CN114507618B

CN114507618B - Oncomelania mycorrhizal fungus strain TP-11 with dendrobium new leaf growth promoting capability and application thereof

Info

Publication number: CN114507618B
Application number: CN202210025989.6A
Authority: CN
Inventors: 高江云; 吴益花; 陈德赟; 李能奇
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2022-01-11
Filing date: 2022-01-11
Publication date: 2023-06-09
Anticipated expiration: 2042-01-11
Also published as: CN114507618A

Abstract

The invention provides a tumor mycorrhizal fungi strain TP-11 with a capacity of promoting growth of new leaves of dendrobium and application thereof, belonging to the technical field of microorganisms. The invention provides a tumor mycorrhizal fungi strain TP-11 with the capacity of promoting the growth of new leaves of dendrobium, and the preservation number is CCTCC NO: M20211284. The method has the advantages that the strain TP-11 can remarkably promote the growth of new leaves of dendrobium seedlings and the number of the new leaves of the dendrobium seedlings growing for 30d and 90d is remarkably superior compared with other separated strains. The dendrobium candidum seedlings and the strain TP-11 show a beneficial symbiotic relationship, and the dendrobium candidum seedlings are mycorrhized by utilizing the symbiotic relationship of the strain TP-11 and the dendrobium candidum seedlings, so that the dendrobium candidum seedlings can be used as a biological microbial inoculum raw material for dendrobium candidum cultivation.

Description

Oncomelania mycorrhizal fungus strain TP-11 with dendrobium new leaf growth promoting capability and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a tumor mycorrhizal fungus strain TP-11 with a capacity of promoting growth of new leaves of dendrobium nobile and application thereof.

Background

The wild resource of Dendrobium officinale (Dendrobium officinale) is mainly distributed in the karst terrains such as Hunan, yunnan, guizhou, sichuan and the like in China, and is good for warm and moist climates, and is suitable for cool, moist and smooth-air environment of semi-yin and semi-yang. Dendrobium officinale has high ornamental value, is taken as a traditional rare Chinese medicinal material in China, has extremely high medicinal value, has the effects of nourishing yin, clearing heat, benefiting stomach, promoting fluid production, improving eyesight, strengthening waist and the like, and is known as the first part of Chinese Jiuda xiancao from Tibet. However, under natural conditions, the breeding rate is low, wild resources are collected in an uncontrolled manner for a long time, and the wild resources are extremely deficient due to serious damage to the habitat. Therefore, how to recover the dendrobium candidum population by the prior knowledge, resources and technical protection and realize the recovery friendly cultivation at the same time, and meeting the consumption requirement becomes a difficult point.

Although a large number of symbiotic fungi for promoting seed germination are obtained at present, the germination rate is high, but the life history bottleneck exists between the germination stage and the seedling stage, and the seedling establishment cannot be realized after the seed germination. Even after the seedling is built, the seedling growth is forced to stagnate due to the lack of nutrient supply because the quality and quantity of the leaves affect the physiological and ecological functions of the orchid, such as photosynthesis. If fungus which can promote new leaf growth and is obtained from dendrobium candidum seedlings is separated, the problem is hopeful to be solved. Seedlings symbiotic with fungi promoting new leaf growth can break through the growth bottleneck, and have stronger adaptability in natural environment, so that the survival rate of the seedlings is greatly improved. The effective fungi are obtained by separating from roots of wild adult plants of orchid, but the screening and separating work of the effective fungi for promoting new leaf growth is complicated and complicated due to a large number of endophytic fungi with unknown effects in the adult plants. Therefore, the method for obtaining the effective symbiotic fungi for promoting the growth of new leaves of seedlings is a key link for developing the protection of dendrobium candidum, recovering population resources and realizing the recovery friendly cultivation. However, different symbiotic bacteria have functional differences, and no symbiotic fungus for promoting the growth of new leaves of dendrobium seedlings has been reported in the prior art.

Disclosure of Invention

Therefore, the invention aims to provide the Oncomelania mycorrhizal fungus strain TP-11 which has the capability of promoting the growth of new leaves of dendrobium, and can realize the efficient cultivation of dendrobium.

The invention provides a tumor mycorrhizal fungi strain TP-11 with the capacity of promoting the growth of new leaves of dendrobium, and the preservation number is CCTCCNO: m20211284.

Preferably, the ITS sequence of the Rhizopus arvensis strain TP-11 is shown as SEQ ID NO. 1.

The invention provides a microbial inoculum with the capability of promoting growth of new leaves of dendrobium, which comprises a tumor mycorrhizal fungi strain TP-11 and acceptable auxiliary materials.

The invention provides an application of the tumor mycorrhizal fungi strain TP-11 or the microbial inoculum in promoting growth of new leaves of dendrobium.

The invention provides a method for promoting growth of new leaves of dendrobium, which comprises the following steps:

symbiotic cultivation is carried out on dendrobium seedlings and the tumor mycorrhizal fungi strain TP-11 or the microbial inoculum on a symbiotic culture medium.

Preferably, the symbiotic medium comprises oat agar medium.

Preferably, in the amplification culture method of the mycorrhizal fungi strain TP-11, the mycorrhizal fungi strain TP-11 is inoculated on a PDA culture medium, and the culture is carried out in the dark until hyphae grow on a culture dish.

Preferably, the temperature of the dark culture is 23-27 ℃.

Preferably, the dendrobium comprises dendrobium candidum.

Preferably, the dendrobium candidum is dendrobium candidum seedlings.

The invention provides a tumor mycorrhizal fungus strain TP-11 with the capacity of promoting the growth of new leaves of dendrobium, and the preservation number is CCTCCNO: M20211284. Experiments prove that a plurality of strains of the Oncomelania bacteria are separated from roots of the field-induced dendrobium candidum seedlings and are subjected to symbiotic culture respectively, the dendrobium candidum seedlings are mycorrhized by the strain, and compared with other separated strains (TP-13 and TP-8), the strain TP-11 can remarkably promote the growth of new leaves of the dendrobium candidum seedlings, and the number of the new leaves of the dendrobium candidum seedlings growing for 30d and 90d has remarkable advantages. Compared with TP-10 belonging to the same Oncomelania bacteria, the effect of the dendrobium seedlings growing for 30d is equivalent to that of the TP-11 strain in the aspect of increasing the number of new leaves, however, in the aspect of growing the dendrobium seedlings for 90d, the TP-10 strain group is 2.786+/-0.481 (tablets), the TP-11 strain group is 4.45+/-0.508 (tablets), and the TP-11 strain has a more stable promoting effect in the aspect of promoting the growth of the new leaves of the dendrobium seedlings for a long time. The TP-11 strain provided by the invention can promote the increase of new leaves of dendrobium seedlings, can obtain high-quality symbiotic seedlings with strong adaptability and high survival rate, is hopeful to realize the reconstruction of dendrobium candidum populations and realizes the efficient cultivation of medicinal dendrobium candidum.

Meanwhile, the strain TP-11 and the product thereof provided by the invention are easy to operate, have low cost, are suitable for popularization and application, and have great popularization value in the aspects of regression protection of rare endangered orchid plants, population reconstruction practice, ecological cultivation of medicinal orchid plants, solving of the bottleneck problem of high-quality seedling sources in the dendrobium candidum cultivation industry and the like.

Drawings

FIG. 1 is a morphology diagram of the strain TP-11 and the control strain provided by the invention for promoting the growth of new leaf numbers.

Preservation of biological materials

Oncorhynchizasp (Epulothiasp.) was deposited at 2021, 10 and 15 days to China Center for Type Culture Collection (CCTCC), address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: CCTCCNO: m20211284, strain number TP-11.

Detailed Description

In the invention, the strain TP-11 is obtained by separating seedling mycorrhiza which is obtained by the field induction of dendrobium candidum seedlings and forms a symbiotic relationship. The method of the present invention is not particularly limited, and a method of separating a root-like endophyte known in the art may be used. The isolated strain TP-11 was identified. The identification includes morphological feature identification and molecular identification. The morphological characteristics of the strain TP-11 are as follows: the bacterial colony is white blanket-shaped, the aerial hyphae are developed, the bacterial colony grows in a regular circular shape in a divergent mode, the bacterial colony surface is rough and dry, and the bacterial colony has three concentric circles with obvious layers. The hyphal characterization of strain TP-11 results were as follows: culturing in dark for 10 days in an incubator at 25+/-2 ℃ and observing under an optical microscope, wherein the thickness of mycelia is 3.21-5.36 mu m, branches are nearly right angles, new mycelia are planted at the top of the old mycelia, the new mycelia have more obvious diaphragms, the number of the diaphragms is more, and the cell walls of the old mycelia have thickening phenomenon. The ITS sequence of the strain TP-11 is preferably shown as SEQ ID NO. 1, and the strain TP-11 is most similar to the HM214462.1 fungus Epulorthizasp, and the maximum similarity reaches 99.83 percent. Comprehensive morphological and molecular identification results show that the strain TP-11 belongs to a fungus (Epulothiasp.) belonging to the genus Oncorhyzasp.

In the method of the present invention, the strain TP-11 is preferably cultured in the dark until the mycelia grow over the dish by inoculating the strain TP-11 onto PDA medium. The method of the present invention is not particularly limited, and the method of inoculation known in the art may be used. The temperature of the dark culture is preferably 23 to 27℃and more preferably 25 ℃.

According to the preparation method of the microbial inoculum, the amplified and cultured mycorrhizal fungus strain TP-11 is inoculated into a culture medium formed by auxiliary materials, cultured, and mixed after hyphae grow full of the auxiliary materials, so that the microbial inoculum is obtained. The acceptable auxiliary materials are not particularly limited, and the auxiliary materials of the microbial inoculum known in the art are adopted. The auxiliary materials preferably comprise sterile mixed auxiliary materials such as wheat bran, rice bran, 10% glucose solution and the like. The volume ratio of the sterile wheat bran to the rice bran to the 10% glucose solution is 2:3:3 proportion. 10 pieces of 0.5cm of auxiliary materials are added into each 500ml of auxiliary materials ³ Size-sized pieces of bacteria. The temperature of the culture is preferably 23 to 27℃and more preferably 25 ℃. The culture is preferably a dark culture. The culture time is preferably 14-16 d, more preferably 15 days, until the auxiliary material has a large amount of hypha attached, and 10 blocks of 0.5cm are added ³ Is a fungus block of (a).

The invention provides an application of the tumor mycorrhizal fungi strain TP-11 or the microbial inoculum in promoting growth of new leaves of dendrobium seedlings. The promotion of the growth of new leaves of dendrobium seedlings is preferably promotion of the increase of the number of new leaves of dendrobium seedlings.

The invention provides a method for promoting growth of new leaves of dendrobium seedlings, which comprises the following steps:

In the present invention, the symbiotic medium preferably includes oat agar medium. The oat agar culture medium takes water as a solvent and also comprises the following components in percentage by weight: 4 g.L ^-1 Oat and 10 g.L ^-1 Agar, pH of the culture medium is 5.6-5.8.

The inoculation amount of the strain TP-11 is preferably 0.4-0.6 cm after each 120ml oat culture medium is inoculated ³ Strain TP-11, more preferably 0.5 cm/120 ml oat Medium ³ Bacterial strain TP-11 bacterial mass. The strain TP-11 bacterial block is obtained by the method for enlarging culture.

The method provided by the invention is suitable for all dendrobium plants, and in the embodiment of the invention, the characteristic of the strain TP-11 in increasing the number of new leaves of dendrobium seedlings is described by taking dendrobium candidum as an example, but the method cannot be understood as limiting the protection scope of the invention. The dendrobe seedlings prepared by the method are mycorrhized, and a foundation is provided for developing the protection, regression and population reconstruction practices of the dendrobe and developing the recovery friendly cultivation of the dendrobe.

The present invention provides a Rhizopus arvensis strain TP-11 with the ability to promote the growth of new leaves of Dendrobium nobile and its application in detail with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Method for separating, purifying and preserving strain TP-11

1. Ground-moving induction of dendrobium candidum seedling mycorrhiza

(1) From 7 months to 9 months in 2018, the team investigated local gatherers in the field, and finally confirmed that Yunnan Guangnan (23°58'N,105°11' E;1428 malt.) and Hunan mountain karst landform (26°30'N,111°10' E;340 malt.) and Danxia landform (26°20'N,110°46' E;455 matt.), chongqing Rofield (30°31'N,108°33' E;1200 matt.), sichuan ludine (29°23'N,102°21' E;1382 matt.) and asbestos (29°22'N,105°11' E;3596 matt.) were the dendrobium candidum origin because historically the gatherers collected wild dendrobium candidum. Six primordial matrixes are collected and brought back to a laboratory, the matrixes brought back from the field are mixed with sterile mixed matrixes (bark, peat soil and volcanic rocks are mixed according to the proportion of 2:1:1) in equal volume, and then the mixture is irrigated to saturation by sterile water and then split-packed into plastic flowerpots (radius 5cm and height 10 cm) for standby.

(2) Selecting sterile dendrobium candidum seedlings with good growth vigor, transplanting the five seedlings into a plastic flowerpot filled with an induction matrix, culturing the seedlings under illumination (the photoperiod is 12/12 hL/D) at the room temperature of 25+/-2 ℃, keeping the humidity of the matrix in the flowerpot, collecting root tissues of the seedlings every 15 days, and checking whether the root tissues are colonized by fungi or not under a microscope.

(3) After 60 days of transplanting, hypha clusters are found on seedling root tissues, and seedling root samples are collected and used for subsequent fungus separation experiments.

2. Isolation, purification and preservation of a strain of Rhizobium fungus (Epulothiasp.) TP-11

(1) Obtaining root samples: seedling mycorrhiza for forming symbiotic relation obtained by in-situ induction of dendrobium candidum seedlings

(2) Inducing, separating, purifying and preserving the root-like endophytic fungi: root samples for fungal isolation were rinsed clean under tap water. Placing the root sample on an ultra-clean workbench, sterilizing for 30s by 75% alcohol, then transferring the root sample into a sterile flat plate containing 2% sodium hypochlorite (NaClO) solution, slightly stirring and sterilizing for 3min, taking out by using sterile tip forceps, and flushing for 3-4 times by using sterile water. The root samples were cut into about 0.1mm root pieces using a sterile scalpel and placed in PDA medium in a 25℃incubator for dark culture. After fungus hypha grows around the root segment, continuously cutting the tip of the hypha to a new PDA culture medium for serial transfer, and obtaining pure bacterial colony after 3-5 times of transfer, thus obtaining 27 symbiotic fungi.

(3) Fungus preservation: the purified fungi were preserved using a conventional tube-slope method. The prepared appropriate amount of PDA medium was poured into a glass test tube of 18X 20mm in size, and the amount of medium poured was about 1/3 of the volume of the test tube. After the silica gel plug, the silica gel plug is put into an autoclave for sterilization (121 ℃ C., 20 min). Placing the test tube into an ultra-clean workbench to form an inclined plane for standby after sterilization. On an ultra-clean workbench, picking the edge hyphae of the purified strain by using a sterile inoculating needle, inoculating the edge hyphae on a PDA inclined plane, and marking strains, numbers and dates. The inoculated test tube is placed in a climatic chamber for dark culture at 25+/-2 ℃. When hyphae grow on the inclined surface of the PDA, the test tube is taken out and stored in a refrigerator at 4 ℃.

(4) Authentication

1) TP-11 has mainly the following microbiological characteristics:

(1) morphological features

The strain of the Oncomelania is cultured on a PDA flat plate for 10 days, the colony is white blanket-shaped, aerial hyphae are developed, the bacterial colony regularly and circularly diverges and grows, the surface of the bacterial colony is rough and dry, and the bacterial colony has three concentric circles with obvious layers.

(2) Hypha growth characteristics

The microscopic morphological characteristics of the strain are observed by using a cover glass inserting sheet culture method, the strain is subjected to dark culture in an incubator for 10 days at the temperature of 25+/-2 ℃, the strain is observed under an optical microscope, the thickness of hypha is 3.21-5.36 mu m, branches are near right angles, new hypha is on the top of the old hypha, the new hypha has more obvious diaphragms, the number of the diaphragms is more, and the cell walls of the old hypha have thickening phenomenon.

2) Molecular characterization

The extraction of the total DNA of fungi involved in molecular biological identification adopts a CTAB method; the primers used for PCR amplification are fungus universal primers ITS1 and ITS4; the PCR reaction system and conditions are carried out by referring to corresponding product specifications; sequencing the amplified product by Shanghai biological engineering Co., ltd; comparing and analyzing the sequenced sequences in the database of the national center for biotechnology information, and confirming the taxonomic status of the sequenced sequences by combining morphological characteristics;

extracting fungus DNA by adopting a CTAB method, wherein primers used for PCR amplification are ITS1 (TCCGTAGG TGAACCTGCGG, SEQ ID NO: 2) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 3); the PCR reaction system (25. Mu.l) included: 2.5 μl of 10 XPCR buffer, 0.4 μl NTP,1.5 μ lMg ²⁺ 1.5. Mu.l ITS1, 1.5. Mu.l ITS4, 0.2. Mu.l Taq enzyme, 15.4. Mu.lddH ₂ O, 2. Mu.l DNA template; the amplification reaction was performed on a PCR instrument Perkinelmer as follows PCR cycles: pre-denaturation at 94 ℃ for 3min, and circulation for 1 time; denaturation at 94℃for 1min, annealing at 51℃for 1min, extension at 72℃for 1min,30 cycles; finally, the mixture is extended for 10min at 72 ℃; sequencing PCR amplified products of Shanghai Bioengineering Co., ltd; the sequenced sequences are submitted to the national center for biotechnology information database for comparison, and the classification status is primarily confirmed. The strain identification result shows that the strain TP-11 is most similar to Epulothiasp. The fungi related to the invention are identified as the fungus of the genus Oncomelania by combining colony, morphological characteristics and molecular biological means.

According to morphological and molecular identification results, the strain TP-11 belongs to the genus Rhizopus (Epulothiasp.). The isolated strain TP-11 is preserved in a mycorrhizal fungi library of orchid in a key laboratory of plant propagation adaptation and evolution ecology of Yunnan university in the period of 5 of 12 of 2018, and the strain is classified and named as the mycorrhizal fungi (Epulorthizasp.) TP-11; and has been deposited at the China center for type culture Collection, with a deposit address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: cctcno: M20211284.

Comparative example 1

In example 1, when the TP-11 strain was isolated, a plurality of strains (TP-13, TP-8, TP-6, TP-14, TP-10, TP-5, TP-4, TP-15) were isolated at the same time, and the isolation, purification and identification methods were the same as in example 1.

Strains TP-10 (SEQ ID NO: 4), TP-13 (SEQ ID NO: 5) were identified as Rhizopus fungi (Epulothiasp.), TP-4 (SEQ ID NO: 6), TP-5 (SEQ ID NO: 7), TP-6 (SEQ ID NO: 8), TP-8 (SEQ ID NO: 9) were identified as Bacillus mucilaginosus (Tulasnellsp.), TP-14 (SEQ ID NO: 10) was identified as Sebaciusp., TP-15 (SEQ ID NO: 11) was identified as Sebaciussp.

Example 2

Experimental for promoting growth effectiveness of new leaves of dendrobium candidum seedlings by using Rhizobium fungus TP-11 strain

The symbiotic experiment of the sterile dendrobium candidum seedlings and fungi in the culture medium is utilized to verify whether the fungi have a promoting effect on the growth of new leaves of the seedlings or not, and the difference of the promoting effects of different fungi on the growth of the new leaves is compared:

(1) Preparing symbiotic culture medium: the symbiotic germination medium is oat agar medium comprising 4g.L ^-1 Oat and 10 g.L ^-1 Agar, the pH of the culture medium is 5.6-5.8;

(2) Taking out 8 mycorrhizal fungi for verifying growth promoting function and the mycorrhizal fungi strain TP-11, inoculating the mycorrhizal fungi strain TP-11 on a PDA culture medium, placing the PDA culture medium in an artificial climate box, and culturing and activating the mycorrhizal fungi strain TP-11 in the dark at the temperature of 25+/-2 ℃ until fungus mycelia grow on a culture dish to obtain a symbiotic strain material;

(3) Transplanting sterile seedlings with approximately consistent growth vigor (4-5 leaves, 2 roots, 1.7-2.5 cm in plant height and 1.2-1.5 mm in stem thickness) into tissue culture bottles filled with oat agar culture medium, and treating 230 seedlings by each group of fungi, wherein 46 times of the treatment are repeated;

(4) Inoculating the symbiotic strain into a tissue culture bottle planted with sterile seedlings, then placing the bottle in a tissue culture room, and culturing at constant temperature at 25+/-2 ℃ with an illumination period of L/D=12/12 and an illumination intensity of 2800Lx;

(5) The method comprises the following steps of (1) promoting effect and data statistical analysis of fungus on new leaves of dendrobium candidum seedlings: counting two periods (30 days and 90 days of symbiosis), counting the number of leaves each time, wherein the new leaf number counting method is to count the number of leaves, subtracting the initial number of leaves of the seedling to obtain the new leaf number, and calculating the new leaf number (L) according to a formula I;

l=mean (Lt-L0) ±se formula I

Wherein Lt is the number of leaves of the seedling in each period, L0 is the initial number of leaves of the seedling, and SE is a standard error;

at 90 day cutoff, the effect of different fungal inoculation treatments on new leaf numbers was compared using Generalized Linear Models (GLMs) and the mean of each treatment was compared using Least Significant Differences (LSD), P <0.05 (see table 1).

TABLE 1 influence of different fungi on New leaf growth of Dendrobium officinale seedlings (30 days, 90 days statistics)

Note that: lowercase letters indicate significance between different fungal treatments.

As can be seen from Table 1, after 30 days of symbiotic cultivation with dendrobium candidum seedlings, the different fungus treatment groups, including PDA control groups without inoculation treatment, all have new leaf growth, especially the treatment of inoculated TP-10 and TP-11 strains, and the average value of the new leaf numbers is obviously higher than that of the inoculation treatment of other strains, namely, the average value of the new leaf numbers is up to 3.266 +/-0.386 and 3.586 +/-0.44 respectively. When the symbiotic culture is used for 90-day cut-off experiments, although the number of new leaves of all fungus treatment groups is obviously higher than that of a control, the average number of new leaves of the treatment group inoculated with TP-11 is highest and reaches 4.45+/-0.508, and the growth of the new leaves is improved by 24.1% on the basis of 30 days, so that the TP-11 strain has the most obvious effect of promoting the growth of new leaves of dendrobium candidum seedlings.

Fungi have different growth promoting effects on seedlings, and the average new leaf numbers from some fungi treatment (TP-10, TP-13 and TP-15) to the later stage are inversely less than those of the earlier stage, so that even the TP-10 with good earlier stage promoting effect, the later stage has the leaf falling phenomenon, and therefore the method has no application value. The seedling inoculated with TP-11 strain has the best effect of promoting the growth of new leaves, the effect can be continuously maintained, and the new root number and fresh weight of the seedling have obvious promoting effect compared with the control group without bacteria inoculation. The dendrobium candidum seedlings and the strain TP-11 of the invention show a beneficial symbiotic relationship, the TP-11 strain and the dendrobium candidum seedlings can be utilized to realize the mycorrhization of the dendrobium candidum seedlings, and the dendrobium candidum seedlings can be used as a biological microbial inoculum raw material for dendrobium candidum cultivation.

Comparative example 2

In order to explore the effect of the Rhizobium japonicum TP-11 strain on other growth characteristics of dendrobium candidum seedlings, the plant height, the number of new roots, the fresh weight and the dry weight of the seedlings are respectively measured in the embodiment. The statistical method is as follows: new root number: counting the root number after culturing for 90 days, and subtracting the initial root number of the seedlings to obtain a new root number; plant height: when the plants are cultivated for 90 days and counted, the length of the plants is measured by utilizing a ruler; fresh weight; the seedlings are cleaned up, naturally air-dried and moisture-free after culturing for 90 days and counting, and are weighed to obtain the fertilizer; dry weight: at the time of culturing for 90 days, the seedlings are put into an oven at 80 ℃ to be baked to dryness, during which the weighing check is carried out to determine whether the dry weight number is changed or not until the dry weight number of the seedlings is no longer changed, and all the dry weight numbers of the seedlings are weighed. The results are shown in Table 2.

TABLE 2 Effect of different fungal treatments on Dendrobium officinale seedlings (90 days)

As can be seen from Table 2, the TP-11 strain was symbiotic with dendrobium candidum seedlings, and did not show outstanding advantages in terms of plant height, new root number, fresh weight and dry weight of the plants, compared with other Rhizobium strains (TP-10, TP-13), bacillus mucilaginosus strains (TP-4, TP-6, TP-8) and Sebashaless. Strain (TP-15). Presumably, when the TP-11 strain and the dendrobium candidum seedlings are symbiotic, the active ingredients for promoting the growth of new leaves of the seedlings are secreted, so that the aim of promoting the growth of the dendrobium candidum seedlings is fulfilled.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> an Oncomelania mycorrhizal fungi strain TP-11 with the ability of promoting growth of new leaves of dendrobium nobile and application thereof

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1042

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gaggtggttc gtctttgacg ttctatctcc atcgtcctcg ggacgttaag gcgctctggt 60

cgaggataaa ggacccctct gaccgaggct aaacggtcgc ttgcctgtgt tacctctttg 120

gaggcacacg ttaaagatcg ttccgcgttg tgagtctaac accagttgta aactttctac 180

aaccggcagc gctggatccc ttggcacgtc attcgatgaa gaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaatccggc tgcggtatgc ccctttgagc gtcattgtat tccttcggga 360

gtctttcctt gctgaaagac ccgagctcgg agtcctcggt cctttggatc gtgttctctc 420

agatgcgtcg cgccgatcgc ctgatgggta ctctaatgcc tgagcgtgga gtccctttga 480

gcttgagacg cgcatgaccg gccgttgggc tcgcgtcacc aagtccgcgt ccttctggac 540

gtcggtacta caacgcatga cctcattggg gtaggacaac ccgctagact taagcatatc 600

aataagcgga ggaaacggaa gccacttctc agcgacccgc cttctaatta catatctgta 660

gggagtgcac tagcaaggga tctccctctg gactgctacc gaccctatcg cacctagcgt 720

cggagctgac cagaggggat gccctcgccc tcgctatcct acccgatctc tactcgtatg 780

tacactatac gtgctattct tcccgaccta cacactcgtc tacgacaagt gtaattgcaa 840

ttccaagtta gagctcatag gctattactc gtaactaatc caaccgactg actggggtta 900

gatcaataat tccaaaaacc tagcatcctc tctattactg cgaatgctgc aagaagtgga 960

ctgtcctaat cttcaataac gtaaagcttg acttaatagc taccatcctt tcatcttggt 1020

aaagttcctt aaaccccaac gc 1042

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

<210> 4

<211> 613

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gcttaagtct agcgggttgt cctaccccaa tgaggtcatg cgttgtagta ccgacgtcca 60

ggaggacgcg gacttggtga cgcgagccca acggccggtc aagcgcgtct caagctcaga 120

gggactccac gctcaggcat tagagtaccc atcaggcgat cggcgcgacg catctgagag 180

aacacgatcc aaaggaccga ggactccgag ctcgggtctt tcagcaagga aagactcccg 240

aaggaataca atgacgctca aaggggcata ccgcagccgg tttagggcgc ggtgcaatgc 300

gttcaacaac tcgatgattc acgtataagt ggtggacttg cgcatcacat cactttatcg 360

caatttgcaa cggtcttcat cgaatgacgt gccaagggat ccagcgctgc cggttgtaaa 420

gtttacaact ggtgttagac tcacaacgcg gaacgatctt taacgtgtgc ctccgaggag 480

gtaacacaga ctggcgaccg tttaacctcg gtcagagggg tcgtttatcc tcgaccagag 540

cgccttaacg tcccgaggac gatggagata gaacgtcaaa gacgattact atgatccttc 600

cgcaggttca cct 613

<210> 5

<211> 610

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ggctgggtaa gtctttgagt tcgctttttc cgttgtcctc gggacgttaa tgcgctctgg 60

tcgaggataa acgacccctc tgaccgaggt aaaacccgtc gctctgtgtt acctcgacga 120

ggcacacgtt aaagatcgtt ccgcgttgtg agtctaacac cagttgtata aactttttac 180

aaccggtagc gatggatccc ttggcacgtc attcgatgaa aaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaaaccggc tgcggtatgc ccctttgagc gtcattgtat cccttcggga 360

gtccttttcc aaaggacccg agttcagagt cctcggtcct cttctggatc gtgttctctt 420

agatgcgtcg caccgatcgc ctgatgggtc ctctaatgcc taagcgtgga gttccttcag 480

agtccgaaac gtgcttgacc gggtgttgag ctcgcgtcgc caagtctgcc ttaaccaaca 540

ggactacaac acatgacctc attggggtag gacaacccgc tagacttaag catatcaata 600

agcggaggaa 610

<210> 6

<211> 1123

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

gggagggcat cggtctttgg acgttcgcta gtctccgtcg tccgccggac gttaagctgc 60

tctggtcgag gataaacgac ccctctgacc gaggctaatc cgtcgtcctc ggggtaacgg 120

ctcctggacc acgttaagaa cggttcgggg tggggagccc cgatccaacg ggggatacca 180

attcgttaac aacgggaagg gagggttccc tgggaccgtc attcaaggaa aacggtggaa 240

aatggcaata aagggagggg aggcgcaggt cccccactaa tacgggaacc ttcgagtggt 300

tgaaggcttt gccccgggcc ctaaccgggt tgcggatggc ccctttgagg gtcttggctt 360

accttcggaa gcttttcttc ggtgaccaac cggagtccgg agtcttcgtt ccttggggat 420

cgggttctct tggatgcttc gggccaatcg ctggtgggtt atcctatggc cggacgggga 480

agccccccga agtcaaaact ggtggaacgg gtggtcaaac ccggcgcttc caagtccaaa 540

acggccgaac ttcgccggct tctcggaact acaaccatgg acttcatggg ggaaggacaa 600

ccggttaatt taggctacaa gggggggggg aaaaaaattt gtattcgttt tggcctttcc 660

ttattccccg tcgccccgga agtttaactt cttcggttca ggataaaaca accctctaac 720

gaggctatcc tctcctctgg ttagctctct gacacattta gagagctctc gcgttgtgac 780

tctatctctc tcggatatca catctcttat acacgtatga tatgatactc tgtgacacat 840

atctctgtaa agactgtgca ttttgctata aggttatgag gtgcgcgatc tctatatcgt 900

gattctcagt ttatgaacgt ttgcgctaca cgcggaatgc ctttgagatc tgtactctgg 960

aatttttctg tgtatcccaa ttcgaacctg ctctgtgaga gtgttataga tgcccagcgc 1020

atcgagacgc attccagatg aagtctgctc catcaagtga cgcgtgtagg acgcagatga 1080

gcctcttctt catcatctac tcttgtgcga cgaccatcat ctt 1123

<210> 7

<211> 622

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

ttattgatat gcttaagtct agcgggttgt cctaccccaa tgaggtcatg cgttgtagta 60

ccgacgtcca gaaggacgcg gacttggtga cgcgagccca acggccggtc atgcgcgtct 120

caagctcaaa gggactccac gctcaggcat tagagtaccc atcaggcgat cggcgcgacg 180

catctgagag aacacgatcc aaaggaccga ggactccgag ctcgggtctt tcagcaagga 240

aagactcccg aaggaataca atgacgctca aaggggcata ccgcagccgg attagggcgc 300

ggtgcaatgc gttcaacaac tcgatgattc acgtataagt ggtggacttg cgcatcacat 360

cactttatcg caatttgcaa cggtcttcat cgaatgacgt gccaagggat ccagcgctgc 420

cggttgtaga aagtttacaa ctggtgttag actcacaacg cggaacgatc tttaacgtgt 480

gcctccaaag aggtaacaca ggcaagcgac cgtttagcct cggtcagagg ggtcctttat 540

cctcgaccag agcgccttaa cgtcccgagg acgatggaga tagaacgtca aagacgatta 600

ctatgatcct tccgcaggtt ca 622

<210> 8

<211> 609

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aaaaaactgg ggtgtctccc caatgaggtc atgcgttgta gtaccgacgt cccagaggaa 60

cgcggacttg gcgacacgag ctcaacgctc ggtcaagcgc atctccactc cgagggactc 120

cacgctcagg cattagagtg acccatcaga caatcagcgc gacgcatcta agagaacacg 180

gtccacagac cgaggactcc gaactcgggt ctaagaaaga ctcccgaagg gatacaatga 240

cgctcaaagg ggcataccgc agccggatta gggcgcggtg caatgcgttc aacaactcga 300

tgattcacgt ataagtggtg gacttgcgca tcacatcact ttatcgcaat ttgcaacggt 360

cttcatcgaa tgacgtgcca agggatccag cgctaccggt tgtaattgtt tttacaactg 420

gtgttagact cacaacgcgg aacgatcttt aacgtgtgcc tcggcaaaga ggtaacacca 480

ggacggattc acctctgtca gaggggtcgt ttatcctcga ccagagcacc ttaacgtccc 540

gaggacgatg gaaacagcac gtcaaagacg attacttatg atccttccgc aggtaccctt 600

acggaaagc 609

<210> 9

<211> 602

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

atgcttaagt ctagcgggtt gtcctacccc aatgaggtca tgcgttgtag tcctgctggt 60

taaggcagac ttggcgacgc gagctcaaca cccggtcaag cacgtctcgg actctgaagg 120

aactccacgc ttaggcatta gaggacccat caggcgatcg gtgcgacgca tctaagagaa 180

cacgatccag aagaggaccg aggactctga actcgggtcc tttggaaaag gactcccgaa 240

gggatacaat gacgctcaaa ggggcatacc gcagccggtt tagggcgcgg tgcaatgcgt 300

tcaacaactc gatgattcac gtataagtgg tggacttgcg catcacatca ctttatcgca 360

atttgcaacg gtcttcatcg aatgacgtgc caagggatcc atcgctaccg gttgtaaaaa 420

gtttatacaa ctggtgttag actcacaacg cggaacgatc tttaacgtgt gcctcgtcga 480

ggtaacacag agcgacgggt tttacctcgg tcagaggggt cgtttatcct cgaccagagc 540

gcattaacgt cccgaggaca acggaaaaag cgaacgtcaa agacgattac tatgatcctt 600

cc 602

<210> 10

<211> 888

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ctttttgatc aattcggtct tctgtgctgg tggcaacaca tgtgcacgtc gatcgtaatt 60

ccatcctcct cccaaccgtc catgtgtgtg tttggtcgac ctcggtcgaa gagttgtggc 120

ccttggcctc gattcgttcc agatgcacct tggttatttc acccactctg ggtactagaa 180

acaaagaaca ttttatataa actatacaac tttcaacaac ggatctcttg gctctcgcat 240

cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc 300

gaatctttga acgcaccttg caccctttgg tattccgaag ggtacgcccg tttgagtgtc 360

attgtaatct caatcccacg actttatgtt gtgtgattgg acttggatcc tgtcgctttt 420

gtgactgatc cgaaatgcat cagcgtgtgt ccgtcgtgac gataaaccga ttgttaaact 480

tcatcgggct cgctctgtcg aggttgtctg gcgaaagcac atgctaaacc cccctacatt 540

ttgacaattt gacctcaaat cgggtgggat cacccgctga acttaagcat atcaaacggg 600

ggggagaaag aaaattttat tgtacaattc cggtagaaca gtgctaggtg gcaacacatg 660

gtgcacgtcg atccgtaatt tccatcctcc tccaaggttc atggtgtgtg gtttggtcga 720

cctcggtcga aagagttgtg ggccctttgg cctcatttct ttcacatgcg cttaggttat 780

ttcaccctct ggggactaaa aacaaaaaaa atgttatata aactatacaa ctttcaacac 840

cggatctcct tggctcgctc gatgaagaag acaccaaatg ctcataag 888

<210> 11

<211> 618

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

tatgcttaag ttcagcgggt agtcccaccc gatttgaggt caaattgtca aacttgtcac 60

aaagacggtt cgcagcgcag agcccacttt gcttacgtgt ccataaggaa ctttgatcag 120

tgaagatgtt tatcacactg aagacgctgc aacagcaggg tacactcatg catttaaggc 180

cagtcgtmat tacacgacat tgcccaagtc cacttcytay racaaaagtc gtagaggtga 240

gattacaatg acactcaaac gggcgtaccc ttcggaatac caaagggtgc aaggtgcgtt 300

caaagattcg atgattcact gaattctgca attcacatta cttatcgcat ttcgctgcgt 360

tcttcatcgg tgcgagagcc aagagatccg ttgttgaaag ttgtatttat atgcgttatg 420

caaagacatt ccattacatt cagagtgtgt aaaaatacca tgagacccca gtcaaacacg 480

acgttcaacc agctgctcgt cagagacaag cggacctcac agtcaaaggt gcacaggtgt 540

gtggatttgc aatcgacgtg cacatgtgtt tccaccagca cagacgaccg cttatgattc 600

attaatgatc cttccgca 618

Claims

1. Oncomelania mycorrhizal fungi capable of promoting growth of new leaves of dendrobium candidumEpulorhizasp.) strain TP-11, characterized in that the preservation number is cctccc NO: m20211284.

2. A microbial inoculum with the capability of promoting the growth of new leaves of dendrobium candidum is characterized by comprising the tumor mycorrhizal fungus strain TP-11 and acceptable auxiliary materials.

3. Use of the mycorrhizal fungi strain TP-11 according to claim 1 or the microbial inoculum according to claim 2 for promoting the growth of new leaves of dendrobium candidum.

4. The method for promoting the growth of the new leaves of the dendrobium candidum is characterized by comprising the following steps of:

symbiotic cultivation of dendrobium candidum seedlings and the Oncorhynchi mycorrhizal strain TP-11 according to claim 1 or the microbial inoculum according to claim 2 on a symbiotic medium.

5. The method of claim 4, wherein the symbiotic medium comprises oat agar medium.

6. The method according to claim 4, wherein the method for the enlarged culture of the Rhizopus arvensis strain TP-11 comprises inoculating the Rhizopus arvensis strain TP-11 onto PDA medium, and culturing in darkness until mycelia grow on a culture dish.

7. The method according to claim 6, wherein the temperature of the dark culture is 23-27 ℃.