CN114381379B

CN114381379B - Adhesive film fungus strain TP-8 with dendrobium seedling tillering improving capability and application thereof

Info

Publication number: CN114381379B
Application number: CN202210026007.5A
Authority: CN
Inventors: 高江云; 吴益花; 陈德赟
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2022-01-11
Filing date: 2022-01-11
Publication date: 2023-06-09
Anticipated expiration: 2042-01-11
Also published as: CN114381379A

Abstract

The invention provides a glue film fungus strain TP-8 with the capability of improving tillering capability of dendrobium candidum seedlings and application thereof, and belongs to the technical field of microorganisms. The invention provides a strain TP-8 of a glue film bacterium (Tulasnella sp.) with the capability of improving tillering capability of dendrobium candidum seedlings, and the preservation number is CCTCC NO: m20211283. The capability of fungus for improving the tillers of the dendrobium candidum is different, and the number of the tillers of the seedlings treated by inoculating TP-8 strain is obviously increased. Simultaneously, TP-8 strain and dendrobium candidum seedlings are symbiotic, so that new leaves and new roots of the seedlings and the thickening and strengthening of the node stems of the seedlings can be promoted to a certain extent. The dendrobium candidum seedlings and the strain TP-8 of the invention show a beneficial symbiotic relationship, and the dendrobium candidum seedlings are mycorrhized by utilizing the symbiotic relationship of the TP-8 strain and the dendrobium candidum seedlings, so that the dendrobium candidum seedlings can be used as a biological microbial inoculum raw material for dendrobium candidum cultivation.

Description

Adhesive film fungus strain TP-8 with dendrobium seedling tillering improving capability and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a glue film fungus strain TP-8 with the capability of improving the tillering capability of dendrobium candidum seedlings and application thereof.

Background

Dendrobium officinale (Dendrobium officinale) is also called as Dendrobium candidum and herba Hedyotidis Diffusae, is a special species in China, and wild resources are mainly distributed in karst terrains such as Hunan, yunnan, guizhou, sichuan and the like in China, and is good for warm and moist climates, and suitable for cool, moist and air-unimpeded environments of semi-yin and semi-yang. As a precious product of traditional Chinese medicinal materials, the Chinese medicinal materials have the chemical components of polysaccharide, alkaloid, glycoside, phenol, lignin and the like, and have various pharmacological effects of regulating immune function, resisting oxidation, resisting tumor, reducing blood sugar, resisting bacteria and the like. However, under natural conditions, the fertility is weak, the growth period is long, excessive collection is added, and meanwhile, the habitat is seriously damaged, so that the wild resources of the dendrobium candidum are extremely endangered. Therefore, how to protect and restore the dendrobium candidum population by the prior knowledge, resources and technology, and realize the friendly cultivation of restoring at the same time, and meeting the consumption requirement becomes a difficult point.

Although a large number of symbiotic fungi promoting seed germination have been obtained, and the germination rate is high, the growth bottleneck is between the germination stage and the seedling stage, and the seedling establishment cannot be realized after the seed germination. Even if seedlings can be formed, the seedlings are short and small, the differentiation ability is weak, new buds cannot be formed, and the seedlings have no tillering ability.

However, the prior art reports fungus strains isolated from the roots of adult dendrobium candidum plants, some of which are capable of killing dendrobium candidum seeds and protocorms, and some of which are capable of promoting dendrobium candidum growth, mainly by increasing fresh weight growth of seedlings, chlorophyll content, nutrient absorption and plant growth hormone level in the seedlings (mycorrhizal fungi influence on germination and growth of dendrobium candidum, wu Huifeng, university of Hainan treatises 2011.5.30). The research in the prior art shows that the types of fungi required by the dendrobium candidum in each growth stage are different, and the physiological indexes of the dendrobium candidum protocorm and the tissue culture seedlings are measured to find that endophytic fungi regulate the growth and development of the dendrobium candidum mainly by producing endogenous hormones. Seedlings symbiotic with fungi with the capability of improving tillering can break through growth bottleneck, grow fast, grow plants greatly, have stronger adaptability in natural environment, and greatly improve survival rate. The effective fungi are obtained by separating from roots or protocorms of wild adult plants of orchid, but the screening and separation of the effective fungi for improving the tillering capability of seedlings are complicated and complicated due to a large number of endophytes with unknown functions in the adult plants, and the wild protocorms are extremely difficult to obtain. Therefore, the method for obtaining the effective symbiotic fungi for improving the sprout of the seedling is a key link for developing the protection of the dendrobium candidum, recovering the population resources and realizing the recovery friendly cultivation.

Disclosure of Invention

Therefore, the invention aims to provide a glue film fungus strain TP-8 with the capability of improving the tillering capability of dendrobium candidum seedlings and application thereof.

The invention provides a strain TP-8 of a glue film bacterium (Tulasnella sp.) with the capability of improving tillering capability of dendrobium candidum seedlings, and the preservation number is CCTCC NO: M20211283.

Preferably, the ITS sequence of the strain TP-8 is shown as SEQ ID NO. 1.

The invention provides a bacterial fertilizer for improving the tillering capability of dendrobium seedlings, which comprises a glue film bacterial strain TP-8 and acceptable nutritional ingredients.

The invention provides application of the glue film fungus strain TP-8 or the fungus fertilizer in improving the tillering capability of dendrobium seedlings.

The invention provides a method for improving the tillering capacity of dendrobium seedlings, which comprises the steps of transplanting dendrobium seedlings to a symbiotic culture medium for growth, inoculating a glue film fungus strain TP-8 or a bacterial fertilizer to the symbiotic culture medium, and enabling glue film fungus to colonize the root of the dendrobium seedlings for cultivation.

Preferably, the symbiotic medium comprises oat agar medium;

the oat agar medium comprises 4g.L ^-1 Oat and 10 g.L ^-1 Agar, pH of the culture medium is 5.6-5.8.

Preferably, the inoculation amount of the strain TP-8 of the glue film bacteria is 0.4-0.6 cm after each 120ml oat culture medium is inoculated ³ The strain TP-8 is a fungus block.

Preferably, the temperature of the culture is 23-27 ℃.

Preferably, the photoperiod of the culture is 12L/12D; the illumination intensity is 2000-3000 Lx.

Preferably, the dendrobium comprises dendrobium candidum.

The invention provides a strain TP-8 of a glue film bacterium (Tulasnella sp.) with the capability of improving the tillering capability of dendrobium candidum seedlings, and the preservation number is CCTCCNO: M20211283. Compared with other glue film fungus strains TP-8 separated from the roots of dendrobium candidum seedlings, the strain TP-8 can improve the tillering capacity of dendrobium candidum seedlings and achieve obvious difference. The dendrobium candidum seedling is mycorrhized by using the glue film fungus strain TP-8, the sprout tiller number of the seedling is increased, high-quality symbiotic seedlings with strong adaptability, strong growth capacity and high survival rate can be obtained, reconstruction of dendrobium candidum population is hopeful to be realized, and efficient cultivation of medicinal dendrobium candidum is realized.

Meanwhile, the method has the advantages of simple process, easy operation and low cost, is suitable for popularization and application, and has great popularization value in the aspects of regression protection of rare endangered orchid plants, population reconstruction practice, ecological cultivation of medicinal orchid plants, solving of the bottleneck problem of high-quality seedling sources in the dendrobium candidum cultivation industry and the like.

Drawings

FIG. 1 is a morphology diagram of the germination capacity of the dendrobium candidum seedlings of the glue film fungus strain TP-8 and the control strain.

Preservation information of biological materials

The strain TP-8 (Tulasnellalsp.) was deposited at China Center for Type Culture Collection (CCTCC) at 10 and 15 of 2021, the deposit address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: CCTCCNO M20211283, strain number is TP-8.

Detailed Description

The invention provides a glue film fungus strain TP-8 with the capability of improving the tillering capability of dendrobium candidum seedlings, and the preservation number is CCTCCNO: M20211283.

In the invention, the glue film bacterial strain TP-8 is obtained by separating seedling mycorrhiza which is obtained by induction of dendrobium candidum seedlings in a transitional manner and forms a symbiotic relationship. The morphological characteristics of the strain TP-8 are as follows: culturing on PDA plate for 10 days to form thin aerial hypha, regularly and circularly growing, and forming three concentric circles with obvious layering. Hyphae of the jelly fungus strain TP-8 are characterized as follows: the microscopic morphological characteristics of the strain are observed by using a cover glass inserting sheet culture method, the strain is subjected to dark culture in an incubator for 10 days at the temperature of 25+/-2 ℃, the strain is observed under an optical microscope, the thickness of hypha is 2.99-4.62 mu m, branches are near right angles, new hypha grows on old hypha, the new hypha has more obvious diaphragms, the number of the diaphragms is more, the cell walls of the old hypha have thickening phenomenon, and the compartment is longer. The ITS sequence of the strain TP-8 of the glue film fungus is preferably shown as SEQ ID NO. 1. The molecular identification result of the glue film fungus strain TP-8 is as follows: according to the ITS fragment comparison result, the nrDNAITS sequence of the coliform strain TP-8 is found to be most similar to the fungus Tulasnellalsp (accession number KX 587486.1), and the maximum similarity reaches 98%. Comprehensive morphological and molecular identification results show that Tulasnella sp.TP-8 belongs to a strain of fungus of genus Tulasnella.

In the method for expanding and culturing the strain TP-8 of the glue film fungus, the strain TP-8 is preferably inoculated on a PDA culture medium and cultured in the dark until fungus mycelia grow on a culture dish. The temperature of the dark culture is preferably 23 to 27℃and more preferably 25 ℃.

The invention provides a bacterial fertilizer for improving the tillering capability of dendrobium seedlings, which preferably comprises a glue film bacterial strain TP-8 and acceptable nutritional ingredients.

In the invention, the bacterial manure comprises a glue film bacterial strain TP-8. According to the preparation method of the bacterial fertilizer, the glue film bacterial strain TP-8 is preferably inoculated to a culture medium formed by nutrient components, and is cultured, and when hyphae uniformly grow in the culture medium, the bacterial fertilizer is obtained by uniformly mixing. The nutritional ingredients comprise wheat bran, rice bran, 10% glucose solution and the like. The volume ratio of the wheat bran to the rice bran to the glucose solution with the mass concentration of 10% is 2:3:3. 10 pieces of 0.5cm were added per 500ml of medium ³ Size-sized pieces of bacteria. The temperature of the culture is preferably 23 to 27℃and more preferably 25 ℃. The culture is preferably a dark culture. The time of the culture is preferably 14 to 16 days, more preferably 15 days, until the auxiliary material has a large amount of hypha attached.

The nutrient components are not particularly limited, and those known in the art, such as macroelements, weight elements, trace elements, components for promoting formation of soil aggregates, reducing soil hardening, and the like, may be used.

In the invention, the preparation method of the bacterial fertilizer preferably comprises the following steps: and (3) mixing the glue film fungus strain TP-8 with acceptable nutrition components after activation.

In the present invention, the symbiotic medium preferably includes oat agar medium. The oat agar medium preferably comprises 4 g.L ^-1 Oat and 10 g.L ^-1 Agar, pH of the culture medium is 5.6-5.8.

In the invention, the inoculation amount of the glue film fungus strain TP-8 is preferably 0.4-0.6 cm after each 120ml oat culture medium is inoculated ³ The strain TP-8 is inoculated with 0.5cm of oat culture medium per 120ml ³ The strain TP-8 is a fungus block. The strain TP-8 is obtained by the method for enlarging and culturing.

In the present invention, the temperature of the culture is preferably 23 to 27℃and more preferably 25 ℃. The photoperiod of the culture is preferably 12L/12D. The light intensity is preferably 2000 to 3000Lx, more preferably 2500Lx.

The method provided by the invention is used for dendrobium plants, and in the embodiment of the invention, the dendrobium candidum is taken as an example to specifically illustrate that the glue film fungus strain TP-8 improves the tillering capability of dendrobium seedlings, but the method is not to be construed as limiting the invention.

The following describes in detail the strain TP-8 and its application, which are provided by the invention, with the capability of improving the tillering capability of dendrobium candidum seedlings by combining with examples, but they are not to be construed as limiting the scope of the invention.

Example 1

Isolation, purification, preservation and identification of a Tulasnella sp.TP-8 strain

1-in-situ induction of dendrobium candidum seedling mycorrhiza

(1) From 7 months to 9 months in 2018, the team investigated local gatherers in the field, and finally confirmed that Yunnan Guangnan (23°58'N,105°11' E;1428 malt.) and Hunan mountain karst landform (26°30'N,111°10' E;340 malt.) and Danxia landform (26°20'N,110°46' E;455 matt.), chongqing Rofield (30°31'N,108°33' E;1200 matt.), sichuan ludine (29°23'N,102°21' E;1382 matt.) and asbestos (29°22'N,105°11' E;3596 matt.) were the dendrobium candidum origin because historically the gatherers collected wild dendrobium candidum. Six primordial matrixes are collected and brought back to a laboratory, the matrixes brought back from the field are mixed with sterile mixed matrixes (bark, peat soil and volcanic rocks are mixed according to the proportion of 2:1:1) in equal volume, and then the mixture is irrigated to saturation by sterile water and then split-packed into plastic flowerpots (radius 5cm and height 10 cm) for standby.

(2) Selecting sterile dendrobium candidum seedlings with good growth vigor, transplanting the five seedlings into a plastic flowerpot filled with an induction matrix, carrying out illumination culture (the photoperiod is 12/12 hL/D) at the room temperature of 25+/-2 ℃, keeping the humidity of the matrix in the flowerpot, collecting root tissues of the seedlings every 15 days, and checking whether the root tissues have fungus colonization under a microscope.

(3) After 60 days of transplanting, mycelium clusters are found on seedling root tissues, and seedling root samples are collected and used for subsequent fungus separation experiments.

Isolation, purification, preservation and identification of TP-8 Strain

(1) Obtaining root samples: seedling mycorrhiza for forming symbiotic relation obtained by in-situ induction of dendrobium candidum seedlings

(2) Inducing, separating, purifying and preserving the root-like endophytic fungi: root samples for fungal isolation were rinsed clean under tap water. Placing the root sample on an ultra-clean workbench, sterilizing for 30s by 75% alcohol, then transferring the root sample into a sterile flat plate containing 2% sodium hypochlorite (NaClO) solution, slightly stirring and sterilizing for 3min, taking out by using sterile tip forceps, and flushing for 3-4 times by using sterile water. The root samples were cut into about 0.1mm root pieces using a sterile scalpel and placed in PDA medium in a 25℃incubator for dark culture. After fungus hypha grows around the root segment, continuously cutting the tip of the hypha to a new PDA culture medium for serial transfer, and obtaining pure bacterial colony after 3-5 times of transfer, thus obtaining 27 symbiotic fungi.

(3) Fungus preservation: the purified fungi were preserved using a conventional tube-slope method. The prepared appropriate amount of PDA medium was poured into a glass test tube of 18X 20mm in size, and the amount of medium poured was about 1/3 of the volume of the test tube. After the silica gel plug, the silica gel plug is put into an autoclave for sterilization (121 ℃ C., 20 min). Placing the test tube into an ultra-clean workbench to form an inclined plane for standby after sterilization. On an ultra-clean workbench, picking the edge hyphae of the purified strain by using a sterile inoculating needle, inoculating the edge hyphae on a PDA inclined plane, and marking strains, numbers and dates. The inoculated test tube is placed in a climatic chamber for dark culture at 25+/-2 ℃. When hyphae grow on the inclined surface of the PDA, the test tube is taken out and stored in a refrigerator at 4 ℃.

(4) Authentication

A. The strain TP-8 of the genus Tachytrium has the following microbiological characteristics:

(1) morphological features

The strain is cultured on PDA plate for 10 days, and the colony is white blanket to form thin aerial hypha, and the colony grows regularly and circularly, has rough surface and is dried to form three concentric circles with obvious layering.

(2) Hypha growth characteristics

The microscopic morphological characteristics of the strain are observed by using a cover glass inserting sheet culture method, the strain is subjected to dark culture in an incubator for 10 days at the temperature of 25+/-2 ℃, the strain is observed under an optical microscope, the thickness of hypha is 2.99-4.62 mu m, branches are near right angles, new hypha grows on old hypha, the new hypha has more obvious diaphragms, the number of the diaphragms is more, the cell walls of the old hypha have thickening phenomenon, and the compartment is longer.

B. Molecular characterization

The extraction of the total DNA of fungi involved in molecular biological identification adopts a CTAB method; the primers used for PCR amplification are fungus universal primers ITS1 and ITS4; the PCR reaction system and conditions are carried out by referring to corresponding product specifications; sequencing the amplified product by Shanghai biological engineering Co., ltd; the sequencing sequences were analyzed by comparison in the national center for biotechnology information database, and their taxonomic status was confirmed by combining morphological features, as follows. Extraction of fungi by CTAB methodThe primers used for PCR amplification of DNA are ITS1 (TCCGTAGGTGAACCTGCGG, SEQ ID NO: 2) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 3); the PCR reaction system (25. Mu.l) included: 2.5. Mu.l 10 XPCR buffer, 0.4. Mu.l dNTPs, 1.5. Mu.l Mg ²⁺ 1.5. Mu.l ITS1, 1.5. Mu.l ITS4, 0.2. Mu.l Taq enzyme, 15.4. Mu.l ddH ₂ O, 2. Mu.l DNA template; the amplification reaction was performed on a PCR instrument Perkin Elmer, with the following PCR cycles: pre-denaturation at 94 ℃ for 3min, and circulation for 1 time; denaturation at 94℃for 1min, annealing at 51℃for 1min, extension at 72℃for 1min,30 cycles; finally, the mixture is extended for 10min at 72 ℃; sequencing PCR amplified products of Shanghai Bioengineering Co., ltd; the sequenced sequences are submitted to the national center for biotechnology information database for comparison, and the classification status is primarily confirmed.

The identification result of the strain TP-8 shows that the strain TP-8 is most similar to a fungus Tulasnella sp (accession number KX 587486.1), and the maximum similarity reaches 98%.

The fungus strain TP-8 of interest was identified as Tulasnella sp according to morphological features and molecular biological means. The separated strain TP-8 is preserved in a mycorrhizal fungi library of orchid in a key laboratory of plant propagation adaptation and evolution ecology in Yunnan university in 12 months 5 days of 2018, and the strain is classified and named as a strain TP-8 of Tulasnella sp; and has been deposited at the China center for type culture Collection, with a deposit address: the preservation number of the Wuhan university of Wuhan in Wuchang district of Hubei province is: cctccc No. M20211283.

Comparative example 1

Different screening strains (TP-2, TP-3, TP-5, TP-6, TP-9, TP-10, TP-12, TP-13, TP-14, TP-15, TP-19, TP-25) were isolated and purified according to the method of example 1, and the classification status of the screening strains was identified by the identification method disclosed in comparative document 1.

The results show that the identification results of the strain TP-2 (SEQ ID NO: 4), the strain TP-3 (SEQ ID NO: 5), the strain TP-5 (SEQ ID NO: 6) and the strain TP-6 (SEQ ID NO: 7) are the glue film bacteria. Strains TP-10 (SEQ ID NO: 8), TP-12 (SEQ ID NO: 9), TP-13 (SEQ ID NO: 10) were identified as Rhizobium (Epulothiasp.). Strain TP-14 (SEQ ID NO: 11) was identified as being Bacillus cereus (Sebacina sp.). Strain TP-15 (SEQ ID NO: 12) was identified as Sebaciules sp. Strain TP-19 (SEQ ID NO: 13) was identified as stropharia rugosa (Clitopius sp.). Strain TP-25 (SEQ ID NO: 14) was identified as Muscor sp.

Example 2

Effectiveness experiment of improving tillering capability of dendrobium candidum seedlings by using glue film fungus strain TP-8 strain

Verifying whether the fungus can improve the tillering capacity of seedlings by utilizing a symbiotic experiment of the sterile dendrobium candidum seedlings and the fungus in a culture medium, and comparing the tillering quantity of seedlings treated by different fungi:

(1) Preparing symbiotic culture medium: the symbiotic germination medium is oat agar medium comprising 4g.L ^-1 Oat and 10 g.L ^-1 Agar, the pH of the culture medium is 5.6-5.8;

(2) Taking out 15 strains of mycorrhizal fungi and the plastic film fungus (Tulasnella sp.) TP-8 for verifying the growth promoting function, inoculating the mycorrhizal fungi and the plastic film fungus onto a PDA culture medium, placing the PDA culture medium into a climatic chamber, and culturing and activating the mycorrhizal fungi in the dark at the temperature of 25+/-2 ℃ until fungus mycelia grow on a culture dish to obtain a symbiotic strain material;

(3) Transplanting the sterile dendrobium candidum seedlings with approximately consistent growth vigor (4-5 leaves, 0 sprouts, 2 roots, 1.7-2.5 cm plant height, 1.2-1.5 mm stem thickness) into a tissue culture bottle filled with an oat agar culture medium, and treating 230 seedlings in each group, wherein 46 seedlings are repeated;

(4) Inoculating the symbiotic strain into a tissue culture bottle planted with sterile seedlings, then placing the bottle in a tissue culture room, and culturing at constant temperature at 25+/-2 ℃ with illumination period L/D=12/12 and illumination intensity of 2500Lx;

(5) Improving effect and data statistical analysis of fungus on tillering capability of dendrobium candidum seedlings: counting two periods (30 days and 90 days of symbiosis), and counting the number of sprouts of the seedlings each time, wherein the counting method of the sprouts is to count the newly sprouted buds, and calculating the average sprout number (T) according to a formula I;

t=mean (Tt) ±se formula I

Where Tt is the number of tillers in seedlings at each stage and SE is the standard deviation.

The effect of different fungal inoculation treatments on tillering number was compared using Generalized Linear Models (GLMs), and the mean of each treatment was compared with minimum significant differences (LSD), P <0.05.

When symbiotic culture is carried out for 90 days, the influence of different fungus inoculation treatments on the tiller number is compared by using a Generalized Linear Model (GLMs), and average values of the treatments are compared by using a Least Significant Difference (LSD), wherein P is less than 0.05; any fungus inoculation treatment has different degrees of promotion effects on the tillering capacity of dendrobium candidum seedlings (see table 1).

TABLE 1 influence of different fungi on tillers of Dendrobium officinale seedlings (30 days, 90 days statistics)

Note that: lowercase letters indicate significance between different fungal treatments.

As can be seen from Table 1, after 30 days of symbiotic culture of dendrobium candidum seedlings and the symbiotic fungi, PDA controls treated by different fungi including non-inoculation treatment have newly increased tillers, but the tillers capability of other groups of fungi treated by other groups of fungi except TP-8 strain treatment is not significantly different from that of the PDA controls treated by non-inoculation treatment, and the average tillers number of experimental groups inoculated with TP-8 strain treatment is as high as 0.703+/-0.108. When the symbiotic culture is used for 90-day cut-off experiments, although the average tillering number of all fungus treatment groups is improved compared with that of the fungus treatment groups in 30 days, the average tillering number is consistent with the 30-day statistical analysis result, the tillering capacity of dendrobium candidum seedlings is obviously improved except TP-8, and other fungus treatment groups are higher than that of a PDA control group, but the improvement effect is not obvious. Therefore, tulasnella sp.TP-8 fungus can obviously improve the tillering capability of dendrobium candidum seedlings.

Comparative example 2

In order to explore the effect of the glue film fungus strain TP-8 on other growth characteristics of dendrobium candidum seedlings, the method for measuring the stem thickness and the plant height of the dendrobium candidum seedlings treated by TP-2, TP-3, TP-5, TP-6, TP-8, TP-10 and sterile control for 90 days is as follows: plant height: when the plants are cultivated for 90 days and counted, the length of the plants is measured by utilizing a ruler; stem thickness: the diameter of the stem at 1cm of the plant height was measured by means of a vernier caliper (digital caliper, 0-150 mm). The results are shown in Table 2.

TABLE 2 influence of different fungal treatments on the stem thickness and plant height of Dendrobium officinale seedlings (90 days)

As shown in the results of Table 2, the TP-8 strain has no obvious advantages in terms of plant height and stem thickness compared with other glue film fungus strains (TP-2, TP-3, TP-5 and TP-6), and the TP-8 strain and dendrobium candidum seedlings are presumed to be symbiotic, and the tillering component of the dendrobium candidum seedlings is promoted by secretion, so that the effect of promoting the growth of the dendrobium candidum seedlings is realized.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> an adhesive film fungus strain TP-8 with the ability of improving tillering of dendrobium seedlings and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 602

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggaaggatca tagtaatcgt ctttgacgtt cgctttttcc gttgtcctcg ggacgttaat 60

gcgctctggt cgaggataaa cgacccctct gaccgaggta aaacccgtcg ctctgtgtta 120

cctcgacgag gcacacgtta aagatcgttc cgcgttgtga gtctaacacc agttgtataa 180

actttttaca accggtagcg atggatccct tggcacgtca ttcgatgaag accgttgcaa 240

attgcgataa agtgatgtga tgcgcaagtc caccacttat acgtgaatca tcgagttgtt 300

gaacgcattg caccgcgccc taaaccggct gcggtatgcc cctttgagcg tcattgtatc 360

ccttcgggag tccttttcca aaggacccga gttcagagtc ctcggtcctc ttctggatcg 420

tgttctctta gatgcgtcgc accgatcgcc tgatgggtcc tctaatgcct aagcgtggag 480

ttccttcaga gtccgagacg tgcttgaccg ggtgttgagc tcgcgtcgcc aagtctgcct 540

taaccagcag gactacaacg catgacctca ttggggtagg acaacccgct agacttaagc 600

at 602

<210> 2

<211> 19

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

<210> 4

<211> 608

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gcggaaggat catagtaatc gtctttgacg ttctatctcc atcgtcctcg ggacgttaag 60

gcgctctggt cgaggataaa ggacccctct gaccgaggct aaacggtcgc ttgcctgtgt 120

tacctctttg gaggcacacg ttaaagatcg ttccgcgttg tgagtctaac accagttgta 180

aactttctac aaccggcagc gctggatccc ttggcacgtc attcgatgaa gaccgttgca 240

aattgcgata aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt 300

tgaacgcatt gcaccgcgcc ctaatccggc tgcggtatgc ccctttgagc gtcattgtat 360

tccttcggga gtctttcctt gctgaaagac ccgagctcgg agtcctcggt cctttggatc 420

gtgttctctc agatgcgtcg cgccgatcgc ctgatgggta ctctaatgcc tgagcgtgga 480

gtccctttga gcttgagacg cgcatgaccg gccgttgggc tcgcgtcacc aagtccgcgt 540

ccttctggac gtcggtacta caacgcatga cctcattggg gtaggacaac ccgctagact 600

taagcata 608

<210> 5

<211> 611

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

ctgcggaagg atcatagtaa acgtctttga cgcacttcgt tccgtcgtcc tccggacgtt 60

aaggcgctct ggtcgaggat aaacgacccc tctgaccgag gctaacccgt cgcgcttccg 120

tgttaccgtc cgcggcacac gttaaagatc gttccgcgtt gtgagtcttg ctggttgtaa 180

taaactgttt acaaccggta gcgctggatc ccttggcacg tcattcgatg aagaccgttg 240

caaattgcga taaagtgatg tgatgcgcaa gtccaccact tatacgtgaa tcatcgagtt 300

gttgaacgca ttgcaccgcg ccctaaaccg gctgcggtat gcccctttga gcgtcattac 360

atccttcggg agtctccttt tctggagacc cgagttcgga gtcctcggtc ccttgggatc 420

gtgttctctc agatgcatcg cgccgatcgc tttgatgggt cactctaatg cctgagcgtg 480

gagtccctct gaagtcgaga cgcgtttgac cgggtggtga gcccgcgtcg gcaagtccac 540

gtccgctgcg acgtcggtac tacaaccaca tgacctcatt ggggtaggac aacccgctag 600

acttaagcat a 611

<210> 6

<211> 622

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

ttattgatat gcttaagtct agcgggttgt cctaccccaa tgaggtcatg cgttgtagta 60

ccgacgtcca gaaggacgcg gacttggtga cgcgagccca acggccggtc atgcgcgtct 120

caagctcaaa gggactccac gctcaggcat tagagtaccc atcaggcgat cggcgcgacg 180

catctgagag aacacgatcc aaaggaccga ggactccgag ctcgggtctt tcagcaagga 240

aagactcccg aaggaataca atgacgctca aaggggcata ccgcagccgg attagggcgc 300

ggtgcaatgc gttcaacaac tcgatgattc acgtataagt ggtggacttg cgcatcacat 360

cactttatcg caatttgcaa cggtcttcat cgaatgacgt gccaagggat ccagcgctgc 420

cggttgtaga aagtttacaa ctggtgttag actcacaacg cggaacgatc tttaacgtgt 480

gcctccaaag aggtaacaca ggcaagcgac cgtttagcct cggtcagagg ggtcctttat 540

cctcgaccag agcgccttaa cgtcccgagg acgatggaga tagaacgtca aagacgatta 600

ctatgatcct tccgcaggtt ca 622

<210> 7

<211> 609

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

aaaaaactgg ggtgtctccc caatgaggtc atgcgttgta gtaccgacgt cccagaggaa 60

cgcggacttg gcgacacgag ctcaacgctc ggtcaagcgc atctccactc cgagggactc 120

cacgctcagg cattagagtg acccatcaga caatcagcgc gacgcatcta agagaacacg 180

gtccacagac cgaggactcc gaactcgggt ctaagaaaga ctcccgaagg gatacaatga 240

cgctcaaagg ggcataccgc agccggatta gggcgcggtg caatgcgttc aacaactcga 300

tgattcacgt ataagtggtg gacttgcgca tcacatcact ttatcgcaat ttgcaacggt 360

cttcatcgaa tgacgtgcca agggatccag cgctaccggt tgtaattgtt tttacaactg 420

gtgttagact cacaacgcgg aacgatcttt aacgtgtgcc tcggcaaaga ggtaacacca 480

ggacggattc acctctgtca gaggggtcgt ttatcctcga ccagagcacc ttaacgtccc 540

gaggacgatg gaaacagcac gtcaaagacg attacttatg atccttccgc aggtaccctt 600

acggaaagc 609

<210> 8

<211> 613

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

gcttaagtct agcgggttgt cctaccccaa tgaggtcatg cgttgtagta ccgacgtcca 60

ggaggacgcg gacttggtga cgcgagccca acggccggtc aagcgcgtct caagctcaga 120

gggactccac gctcaggcat tagagtaccc atcaggcgat cggcgcgacg catctgagag 180

aacacgatcc aaaggaccga ggactccgag ctcgggtctt tcagcaagga aagactcccg 240

aaggaataca atgacgctca aaggggcata ccgcagccgg tttagggcgc ggtgcaatgc 300

gttcaacaac tcgatgattc acgtataagt ggtggacttg cgcatcacat cactttatcg 360

caatttgcaa cggtcttcat cgaatgacgt gccaagggat ccagcgctgc cggttgtaaa 420

gtttacaact ggtgttagac tcacaacgcg gaacgatctt taacgtgtgc ctccgaggag 480

gtaacacaga ctggcgaccg tttaacctcg gtcagagggg tcgtttatcc tcgaccagag 540

cgccttaacg tcccgaggac gatggagata gaacgtcaaa gacgattact atgatccttc 600

cgcaggttca cct 613

<210> 9

<211> 619

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tccgcttatt gatatgctta agtctagcgg gttgtcctac cccaatgagg tcatgcgttg 60

tagtaccgac gtccagaagg acgcggactt ggtgacgcga gcccaacggc cggtcaagcg 120

cgtctcaagc tcaaagggac tccacgctca ggcattagag tacccatcag gcgatcggcg 180

cgacgcatct gagagaacac gatccagagg accgaggact ccgaactcgg gtctttcagc 240

aaggaaagac tcccgaagga atacaatgac gctcaaaggg gcataccgca gccggattag 300

ggcgcggtgc aatgcgttca acaactcgat gattcacgta taagtggtgg acttgcgcat 360

cacatcactt tatcgcaatt tgcaacggtc ttcatcgaat gacgtgccaa gggatccagc 420

gctgccggtt gtagaaagtt tacaactggt gttagactca caacgcggaa cgatctttaa 480

cgtgtgcctc cagagaggta acacaggcaa gcgaccgttt aacctcggtc agaggggtcg 540

tttatcctcg accagagcgc cttaacgtcc cgaggacgat ggagatagaa cgtcaaagac 600

gattactatg atccttccg 619

<210> 10

<211> 610

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ggctgggtaa gtctttgagt tcgctttttc cgttgtcctc gggacgttaa tgcgctctgg 60

tcgaggataa acgacccctc tgaccgaggt aaaacccgtc gctctgtgtt acctcgacga 120

ggcacacgtt aaagatcgtt ccgcgttgtg agtctaacac cagttgtata aactttttac 180

aaccggtagc gatggatccc ttggcacgtc attcgatgaa aaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaaaccggc tgcggtatgc ccctttgagc gtcattgtat cccttcggga 360

gtccttttcc aaaggacccg agttcagagt cctcggtcct cttctggatc gtgttctctt 420

agatgcgtcg caccgatcgc ctgatgggtc ctctaatgcc taagcgtgga gttccttcag 480

agtccgaaac gtgcttgacc gggtgttgag ctcgcgtcgc caagtctgcc ttaaccaaca 540

ggactacaac acatgacctc attggggtag gacaacccgc tagacttaag catatcaata 600

agcggaggaa 610

<210> 11

<211> 888

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

ctttttgatc aattcggtct tctgtgctgg tggcaacaca tgtgcacgtc gatcgtaatt 60

ccatcctcct cccaaccgtc catgtgtgtg tttggtcgac ctcggtcgaa gagttgtggc 120

ccttggcctc gattcgttcc agatgcacct tggttatttc acccactctg ggtactagaa 180

acaaagaaca ttttatataa actatacaac tttcaacaac ggatctcttg gctctcgcat 240

cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca gtgaatcatc 300

gaatctttga acgcaccttg caccctttgg tattccgaag ggtacgcccg tttgagtgtc 360

attgtaatct caatcccacg actttatgtt gtgtgattgg acttggatcc tgtcgctttt 420

gtgactgatc cgaaatgcat cagcgtgtgt ccgtcgtgac gataaaccga ttgttaaact 480

tcatcgggct cgctctgtcg aggttgtctg gcgaaagcac atgctaaacc cccctacatt 540

ttgacaattt gacctcaaat cgggtgggat cacccgctga acttaagcat atcaaacggg 600

ggggagaaag aaaattttat tgtacaattc cggtagaaca gtgctaggtg gcaacacatg 660

gtgcacgtcg atccgtaatt tccatcctcc tccaaggttc atggtgtgtg gtttggtcga 720

cctcggtcga aagagttgtg ggccctttgg cctcatttct ttcacatgcg cttaggttat 780

ttcaccctct ggggactaaa aacaaaaaaa atgttatata aactatacaa ctttcaacac 840

cggatctcct tggctcgctc gatgaagaag acaccaaatg ctcataag 888

<210> 12

<211> 618

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

tatgcttaag ttcagcgggt agtcccaccc gatttgaggt caaattgtca aacttgtcac 60

aaagacggtt cgcagcgcag agcccacttt gcttacgtgt ccataaggaa ctttgatcag 120

tgaagatgtt tatcacactg aagacgctgc aacagcaggg tacactcatg catttaaggc 180

cagtcgtmat tacacgacat tgcccaagtc cacttcytay racaaaagtc gtagaggtga 240

gattacaatg acactcaaac gggcgtaccc ttcggaatac caaagggtgc aaggtgcgtt 300

caaagattcg atgattcact gaattctgca attcacatta cttatcgcat ttcgctgcgt 360

tcttcatcgg tgcgagagcc aagagatccg ttgttgaaag ttgtatttat atgcgttatg 420

caaagacatt ccattacatt cagagtgtgt aaaaatacca tgagacccca gtcaaacacg 480

acgttcaacc agctgctcgt cagagacaag cggacctcac agtcaaaggt gcacaggtgt 540

gtggatttgc aatcgacgtg cacatgtgtt tccaccagca cagacgaccg cttatgattc 600

attaatgatc cttccgca 618

<210> 13

<211> 646

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

gcggaaggat cattaatgaa taaacttggt caagctgttg ctggtccttc ggggcatgtg 60

cacgcttgcc accaatttta accacctgtg caccttttgt agactgaaaa caaattctcg 120

aggaaactcg gattgagaac tgctgtgcgc aagccagctc ttcttgtgtt tctcagtcta 180

tgtctttaca taccccaaat gaatgtataa gaatgtattg ctaggccttt gtgcctttaa 240

atcaaataca actttcaaca acggatctct tggctctcgc atcgatgaag aacgcagcga 300

aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt gaacgcacct 360

tgcgctcctt ggtattccga ggagcatgcc tgtttgagtg tcattaaatt ctcaaccata 420

caagtttttg ttgatttgta tggattggat catgggattt gcgggctttc acaagtcggc 480

tatcctcaaa tgcattagca gagcttttgc cgctaactat tagtgtgata attatcaacg 540

ctattattga gtggcatgaa tggagcttcg cttctaatcg tcttcacaga caactttgac 600

aatctgacct caaatcaggt aggactaccc gctgaactta agcata 646

<210> 14

<211> 592

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

tatgcttaag ttcagcgggt attcctacct gatccgaggt caacctttga tatagggggt 60

tttacggcag gggccggaac cactacagag gcgagataga tttactacgc ctagagtgag 120

aaccaactcc gccaatcact ttagggagct acgggcagtg ccgtaggctc ccaacgctaa 180

gcaacagggc ttaagtggtg aaatgacgct cgaacaggca tgcccactag aatgctaatg 240

ggcgcaatgt gcgttcaaag attcgatgat tcactgaatt ctgcaattca cattacttat 300

cgcatttcgc tgcgttcttc atcgatgcca gaaccaagag atccgttgtt gaaagtttta 360

acttattaag tttataattc agaatgccat aaaaacagag tttagttagc cgccggcggg 420

gagggccacc gggtagctag tcgtagacga taagacgttg agcacgatct agcacctggg 480

actacagggt aaccactacg tggtatcccc tatagggtag cctccgccgc cgaagcaaca 540

aaggtaagtt cacatagggt tgggagttta gaaaactctg taatgatccc tc 592

Claims

1. Adhesive film fungus capable of improving tillering capacity of dendrobium candidum seedlingsTulasnellasp.) strain TP-8, characterized in that the preservation number is CCTCC NO: M20211283.

2. A bacterial fertilizer for improving the tillering capability of dendrobium candidum seedlings, which is characterized by comprising the glue film fungus strain TP-8 and acceptable nutritional ingredients.

3. Use of the glue film fungus strain TP-8 according to claim 1 or the fungus fertilizer according to claim 2 for improving the tillering capability of dendrobium candidum seedlings.

4. A method for improving the tillering capacity of dendrobium candidum seedlings is characterized in that the dendrobium candidum seedlings are transplanted to a symbiotic medium for growth, and the glue film fungus strain TP-8 according to claim 1 or the fungus fertilizer according to claim 2 is inoculated to the symbiotic medium to enable the glue film fungus to colonize the root of the dendrobium candidum seedlings, and then the dendrobium candidum seedlings are cultivated.

5. The method for improving the tillering capacity of dendrobium candidum seedlings according to claim 4, wherein the symbiotic medium comprises oat agar medium;

6. The method for improving the tillering capacity of dendrobium candidum seedlings according to claim 5, wherein the inoculation amount of the glue film fungus strain TP-8 is 0.4-0.6 cm after each 120ml of oat agar culture medium is inoculated ³ The strain TP-8 is a fungus block.

7. The method for improving tillering ability of dendrobium candidum seedlings according to claim 4, wherein the temperature of the cultivation is 23-27 ℃.

8. The method for improving tillering ability of dendrobium candidum seedlings according to claim 4, wherein the photoperiod of the cultivation is 12L/12D; the illumination intensity is 2000-3000 Lx.