CN114806887B

CN114806887B - Fungus strain for promoting germination of Jinsha Jiang Danhu and application

Info

Publication number: CN114806887B
Application number: CN202210310005.9A
Authority: CN
Inventors: 赵大克; 张雪; 王后平; 牟宗敏; 陈穗云
Original assignee: Yunnan University YNU
Current assignee: Yunnan University YNU
Priority date: 2022-03-28
Filing date: 2022-03-28
Publication date: 2023-09-05
Anticipated expiration: 2042-03-28
Also published as: CN114806887A

Abstract

The invention provides a fungus strain for promoting germination of Jinsha Jiang Danhu and application thereof, and belongs to the technical field of plant protection. The fungus strain for promoting the germination of the Jinsha Jiang Danhu is Fusarium (Fusarium sp.) strain 1-1-2, and the preservation number is CCTCCNO: m2020553. The strain 1-1-2 is separated from the gold sand Jiang Danhu protocorm. After the strain 1-1-2 is co-cultured with dendrobium candidum, compared with other fungus strains, the dendrobium candidum seed germination can be greatly promoted, so that the strain 1-1-2 can be applied to the germination of dendrobium candidum Jiang Danhu. Therefore, the invention provides favorable conditions for improving the germination rate of the dendrobium chrysanthemi seeds, increasing the population quantity and further developing the original environment protection work.

Description

Fungus strain for promoting germination of Jinsha Jiang Danhu and application

Technical Field

The invention belongs to the technical field of plant protection, and particularly relates to a fungus strain for promoting germination of Jinsha Jiang Danhu and application thereof.

Background

Dendrobium nobile (Dendrobium wangliangii) is a typical representative of a very small population of plants in the dry-hot valley of Jinshajiang, is a window plant for understanding the formation and evolution of orchid in the species of the dry-hot valley, and has important potential value in medicinal and ornamental aspects. Due to superposition of factors such as narrow distribution area, abnormal climate, artificial collection and the like, the dendrobium nobile is in an endangered and extinct place at present, and needs to be protected.

The number of population individuals is increased by improving the germination rate of seeds, so that the method is an important measure for developing the protection of the protozoon. Mature orchid seeds are extremely tiny and have no nutrient-storing endosperm tissue, and are required to be nourished by mycelium rings (Pelotons) formed with orchid mycorrhizal fungi (Orchid mycorrhiza fungi, OMF) so as to germinate and differentiate cotyledons and radicles, and finally form seedlings. Thus, obtaining optimal germination-promoting fungi is a key step in the protection of rare or endangered orchids. And (3) symbiotic germination is carried out by utilizing the dendrobium candidum seeds and matrixes of the habitat thereof to form protocorms, then the symbiotic fungi are separated and purified from the protocorms and identified, and finally the symbiotic fungi are respectively tiebased with the Jiang Danhu seeds of the dendrobium candidum, so that the most suitable germination-promoting fungi of the dendrobium candidum are screened. Thereby providing necessary conditions for efficiently producing mycorrhizal seedlings and laying a foundation for developing wild regression and primordial environment protection of dendrobium nobile.

At present, the orchidaceae mycorrhizal fungi germinate symbiotically with dendrobium candidum seeds, but the germination rate is not high, which greatly hinders the cultivation process of the dendrobium candidum Jiang Danhu seedlings.

Disclosure of Invention

Therefore, the invention aims to provide the fungus strain 1-1-2 for promoting the germination of dendrobium candidum, which can greatly improve the germination rate of dendrobium candidum compared with other fungi.

The invention provides a fungus strain for promoting germination of gold sand Jiang Danhu, which is Fusarium sp.1-1-2 and has a preservation number of CCTCC NO: m2020553.

Preferably, the nucleotide sequence of the ITS gene of the fusarium strain 1-1-2 is shown as SEQ ID NO. 1.

The invention provides a method for culturing a fungus strain for promoting germination of Jinsha Jiang Danhu, which comprises the following steps:

the fungus strain promoting the germination of the golden sand Jiang Danhu is inoculated on a PDA culture medium for culture.

The invention provides application of the fungus strain for promoting germination of Jinsha Jiang Danhu in promoting germination of Jinsha Jiang Danhu seeds.

Preferably, in the method for promoting the germination of the Jinsha Jiang Danhu seeds, the Jinsha dendrobium seeds and the fungus strain for promoting the germination of the Jinsha Jiang Danhu are inoculated into a germination culture medium for co-culture to obtain germinated Jinsha Jiang Danhu.

Preferably, the fungus strain promoting the germination of the Jinsha Jiang Danhu is inoculated into a germination culture medium for preculture for one week and then inoculated into the Jinsha dendrobium seeds.

Preferably, the dendrobium nobile seeds are added into the germination medium in the form of a suspension, and the seed density of the suspension is 700-900 grains/ml.

Preferably, the inoculum size of the fungus strain promoting the germination of the gold sand Jiang Danhu is 0.8cm diameter fungus mass/culture dish.

Preferably, the germination medium is oat agar medium.

Preferably, the temperature of the co-culture is 23-27 ℃;

the co-cultivation time is 30-45 d.

The fungus strain for promoting the germination of the gold sand Jiang Danhu provided by the invention is identified as fusarium strain 1-1-2 by morphology and molecular biology, and the preservation number is CCTCC NO: m2020553. The result of co-culturing fusarium strains 1-1-2 and mature dendrobium nobile seeds shows that the germination proportion and germination rate of the dendrobium nobile seeds co-cultured with 1-1-2 strains are obviously higher than those of the dendrobium nobile seeds co-cultured with other strains except for germination stage 2 and germination stage 3 which are slightly lower than those of the dendrobium nobile seeds co-cultured with 2-1-2 strains. Compared with other conventional fungus strains, the fusarium strain 1-1-2 provided by the invention has obvious advantages in promoting germination of dendrobium nobile, and can obviously improve the germination rate of the seeds, thereby providing necessary conditions for efficient production of mycorrhizal seedlings and providing a foundation for further development of the protozoon protection work.

Drawings

FIG. 1 is a diagram of intergrowth germination of gold sand Jiang Danhu on site;

FIG. 2 is a morphology of Fusarium strain 1-1-2, wherein FIG. 2A is a colony morphology; FIG. 2B is a meristematic subgraph;

FIG. 3 is a phylogenetic tree diagram of strains 1-1-2 constructed based on ITS sequences;

FIG. 4 is a graph showing symbiotic germination comparison of strains 1-1-2 and other strains with Jinsha Jiang Danhu seeds;

FIG. 5 is a graph showing symbiotic germination of strain 1-1-2 and Dendrobium Jinshajiang seeds on OMA medium, wherein FIG. 5A. Stage 1, water swelling; FIG. 5B stage 2, embryo break through seed coat, protocorm formation; C. stage 3, the occurrence of a primordial meristem, the development of the protocorm, is regarded as germination; D. and 4, growing young leaves and forming seedlings.

Biological material preservation information

Fusarium sp. Fusarium strains 1-1-2 were deposited at China Center for Type Culture Collection (CCTCC), address: in the university of marchant in marchant district of marchant university (across from the first affiliated university of marchant), the preservation number of the room 211 of the China center for type culture collection is cctccc NO: m2020553.

Detailed Description

In the invention, the fusarium strains 1-1-2 are separated from the golden sand Jiang Danhu protocorm. Fusarium strain 1-1-2 was inoculated onto PDA medium for cultivation, and colony morphological characteristics were observed (cultivation 4 d): the mycelium is milky white, the bacterial colony is regular in morphology and round, the growth speed is 2.000+/-0.255 cm every two days, the culture time is short, a 9cm flat plate is paved about 7 days, the mycelium is white short velvet mycelium at the initial stage, and the color of the secondary metabolite is light yellow at the later stage. Observing the conidium under an optical microscope, wherein the conidium has two forms, and the small conidium has an oval shape to a column shape and 1-3 diaphragms; the large conidium sickle shape or long column shape is scattered on aerial hypha, the separation number is 3-10, the separation number is more, the separation membrane is different, the separation is obvious, and the separation is not obvious. No chlamydospores were observed. Meanwhile, molecular biological identification is carried out on the Fusarium strain 1-1-2, the ITS gene fragment is amplified by PCR, the nucleotide sequence of the ITS gene of the Fusarium strain 1-1-2 is shown as SEQ ID NO. 1 (CTGATCCGAGGTCAACATTCAGAAGTTGGGGGTTTAACGGCATGGCCGCACCGCGTTCCAGTTGCGAGGTGTTAGCTACTACGCAATGGAGGCTGCAGTGAGACCGCCACTAGATTTAGGGGGCGGCTGGTCCTAAGACTCGCCGATCCCCAACACCAAACCCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTGTTTGTTTTACTCAGAAGTTACAATAACAGCAAGAGTTTGGATCCTCTGGCGGGCCGTCCCGTTTTACCGGGCGCGGGCTGATCCGCCGAGGCAACATTAAGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGGTAATGATCCCTCCGCAGGTCACCCTACGGAA), the nucleotide sequence is most similar to that of the Fusarium strain (Fusarium sp.) by comparison, the similarity reaches 99%, and the ITS fragment is constructed into a phylogenetic tree (see figure 3).

the fungus strain promoting the germination of the golden sand Jiang Danhu is inoculated on a PDA culture medium for culture. The temperature of the culture is preferably 28℃and the time of the culture is preferably 6 to 10 days, more preferably 7 days.

In the method for promoting the germination of the Jinsha Jiang Danhu seeds, preferably, the Jinsha dendrobium seeds and the fungus strain for promoting the germination of the Jinsha Jiang Danhu are inoculated into a germination culture medium for co-culture to obtain germinated Jinsha Jiang Danhu.

In the invention, the co-culture is preferably carried out by inoculating the fungus strain promoting the germination of the golden sand Jiang Danhu into a germination culture medium for pre-culture and then inoculating the golden sand dendrobium seeds. The time of the preculture is preferably 6 to 8 days, more preferably 7 days. The temperature of the preculture is preferably 25 to 30℃and more preferably 28 ℃. The germination medium is preferably oat agar medium.

In the present invention, the inoculum size of the fungus strain promoting germination of gold sand Jiang Danhu is preferably a fungus cake/culture vessel with a diameter of 0.8 cm. The inoculation method is preferably to pick hypha at the colony edge of the PDA culture medium at the center of the surface of the OMA culture medium, seal the film and culture.

In the present invention, the dendrobium chrysanthemi seeds are preferably added to the germination medium in the form of a suspension, the seed density of the suspension preferably being 700 to 900 grains/ml, more preferably 750 to 850 grains/ml, most preferably 800 grains/ml. The solvent of the suspension is preferably sterile water. The inoculation amount of the dendrobium nobile seeds is preferably 750-850 grains/ml, more preferably 800 grains/ml.

In the present invention, the temperature of the co-culture is preferably 23 to 27 ℃, more preferably 25 ℃. The co-cultivation time is preferably 30 to 45 days, more preferably 35 to 40 days. The germination process of dendrobium chrysanthemi seeds is divided into 4 stages, and the growth characteristics of each stage are shown in table 1.

TABLE 1 description of seed germination stage of Dendrobium Jinshajiang

Co-cultivation results show that the ratio and germination rate of the gold sand Jiang Danhu co-cultivated with the 1-1-2 strain are obviously higher than those of the gold sand Jiang Danhu co-cultivated with other strains except for the stage 2 and the stage 3, which are slightly lower than those of the gold sand Jiang Danhu co-cultivated with the 2-1-2 strain (shown in figure 4).

The fungus strain and application of the present invention for promoting germination of gold sand Jiang Danhu will be described in detail with reference to examples, but they should not be construed as limiting the scope of the invention.

Example 1

Induction separation and purification method of fusarium strain 1-1-2

1) Taking bark in the original habitat of the golden sand Jiang Danhu back to a laboratory by utilizing a site-moving symbiotic germination technology, grinding into powder to prepare symbiotic germination matrix, sowing mature golden sand dendrobium seeds, and forming protocorms after the seeds germinate, so that seedlings are formed by budding, as shown in figure 1;

2) Picking up protocorms with good growth vigor, cutting into halves, placing on PDA culture medium, and culturing under the condition of dark constant temperature of 28 deg.C. When hypha grows to a certain length, purifying, namely continuously picking the edge hypha of the bacterial colony to a new PDA culture medium for serial transfer, and obtaining pure bacterial colony after 3-5 times of transfer. Carrying out morphological and molecular identification on the obtained fungus, and simultaneously screening out the optimal germination-promoting strain by carrying out symbiotic germination experiments on dendrobium chrysanthemi seeds and the obtained fungus;

3) Fungus preservation: the purified fungi were preserved using a conventional tube-slope method. The prepared appropriate amount of PDA medium was poured into a glass test tube of 18X 20mm in size, and the amount of medium poured was about 1/3 of the volume of the test tube. After the silica gel plug, the silica gel plug is put into an autoclave for sterilization (121 ℃ C., 25 min). Placing the test tube into an ultra-clean workbench to form an inclined plane for standby after sterilization. And (3) on an ultra-clean workbench, picking edge hyphae of the purified strain by using sterilized bamboo sticks, inoculating the edge hyphae on a PDA inclined plane, and marking strains, numbers and dates. The inoculated test tube was placed in a constant temperature incubator at 28℃for cultivation. When hypha grows to be full of PDA inclined plane, take out test tube and put into refrigerator at 4 deg.C for preservation.

The separated optimal germination promoting strain is preserved in China center for type culture collection; address: in the university of marchant in marchant district of marchant university (opposite to the first affiliated university of marchant), the chinese collection of typical cultures 211 room. The strain is classified and named as Fusarium sp with a collection number of CCTCC NO: m2020553, the preservation date is 9 months and 29 days in 2020.

Example 2

Identification method of fusarium 1-1-2 strain

1) Morphological classification of strains

Strains were inoculated on PDA medium and colony morphology was observed as shown in fig. 2: FIG. 2A is a graph showing colony morphology of strain 1-1-2 grown on PDA medium for 4 days, its hyphae are milky white, gas-borne, colony morphology is regular, it is round, every two days growth rate is 2.000.+ -. 0.255cm, culture time is shorter, about 7 days a 9cm plate is spread, the initial stage is white short velvet hypha, and the later stage is light yellow in color of visible secondary metabolite. FIG. 2B is a 1-1-2 conidium subgraph showing two forms, a small conidium oval to cylindrical form with 1-3 membranes; the large conidium sickle shape or long column shape is scattered on the aerial hypha, the separation number is 3-10, the separation number is more, the separation membrane is different, the separation is obvious, and the separation is not obvious. No chlamydospores were observed.

2) Molecular biological identification

Extracting fungus DNA by adopting a CTAB method, wherein common primers used for PCR amplification are ITS1 and ITS4; the PCR reaction system (50. Mu.l) included: 2.5. Mu.l 10 XPCR buffer, 0.4. Mu.l dNTPs, 1.5. Mu.l Mg ²⁺ 1.5. Mu.l ITS1, 1.5. Mu.l ITS4, 0.2. Mu.l Taq enzyme, 2. Mu.l DNA template, ddH ₂ O was made up to 50. Mu.l.

The amplification reaction was performed on a PCR instrument Perkin Elmer as follows: pre-denaturation at 94 ℃ for 3min, and circulation for 1 time; denaturation at 94℃for 1min, annealing at 51℃for 30s, extension at 72℃for 1min,30 cycles; finally, the extension is carried out for 5min at 72 ℃. The PCR amplified product was sent to Kunming engineering Co.Ltd for sequencing.

Submitting the measured ITS sequences to a database of the national center for biotechnology information to be compared, and preliminarily confirming that the classification status of the ITS sequences is Fusarium; the ITS sequences of the 27 known species under the genus Fusarium were then combined with the ITS sequences of strains 1-1-2 to construct a phylogenetic tree. Results As shown in FIG. 3, the phylogenetic tree constructed based on ITS sequences shows that strain 1-1-2 does not accumulate on a small branch (55% support) with other known species of Fusarium. Based on the above morphological and molecular biological identification information, strain 1-1-2 was identified as a suspected new species under the genus Fusarium, designated Fusarium sp.1-1-2.

Example 3

The Fusarium sp.1-1-2 strain deposited in example 2 was inoculated onto PDA medium (200 g/L potato, 20g/L glucose, 15g/L agar) and cultured at 28℃for 7d to grow hyphae, thereby obtaining Fusarium sp.1-1-2 strain.

Comparative example 1

The strains 1-5-1, 1-6-4, 2-1-4- (5), 2-1-4- (2), and unknown species 1-3-1, 2-1-2 were isolated according to the isolation method described in example 1, and strain identification was performed by the method described in example 1.

The separation method is the same as the separation method of the 1-1-2 strain, and the identification results of the 1-5-1, 1-6-4, 2-1-4- (5), 2-1-4- (2) and 2-1-2 strains are Fusarium fungi.

Example 4

Promoting effect of 1-1-2 strain on germination of mature dendrobium chrysanthemi seeds

1) Preparation of germination medium

Oat agar medium (OMA medium formulation: 4g/L oat+10 g/L agar, pH=5.8) was formulated as fungal and seed symbiotic germination medium. The specific preparation method of the OMA culture medium comprises the following steps: weighing 4g of oat flour special for fermentation and 10g of agar, boiling and stirring, transferring into a beaker after uniform mixing to supplement water to 1L, adjusting pH to 5.8, pouring into a triangular flask for sterilization (121 ℃ for 25 min), and subpackaging in sterile culture dishes with the diameter of 9cm in an ultra-clean workbench for cooling after sterilization. And (3) picking hyphae at the colony edge of the PDA culture medium by using a sterile bamboo stick, sealing a film on the center of the surface of the OMA culture medium, marking, and culturing in a constant temperature incubator at 28 ℃ for 7 days for later experiments.

2) Seed sowing

Adding appropriate amount of Dendrobium nobile seeds and sterile water into sterilized test tube, mixing, and making into seed suspension. 1ml of the suspension (approximately 800 seeds) was then aspirated with a pipette and evenly sown on the OMA medium surface with 1-1-2 and other strains. The culture dish is covered, the sealing film is sealed, and the mark is made. The above treatments were repeated for 10 dishes per group. Culturing under illumination (12/12 h, light/dark) at constant temperature (25+ -2deg.C) in an artificial incubator.

3) Observation and data statistical analysis

After about 40d of seed germination, the culture dish was opened, and the germination of Dendrobium candidum seeds was classified according to Table 1.

The number of stages 1-4 and germination was recorded and the results are shown in Table 2.

The ratio and germination rate of the gold sand Jiang Danhu co-cultured with the 1-1-2 strain are obviously higher than those of the gold sand Jiang Danhu co-cultured with other strains except for the stage 2 and the stage 3, which are slightly lower than those of the gold sand Jiang Danhu co-cultured with the 2-1-2 strain (shown in figure 4).

In FIG. 5, growth of Dendrobium nobile seeds in various stages after co-cultivation with Fusarium strains 1-1-2. FIG. 5A stage 1, water swelling; FIG. 5B stage 2, embryo break through seed coat, protocorm formation; FIG. 5C stage 3, the development of the meristem, i.e., the germination, occurs; fig. 5D, stage 4, young leaves develop and seedlings form.

The foregoing is merely a preferred embodiment of the present invention and it should be noted that modifications and adaptations to those skilled in the art may be made without departing from the principles of the present invention, which are intended to be comprehended within the scope of the present invention.

Sequence listing

<110> university of Yunnan

<120> fungus strain for promoting germination of gold sand Jiang Danhu and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 515

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ctgatccgag gtcaacattc agaagttggg ggtttaacgg catggccgca ccgcgttcca 60

gttgcgaggt gttagctact acgcaatgga ggctgcagtg agaccgccac tagatttagg 120

gggcggctgg tcctaagact cgccgatccc caacaccaaa cccgggggct tgagggttga 180

aatgacgctc gaacaggcat gcccgccaga atactggcgg gcgcaatgtg cgttcaaaga 240

ttcgatgatt cactgaattc tgcaattcac attacttatc gcattttgct gcgttcttca 300

tcgatgccag aaccaagaga tccgttgttg aaagttttga tttatttgtt tgttttactc 360

agaagttaca ataacagcaa gagtttggat cctctggcgg gccgtcccgt tttaccgggc 420

gcgggctgat ccgccgaggc aacattaagg tatgttcaca ggggtttggg agttgtaaac 480

tcggtaatga tccctccgca ggtcacccta cggaa 515

Claims

1. A fungus strain for promoting germination of dendrobium chrysanthemi seeds is characterized in that the fungus strain is fusariumFusariumsp.) strain 1-1-2 with a preservation number of CCTCC NO: m2020553.

2. A method of culturing a fungal strain according to claim 1 for promoting germination of seeds of golden sand Jiang Danhu, comprising the steps of:

fungus strains promoting germination of dendrobium chrysanthemi seeds are inoculated on a PDA culture medium for culture.

3. Use of the fungal strain of claim 1 for promoting germination of seeds of golden sand Jiang Danhu for promoting germination of seeds of golden sand Jiang Danhu.

4. The use according to claim 3, wherein the method for promoting germination of dendrobium candidum seeds comprises inoculating dendrobium candidum seeds and the fungus strain for promoting germination of dendrobium candidum Jiang Danhu seeds into germination culture medium for co-cultivation to obtain germinated dendrobium candidum Jiang Danhu.

5. The use according to claim 4, wherein the fungus strain promoting germination of dendrobium candidum seeds is inoculated into germination medium for a week before inoculating dendrobium candidum seeds.

6. The use according to claim 4 or 5, wherein the dendrobium chrysanthemi seeds are added to the germination medium in the form of a suspension, the suspension having a seed density of 700-900 grains/ml.

7. The use according to claim 4 or 5, wherein the fungal strain promoting germination of dendrobium chrysanthemi seeds is inoculated in an amount of 0.8cm diameter mass/dish.

8. The use according to claim 7, wherein the germination medium is oat agar medium.

9. The use according to any one of claims 4, 5 and 8, wherein the temperature of the co-cultivation is 23-27 ℃;

the co-culture time is 30-45 d.