AU2020103947A4 - Trichoderma viride, microbial agent, biological fertilizer and application - Google Patents

Abstract

The present disclosure belongs to the field of microbial growth promotion technology, and specifically relates to a Trichoderma viride, a microbial agent, a biological fertilizer and an application. The bio-organic fertilizer, which uses industrial wastes as raw materials, effectively solves the problem of environmental pollution by means of functional microorganisms, and has the effects of reducing crop diseases, increasing productivity, etc. The Trichoderma bio-organic fertilizer has multiple functions such as growth promotion, productivity increase, and disease prevention, and has a good development prospect. The present disclosure provides a strain of Trichoderma viride Tv-1511, which has a good effect of promoting seed germination and seedling growth. The solid ferment obtained by inoculating the strain into mushroom residue can be used as a good bio-organic fertilizer. The strain is convenient to use, has significant growth promotion and productivity increase effects, and has a good development prospect.

Description

Description

TRICHODERMA VIRIDE, MICROBIAL AGENT, BIOLOGICAL FERTILIZER AND APPLICATION

Field of the Invention

The present disclosure belongs to the field of microbial growth promotion technology,

and specifically relates to a Trichoderma viride Tv-1511 strain with a growth

promotion effect, a corresponding microbial agent and a multifunctional bio-organic

fertilizer prepared and application thereof.

Backgroundofthe Invention

The information disclosed in the background is merely intended to increase the

understanding on the general background of the present disclosure, and should not be

construed as acknowledgment or hint in any form that the information constitutes the

prior art that has been known by those skilled in the art.

As an important agricultural production material, fertilizers play a vital role in food

production. China is a big agricultural country and a big fertilizer production and

consumption country. At present, the utilization of single-season fertilizers in China is

low, only 30%-35%, and would cause serious pollution to the environment.

Bio-organic fertilizers emerged in this situation. Such fertilizers organically combine

organic fertilizers and microbial fertilizers, and are special fertilizers containing

microbial strains with definite functions. The application of bio-organic fertilizers can

not only increase the supply level of plant nutrients in soil, but also can promote the

absorption and utilization of nutrients by plants through the life activities of specific

functional microorganisms therein, reduce diseases and insect pests, and thereby

increase crop productivity and quality. In addition, bio-organic fertilizers use

industrial and agricultural wastes as raw materials, which not only realizes resource

utilization of the industrial and agricultural wastes, but also effectively solves the

problem of environmental pollution, so the bio-organic fertilizers are

environment-friendly fertilizers that are safe and non-toxic to humans, animals and

the environment. The core of bio-organic fertilizers is the microorganisms with

Description

specific functions, so the selection and use of microbial strains are the key to the

production of bio-organic fertilizers.

Trichoderma spp. is classified as a deuteromycetes moniliales fungus, which is widely

distributed in nature, and is an important part of the soil microbial community.

Common Trichoderma includes T viride, T reesei, T harzianum, T longibrachiatum,

etc. The secondary metabolites produced by Trichoderma spp. are rich in types,

diverse in biological activity and different in functions, and have wide applications in

agricultural production. The Trichoderma bio-organic fertilizer is a novel fertilizer

prepared by adding conidiophores of excellent Trichoderma strains to an organic

fertilizer with a reasonable ratio. Organic matters in the fertilizer are either the basis

of fertility, or the culture medium for Trichoderma. Trichoderma can grow and

reproduce fast by means of the organic fertilizer as a carrier, occupy a dominant niche,

and increase the number of beneficial microorganisms in the rhizosphere of plants.

Therefore, the Trichoderma bio-organic fertilizer has multiple functions such as

growth promotion, productivity increase, and disease prevention, and has good

development and application prospects.

Summary of the Invention

In view of the above research background, the inventors believe that the types of

Trichoderma spp. that are currently publicly used in the production of bio-organic

fertilizers are limited, and the further development and exploration of Trichoderma

spp. with a growth promotion effect are of great significance to the development of

the bio-fertilizer industry.

The present disclosure isolates a strain of Trichoderma viride from the rhizosphere of

tobacco. The strain has the characteristics of fast growth, large spore production,

strong adaptability and rapid and large-scale colonization, has an effect of improving

food production when applied to agricultural production, and can effectively reduce

costs and improve economic benefits when applied to the production of biological

fertilizers.

In order to achieve the above objective, the present disclosure provides the following

Description

technical solution:

The first aspect of the present disclosure provides a strain of Trichoderma viride

Tv-1511, which was collected in the China General Microbiological Culture

Collection (CGMCC, address: Institute of Microbiology, Chinese Academy of

Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing) on

December 4, 2018, with a collection number: CGMCC No. 16800.

The rDNA-ITS sequence of the Trichoderma viride Tv-1511 according to the first

aspect is shown in SEQ ID NO: 1.

The strain was isolated from tobacco soil in Weifang City, Shandong Province, and its

rDNA-ITS sequence has a length of 576 bp. Through homology comparison in the

NCBI database, it was found that the strain has the highest homology with

Trichoderma virens with an accession number JX993849.1, up to 99%. As a

phylogenetic tree was established by means of Mega6.0 software and Neighbor

Joining, it was found that Tv-1511 belongs to the same genetic branch as Trichoderma

virens, and the both have the closest genetic relationship. In combination with the

above morphological classification and molecular biology identification results, the

strain of the present disclosure was identified as a new species of Trichoderma viride,

named Trichodermaviride Tv-1511.

The morphological characteristics of the Trichoderma viride Tv-1511 are as follows:

Bacterial characteristics: conidiophores grow upright from hyphae, and branch

symmetrically or alternately to form secondary and tertiary branches, and the whole

conidiophores are like branches; the branch angle is acute or approximately right, the

end forms a phial-like petiole, the base of the phialide is constricted, the middle part is

wider, and the branch narrows above the middle part to form a long neck; the

conidiophores are colorless, mostly spherical, spined on the surface, and clustered at

the top of the petiole.

Colony characteristics: Tv-1511 grows rapidly on a potato dextrose agar (PDA)

medium, the colony is white and velvety in the early stage, and a concentric ring-like

conidiation area appears in the later stage and is green to dark green; there is a hyphae

growth zone around the colony, and hyphae are transparent, with separate branches;

Description

conidiophores grow upright from the hyphae, and branch symmetrically or alternately

to form secondary and tertiary branches, and the whole conidiophores are like

branches; the branch angle is acute or approximately right, the end forms a phial-like

petiole, the base of the phialide is constricted, the middle part is wider, and the branch

narrows above the middle part to form a long neck; the conidiophores are colorless,

mostly spherical, spined on the surface, and clustered at the top of the petiole.

Preferably, the Trichoderma viride Tv-1511 depends on a potato dextrose (PDA)

medium.

Preferably, the formula of the medium is: potato extract powder 6 g/L, glucose 20 g/L,

and pH value 5.60.2.

The second aspect of the present disclosure provides a microbial agent, which is the

Trichoderma viride Tv-1511 according to the first aspect and/or a culture of the

Trichodermaviride Tv-1511.

The third aspect of the present disclosure provides an application of the Trichoderma

viride Tv-1511 according to the first aspect or the microbial agent according to the

second aspect as a crop growth promoter.

Preferably, the crop growth promoter is used to increase the germination rate of seeds

or promote the growth of seed embryos.

Preferably, the crop growth promoter is used to promote the growth of seedlings.

Preferably, the crops include but are not limited to wheat and cucumber; further, the

wheat is Ji Mai No. 22, and the cucumber is Jin Yan No. 4.

The fourth aspect of the present disclosure provides a bio-organic fertilizer, including

a solid ferment of the Trichoderma viride Tv-1511 according to the first aspect.

Preferably, a preparation method of the solid ferment is as follows: inoculating the

Trichoderma viride Tv-1511 into a medium containing mushroom residue, and

culturing same at 20-30°C for 15-25 days to form the solid ferment of the

Trichoderma viride Tv-1511.

Further preferably, the added amount of the solid ferment is 5% of the dry weight of

the bio-organic fertilizer.

In some specific embodiments, the bio-organic fertilizer further includes an

Description

all-element organic fertilizer; more specifically, the all-element organic fertilizer is

provided by Jinxing (Rizhao) Agricultural Technology Co., Ltd., with moisture

content <30%, organic matters >45%, total nitrogen 4%, total phosphorus (P205)

4%, total potassium (K20) 2%, zinc sulfate (ZnSO4) 0.05%, free amino acid 1%.

The fifth aspect of the present disclosure provides an application of the bio-organic

fertilizer according to the fourth aspect in productivity increase of a crop.

Preferably, the crop is corn, and further, is Hua Nong No. 138.

Preferably, a method to use the bio-organic fertilizer is as follows: applying the

bio-organic fertilizer instead of 30% of chemical fertilizer.

Compared with the prior art, the beneficial effects of the present disclosure are:

1. The present disclosure provides a Trichoderma viride Tv-1511, which has a good

growth promoting effect, and can significantly increase the germination rate of seeds,

promote the growth of seed embryos, significantly promote the growth of seedlings

and increase the biomass of seedlings.

2. The conidiophores of the Trichoderma viride Tv-1511 strain can be prepared into

a novel fertilizer, this is, a Trichoderma type multifunctional bio-organic fertilizer.

The organic matters in the fertilizer are not only the basis of fertility, but also the

culture medium for Trichoderma. Therefore, the Trichoderma type multifunctional

bio-organic fertilizer provides nutrients for crops, and can exert its growth promoting

function to significantly increase the productivity of crops. The Trichoderma type

multifunctional bio-organic fertilizer can not only improve fertilizer utilization and

reduce the input of some fertilizers, but also can effectively improve the

micro-ecological environment of soil, with good economic and ecological benefits.

After the patented product is applied, it is convenient to use, has good growth

promotion and productivity increase effects, is suitable for large-scale use in planting

areas, and has a good development and application prospect.

Detailed Description of Embodiments

It should be noted that the following detailed descriptions are exemplary and are

intended to provide further descriptions of the present disclosure. All technical and

Description

scientific terms used herein have the same meaning as commonly understood by those

of ordinary skill in the technical filed to which the present application belongs, unless

otherwise indicated.

It should be noted that the terms used here are merely used for describing specific

embodiments, but are not intended to limit the exemplary embodiments of the present

invention. As used herein, the singular form is also intended to comprise the plural

form unless otherwise indicated in the context. In addition, it should be understood

that when the terms "contain" and/or "comprise" are used in the description, they are

intended to indicate the presence of features, steps, operations, devices, components

and/or combinations thereof.

As introduced in the background, the bio-organic fertilizer, which takes functional

microorganisms as the core, improves plant growth through the life activities of

specific functional microorganisms, improves the quality of crops, can also recycle

wastes, and has good economic benefits. The secondary metabolites of Trichoderma

spp. have various biological activities, and have been widely applied in agricultural

production. The present disclosure provides a Trichoderma viride Tv-1511, which

grows fast and has the characteristic of rapid colonization. The application of a

biological fertilizer prepared from a solid culture of the strain has important

significance for increasing grain productivity.

In order that those skilled in the art can understand the technical solution of the

present disclosure more clearly, the technical solution of the present disclosure will be

described in detail below in combination with specific embodiments and comparative

examples.

Embodiment 1

1.1 Isolation and purification of functional strains:

(1) Collection of sample: the sample was collected from tobacco soil in Weifang City,

Shandong Province. Surface floating soil was removed until the soil layer with plant

roots was exposed, and the soil was shoveled out together with the roots, sealed with a

plastic bag, and brought back to a laboratory.

Description

(2) Isolation of strain: the soil sample was crushed into fine powder, placed in a

sterilized triangular flask, and added with sterile water, followed by shaking to obtain

a soil suspension; the soil suspension was gradually diluted with sterile saline, 100 pL

of the soil suspension was dropped onto a PDA plate, spread uniformly by means of a

plate dilution method, and cultured in a 28°C incubator for 2-4 days; a single colony

was selected and transferred to the PDA plate to grow a new colony, and the colony

was isolated and purified by means of a single spore isolation method and saved for

later use. The formula of a PDA medium was: potato extract powder 6 g/L, glucose 20

g/L, agar 20 g/L, and pH value 5.6±0.2.

1.2 Identification of functional strain

(1) Morphological identification:

The strain grew rapidly on the PDA medium, and the colony was white, velvety,

dense and round in the early stage; in the later stage, the colony begun to produce

conidiophores, and a concentric ring-shaped sporulation area appeared and was green

to dark green; there was a hyphae growth zone around the colony, and hyphae were

transparent, with separate branches and smooth cell walls; conidiophores were short

side branches of the hyphae, grew upright from the hyphae, and branched

symmetrically or alternately to form secondary and tertiary branches, and the whole

conidiophores were like branches; the branch angle was acute or approximately right,

the end formed a phial-like petiole, the base of the phialide was constricted, the

middle part was wider, and the branch narrowed above the middle part to form a long

neck; the conidiophores were colorless, mostly spherical, spined on the surface, and

clustered at the top of the petiole.

(2) Molecular biology characteristics:

The DNA of the strain was extracted by means of a CATB method, then PCR

amplification was carried out by using universal primers ITS1/ITS2, and the amplified

fragment was sequenced. The obtained sequence was compared for homology in the

NCBI database. The result showed that the similarity between the ribosome DNA ITS

sequences of this strain and Trichoderma virens with an accession number

JX993849.1 reached 99.65%. As a phylogenetic tree was constructed by means of a

Description

Neighbor Joining method in Mega6.0 software, it was found that Tv-1511 belongs to

the same genetic branch as Trichoderma virens, and the both have the closest genetic

relationship. Combined with the results of morphological classification and molecular

biology identification, it can be determined that the strain of the present invention is a

new species of Trichodermaviride, named Trichoderma viride Tv-1511, and collected

in the China General Microbiological Culture Collection, with a collection number:

CGMCC No. 16800.

Embodiment 2: Pure culture of Trichoderma viride Tv-1511 and collection of

sterile spores

(1) Trichoderma viride Tv-1511 was inoculated into a culture flask filled with

mushroom residue, and cultured in an incubator at 26°C for 20 days;

(2) Sterile water was added to suspend spores, same was poured into a gauze-sealed

triangular flask, impurities and hyphae were removed, and a spore liquid was

collected;

(3) The spore liquid was balanced and then centrifuged at 10000 rpm and 20°C for 5

min, a supernatant was taken, and sterile water was added to re-suspend the spores,

followed by full shaking and re-centrifuging;

(4) The spore liquid was suspended with 30% glycerol, mixed thoroughly, dispensed

into 1.5 mL/2 mL centrifuge tubes, and marked by name and time;

(5) A tube of spore liquid was taken to count viable bacteria, wherein the

concentration of the spore liquid was 10.8x108 cfu/mL.

Embodiment 3: Test on effects of Trichoderma viride Tv-1511 spore liquid

promoting seed germination

3.1. Test materials

Test microorganism: Trichoderma viride Tv-1511 spore liquid (prepared in

Embodiment 2);

Test plants: wheat (Ji Mai No. 22) and cucumber (Jin Yan No. 4).

3.2. Experimental design

The germination test was carried out in the Industrial Microbiology Laboratory of the

Description

Institute of Biology, Shandong Academy of Sciences. Healthy and plump seeds were

picked, disinfected with 75% alcohol for 30 s, then disinfected on surfaces with 2%

NaClO for 3 minutes, rinsed with sterile water for 4-5 times, and air-dried in an

ultra-clean workbench until the surfaces of the seeds were dry. Culture vessels with a

diameter of 13 cm were used and spread with 3 layers of sterile filter paper, and 20

seeds and 10 mL of corresponding germination solution were put into each vessel.

Sterile water was the germination solution for a control group (CK), the Trichoderma

spore liquid (final concentration of 105 cfu/mL) was added for a treatment group (T),

with 4 replicates for each treatment. The germination rate of seeds and the number of

lateral roots were counted, and the indicators such as radicle length and germ length

were measured.

3.3 Experimental results

The effects of Trichodermaviride Tv-151 on seed germination were shown in Table 1

(wheat) and Table 2 (cucumber). After treatment with the Trichoderma viride Tv-151,

the related indicators of germination rate and embryo growth of wheat and cucumber

seeds reached significant difference levels (P<0.05). Compared with the control group,

the radicle length, germ length, number of lateral roots and germination rate of wheat

in the treatment group increased by 23.86%, 22.29%, 20.00%, and 16.67%,

respectively; and the same indicators of cucumber increased by 23.71%, 21.90%,

20.47%, and 11.83%, respectively. The above results showed that the Trichoderma

viride Tv-151 can significantly increase the germination rate of seeds and promote the

growth of seed embryos.

Table 1 Effects of Trichoderma viride Tv-1511 on germination of wheat seeds

Radicle length Germ length Number of Germination

(cm) (cm) lateral roots rate

(pCs) (%) CK 7.00 0.28 b 4.62 0.42 b 4.0 0.63 b 60.0 0.55 b T 8.67 0.74 a 5.65 0.46 a 4.8 0.41 a 70.0 1.05 a

Table 2 Effects of Trichodermaviride Tv-1511 on germination of cucumber seeds

Description

Radicle length Germ length Number of Germination

(cm) (cm) lateral roots rate

(pcs) (%) CK 3.29 0.30 b 2.42 0.21 b 12.7 0.63 b 82.0 2.40 b T 4.07 0.25 a 2.95 0.33 a 15.3 1.21 a 91.7 1.05 a

Embodiment 4: Test on effects of Trichoderma viride Tv-1511 spore liquid

promoting seedling growth

4.1. Test materials

Test microorganism: Trichoderma viride Tv-1511 spore liquid (prepared in

Embodiment 2);

Test plants: wheat (Ji Mai No. 22) and cucumber (Jin Yan No. 4).

4.2. Experimental design

This embodiment was carried out in the Industrial Microbiology Laboratory of the

Institute of Biology, Shandong Academy of Sciences. Plump and uniform seeds were

picked, disinfected, and germinated in dark in a 25°C incubator till germs emerged.

Then after cultured for 16 h in light and 8 h in dark, seedlings with uniform growth

were picked and transplanted to a hydroponic device for treatment. 1/2 Hoagland

nutrient solution was the hydroponic solution for a control group (CK), and the

Trichoderma spore liquid (final concentration of 10' cfu/mL) was added for a

treatment group (T), with 4 replicates for each treatment. After 7 days, the indicators

such as main root length, plant height, leaf width, leaf length, fresh weight and dry

weight were measured.

4.3 Experimental results

The effects of Trichoderma viride Tv-151 on seedling growth were shown in Table 3

(wheat) and Table 4 (cucumber). After treatment with the Trichoderma viride Tv-151,

the growth indicators (main root length, plant height, leaf width, leaf length) and

biomass (dry weight, fresh weight) of wheat and cucumber reached significant

difference levels (P<0.05). Compared with the control group, the main root length,

plant height, leaf width, and leaf length of wheat in the treatment group increased by

Description

26.92%, 24.79%, 26.42%, 25.69%, 46.15%, and 46.30%, respectively; and the same

indicators of cucumber increased by 26.32%, 28.94%, 16.41%, 14.63%, 44.44% and

48.55%, respectively. The above results showed that the Trichoderma viride Tv-151

can significantly promote the growth of seedlings and increase the biomass of

seedlings.

Table 3 Effects of Trichodermaviride Tv-1511 on growth of wheat seedlings

Root Plant Leaf width Leaf Dry Fresh

length height (mm) length weight weight

(cm) (cm) (cm) (g) (g) CK 10.40 3.55± 3.71 10.90+ 0.13 1.08 1.04 b 0.30 b 0.50 b 0.91 b 0.003 b 0.015 b T 13.20 4.43 4.69 13.70 0.19 1.58± 1.56 a 0.50 a 0.28 a 0.79 a 0.006 a 0.021 a

Table 4 Effects of Trichodermaviride Tv-1511 on growth of cucumber seedlings

Root Plant Leaf width Leaf Dry Fresh

length height (mm) length weight weight

(cm) (cm) (cm) (g) (g) CK 24.13 2.35+ 5.18 4.58± 0.27 3.44 2.05 b 0.24 b 0.24 b 0.30 b 0.002 b 0.19 b T 30.48 3.03 6.03 5.25 0.39 5.11+ 3.41 a 0.53 a 0.15 a 0.13 a 0.004 a 0.11 a

Embodiment 5: Field demonstration of multifunctional bio-organic fertilizer

prepared from Trichoderma viride Tv-1511

5.1. Test materials

Test microorganism: Trichoderma viride Tv-1511.

Test crop: corn (Hua Nong 138), purchased from Beijing Huanong Weiye Seed

Technology Co., Ltd.

Test all-element organic fertilizer: provided by Jinxing (Rizhao) Agricultural

Technology Co., Ltd., water content <30%, organic matter >45%, total nitrogen 4%,

Description

total nitrogen 4%, total phosphorus (P205) 4%, total potassium (K20) 2%, zinc sulfate

(ZnSO4) 0.05%, and free amino acid 1%.

Test multifunctional bio-organic fertilizer: provided by Jinxing (Rizhao) Agricultural

Technology Co., Ltd., water content <30%, organic matter ;>45%, total nitrogen 4%,

total phosphorus (P205) 4%, total potassium (K20) 2%, zinc sulfate (ZnSO4) 0.05%,

free amino acid 1%, and prepared by adding a Trichoderma solid ferment in an

amount which was 5% of the dry weight of the organic fertilizer.

5.2. Experimental design

The field demonstration experiment was carried out in Jinxing Farmland in Lanshan

District, Rizhao City, Shandong Province. The basic properties of soil were as follows:

organic matter 21.4 g-kg- 1, total nitrogen 2.2 g-kg- 1, ammonium nitrogen 19.5 mg-kg- 1

, nitrate nitrogen 39.2 mg-kg-1, rapidly available phosphorus 39.6 mg-kg- , and rapidly

available potassium 65.0 mg-kg- 1. The conventional fertilization of farmers was a

control group (CK); the application of the multifunctional bio-organic fertilizer

instead of 15% of chemical fertilizer was treatment 1 (Ti); the application of the

multifunctional bio-organic fertilizer instead of 30% of chemical fertilizer was

treatment 2 (T2); and the application of the multifunctional bio-organic fertilizer

instead of 100% of chemical fertilizer was treatment 3 (T3). There were 3 replicates

for each treatment, the plot was 33.3 m long, 20 m wide, and 666 m 2 in area. All the

treatments realized uniform fertilization according to the nutrients required by the

local fertilization mode (N: P: K=12 kg: 6 kg: 4 kg, topdressing N 24 kg) and routine

management, and the corn was harvested after mature, weighed and calculated.

5.3 Experimental results

The effects of the multifunctional bio-organic fertilizer prepared from the

Trichoderma viride Tv-151 on corn productivity were shown in Table 5. Compared

with CK (conventional fertilization), the effects of applying the multifunctional

bio-organic fertilizer on the 100-kernel weight and productivity of corn reached

significant difference levels (P<0.05). The 100-kernel weights of corn treated by TI

(multifunctional microbial fertilizer instead of 15% of chemical fertilizer), T2

(multifunctional microbial fertilizer instead of 30% of chemical fertilizer) and T3

Description

(multifunctional microbial fertilizer instead of 100% of chemical fertilizer) were 1.05,

1.07 and 1.05 times that of CK, respectively; and the productivitys increased by

14.69%, 19.26% and 10.48%, respectively. The above results showed that the

multifunctional bio-organic fertilizer prepared from the Trichoderma viride Tv-151

can significantly increase the productivity of plants, and the productivity increase

effect of the multifunctional microbial fertilizer instead of 30% of chemical fertilizer

was the most significant. Table 5 Effects of Trichoderma multifunctional bio-organic fertilizer on 100-kernel weight and productivity of corn

100-kernel weight Productivity

(g) (kg/mu)

CK 34.04 0.43 b 561.55 18.76 c

TI 35.81 1.37 ab 644.04 41.91 ab

T2 36.57 0.41 a 669.73 35.02 a

T3 35.70 0.66 ab 620.38 14.98 ab

Described above are merely preferred embodiments of the present application, and the

present application is not limited thereto. Various modifications and variations may be

made to the present application for those skilled in the art. Any modification,

equivalent substitution, improvement or the like made within the spirit and principle

of the present application shall fall into the protection scope of the present application.

SEQUENCELISTING 08 Dec 2020

<110>BIOLOGYINSTITUTEOFSHANDONGACADEMYOFSCIENCES;GOLDENSTAR(RIZHAO) AGRICULTURALSCIENCEANDTECHNOLOGYDEVELOPMENTCO.,LTD.

<120>TRICHODERMAVIRIDE,MICROBIALAGENT,BIOLOGICALFERTILIZERAND APPLICATION

<130>2010 2020103947

<160>1

<170>PatentInversion3.3

<210>1 <211>576 <212>DNA <213>TrichodermavirideTvŞ1511rDNAŞITS

<400>1 ggggatcggaggtcactcccaacccaatgtgaacgttaccaaactgttgcctcggcggga60

tctctgccccgggtgcgtcgcagccccggaccaaggcgcccgccggaggaccaaccaaaa120

ctcttattgtataccccctcgcgggttttttactatctgagccatctcggcgcccctcgt180

gggcgtttcgaaaatgaatcaaaactttcaacaacggatctcttggttctggcatcgatg240

aagaacgcagcgaaatgcgataagtaatgtgaattgcagaattcagtgaatcatcgaatc300

tttgaacgcacattgcgcccgccagtattctggcgggcatgcctgtccgagcgtcatttc360

aaccctcgaacccctccggggggtcggcgttggggatcggccctttacggggccggcccc420

gaaatacagtggcggtctcgccgcagcctctcctgcgcagtagtttgcacactcgcatcg480

ggagcgcggcgcgtccacagccgttaaacaccccaaacttctgaaatgttgacctcggat540

caggtaggaatacccgctgaacttaagcatatcaaa576

1/1

Claims (4)

Claims

1. Use of a Trichoderma viride Tv-1511 strain obtainable from a deposit made at the

China General Microbiological Culture Collection (CGMCC, address: Institute of

Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road,

Chaoyang District, Beijing) with a collection number: CGMCC No. 16800, or a

microbial agent comprising the Trichoderma viride Tv-1511 and/or a culture of the

Trichoderma viride Tv-1511 as a crop growth promoter; preferably, the crop growth

promoter is used to increase the germination rate of seeds or promote the growth of

seed embryos; or the crop growth promoter is used to promote the growth of

seedlings.

2. The use according to claim 1, wherein the crops comprise but are not limited to

wheat and cucumber; preferably, the wheat is Ji Mai No. 22, and the cucumber is Jin

Yan No. 4.

3. Use of a bio-organic fertilizer comprising a solid ferment of the Trichoderma

viride Tv-1511 as defined in claim 1 to increase productivity of a crop.

4. The use according to claim 3, wherein a method to use the bio-organic fertilizer

is as follows: applying the bio-organic fertilizer instead of 30% of chemical fertilizer.