CN114717139A - Turkey mycorrhiza strain TP-13 capable of promoting growth of new roots of dendrobium and application thereof - Google Patents

Abstract

The invention provides a mycorrhizal fungi (Epulorrhiza sp) strain TP-13 with the capability of promoting the growth of new roots of dendrobium and application thereof, belonging to the technical field of microorganisms. The rhizobium japonicum strain TP-13 with the preservation number of CCTCC NO: m20211285. The strain TP-13 is obtained by separating and screening from roots of ex-situ induced dendrobium officinale seedlings, can remarkably promote the growth of new roots of the dendrobium officinale seedlings, can promote the growth of leaves and sprouts of the seedlings, and improves the dry weight of the seedlings. The strain TP-13 is utilized to mycorrhize the dendrobe seedlings, high-quality symbiotic seedlings with strong adaptability and high survival rate can be obtained, a new thought is provided for rebuilding dendrobe population and high-efficiency cultivation of medicinal dendrobe, and the method has a great application value.

Description

Turkey mycorrhiza strain TP-13 capable of promoting growth of new roots of dendrobium and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a rhizobium japonicum strain TP-13 capable of promoting the growth of new roots of dendrobium and application thereof.

Background

Dendrobium (Dendrobium Sw.) genus, Dendrobium nobile, also known as the root of Hovenia acerba. The pseudobulb grows in clusters, extends to be in a stem shape and is in multiple sections; the upper node of the cauliflower has a plurality of flowers or only 1 flower; the flower is large and gorgeous, the perianth is developed, the base with wide lateral sepals grows on the stamen pillar foot, and the base of the lipped form a sepal sac together; the lip is 3 fissured. The dendrobium stem dendrobium candidum, dendrobium officinale, dendrobium combianum, dendrobium candidum, dendrobium huoshanense and the like which are original plants of traditional Chinese medicine dendrobium nobile are bred in China, wherein the dendrobium candidum has thin stems and small flowers; the species with thick stem and big flower can be used as the flower for appreciation. Wherein the Dendrobium officinale (Dendrobium officinale) is known as the first of the nine major Mesona chinensis in the "preservation of state" and has various pharmacological actions. However, the dendrobium plants have low reproduction rate under natural conditions, long growth period and serious habitat damage, so that wild resources are extremely deficient, and therefore, a method for artificially cultivating dendrobium is urgently needed.

The dendrobium officinale seedlings can be obtained by two modes of non-symbiotic germination culture and symbiotic germination culture, the seedling rate is higher through the non-symbiotic germination culture, but the seedlings obtained by the method are transplanted to the natural environment, and due to the lack of a fungus partner establishing a symbiotic relationship with the seedlings, the adaptability is weak, the pathogenic microorganism resistance is poor, the growth is slow, the survival rate is low, and the subsequent growth is seriously hindered. The symbiotic germination culture technology is characterized in that plant seeds are sown in a specific medium (culture medium) at the same time, and symbiotic fungi for promoting seed germination are infected, so that the method can improve the germination rate of the seeds and the formation rate of seedlings. However, because the orchid and the fungus partner are complex and diverse, after the seedlings are built, the seedlings are short and weak in resistance to external resistance, and the growth is often blocked and stopped or directly killed, the seedlings need to be symbiotic with more suitable fungi in the later growth stage, and the seedlings are stimulated to continue to grow. Therefore, determining effective fungi capable of forming symbiotic relationship with the dendrobium officinale seedlings and promoting the growth of the dendrobium officinale seedlings is a key link for cultivating and protecting the dendrobium officinale. The acquisition of mycorrhized seedlings is the basis for developing the protection, regression and population reconstruction practices of the dendrobium officinale and developing the recovery-friendly cultivation of the dendrobium officinale. The variety of fungi required by the dendrobium officinale in each growth stage is different, and the physiological indexes of the protocorm and the tissue culture seedling of the dendrobium officinale are measured to find that the endophytic fungi mainly regulate the growth and development of the dendrobium officinale by generating endogenous hormones. However, the prior art reports that some strains can kill dendrobium seeds and protocorms, and some strains can promote the growth of dendrobium officinale, which is mainly reflected in the aspects of improving the growth of seedlings, the content of chlorophyll, promoting the absorption of nutrient elements and the like. The growth of new roots is an important influence factor influencing the survival rate of transplanting seedlings, so that the provision of the endophytic strain of the new roots of the dendrobium seedlings can greatly help artificial cultivation of the dendrobium seedlings.

Disclosure of Invention

In view of the above, the invention aims to provide a rhizobium japonicum strain TP-13 which has the capability of promoting the growth of new roots of dendrobium officinale, so that the high-efficiency cultivation of dendrobium officinale is realized.

The invention provides a mycorrhizal fungi (Epulorrhiza sp.) strain TP-13 with the capability of promoting the growth of new roots of dendrobium, and the preservation number is CCTCC NO: m20211285.

Preferably, the ITS sequence of the mycorrhizal fungi strain TP-13 is shown in SEQ ID NO. 1.

The invention provides a product for dendrobium cultivation, which comprises the rhizobium japonicum strain TP-13 and acceptable auxiliary materials.

Preferably, the product comprises a microbial agent and a bacterial fertilizer for dendrobium cultivation.

The invention provides application of the rhizopus nodorum strain TP-13 or the product in dendrobium cultivation.

Preferably, the dendrobium growth comprises the growth of new roots of dendrobium, the growth of seedling leaves and sprout tillers and the increase of dry weight of seedlings.

Preferably, the dendrobium comprises dendrobium officinale.

The invention provides a method for improving the growth of new roots of dendrobium, which comprises the following steps:

symbiotic culture is carried out on the dendrobium seedlings and the mycorrhizal fungi strain TP-13.

Preferably, the culture medium for symbiotic culture is an oat culture medium.

Preferably, the temperature of the symbiotic culture is 23-27 ℃, the light-dark period L/D of the symbiotic culture is 12/12, and the illumination intensity is 2000-3000 Lx.

The rhizobium japonicum strain TP-13 capable of promoting the growth of the new roots of dendrobium provided by the invention has the preservation number of CCTCC NO: m20211285. The strain TP-13 is obtained by separating and screening seedling mycorrhiza which forms symbiotic relationship and is obtained by the ex-situ induction of dendrobium officinale seedlings. The strain TP-13 and the dendrobium plant are cultured in a symbiotic way, the strain TP-13 mycorrhizates the dendrobium plant, and compared with other strains separated in the same batch, the growth of new roots of dendrobium officinale seedlings is remarkably promoted, an effective way is provided for obtaining high-quality dendrobium seedlings with strong adaptability and high survival rate, and reconstruction of dendrobium population and efficient cultivation of medicinal dendrobium are hopefully realized. Meanwhile, the strain TP-13 can promote the growth of leaves and sprout tillers of seedlings to different degrees, and the dry weight of the seedlings is improved, so that the growth of the dendrobium seedlings is promoted.

The method for improving the growth of the new roots of the dendrobium has the advantages of simplicity, easiness in operation, low cost, suitability for popularization and application, and great popularization value in the aspects of regression protection of rare or endangered orchids, population reconstruction practice, ecological cultivation of medicinal orchids, solving of the bottleneck problem of high-quality seedling source in the dendrobium officinale cultivation industry and the like.

Drawings

FIG. 1 is a morphological diagram of the growth capacity of new roots after symbiotic culture of the strain TP-13 and dendrobium officinale seedlings provided by the invention.

Biological material preservation information

Mycorrhizal fungi (Epulorrhiza sp.) were collected in China Center for Type Culture Collection (CCTCC) at 10/15/2021 at the collection address: the Wuhan university in Wuchang district, Wuhan city, Hubei province has the preservation number: CCTCC NO of M20211285, and the strain number is TP-13.

Detailed Description

The invention provides a rhizobium japonicum strain TP-13 with the capability of promoting the growth of new roots of dendrobium, and the preservation number is CCTCC NO: m20211285.

In the invention, the strain TP-13 is obtained by separating and screening seedling mycorrhiza which forms symbiotic relationship and is obtained by the ex-situ induction of dendrobium officinale seedlings. The morphological characteristics of the strain TP-13 are as follows: after 10 days of culture on a PDA plate, the bacterial colony is in a white blanket shape, the aerial hyphae are developed, the bacterial colony grows in a regular circular and divergent mode, and the surface of the bacterial colony is rough and dry. The hyphal characteristics of the strain TP-13 are as follows: culturing in dark at 25 + -2 deg.C for 10 days, observing with optical microscope, wherein the thickness of mycelium is 3.51-4.65 μm, the branch is nearly right angle, new mycelium grows on old mycelium, the new mycelium has more obvious diaphragm, and the diaphragm quantity is more, the cell wall of old mycelium has thickening phenomenon, and the compartment is longer. The ITS gene fragment is adopted for molecular identification, the ITS sequence of the rhizopus tumefaciens strain TP-13 is preferably shown as SEQ ID NO:1, the strain TP-13 is most similar to fungus Epulorrhiza sp (accession number: KC154064.1), and the maximum similarity reaches 97.28%. The results of comprehensive morphological, physiological, biochemical and molecular identification show that the strain TP-13 belongs to mycorrhizal fungi (Epulorrhiza sp.).

In the present invention, the method for expanding the culture of the mycorrhizal fungi strain TP-13 is preferably as follows:

inoculating the mycorrhizal fungi strain TP-13 to a PDA culture medium, and culturing in the dark until hyphae overgrow a culture dish.

The inoculation amount of the rhizopus tumefaciens strain TP-13 is not particularly limited in the invention, and the inoculation amount of fungi well known in the field can be adopted. The temperature of the dark culture is preferably 23-27 ℃, and more preferably 25 ℃. The dark culture time is not particularly limited, and the culture is carried out until hyphae grow over the culture medium. The dark cultivation is preferably carried out in an artificial climatic chamber.

In the invention, an effectiveness experiment of promoting the growth of new roots of dendrobium officinale seedlings by using the strain TP-13 is carried out, and meanwhile, other rhizobium strains and non-rhizobium strains separated in the same batch are used as control strains to carry out symbiotic culture for 30d and 90d, and the results show that each strain has different degrees of improvement on the new roots of the seedlings during the symbiotic culture for 30d and has obvious difference compared with a blank control (PDA group), while the strain TP-13 has obvious advantages in the aspect of the new roots of the seedlings compared with the blank control (PDA group) during the symbiotic culture for 90d and also has the effect of remarkably promoting the new roots of the seedlings compared with other strains. Therefore, the TP-13 strain has the most obvious effect of promoting the growth of new roots of dendrobium officinale seedlings.

The invention provides a product for dendrobium nobile cultivation, which comprises the mycorrhizal fungi strain TP-13 and acceptable auxiliary materials.

In the invention, the product preferably comprises a microbial agent and a bacterial fertilizer for dendrobium cultivation. The preparation method of the microbial agent is not particularly limited, and the preparation method of the fungal agent known in the field can be adopted. In the present invention, the microbial agent is preferably prepared by inoculating the mycelia of the strain TP-13 obtained by the above-mentioned extensive culture on a culture medium, and mixing the mycelia after the culture medium is overgrown with the mycelia. The plant bacterial manure is preferably obtained by inoculating hypha of the strain TP-13 obtained by the enlarged culture onto a culture medium, and mixing the hypha with nutrient components after the hypha grows over the culture medium. The culture medium comprises wheat bran, rice bran, 10% glucose solution and the like. The volume ratio of the wheat bran, the rice bran and the glucose solution with the mass concentration of 10% is 2: 3: 3. adding 10 pieces of 0.5cm per 500ml culture medium³A volume sized clump of bacteria. The temperature of the culture is preferably 23-27 ℃, and more preferably 25 ℃. The culture is preferably a dark culture. The culture time is preferably 14-16 days, and more preferably 15 days until the auxiliary materials have a large number of hyphae attached. The nutrient components also preferably comprise nutrient elements or organic fertilizers and the like.

The invention provides the application of the rhizobium nodorum strain TP-13 or the product in dendrobium cultivation, in view of the fact that the TP-13 strain has the most obvious effect of promoting the growth of new roots of dendrobium seedlings, and also has the effects of promoting the growth of leaves and sprouts of the seedlings and improving the dry weight of the seedlings.

In the invention, the preferable growth of the dendrobium comprises the growth of new roots of the dendrobium, the promotion of the growth of seedling leaves and sprout tillers and the improvement of the dry weight of seedlings. The invention has no special limitation on the types of the cultivated dendrobium, and can adopt the dendrobium types well known in the field, such as dendrobium moniliforme, dendrobium officinale, dendrobium combianum, dendrobium candidum and dendrobium huoshanense. In the embodiment of the invention, dendrobium officinale is taken as an example to illustrate the symbiosis of the strain TP-13.

The invention provides a method for improving the growth of new roots of dendrobium, which comprises the following steps:

symbiotic culture is carried out on the dendrobium seedlings and the mycorrhizal fungi strain TP-13.

In the present invention, the culture medium for symbiotic culture is preferably an oat culture medium. The oat culture medium is preferably 4 g.L^-1Oat and 10 g.L^-1Agar, and the pH value of a culture medium is 5.6-5.8. The temperature of the symbiotic culture is preferably 23-27 ℃, and more preferably 25 ℃. The symbiotic culture time is preferably 60-120 days, and more preferably 90 days. The light-dark cycle L/D of the symbiotic culture is 12/12, and the illumination intensity is preferably 2000-3000 Lx, more preferably 2500 Lx. The inoculation sequence of the dendrobium seedling and the mycorrhizal fungi strain TP-13 is not particularly limited, and the inoculation sequence of symbiotic culture well known in the field can be adopted. In the embodiment of the invention, the dendrobium seedlings are preferably transplanted into the culture medium and then inoculated with the strain TP-13.

The mycorrhiza strain TP-13 capable of promoting the growth of the new roots of dendrobium and the application thereof provided by the invention are described in detail by the following examples, but the invention is not to be construed as being limited by the scope of the invention.

Example 1

Isolation, purification and characterization of the TP-13 Strain of the mycorrhizal fungus (Epulorrhiza sp.)

(I) separation and purification of TP-13 Strain

1. Method for inducing mycorrhiza of dendrobium officinale seedling in ex situ

(1) In 2018, from 7 to 9 months, a team carries out on-site research on a plurality of places, local drug collectors are interviewed, and finally, Yunnan Guannan (23 degrees 58 'N, 105 degrees 11' E; 1428m alt.), Hunan mountain karst landform (26 degrees 30 'N, 111 degrees 10' E; 340m alt.) and Danxia landform (26 degrees 20 'N, 110 degrees 46' E; 455m alt.), Chongqing Lutian (30 degrees 31 'N, 108 degrees 33' E; 1200m alt.), Sichuan Ludine (29 degrees 23 'N, 102 degrees 21' E; 1382m alt.) and asbestos (29 degrees 22 'N, 105 degrees 11' E; 3596m alt.) are the original habitat of dendrobium officinale, because wild dendrobium officinale is historically collected by the drug collectors. During the period, six habitat substrates are collected and taken back to a laboratory, the substrates taken back from the field are mixed with a sterile mixed substrate (bark, peat soil and vesuvianite are mixed in a ratio of 2:1: 1) in the same volume, then the mixture is poured to be saturated by sterile water, and then the mixture is subpackaged into plastic flowerpots (the radius is 5cm, and the height is 10cm) for later use.

(2) Selecting aseptic dendrobium officinale seedlings with good growth vigor, taking five seedlings as a group, transplanting the seedlings to a plastic flowerpot filled with an induction matrix, performing illumination culture at the room temperature of 25 +/-2 ℃ (the light cycle is 12/12h L/D), keeping the humidity of the matrix in the flowerpot, collecting the root tissue of the seedlings every 15 days, and checking whether the root tissue is colonized by fungi under a microscope.

(3) After 60 days of transplanting, finding hypha clusters on the seedling root tissues, collecting seedling root samples for subsequent fungus separation experiments

2. Isolation, purification and preservation of a TP-13 strain of the genus Rhizobium

(1) Obtaining a root sample: seedling mycorrhiza forming symbiotic relationship obtained by ex-situ induction of dendrobium officinale seedlings

(2) Induction, separation, purification and preservation of root-like endophytic fungi: the root sample used for the fungal isolation was washed clean under tap water. And (3) putting the root sample into 75% alcohol for disinfection for 30s on a super-clean workbench, then transferring the root sample into a sterile flat plate containing 2% sodium hypochlorite (NaClO) solution, slightly stirring and disinfecting for 3min, then taking out the root sample by using sterile sharp forceps, and washing the root sample by using sterile water for 3-4 times. The root specimens were cut into approximately 0.1mm root pieces with a sterile scalpel, and they were cultured in PDA medium at 25 ℃ in the dark in an incubator. And continuously cutting hypha tips to a new PDA culture medium for serial transfer after the hypha grows around the root segments, and transferring for 3-5 times to obtain pure colonies, thereby obtaining 27 symbiotic fungi.

(3) And (3) fungus preservation: the purified fungi were preserved using a conventional tube-slant method. The prepared proper amount of PDA culture medium is poured into a glass test tube with the specification of 18X 20mm, and the culture medium is poured into 1/3 with the volume being about the volume of the test tube. After the silica gel plug, the mixture was sterilized in an autoclave (121 ℃ C., 20 min). And after sterilization, placing the test tube in a superclean bench to swing into an inclined plane for later use. On a clean bench, picking edge hyphae from the purified strain with a sterile inoculating needle, inoculating on PDA slant, and noting strain, number and date. Placing the inoculated test tube in an artificial climate box for dark culture at 25 +/-2 ℃. When hyphae grow over the PDA slope, the test tube is taken out and stored in a refrigerator at 4 ℃.

(II) identification method

1. Molecular characterization

Extracting total DNA of fungi by adopting a CTAB method, performing PCR amplification by using primers ITS1 and ITS4, and performing PCR reaction system and conditions according to corresponding product instructions; the amplified product is sent to Shanghai biological engineering company Limited for sequencing; and (3) comparing and analyzing the sequenced sequence in a national information center database of the biotechnology, and confirming the taxonomic status by combining morphological characteristics. The details are as follows. Extracting fungus DNA by CTAB method, PCR amplifying with ITS1(TCCGTAGGTGAACCTGCGG, SEQ ID NO:2) and ITS4 (TCCTCCGCTTATTGATATGC, SEQ ID NO: 3); the PCR reaction system (25. mu.l) included: 2.5. mu.l of 10 XPCR buffer, 0.4. mu.l of dNTP, 1.5. mu.l of Mg ²⁺1.5. mu.l ITS1, 1.5. mu.l ITS4, 0.2. mu.l Taq enzyme, 15.4. mu.l ddH₂O, 2. mu.l of DNA template; the amplification reaction was performed on a PCR instrument Perkin Elmer, with the following PCR cycles: performing pre-denaturation at 94 deg.C for 3min, and circulating for 1 time; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 1min, and 30 times of circulation; finally extending for 10min at 72 ℃; sequencing the PCR amplification product for Shanghai biological engineering Limited company; and submitting the sequence to a database of a national center for biotechnology information for comparison, and preliminarily determining the status under classification.

The strain identification result shows that the strain TP-13 is most similar to Epulorrhiza sp (accession number: KC154064.1) fungi, and the maximum similarity reaches 97.28%.

2. The strain TP-13 has the following morphological characteristics:

the morphological characteristics of the strain TP-13 are as follows: after 10 days of culture on a PDA plate, the bacterial colony is in a white blanket shape, the aerial hyphae are developed, the bacterial colony grows in a regular circular and divergent mode, and the surface of the bacterial colony is rough and dry.

The hyphal characteristics of the strain TP-13 are as follows: culturing in dark at 25 + -2 deg.C for 10 days, observing with optical microscope, wherein the thickness of mycelium is 3.51-4.65 μm, the branch is nearly right angle, new mycelium grows on old mycelium, the new mycelium has more obvious diaphragm, and the diaphragm quantity is more, the cell wall of old mycelium has thickening phenomenon, and the compartment is longer.

The fungus related to the invention is identified as a mycorrhizal fungus according to colony, morphological characteristics and molecular biological means.

The isolated strain TP-13 is preserved in the plant propagation adaptation and evolution ecology key laboratory Orchidaceae mycorrhizal fungi library of Yunnan university in 2018, 12 months and 5 days, and the strain is classified and named as mycorrhizal fungi (Epulorrhiza sp.) TP-13; and has been preserved in China Center for Type Culture Collection (CCTCC) at 10/15/2021 at the deposition address: the Wuhan university in Wuchang district, Wuhan city, Hubei province has the preservation number: CCTCC NO: m20211285.

Comparative example 1

Of the 27 isolated strains in example 1, the TP-1, TP-3, TP-6, TP-11, TP-15, TP-23 and TP-27 strains were identified as described in example 1.

Strains TP-1(SEQ ID NO:4), TP-3(SEQ ID NO:5), TP-6(SEQ ID NO:6) were identified as Mucuna fungi (Tulasnella sp.), TP-11(SEQ ID NO:7) was identified as mycorrhizal fungi (Epulorrhiza sp.), strain TP-15(SEQ ID NO:8) was identified as Sebaciales sp., TP-23(SEQ ID NO:9) was identified as Trichoderma (Trichoderma sp.), and strain TP-27(SEQ ID NO:10) was identified as Muscodor sp.).

Example 2

Effectiveness experiment for promoting growth of new roots of dendrobium officinale seedlings by using mycorrhizal fungi TP-13 strain

The symbiotic experiment of the sterile dendrobium officinale seedlings and the fungi in the culture medium is utilized to verify whether the fungi have a promoting effect on the growth of the new roots of the seedlings and compare the difference of the promoting effects of different fungi on the growth of the new roots:

(1) preparing a symbiotic culture medium: the symbiotic germination culture medium is oat agar culture medium comprising 4 g.L^-1Oat and 10 g.L^-1Agar, wherein the pH of a culture medium is 5.6-5.8;

(2) taking out 26 symbiotic fungi for verifying growth promoting function and Epulorrhiza sp.TP-13 of the rhizobium fungi, inoculating the symbiotic fungi on a PDA culture medium, placing the PDA culture medium in an artificial climate box, and culturing and activating in the dark at the temperature of 25 +/-2 ℃ until fungal hyphae grow to fill a culture dish to obtain symbiotic strain materials;

(3) transplanting sterile Dendrobium officinale seedlings with approximately consistent growth vigor (4-5 leaves, 2 roots, 1.7-2.5cm of plant height and 1.2-1.5mm of stem thickness) into tissue culture bottles filled with oat agar medium, treating 230 seedlings in each group, and repeating for 46 times;

(4) inoculating symbiotic strains into a tissue culture bottle in which sterile seedlings are planted, then placing the tissue culture bottle in a tissue culture room, and culturing at a constant temperature of 25 +/-2 ℃, wherein the light period L/D is 12/12, and the light intensity is 2500 Lx;

(5) The fungus promotes effect and data statistical analysis to new roots of dendrobium officinale seedlings: counting two periods (30 days and 90 days of symbiosis), counting the number of roots of the seedlings each time, and calculating a new root number (R) according to a formula I;

r ═ maen (Rt-R0) ± SE formula I

Where Rt is the number of seedlings at each stage, R0 is the initial number of roots of seedlings, and SE is standard error.

When the symbiotic culture is carried out for 90 days, the influence of different fungus inoculation treatments on new roots is compared by utilizing Generalized Linear Models (GLMs), and the average value of each treatment is compared by utilizing Least Significant Difference (LSD), wherein P is less than 0.05; any inoculation treatment has different degrees of promotion effects on the growth of new roots of dendrobium officinale seedlings (Table 1).

TABLE 1 Effect of different fungi on the growth of the New root of Dendrobium officinale seedling (statistics of 30 days and 90 days)

Note that: lower case letters indicate significance between different fungal treatments.

As can be seen from Table 1, after the seedlings of Dendrobium officinale Kimura et Migo are cultured with symbiotic fungi for 30 days, the PDA controls treated by different fungi including the treatment without inoculation of fungi all have the growth of new roots, especially the PDA controls treated by inoculating TP-27, TP-1 and TP-13 strains, and the average value of the number of the new roots is obviously higher than that of the PDA controls treated by other fungi, and is respectively as high as 2.227 +/-0.192, 1.724 +/-0.112 and 1.62 +/-0.189. In the 90-day symbiotic culture cut-off experiment, although the new roots of all the fungus treatment groups are obviously higher than the control, the average new root of the treatment group inoculated with TP-13 is the highest and reaches 2.688 +/-0.298, the increase is 29.78% on the basis of 30 days, and the effect of promoting the growth of the new roots is the best, so that the TP-13 fungus has the most obvious effect of promoting the growth of the new roots of the dendrobium officinale seedlings.

The fungi have different effects of promoting the growth of the new roots of the dendrobium officinale seedlings, most fungi treatment has continuous positive influence on the growth of the new roots of the seedlings, but the TP-27 strain is very special, the effect on the new roots of the seedlings is optimal in the early stage, but the number of the new roots is found to be rather inferior to that in the early stage when statistics is carried out for 90 days, the treated root systems of the seedlings are found to be yellow and withered and broken in the culture process and are left in a symbiotic culture medium, so that the application value of the seedling is not high; although the early-stage effect of TP-1 is comparable to that of TP-13, the latter-stage promotion effect is not as good as that of TP-13. The seedling inoculated with the TP-13 strain has the best effect of promoting the growth of new roots, the effect can be always continuous, and simultaneously, the number of new leaves, the number of sprouts and the dry weight of the seedling have remarkable promoting effect compared with a control group which is not treated by inoculation. The dendrobium officinale seedlings and the strain TP-13 show a beneficial symbiotic relationship, and mycorrhization of the dendrobium officinale seedlings is realized by symbiosis of the strain TP-13 and the dendrobium officinale seedlings, so that the dendrobium officinale seedlings can be used as a raw material of a biological microbial inoculum for cultivating the dendrobium officinale.

Example 3

In order to further study the influence of the TP-13 strain and the dendrobium officinale seedling symbiosis on the growth of the dendrobium officinale seedling, the new leaf number, the tiller number and the dry weight index data of the seedling are respectively measured, wherein the tiller: counting for 90 days to obtain newly germinated buds; number of new leaves: counting the number of leaves at 90 days, and subtracting the initial number of leaves of the seedling to obtain a new number of leaves; dry weight: and (3) when the seedlings are counted for 90 days, putting the seedlings into an 80-degree oven, baking the seedlings to be dry, weighing the seedlings in the period to check whether the dry weight number is changed or not until the dry weight value of the seedlings is not changed, and weighing all the dry weights of the seedlings.

The results are shown in Table 2.

TABLE 2 influence of different fungi on the growth of seedlings of Dendrobium officinale (statistics for 90 days)

Note that: lower case letters indicate significance between different fungal treatments.

Compared with blank control, the TP-13 strain has obvious growth promotion effect on new leaf trees, tillering number and dry weight of seedlings of dendrobium officinale seedlings. Compared with other strains (TP-1, TP-3, TP-23, TP-6, TP-27 and TP-15), the TP-13 microbial inoculum has a considerable growth promotion effect. Compared with the strain (TP-11) of the same species, the strain TP-13 is obviously lower than the strain TP-11 in the aspect of promoting the young seedling to grow new leaves, the sprouting number is equivalent to that of the strain TP-13 and the growth promoting effect of the strain TP-11, and the dry weight of the young seedling is obviously better than that of the strain TP-11 in the strain TP-13. Therefore, the TP-13 strain also has the effects of promoting the development of new leaves and the breeding number of dendrobium officinale seedlings and increasing the dry weight of the seedlings.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> yunnan university

<120> mycorrhizal strain TP-13 with ability of promoting growth of new roots of dendrobe and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 610

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggctgggtaa gtctttgagt tcgctttttc cgttgtcctc gggacgttaa tgcgctctgg 60

tcgaggataa acgacccctc tgaccgaggt aaaacccgtc gctctgtgtt acctcgacga 120

ggcacacgtt aaagatcgtt ccgcgttgtg agtctaacac cagttgtata aactttttac 180

aaccggtagc gatggatccc ttggcacgtc attcgatgaa aaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaaaccggc tgcggtatgc ccctttgagc gtcattgtat cccttcggga 360

gtccttttcc aaaggacccg agttcagagt cctcggtcct cttctggatc gtgttctctt 420

agatgcgtcg caccgatcgc ctgatgggtc ctctaatgcc taagcgtgga gttccttcag 480

agtccgaaac gtgcttgacc gggtgttgag ctcgcgtcgc caagtctgcc ttaaccaaca 540

ggactacaac acatgacctc attggggtag gacaacccgc tagacttaag catatcaata 600

agcggaggaa 610

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tccgtaggtg aacctgcgg 19

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tcctccgctt attgatatgc 20

<210> 4

<211> 614

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tatgcttaag tctagcgggt tgtcctaccc caatgaggtc atgtggttgt agtaccaaac 60

ggtcctgacg gacgttggac ttgccgacac aggtctcacc acccggtcaa gcgcgtctcg 120

gcttcagagg gactccacgc tcaggcatta gagtgaccca tcaaagcgat cggcgcgatg 180

catctgagag aacacgatcc caaaggaccg aggactccga actcgggtct cacagcaaag 240

gagactcccg aaggatgtaa tgacgctcaa aggggcatac cgcagccggt ttagggcgcg 300

gtgcaatgcg ttcaacaact cgatgattca cgtataagtg gtggacttgc gcatcacatc 360

actttatcgc aatttgcaac ggtcttcatc gaatgacatg ccaagggatc cagcgctacc 420

ggttgtaaac tgttttttac aaccagtaag actcacaacg cggaacgatc tttaacgtgt 480

gcccacggag ggtaacacgg aatgcatgac aggttagcct cggtcagagg ggtcgtttat 540

cctcgaccag agcaccttaa cgtccggagg acaacggaac gaagcgtgcg tcagagacgt 600

ttactatgat cctt 614

<210> 5

<211> 611

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctgcggaagg atcatagtaa acgtctttga cgcacttcgt tccgtcgtcc tccggacgtt 60

aaggcgctct ggtcgaggat aaacgacccc tctgaccgag gctaacccgt cgcgcttccg 120

tgttaccgtc cgcggcacac gttaaagatc gttccgcgtt gtgagtcttg ctggttgtaa 180

taaactgttt acaaccggta gcgctggatc ccttggcacg tcattcgatg aagaccgttg 240

caaattgcga taaagtgatg tgatgcgcaa gtccaccact tatacgtgaa tcatcgagtt 300

gttgaacgca ttgcaccgcg ccctaaaccg gctgcggtat gcccctttga gcgtcattac 360

atccttcggg agtctccttt tctggagacc cgagttcgga gtcctcggtc ccttgggatc 420

gtgttctctc agatgcatcg cgccgatcgc tttgatgggt cactctaatg cctgagcgtg 480

gagtccctct gaagtcgaga cgcgtttgac cgggtggtga gcccgcgtcg gcaagtccac 540

gtccgctgcg acgtcggtac tacaaccaca tgacctcatt ggggtaggac aacccgctag 600

acttaagcat a 611

<210> 6

<211> 609

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaaaaactgg ggtgtctccc caatgaggtc atgcgttgta gtaccgacgt cccagaggaa 60

cgcggacttg gcgacacgag ctcaacgctc ggtcaagcgc atctccactc cgagggactc 120

cacgctcagg cattagagtg acccatcaga caatcagcgc gacgcatcta agagaacacg 180

gtccacagac cgaggactcc gaactcgggt ctaagaaaga ctcccgaagg gatacaatga 240

cgctcaaagg ggcataccgc agccggatta gggcgcggtg caatgcgttc aacaactcga 300

tgattcacgt ataagtggtg gacttgcgca tcacatcact ttatcgcaat ttgcaacggt 360

cttcatcgaa tgacgtgcca agggatccag cgctaccggt tgtaattgtt tttacaactg 420

gtgttagact cacaacgcgg aacgatcttt aacgtgtgcc tcggcaaaga ggtaacacca 480

ggacggattc acctctgtca gaggggtcgt ttatcctcga ccagagcacc ttaacgtccc 540

gaggacgatg gaaacagcac gtcaaagacg attacttatg atccttccgc aggtaccctt 600

acggaaagc 609

<210> 7

<211> 1042

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gaggtggttc gtctttgacg ttctatctcc atcgtcctcg ggacgttaag gcgctctggt 60

cgaggataaa ggacccctct gaccgaggct aaacggtcgc ttgcctgtgt tacctctttg 120

gaggcacacg ttaaagatcg ttccgcgttg tgagtctaac accagttgta aactttctac 180

aaccggcagc gctggatccc ttggcacgtc attcgatgaa gaccgttgca aattgcgata 240

aagtgatgtg atgcgcaagt ccaccactta tacgtgaatc atcgagttgt tgaacgcatt 300

gcaccgcgcc ctaatccggc tgcggtatgc ccctttgagc gtcattgtat tccttcggga 360

gtctttcctt gctgaaagac ccgagctcgg agtcctcggt cctttggatc gtgttctctc 420

agatgcgtcg cgccgatcgc ctgatgggta ctctaatgcc tgagcgtgga gtccctttga 480

gcttgagacg cgcatgaccg gccgttgggc tcgcgtcacc aagtccgcgt ccttctggac 540

gtcggtacta caacgcatga cctcattggg gtaggacaac ccgctagact taagcatatc 600

aataagcgga ggaaacggaa gccacttctc agcgacccgc cttctaatta catatctgta 660

gggagtgcac tagcaaggga tctccctctg gactgctacc gaccctatcg cacctagcgt 720

cggagctgac cagaggggat gccctcgccc tcgctatcct acccgatctc tactcgtatg 780

tacactatac gtgctattct tcccgaccta cacactcgtc tacgacaagt gtaattgcaa 840

ttccaagtta gagctcatag gctattactc gtaactaatc caaccgactg actggggtta 900

gatcaataat tccaaaaacc tagcatcctc tctattactg cgaatgctgc aagaagtgga 960

ctgtcctaat cttcaataac gtaaagcttg acttaatagc taccatcctt tcatcttggt 1020

aaagttcctt aaaccccaac gc 1042

<210> 8

<211> 618

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

tatgcttaag ttcagcgggt agtcccaccc gatttgaggt caaattgtca aacttgtcac 60

aaagacggtt cgcagcgcag agcccacttt gcttacgtgt ccataaggaa ctttgatcag 120

tgaagatgtt tatcacactg aagacgctgc aacagcaggg tacactcatg catttaaggc 180

cagtcgtmat tacacgacat tgcccaagtc cacttcytay racaaaagtc gtagaggtga 240

gattacaatg acactcaaac gggcgtaccc ttcggaatac caaagggtgc aaggtgcgtt 300

caaagattcg atgattcact gaattctgca attcacatta cttatcgcat ttcgctgcgt 360

tcttcatcgg tgcgagagcc aagagatccg ttgttgaaag ttgtatttat atgcgttatg 420

caaagacatt ccattacatt cagagtgtgt aaaaatacca tgagacccca gtcaaacacg 480

acgttcaacc agctgctcgt cagagacaag cggacctcac agtcaaaggt gcacaggtgt 540

gtggatttgc aatcgacgtg cacatgtgtt tccaccagca cagacgaccg cttatgattc 600

attaatgatc cttccgca 618

<210> 9

<211> 553

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttaccgagtt tacaactccc aaacccaatg tgaacgttac caaactgttg cctcggcggg 60

gtcacgcccc gggtgcgtaa aagccccgga accaggcgcc cgccggagga accaaccaaa 120

ctctttctgt agtcccctcg cggacgtatt tcttacagct ctgagcaaaa attcaaaatg 180

aatcaaaact ttcaacaacg gatctcttgg ttctggcatc gatgaagaac gcagcgaaat 240

gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcacattgc 300

gcccgccagt attctggcgg gcatgcctgt ccgagcgtca tttcaaccct cgaacccctc 360

cgggggatcg gcgttgggga tcgggacccc tcaccgggtg ccggccctga aatacagtgg 420

cggtctcgcc gcagcctctc ctgcgcagta gtttgcacaa ctcgcaccgg gagcgcggcg 480

cgtccacgtc cgtaaaacac ccaacttctg aaatgttgac ctcggatcag gtaggaatac 540

ccgctgaact taa 553

<210> 10

<211> 567

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

tatgcttaag ttcagcgggt attcctacct gatccgaggt caacctttat ataaggggtt 60

ttacggcagg ggccggaacc actacaaaag cgagatatag ttactacgct tagagtgaga 120

accaactccg ccaatcactt taaggagcta cgggctatgc cgtaggctcc caacgctaag 180

caacagggct taagtggtga aatgacgctc gaacaggcat gcccactaga atgctaatgg 240

gcgcaatgtg cgttcaaaga ttcgatgatt cactgaattc tgcaattcac attacttatc 300

gcatttcgct gcgttcttca tcgatgccag aaccaagaga tccgttgttg aaagttttaa 360

ctaattaagt ttatgattca gaattccaaa gaaaacagag tttagttggc cgccggcggg 420

gatgactacc gggtaacaaa tgtacctggg actgcagggt aatcactaag tggtaatccc 480

ccgcagggta gcctccgccg ccgaagcaac aaaggtaagt tcacataggg ttgggagttt 540

agaaaactct gtaatgatcc ctccgca 567

Claims (10)

1. A mycorrhizal fungi (Epulorrhiza sp.) strain TP-13 with the capability of promoting the growth of new roots of dendrobium nobile is characterized in that the preservation number is CCTCC NO: m20211285.

2. The mycorrhizal fungi strain TP-13 of claim 1, wherein the ITS sequence of said mycorrhizal fungi strain TP-13 is shown in SEQ ID NO 1.

3. A product for use in dendrobium nobile cultivation comprising the mycorrhizal fungi strain TP-13 of claim 1 or 2 and acceptable adjuvants.

4. The product of claim 3, wherein the product comprises a microbial agent and a bacterial fertilizer for dendrobium cultivation.

5. Use of the mycorrhizal fungi strain TP-13 according to claim 1 or 2 or the product according to claim 3 or 4 for dendrobium nobile cultivation.

6. The use of claim 5, wherein the dendrobe growth comprises dendrobe new root growth, promotion of growth of seedling leaves, sprout tillers and increase of dry seedling weight.

7. The use of claim 5, wherein said Dendrobium nobile comprises Dendrobium officinale.

8. A method for improving the growth of new roots of dendrobium nobile is characterized by comprising the following steps:

symbiotic culturing dendrobium seedlings and the mycorrhizal fungi strain TP-13 of claim 1 or 2.

9. The use according to claim 8, wherein the symbiotic culture medium is an oat culture medium.

10. The use according to claim 8 or 9, wherein the temperature of the symbiotic culture is 23-27 ℃, the light-dark period L/D of the symbiotic culture is 12/12, and the illumination intensity is 2000-3000 Lx.

Images