like (DOI: 10.7506/spkx 1002-6630-201525) report that the bacillus screened from rhizosphere soil hypha has obvious inhibition effect on growth and spore germination of ginseng root rot germs. Li Wen et al (Li Wen, wang lorhong, kike Kong Tan. Screening of antagonistic bacteria of ginseng pathogens and identification of bacteriostatic activity [ J ]. University of northeast forestry, 2019, v.47 (09): 93-97.) screened from rhizosphere soil to obtain 34 strains of bacteria, of which the inhibitory effect of Streptococcus Fahrenheit on root rot bacteria is most obvious.

However, the site of ginseng root rot is a plant tissue, and it is not clear whether or not the antagonistic bacteria screened from rhizosphere soil can normally exert the inhibitory action on root rot germs due to the difference of the action sites, and the dominant bacteria such as bacillus subtilis have a broad-spectrum bacteriostatic action and seriously damage the soil microbial community, so that microorganisms capable of effectively biologically controlling diseases of perennial medicinal herbaceous plants, particularly the biological control of ginseng, are in the present shortage.

In view of this, the invention is particularly proposed.

Disclosure of Invention

The invention aims to provide a microorganism which has biological control effect on herbaceous plants used for perennial crude drugs of ginseng.

The second purpose of the invention is to provide a microbial inoculum which comprises the microorganism with the biological control effect.

The third purpose of the invention is to provide the application of the microorganism or the microbial inoculum with the biological control effect in the biological control of plants.

The fourth purpose of the invention is to provide a plant biological control product.

The fifth object of the present invention is to provide a method for screening the above-mentioned microorganisms having biocontrol activity, so as to satisfy the current demand of herbaceous plants for perennial crude drugs of the genus Panax for biocontrol microorganisms, in particular, the demand of Panax for biocontrol microorganisms.

In order to solve the technical problems, the following technical scheme is adopted:

in a first aspect, the invention provides Chaetomium fortunei, wherein Chaetomium fortunei (c.subaffine) is deposited in the common microorganism center of the china committee for culture collection and management of microorganisms at 1 month and 15 days 2021, with the strain preservation number of CGMCC No.21452, the preservation address of No.3 institute for microorganisms of the china academy of sciences, north cheng west way 1 of sunny region in beijing.

In a second aspect, the present invention provides a bacterial agent comprising chaetomium yuanensis as described in the first aspect.

In a third aspect, the present invention provides the use of chaetomium yuanensis as described in the first aspect or a microbial inoculum as described in the second aspect in biological control of plants.

In an alternative embodiment, the plant comprises a medicinal herb.

Preferably, the plant comprises a perennial herb of the genus panax.

Preferably, the plant comprises ginseng.

In alternative embodiments, the plant biocontrol disease comprises plant root rot.

Preferably, the plant root rot includes a ginseng perennial herb root rot.

Preferably, the plant root rot comprises ginseng root rot.

The ginseng root rot is one of important fungal diseases of ginseng roots, the pathogenic bacteria of the ginseng root rot are fusarium solani of deuteromycotina, the fusarium solani mainly damages old ginseng of 3-6 years, the ginseng root rot usually starts from a reed head or a branch root and spreads to a main root, the diseased part is yellow brown to grey brown, part or all of the ginseng root rot, the diseased plant withers, and seedling rot occurs after a low-age ginseng seedling is damaged. The soil and the seedlings carry bacteria, and the fertilizer piled by the disease and residue plants can also transmit diseases. The use of farmland for planting ginseng is beneficial to the morbidity of heavy soil, low-lying terrain, poor drainage, poor root growth or wounds and the like.

In a fourth aspect, the present invention provides a plant biocontrol product comprising chaetomium interjavanicum of the first aspect and/or a microbial inoculum of the second aspect.

In a fifth aspect, the present invention provides a screening method of chaetomium interjavanicum described in the previous embodiment, the screening method includes that pathogenic bacteria of plant root rot and plant endophytic fungi are subjected to confronting culture to obtain plant endophytic fungi with a bacteriostatic rate of more than 60% to the pathogenic bacteria, and then morphological identification and/or molecular identification are performed to obtain the chaetomium interjavanicum; the pathogenic bacteria of the plant root rot disease comprise ginseng root rot bacteria. Compared with the screening of antagonistic bacteria from rhizosphere soil, the screening of antagonistic bacteria from endophytes of plants provided by the invention has the advantages that the peritrichotheca can be endogenously produced with the plants and can exert bacteriostatic effect on the infected plants, and the antagonistic bacteria screened from rhizosphere soil does not have bacteriostatic effect on the infected plants because the antagonistic bacteria cannot endogenously produced.

In an alternative embodiment, the method for obtaining the plant endophytic fungi comprises the steps of separating and culturing healthy plant root tissues to obtain flora, purifying and separating to obtain the endophytic fungi.

In an alternative embodiment, the method of confrontation culture comprises co-culturing the endophytic fungus and the plant root rot pathogen in the same solid medium at opposite positions.

Preferably, the endophytic fungi and the plant root rot pathogen are both cultured in the form of a fungus cake.

Preferably, the solid medium comprises a plate medium.

Preferably, the solid medium comprises PDA medium.

In an alternative embodiment, the molecular characterization comprises performing homologous species analysis after genetic sequencing of the endophytic fungi.

Preferably, the method of gene sequencing comprises an ITS sequence analysis method.

Preferably, the method of homologous species analysis comprises constructing a phylogenetic tree of an endophytic fungus.

Preferably, the method of obtaining data for use in the analysis of homologous species comprises sequence alignment of the endophytic fungal gene sequencing results with the database of NCBI.

Preferably, the software used for the sequence alignment comprises Blast.

The invention adopts a method combining morphological identification and molecular identification to analyze endophytic fungi separated and screened from healthy ginseng plants, separates a strain of endophytic fungi with biocontrol potential from ginseng roots, and the strain has good inhibition effect on ginseng root rot fungi. The morphological characteristics and molecular biology are combined and analyzed, and the strain is identified as Chaetomium sp C.subbaffine according to the reported morphological characteristics of various Chaetomium sp.

The chaetomium fortunei preserved in the common microorganism center of China Committee for culture Collection of microorganisms, which is provided by the invention, has the antagonistic effect on fusarium solani with the preservation number of CGMCC No.21452, can be used for biological control of ginseng root rot, only one microorganism is introduced, the damage to soil microecology is reduced to the maximum extent, the soil microecology balance is maintained, and the control of diseases is realized.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings can be obtained by those skilled in the art without creative efforts.

FIG. 1 shows the results of the counter culture in example 2 of the present invention;

FIG. 2 shows the bacteriostatic results of the fermentation broth of strain No.1 in example 3;

FIG. 3 is a phylogenetic tree of strain No.1 constructed in example 4 of the present invention;

FIG. 4 shows the result of the rot test of the ginseng root pieces after the strain No.1 is inoculated in the embodiment 5 of the present invention;

FIG. 5 shows the potting control effect of Strain No.1 in example 6 of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are some, but not all, embodiments of the present invention. The components of embodiments of the present invention generally described and illustrated in the figures herein may be arranged and designed in a wide variety of different configurations.

Thus, the following detailed description of the embodiments of the present invention, presented in the figures, is not intended to limit the scope of the invention, as claimed, but is merely representative of selected embodiments of the invention. All other embodiments, which can be obtained by a person skilled in the art without inventive step based on the embodiments of the present invention, are within the scope of protection of the present invention.

It should be noted that: like reference numbers and letters refer to like items in the following figures, and thus, once an item is defined in one figure, it need not be further defined and explained in subsequent figures.

In the description of the present invention, it should be noted that the term "relative position" indicates an orientation or a positional relationship based on the orientation or the positional relationship shown in the drawings, or an orientation or a positional relationship which is usually placed when the product of the present invention is used, and is only for convenience of describing the present invention and simplifying the description, for example, two ends of the diameter of the plate culture medium belong to the "relative position" of the present invention, and it does not indicate or imply that the device or the element to be referred to must have a specific orientation, be constructed and operated in a specific orientation, and thus, should not be construed as limiting the present invention.

Some embodiments of the invention are described in detail below with reference to the accompanying drawings. The embodiments described below and the features of the embodiments can be combined with each other without conflict.

Example 1

The embodiment provides a method for separating and purifying ginseng root endophytes by adopting a tissue isolation method, which specifically comprises the steps of firstly washing collected fresh ginseng roots with water, removing soil on the roots, washing with sterile water twice, then disinfecting with 75% ethanol for 1min, disinfecting with 0.1% mercury bichloride for 30s, washing with sterile water for 3 times, then sucking residual moisture on the surfaces of the roots with sterilized filter paper, and airing in a greenhouse for later use. Cutting the tissue to be separated into 0.5mm multiplied by 0.5mm slices by a sterile scalpel, placing the slices on a PDA (personal digital Assistant) plate, culturing for 6 days in an incubator at 25 ℃, purifying the obtained strains on the PDA plate again, and storing for later use at 4 ℃ to obtain 4 fungi, wherein the strains are respectively named as No.1 to No. 4 strains and respectively named as MS-01 to MS-04.

Example 2

The embodiment provides a method for screening ginseng endophytes with biocontrol capability by adopting a confronting culture method, which specifically comprises the steps of fetching endophyte cakes with the diameter of 5mm from the edges of 4 colonies of endophytes obtained in the embodiment 1, inoculating the endophyte cakes to the left side of a PDA (personal digital assistant) plate, simultaneously inoculating a Fusarium solani cake with the same size at the relative position with the same diameter on the right side of the PDA plate, setting a culture dish only inoculated with Fusarium solani as a control, repeating each treatment for three times, then culturing for 7d at 25 ℃, observing the growth condition of colonies, measuring the colony radius (Rc) of the Fusarium solani only inoculated and the radius (Rp) of the confronting culture by adopting a cross method after 7d, and calculating the bacteriostasis rate, wherein the calculation formula is as follows: bacteriostatic rate = (Rc-Rp)/Rc × 100%.

The bacteriostatic ratios of the 4 endophytic fungi obtained in example 1 are shown in table 1:

TABLE 1 bacteriostatic ratio of 4 endophytic fungi obtained in example 1

Antagonistic lines appear between the strain No.1 and the strain Fusarium solani, the growth of Fusarium solani is obviously inhibited (shown as A in figure 1), the junction of the two strains is observed through a microscope to find that Fusarium solani hyphae are obviously dissolved (shown as B in figure 1) and broken (shown as C in figure 1), and as can be seen from the table 1, the bacteriostasis rate of only the strain No.1 exceeds 60%, so that the strain is more favorable for biological control of the ginseng root rot.

Example 3

This example provides the evaluation of the bacteriostatic properties of the strain No.1 screened in example 2, which specifically comprises activating the strain No.1 screened on a PDA plate, culturing for 7 days, inoculating the strain into PDB medium, culturing at 25 deg.C and 120 r.min ^-1 Performing shake culture for 7d, filtering cultured bacteria solution with double-layer sterile gauze to remove mycelium, dividing the obtained fermentation broth into two parts, sterilizing one part with autoclave, and leaving the other part without any treatment. The fermentation broth of strain No.1, sterilized and not sterilized above, was mixed with PDA medium cooled to 45 ℃ at a ratio of 1:4, preparing a solid plate containing biocontrol bacteria fermentation liquor, taking a PDA plate without the fermentation liquor as a reference, inoculating fusarium solani cakes with the diameter of 5mm in the center of the plate, culturing for 7d in an incubator at the temperature of 25 ℃, recording the growth diameter of the strain, calculating the bacteriostasis rate, repeating the treatment for 3 times, and obtaining the result shown in figure 2.

The fermentation liquor of the strain No.1 can generate inhibition zones for ginseng root rot bacteria under the conditions of non-sterilization and sterilization, the inhibition rate of the fermentation liquor of the sterilized strain No.1 to ginseng root rot bacteria determined by a colony diameter method is (47.22 +/-0.39)%, the inhibition rate of the fermentation liquor of the non-sterilized strain No.1 to ginseng root rot bacteria is (79.92 +/-0.77)%, a in figure 2 is the sterilized fermentation liquor, b is the non-sterilized fermentation liquor, and c is a comparison.

Example 4

The morphological identification and phylogenetic tree construction of the strain No.1 with significant biocontrol function verified in the example 3 specifically comprises the following steps:

4.1 morphological identification

The morphological characteristics of the bacteria are observed by using an inverted phase contrast microscope, and the method specifically comprises the steps of dripping 1 drop of sterile water into the center of a glass slide, scraping a little hypha by using a cover glass, slightly beating one end of the glass slide, which contains the hypha, in the sterile water, immersing the hypha into the sterile water, then placing the cover glass on the sterile water, slightly pressing the cover glass, enabling the hypha not to be stacked as much as possible so as not to influence the observation, observing the hypha and spore morphology under the microscope, and taking a picture. The results show that: bacterial colony of No.1 strain on PDA plate is light yellow, aerial hypha is cotton-like, grows loosely and exuberantly, hypha has obvious diaphragm, spore is egg-shaped, two sides are smooth, and two ends are protruded. The strain is consistent with morphological characteristics of Chaetomium subaffine, and the strain No.1 is preliminarily inferred to be the Chaetomium subaffine.

4.2 construction of phylogenetic Tree

The extracted fungal DNA was PCR amplified using the fungal universal primers ITS1 (5' TCCGTAGGTGAACCTGCGG-. <xnotran> ( ) , TAACCATTGTGAACGTTACCTAAACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAACTCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGCAGTGGCGGGCTCGCTGTCACACCGAGCGTAGTAGCATACATCTCGCTCTGGGCGTGCTGCGGGTTCCGGCCGTTAAACCCCCTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTAAGCATATCAATAGGCCGGAGGAA, SEQ ID No.3 , 526bp . </xnotran> And (3) comparing the sequencing result with a Nucleotide blast database to obtain the information of homologous species, selecting the homologous sequence with the similarity rate of more than 99%, and constructing a phylogenetic tree by using MEGA 7.0 software in an adjacency method, wherein as shown in figure 3, the relationship between the strain No.1 and Chaetomium subaffine is closest as can be seen from figure 3.

Example 5

In this example, the bacterial strain No.1 obtained by screening in example 3 was inoculated into a ginseng root block, and the anti-rotting ability of the ginseng root block was evaluated, specifically, the ginseng root block was placed in a sterilized empty petri dish, and treated in 4 groups, the first group was not treated at all and was named as a control group as CK group, and the second group was inoculated with 10uL of bacterial content of 10 ⁶ The bacterial suspension of the Fusarium solani of cfu is named as Fusarium solani group, and the third group is inoculated with 10uL of bacteria with the bacterial content of 10 ⁶ The bacterial content of 10uL is added after the Fusarium solani of cfu ⁶ Bacterial suspension of the cfu strain No.1 is named as Fusarium solani + MS-01 group, and the fourth group is added with 10uL of bacterial content of 10 ⁶ A bacterial suspension of cfu strain No.1 was designated as MS-01 group. The obtained dish was cultured at 25 ℃ for 3 days in an incubator, and then the ginseng root pieces were observed to decay, and the results are shown in FIG. 4. As can be seen from FIG. 4, in the ginseng root block, the bacterial suspension of the No.1 bacterial strain can obviously inhibit the growth of fusarium solani, and meanwhile, the ginseng root block of the bacterial suspension of the No.1 bacterial strain alone normally grows without rotting, which indicates that the No.1 bacterial strain does not damage the ginseng root block, so that the No.1 bacterial strain can be used for biological control of ginseng root rot.

Example 6

This example examined the potting control effect of the strain No.1 selected in example 3. Respectively preparing the No.1 strain and ginseng root rot pathogenic bacteria into spore suspension with the concentration of 1 × 10 ⁸ each/mL of bacterial suspension, and then taking 4 potted ginseng with consistent growth vigor, and respectively carrying out the following treatment: (1) respectively irrigating root and inoculating chaetomium fortunei suspension and 150mL of ginseng root rot pathogenic bacteria suspension, named as MK + LD group, (2) irrigating root and inoculating ginseng root rot pathogenic bacteria suspension 300mL, named as LD group, (3) irrigating root and inoculating chaetomium fortunei suspension 300mL, named as MK group, (4) inoculating 300mL sterile water is used as a control group and named as CK, each group is repeatedly treated for 3 times, inoculation is repeatedly carried out every 7 days, the growth condition and the disease condition of ginseng plants are regularly observed, the result is shown in figure 5, after 20 days of inoculation, ginseng leaves treated by ginseng root rot pathogens are yellowish, overground part of the leaves of other treatment groups are light green and have good growth vigor, ginseng roots treated by underground part of the ginseng root rot pathogens have scabs infected by the pathogens, and other treatment groups do not have obvious scabs, so that the closely-related chaetomium fortunei is harmless to ginseng and has a certain control effect on the ginseng root rot.

Finally, it should be noted that: the above embodiments are only used to illustrate the technical solution of the present invention, and not to limit the same; while the invention has been described in detail and with reference to the foregoing embodiments, it will be understood by those skilled in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some or all of the technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.

SEQUENCE LISTING

<110> institute of specialty products of Chinese academy of agricultural sciences

<120> chaetomium fortunei, application and screening method

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Artificial sequence

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 17

<212> DNA

<213> Artificial sequence

<400> 2

tccgcttatt gatatgc 17

<210> 3

<211> 526

<212> DNA

<213> Chaetomium fortunei Chabaffine

<400> 3

taaccattgt gaacgttacc taaaccgttg cttcggcggg cggccccggg gtttaccccc 60

cgggcgcccc tgggccccac cgcgggcgcc cgccggaggt caccaaactc ttgataattt 120

atggcctctc tgagtcttct gtactgaata agtcaaaact ttcaacaacg gatctcttgg 180

ttctggcatc gatgaagaac gcagcgaaat gcgataagta atgtgaattg cagaattcag 240

tgaatcatcg aatctttgaa cgcacattgc gcccgccagt attctggcgg gcatgcctgt 300

tcgagcgtca tttcaaccat caagccccgg gcttgtgttg gggacctgcg gctgccgcag 360

gccctgaaaa gcagtggcgg gctcgctgtc acaccgagcg tagtagcata catctcgctc 420

tgggcgtgct gcgggttccg gccgttaaac cccctttaac ccaaggttga cctcggatca 480

ggtaggaaga cccgctgaac ttaagcatat caataggccg gaggaa 526

Claims

1. A chaetomium fortunei is characterized in that the strain of the chaetomium fortunei is preserved in the common microorganism center of China Committee for culture Collection of microorganisms with the preservation number of CGMCC NO.21452.

2. A bacterial preparation comprising the chaetomium interjavanicum according to claim 1.

3. Use of chaetomium yuanensis as claimed in claim 1 or microbial inoculum as claimed in claim 2 for preventing ginseng root rot.

4. A ginseng root rot control product comprising chaetomium fortunei according to claim 1 and/or the microbial agent according to claim 2.