CN111763627A - Fungus for promoting growth of medicinal dendrobium officinale seedlings - Google Patents
Fungus for promoting growth of medicinal dendrobium officinale seedlings Download PDFInfo
- Publication number
- CN111763627A CN111763627A CN202010657855.7A CN202010657855A CN111763627A CN 111763627 A CN111763627 A CN 111763627A CN 202010657855 A CN202010657855 A CN 202010657855A CN 111763627 A CN111763627 A CN 111763627A
- Authority
- CN
- China
- Prior art keywords
- fungus
- dendrobium officinale
- seedlings
- culture
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Virology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Plant Pathology (AREA)
- Dentistry (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Biomedical Technology (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention relates to a fungus for promoting the growth of Dendrobium officinale (Dendrobium officinale) seedlings, which is Tulasnella sp.TYPD-2; the storage place: china center for type culture Collection, the preservation number is CCTCC NO: m2020165. The fungus can effectively promote the growth of roots, stems, leaves, dry weight and fresh weight of dendrobium officinale at seedling stage. According to the invention, the fungus and the dendrobium candidum aseptic seedlings are subjected to symbiotic culture on a sterilization culture medium, and TPYD-2 is compared with other two kinds of fungus and blank contrast, so that the result shows that the strain TPYD-2 can effectively promote the growth of the dendrobium candidum seedlings. The taxonomic status of the fungus is determined by colony characteristics, morphological characteristics and molecular biological means, and the similarity of the fungus and the tunasella sp (KP050605.1) reaches 97.42 percent; by utilizing the strain, a foundation can be laid for developing bionic cultivation and species regression of the medicinal dendrobium officinale.
Description
Technical Field
The invention belongs to the technical field of plant protection, and particularly relates to a fungus, and the technical field of culture conditions and application methods of the fungus.
Background
Dendrobium officinale (Dendrobium officinale) has extremely high medicinal value as a traditional and famous Chinese medicinal material, has more than 2000 years of use history and is known as the first of nine immortals in China. In the past, wild dendrobium is mainly collected, the dendrobium industry is mainly cultivated in intensive greenhouses from the last 90 th century due to depletion of wild resources, and through development of nearly 30 years, the problems of huge infrastructure investment, high planting technical requirements, doubtful product safety and land-to-land property and the like exist in the industrial mode.
As the seeds of the orchids are very tiny and only have incompletely developed embryos, the germination of the seeds needs to rely on specific symbiotic fungi to obtain nutrient substances under natural conditions, and the fungi are closely related to the whole life history stage of the orchids. The dendrobium officinale seedling stage is extremely important and is easily influenced by environmental factors, and the dendrobium officinale seedling stage is obtained by separating from the roots of adult orchidaceae plants in a traditional method and is used for verifying the effects of the dendrobium officinale seedling stage on seed germination, seedling growth and the like of the orchidaceae plants. However, studies have shown that orchids interact with different fungi at different stages. The dendrobium officinale seedling stage and the importance thereof are that effective fungi can be used for promoting the growth of seedlings, the growth period of dendrobium officinale is shortened, the success rate of field regression and auxiliary transplantation is improved, the obtained effective fungi is a key step for protecting rare endangered orchids, and symbiotic seedlings have good environmental adaptability after returning to a natural habitat, so that the effective symbiotic fungi for promoting the growth of the seedlings and the importance thereof are obtained, and the key link for developing ecological cultivation is also provided. The effective fungi are mostly obtained by separating from roots of wild orchids, but because a large amount of endophytic fungi with unknown action exist in the orchids, the screening and separation of the effective fungi become complicated and tedious, so that the fungi can be induced by using sterile seedlings of the orchids, and the fungi obtained by separating from the sterile seedlings can ensure the fungi at the seedling stage, which is the most direct and efficient method for obtaining the effective strains. Then carrying out symbiotic culture on the dendrobium officinale aseptic seedlings and the fungi obtained by separation in a mixed matrix, screening out the symbiotic fungi most effective on the dendrobium officinale seedlings, providing necessary conditions for efficiently producing mycorrhizal seedlings, and laying a foundation for developing regression and ecological cultivation of the dendrobium officinale.
Disclosure of Invention
The invention aims to provide a strain capable of effectively promoting the growth of dendrobium officinale seedlings aiming at the defects of the prior art.
The invention also aims to provide the specific application of the strain in dendrobium officinale breeding.
The purpose of the invention is realized by the following technical scheme.
A fungus of the invention is Tulasnella sp.TYPD-2; the storage place: china center for type culture Collection, the preservation number is CCTCC NO: m2020165, preservation date is 2020, 6.1.1.
Further, the nrDNA ITS sequence of the fungal strain of the present invention is characterized by:
GGGGGGGGGGTATCGGTCTTTGGACGTTCGCTTTTCGTTGTCCTCGGGACGTTAATGTG CTCTGGTCGAGGATAAATGACCCCTCTGACCGAGGTCAAACCTGTCACTGTGTTACCTC TTTACTGAGGCACACGTTAAAGATCGTTCCGCGTTGTGAGTCTAACACCAGTTGTATAA ACTTTTTACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCA AATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTT GTTGAACGCATTGCACCGCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTG TAATCCTTCGGGAGTCCTTTTAATTAAGGACCCGAGTTCGGAGTCCTCGGTCCTCTGGA TCGTGTTCTCTTAGATGCGTCGCACCGATCGCCTGATGGGTCCTCTAATGCCTAAGCGT GGAGTTCCTTCAGAGTCTGAGACGTGCTTGACCGGGTGTTGAGCTCGCGTCACCAAGTC CGCCTCACCGCGGGACCTACACCGCTGGACCCCTTTGGGGTAGACCACCCCGTTAAAC TTAGCCATATCATTAGGGGGGAGGAAAAAAAAAAAGGTGGCACCGAATAGCCAAAAA AAAAAATAAATAAAGAAAAGACAAAAAAGAGAAAACGGAAGAGAACGGGAAATGGG AGAGGCATTACAAAGGAGAACGACAAAAGAAGGGGAGGAAAACAAGGCGGAGGGGG GGGGGACGGGGAGGAAGAGGCAGGGAGGAGAAAAAGGGAGAAAAAAGAAGAGCGA GAGACAAAGATATAGAGGTACAGAGCCACCACAGCAGCCCCTGAAAACCACGCCGCT ACTAACATACTCATACGAAACAGAGAAATAAGAAATTAAAATGGATAAATGGGACGG TCAAGCGAACGTCTGCATACGAACGCGTTAAAGTGTGGCGTCGTAGTCGAGGTATATG ATGTAGTGACGTAAGAGCACTGAGATATCAATCACCTACCAGATGTCGACC。
further, the culture conditions of the fungal strain of the present invention are: culturing on PDA plate for 7 days, wherein the mycelium is white, aerial, regular colony morphology, circular, growth rate of 1.700 + -0.385 cm every two days, and culture time is long, and secondary metabolite is light yellow.
Further, the method for identifying the fungus strain in molecular biology comprises the following steps:
1) extracting fungus DNA by a CTAB method;
2) primers used for PCR amplification are ITS1 and ITS 4;
3)25 μ l of PCR reaction system comprises 2.5 μ l of 10 × PCR buffer, 0.4 μ l of dNTP, and 1.5 μ l of Mg2+1.5. mu.l ITS1, 1.5. mu.l ITS4, 0.2. mu.l Taq enzyme, 15.4. mu.l ddH2O, 2. mu.l of DNA template;
4) the amplification reaction was performed on a PCR instrument Perkin Elmer, with the following PCR cycles: pre-denaturation at 94 deg.C for 3min, and circulating for 1 time; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 1min, and 30 times of circulation; finally, extending for 10min at 72 ℃;
5) sequencing the PCR amplification product for Shanghai biological engineering company Limited; submitting the sequence to a national information center database of the biotechnology for comparison, and preliminarily confirming the following classification status: the BLAST comparison analysis shows that the strain is most similar to KP050605.1 fungus Tulasnella sp, and the maximum similarity reaches 97.42 percent.
Further, the application of the fungus of the invention is as follows: is used for promoting the growth of medicinal dendrobium officinale seedlings.
Further, the substrate for symbiotic culture of the fungus strain and the dendrobium officinale of the invention is as follows: the matrix is prepared by mixing bark, peat and coconut husk at equal volume ratio.
Further, the determination method for promoting the growth of the medicinal dendrobium officinale seedlings by using the fungus comprises the following steps:
1) transplanting the dendrobium candidum aseptic seedlings into an original habitat, separating when fungi are found to be infected into the roots of the dendrobium candidum seedlings, performing morphological and molecular identification on the obtained fungi, performing symbiotic culture experiments on the medical dendrobium candidum aseptic seedlings and the obtained fungi, screening out strains with the best growth promoting effect, and storing the strains at a refrigerator test tube inclined plane at 4 ℃ for later use;
2) taking out the test strains stored in the test tube inclined plane at 4 ℃, re-inoculating the test strains on a PDA plate culture medium, and placing the test strains in an artificial climate box for activated culture at 25 ℃; when the culture dish is full of fungus hyphae; taking out to be used as symbiotic culture material;
3) preparing a symbiotic culture medium: the matrix is prepared by mixing bark, peat and coconut husk in equal volume ratio; sterilizing the mixed matrix at 121 deg.C for 30 min; the total number of the treatments of 3 experimental groups and 1 blank control treatment is 4, each treatment comprises 24 pots, each pot comprises 5 dendrobium officinale seedlings, and the total number of the dendrobium officinale seedlings is 600;
4) preparing dendrobium officinale aseptic seedlings: sterile germination of Dendrobium officinale seeds on culture to obtain Dendrobium officinale sterile seedlings, and hardening off the seedlings by irradiation of sunlight; selecting the dendrobium officinale aseptic seedlings which are sown in the same batch and grow consistently as experimental materials; before transplanting, cleaning a culture medium on dendrobium officinale seedlings, soaking the dendrobium officinale seedlings for 30min by using carbendazim, and then airing the dendrobium officinale seedlings for later use;
5) symbiotic culture of the dendrobium officinale aseptic seedlings and fungi: transplanting the aseptic seedlings to be reserved in flowerpots containing sterilized mixed substrates with the radius of 5cm and the height of 10cm, inoculating agar blocks containing single fungus pure culture materials on the mixed culture substrates in the flowerpots treated by the experimental group, and connecting aseptic PDA culture medium agar blocks with the same size in a blank control treatment group; 4 treatments of dendrobium officinale seedlings and fungus culture are respectively placed in 4 artificial culture boxes, and the temperature is 25 ℃, the photoperiod is 12h/12 h-illumination (2000 Lx)/darkness is formed;
6) and (3) fungus colonization detection: after symbiotic culture, taking roots of dendrobium officinale seedlings every 30 days for bare-handed slicing, observing whether fungi are successfully colonized in the roots of the dendrobium officinale seedlings under a microscope, wherein no mycelium colonization is found in blank control treatment, no mycelium is found in experimental group treatment on 30 days and 60 days, and fungi are found in 3 experimental group treatment on 90 days; judging that the colonization is successful;
7) judging the promotion effect of the fungus on the dendrobium officinale seedlings: the longest root length, the longest leaf length, the plant height, the fresh weight and the dry weight of the 4 treated dendrobium officinale seedlings are measured in 120 days, 150 days and 180 days respectively, 8 pots are randomly extracted for each treatment in each stage, 40 seedlings are measured, and the experimental group and the control group are compared and analyzed to see whether the experimental group and the control group have differences or not.
Further, the effective symbiotic fungus for promoting the growth of the medicinal dendrobium officinale seedlings is a tunasella (Tulasnella) fungus.
Compared with the prior art, the invention has the following outstanding advantages:
(1) the invention takes the Mucor fungus separated from the dendrobium officinale seedling stage as a material, researches the growth promotion effect of the Mucor fungus on the medical dendrobium officinale seedling stage, and proves that the strain can remarkably promote the growth of the dendrobium officinale seedling, can remarkably promote the growth of roots, stems and leaves, namely promote the growth of biomass, shortens the growth period, and has the promotion effect in all aspects obviously superior to that of other two fungi. (2) The invention ensures that the obtained fungus is the fungus at the seedling stage of the iron sheet, and the promotion effect is very obvious.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail by examples and experimental data below. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
A fungus for promoting growth of medicinal Dendrobium officinale seedlings.
1. The strain is obtained by separating the roots of the seedlings of the dendrobium officinale in the Xingjiang Kongcun dendrobium candidum bionic cultivation base in 2018 and 9 months in Guizhou, performing morphological and molecular identification on the obtained fungus, and storing the strain in a refrigerator test tube inclined plane at 4 ℃ for later use; the nrdNAITS sequence of the strain related to the invention has been submitted to the national center for Biotechnology information database (NCBI, http:// www.ncbi.nlm.nih.gov /), and the Genbank number thereof is: MN 545849;
2. culturing a Mycoplasma rosenbergii strain with the number of TPYD-2 on a PDA plate for 7 days, wherein hypha is white, aerial, regular in colony morphology, circular, the growth speed is 1.700 +/-0.385 cm every two days, the culture time is long, and the color of a secondary metabolite is light yellow;
3. the obtained ITS fragment sequence of the symbiotic fungus effective to the growth of the dendrobium officinale seedlings is subjected to BLAST comparison analysis in a national center database of biotechnology information (NCBI, http:// www.ncbi.nlm.nih.gov /), and is most similar to KP050605.1 fungus Tulasnella sp, and the maximum similarity reaches 97.42%. The fungus is identified as the Mucor fungus according to the colony, morphological characteristics and molecular biological means.
4. Symbiotic culture test is carried out on the dendrobium officinale aseptic seedlings and 3 strains of fungi (all belong to the genus Acrophyllum):
carrying out symbiotic culture on the dendrobium officinale aseptic seedlings and fungi on a sterilization matrix, screening out the most effective fungi and comparing the difference of the growth promoting effects of different fungi on the dendrobium officinale seedlings;
4.1 taking out the test strains stored in the test tube inclined plane at 4 ℃, re-inoculating the test strains on a PDA plate culture medium, placing the test strains in an artificial climate box for culture at 25 ℃ and activating. Taking out the fungus hyphae as symbiotic culture material when the fungus hyphae grow over the culture dish (about 7 days);
4.2 preparing symbiotic culture mixed matrix: the symbiotic culture medium is prepared by mixing bark, peat and coconut husk in equal volume ratio. Sterilizing the mixed matrix at high temperature for later use; 3 experimental group treatments and a blank control treatment in total, wherein 4 treatments are performed in total, each treatment comprises 24 pots, 5 dendrobium officinale seedlings are planted in each pot, and 600 dendrobium officinale seedlings are planted in each pot;
4.3 preparing the dendrobium officinale aseptic seedlings: sterile seedlings of the dendrobium officinale are obtained by sterile germination of dendrobium officinale seeds on a culture medium, and seedlings are hardened by solar irradiation. The same batch of dendrobium officinale aseptic seedlings which are sown and grow consistently are selected as experimental materials. Before transplanting, the culture medium on the dendrobium officinale seedlings needs to be cleaned, then is soaked for 30 minutes by using carbendazim, and is dried for later use;
4.4 symbiotic culture of aseptic seedlings of dendrobium officinale and fungi: transplanting the aseptic seedling in a flowerpot with sterilized mixed matrix of 5cm in radius and 10cm in height, and inoculating the mixed culture matrix in the flowerpot treated by the experimental group to about 0.5cm3(1 × 1 × 0.5.5 cm) agar blocks containing pure cultures of a single fungus, placebo treated groups of sterile PDA Medium agar blocks of the same size Each treatment of seedlings of Dendrobium officinale and fungal cultures was placed in 4 artificial incubators, respectivelyCulturing at 25 deg.C under light of 12h/12h (2000 Lx)/dark; each treatment of the dendrobium officinale seedlings and the fungus culture is respectively placed in 4 artificial culture boxes to avoid mutual pollution of the fungi, and the seedlings and the fungi are watered regularly at the temperature of 25 ℃, in the photoperiod of 12h/12 h-illumination (2000 Lx)/darkness;
4.5 fungal colonization assay: after symbiotic culture, taking roots of dendrobium officinale seedlings every 30 days for bare-handed slicing, observing whether fungi are successfully colonized in the roots of the dendrobium officinale seedlings under a microscope, wherein no mycelial colonization is found in blank control treatment, no mycelial colonization is found in experimental group treatment on 30 days and 60 days, and successful colonization is found in 3 experimental group treatment on 90 days; the fungus colonization does not find the colonization of the hypha groups in the blank control treatment, no hypha groups are found in the experimental group treatment on the 30 th day and the 60 th day, the fungus colonization is successfully found in 3 experimental group treatment on the 90 th day, and the standard for judging the success of the colonization is that the existence of the hypha groups is obtained by observing under a microscope;
4.6 promoting effect of fungus on dendrobium officinale seedlings: respectively measuring the longest root length, the longest leaf length, the plant height, the fresh weight and the dry weight of the 4 treated dendrobium officinale seedlings within 120 days, 150 days and 180 days, and comparing and analyzing the measured values with a control group to determine whether the experimental group is different from the control group; proves the promotion effect of the fungus on the dendrobium officinale seedlings.
In the above steps, step 1, providing strain materials cultured by three test tube slants according to the requirements of a strain preservation unit, and warehousing the strain materials to obtain registration numbers of the registration book; meanwhile, uploading an ITS sequence obtained by sequencing to software provided by a Genbank and submitting the obtained number of the Genbank;
in the molecular identification described in step 3, the fungal DNA is extracted by CTAB method, primers used for PCR amplification are ITS1 and ITS4, and a PCR reaction system (25 μ l) comprises 2.5 μ l of 10 × PCR buffer solution, 0.4 μ l of dNTP and 1.5 μ l of Mg2+1.5. mu.l ITS1, 1.5. mu.l ITS4, 0.2. mu.l Taq enzyme, 15.4. mu.l ddH2O, 2. mu.l of DNA template. The amplification reaction was performed on a PCR instrument PerkinElmer, with the following PCR cycles: pre-denaturation at 94 deg.C for 3min, and circulating for 1 time; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 1min, and 30 times of circulation; finally, extension is carried out for 10min at 72 ℃. PCRThe amplification product was sequenced for Shanghai Bioengineering, Inc. Submitting the sequence to a national information center database of the biotechnology for comparison, and primarily determining the status under classification;
the mixed matrix for symbiotic culture in the step (4.2) simulates the growth characteristics of the dendrobium officinale;
selecting the same batch of aseptic dendrobium officinale seedlings which are sown and grow consistently as an experimental material in the step (4.3), wherein the error is reduced, and the aim of soaking the aseptic dendrobium officinale seedlings for 30 minutes by using carbendazim is to reduce the interference of mixed bacteria and prevent the roots of the young dendrobium officinale seedlings from rotting;
inoculating the mixed culture medium in the flowerpot treated by the experimental group in the step (4.4) to about 0.5cm3(1 × 1 × 0.5.5 cm) agar blocks containing a pure culture of a single fungus, a placebo treated group of sterile PDA medium agar blocks of the same size, in order to exclude interference with PDA medium;
taking roots in the previous stage to perform freehand slicing to observe the colonization condition of fungi, taking 4 treated roots to perform paraffin slicing in 180 days, and finding mycelial groups in the inoculation treatment and not finding mycelial groups in the non-inoculation treatment;
and (4.6) measuring the longest root length, the longest leaf length, the plant height, the fresh weight and the dry weight of the 4 treated dendrobium officinale seedlings in 120 days, 150 days and 180 days respectively, and screening out the fungi with the best promotion effect by adopting single-factor variance analysis.
Examples of the invention
Firstly, separation and identification of TPYD-2 strain of tunasella sp
1. Transplanting the dendrobium officinale aseptic seedlings into an original habitat, regularly performing microscopic examination, and taking roots back to a laboratory when fungi are found to be infected into the roots of the dendrobium officinale young seedlings;
2. separating, performing morphological and molecular identification on the obtained fungi, performing symbiotic culture experiment on the medical dendrobium candidum aseptic seedlings and the obtained fungi to screen out the strain with the best germination-promoting long-acting effect, and storing the strain at the inclined plane of a test tube of a refrigerator at 4 ℃ for later use;
3. cleaning the roots of the collected dendrobium officinale seedlings with tap water, removing attachments, immersing the roots in a sterilized beaker filled with a 1% sodium hypochlorite (NaClO) solution on a sterile operating platform for 5min, taking out the roots with sterilized blunt-ended tweezers, washing the roots with sterile water for 3-4 times, immersing the roots in 75% alcohol for 3min, and washing the roots with sterile water for 3-4 times. Separating by adopting a single mycelium pellet method, scraping the mycelium pellet into tiny fragments by using a dissecting needle, observing and finding the mycelium pellet under a dissecting mirror, transferring the mycelium pellet into a PDA culture medium by using a pipette, and inversely culturing at 25 ℃ in the dark. And (3) purifying when the hyphae grow to a certain length, wherein the hyphae tip is continuously cut and transferred to a new PDA culture medium for series in the purification process, and the pure bacterial colony can be obtained after 3-5 times of transfer.
3. And (3) fungus preservation: the purified fungi were preserved using a conventional tube slant method. The prepared proper amount of PDA medium was poured into a glass test tube of 18X 20mm in size, and the amount of the medium was 1/3 which was about the volume of the test tube. After the silica gel plug, the mixture was sterilized in an autoclave (121 ℃ C., 30 min). After sterilization, the test tube is placed in a superclean bench and is swung into an inclined plane for standby. On a clean bench, picking edge hyphae from the purified strain with a sterile inoculating needle, inoculating on PDA slant, and noting the strain, number and date. And (3) placing the inoculated test tube in a climatic chamber for culture at 25 +/-2 ℃. And taking out the test tube and storing the test tube in a refrigerator at 4 ℃ when hyphae grow over the PDA inclined plane.
The obtained strain is preserved in China center for type culture Collection; the strain is classified and named as Acrophyta (Tulasnella sp.) with the preservation number of CCTCC NO: m2020165.
Secondly, identifying the TPYD-2 strain of the Mucor
To confirm that the preservation number is CCTCC NO: the M2020165 strain has biogenetic information, ITS nrDNA ITS sequence has been submitted to the national center for Biotechnology information database (NCBI, http:// www.ncbi.nlm.nih.gov /) for preservation, ITS Genbank number is: MN545849, which is subjected to BLAST comparison, shows that the strain is most similar to KP050605.1 fungus Tulasnella sp, and the maximum similarity reaches 97.42 percent. The fungus of the invention is identified as a Mucor (Tulasnella) fungus according to colony, morphological characteristics and molecular biological means. Culturing the Mycoplasma rosenbergii with the number of TPYD-2 on a PDA plate for 7 days, wherein the hypha is white, aerial, regular in colony morphology, circular, the growth speed is 1.700 +/-0.385 cm every two days, the culture time is long, and the color of the secondary metabolite is light yellow;
the total DNA of the fungi related to the molecular biological identification is extracted by adopting a CTAB method; primers used for PCR amplification are fungus universal primers ITS1 and ITS 4; the PCR reaction system and conditions are carried out according to corresponding product instructions; and (3) sending the amplified product to Shanghai biological engineering Co., Ltd for sequencing. And (3) carrying out comparison analysis on the sequenced sequence in a national information center database of the biotechnology, and confirming the taxonomic status by combining morphological characteristics.
Third, fungus tie-back experiment
Utilize aseptic seedling of dendrobii officmalis caulis and fungi symbiotic culture on mixed matrix, detect whether the fungi that separate promotes the effect to dendrobii officmalis caulis seedling to contrast the difference of different fungi to dendrobii officmalis caulis seedling promotion effect:
1. preparing a symbiotic culture medium: the matrix is prepared by mixing bark, peat and coconut husk in equal volume ratio; sterilizing the mixed matrix at high temperature for later use; the total number of the treatments of 3 experimental groups and a blank control treatment is 4, each treatment comprises 24 pots, each pot comprises 5 dendrobium officinale seedlings, and the total number of the dendrobium officinale seedlings is 600.
2. And (3) re-culturing test strains: taking out the test strains stored in the test tube inclined plane at 4 ℃, re-inoculating the test strains on a PDA culture medium, and placing the test strains in an artificial climate box for culture at 25 +/-2 ℃ for activation. Taking out the mycelia as symbiotic culture material when the fungi mycelia grow over the culture dish.
3. Preparing dendrobium officinale aseptic seedlings: sterile seedlings of the dendrobium officinale are obtained by sterile germination of dendrobium officinale seeds on culture, and seedlings are hardened by irradiation of the sun. The same batch of dendrobium officinale aseptic seedlings which are sown and grow consistently are selected as experimental materials. Before transplanting, cleaning a culture medium on dendrobium officinale seedlings, soaking the dendrobium officinale seedlings for 30 minutes by using carbendazim, and then airing the dendrobium officinale seedlings for later use;
4. and (3) fungus tieback: transplanting the aseptic seedlings into the containerThe mixed culture medium in the flowerpot treated in the experimental group was inoculated to about 0.5cm in a flowerpot having a sterilized mixed medium with a radius of 5cm and a height of 10cm3(1 × 1 × 0.5.5 cm) containing agar blocks of pure culture of single fungus, and a blank control treatment group containing agar blocks of sterile PDA culture medium with the same size, placing the seedlings of Dendrobium officinale and each treatment of fungus culture in 4 artificial incubators respectively, and culturing at 25 + -2 deg.C under light cycle of 12h/12 h-illumination (2000 Lx)/dark;
6. counting the growth conditions of the dendrobium officinale seedlings:
6.1 detection of fungal colonization: after symbiotic culture, taking roots of dendrobium officinale seedlings every 30 days for bare-handed slicing, observing whether fungi are successfully colonized in the roots of the dendrobium officinale seedlings under a microscope, wherein no mycelial colonization is found in blank control treatment, no mycelial colonization is found in experimental group treatment on 30 days and 60 days, and successful colonization is found in 3 experimental group treatment on 90 days;
6.2 promoting effect of fungus on Dendrobium officinale seedlings: the longest root length, the longest leaf length, the plant height, the fresh weight and the dry weight of the 4 treated dendrobium officinale seedlings are measured in 120 days, 150 days and 180 days respectively, and compared with a control group for analysis, whether the experimental group is different from the control group or not is determined. And (4) counting the longest root length (R), the longest leaf length (S), the plant height (H), the fresh weight (F) and the dry weight (D) of the dendrobium officinale seedlings at each next treatment stage.
6.2 Single-factor ANOVA was performed in SPSS software (version 25.0), see Table 1.
Table 1:
note: mean ± SE, Mean ± standard error, r ═ x 100% of (longest root length treated with different inoculants-longest control root length)/longest control root length ], s ═ x 100% of (longest leaf length treated with different inoculants-longest control leaf length)/longest control leaf length ], h ═ x 100% of (height of different inoculants-height of control plants)/height of control plants, f ═ x 100% of (fresh weight treated with different inoculants-fresh control weight)/fresh control weight, and d ═ x 100% of (dry weight treated with different inoculants-dry control weight)/dry control weight).
6.3 the results show
TPYD-2 belongs to tuninella sp, comes from the seedling stage of dendrobium officinale and has obvious promotion effect on the seedling stage of the dendrobium officinale. TPYD-2 has good growth promotion effect on biomass and longest root length of seedlings; after inoculation and cultivation, 150d and 180d have obvious promotion effects on the longest leaf length and the plant height. 120d and 150d of TPYD-1 after inoculation and culture also have certain promotion effect on the longest root length and dry weight; however, there was no significant effect on the longest leaf length, plant height and fresh weight at 180 days after inoculation culture. TPYD-3 can obviously improve the dry weight of seedlings, promote the increase of the longest root length, the longest leaf length and the fresh weight under certain conditions, and has no obvious effect on the plant height.
The above description is only for the specific embodiment of the present invention (the protection scope of the present invention is based on the numerical content of the present invention and other technical gist scope), and the specific content or common sense known in the schemes is not described too much herein. It should be noted that the above-mentioned embodiments do not limit the present invention in any way, and all technical solutions obtained by means of equivalent replacement or equivalent transformation for those skilled in the art fall within the protection scope of the present invention. The scope of the claims of the present application shall be determined by the contents of the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.
<110> university of Yunnan
<120> fungus for promoting growth of medicinal dendrobium officinale seedlings
<160>1
<210>1
<211>1035
<212>DNA
<213> Artificial sequence
<400>1
GGGGGGGGGGTATCGGTCTTTGGACGTTCGCTTTTCGTTGTCCTCGGGACGTTAATGTGCTCTGGTCGAGGATAAATGACCCCTCTGACCGAGGTCAAACCTGTCACTGTGTTACCTCTTTACTGAGGCACACGTTAAAGATCGTTCCGCGTTGTGAGTCTAACACCAGTTGTATAAACTTTTTACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTAATCCTTCGGGAGTCCTTTTAATTAAGGACCCGAGTTCGGAGTCCTCGGTCCTCTGGATCGTGTTCTCTTAGATGCGTCGCACCGATCGCCTGATGGGTCCTCTAATGCCTAAGCGTGGAGTTCCTTCAGAGTCTGAGACGTGCTTGACCGGGTGTTGAGCTCGCGTCACCAAGTCCGCCTCACCGCGGGACCTACACCGCTGGACCCCTTTGGGGTAGACCACCCCGTTAAACTTAGCCATATCATTAGGGGGGAGGAAAAAAAAAAAGGTGGCACCGAATAGCCAAAAAAAAAAATAAATAAAGAAAAGACAAAAAAGAGAAAACGGAAGAGAACGGGAAATGGGAGAGGCATTACAAAGGAGAACGACAAAAGAAGGGGAGGAAAACAAGGCGGAGGGGGGGGGGACGGGGAGGAAGAGGCAGGGAGGAGAAAAAGGGAGAAAAAAGAAGAGCGAGAGACAAAGATATAGAGGTACAGAGCCACCACAGCAGCCCCTGAAAACCACGCCGCTACTAACATACTCATACGAAACAGAGAAATAAGAAATTAAAATGGATAAATGGGACGGTCAAGCGAACGTCTGCATACGAACGCGTTAAAGTGTGGCGTCGTAGTCGAGGTATATGATGTAGTGACGTAAGAGCACTGAGATATCAATCACCTACCAGATGTCGACC
Claims (8)
1. A fungus, wherein the fungus is Tulasnella sp. The storage place: china center for type culture Collection, the preservation number is CCTCC NO: m2020165.
2. The fungus according to claim 1, wherein: the nrDNA ITS sequence of the fungus strain is characterized in that: GGGGGGGGGGTATCGGTCTTTGGACGTTCGCTTTTCGTTGTCCTCGGGACGTTAATGTGCTCTGGTCGAGGATAAATGACCCCTCTGACCGAGGTCAAACCTGTCACTGTGTTACCTCTTTACTGAGGCACACGTTAAAGATCGTTCCGCGTTGTGAGTCTAACACCAGTTGTATAAACTTTTTACAACCGGTAGCGATGGATCCCTTGGCACGTCATTCGATGAAGACCGTTGCAAATTGCGATAAAGTGATGTGATGCGCAAGTCCACCACTTATACGTGAATCATCGAGTTGTTGAACGCATTGCACCGCGCCCTAATCCGGCTGCGGTATGCCCCTTTGAGCGTCATTGTAATCCTTCGGGAGTCCTTTTAATTAAGGACCCGAGTTCGGAGTCCTCGGTCCTCTGGATCGTGTTCTCTTAGATGCGTCGCACCGATCGCCTGATGGGTCCTCTAATGCCTAAGCGTGGAGTTCCTTCAGAGTCTGAGACGTGCTTGACCGGGTGTTGAGCTCGCGTCACCAAGTCCGCCTCACCGCGGGACCTACACCGCTGGACCCCTTTGGGGTAGACCACCCCGTTAAACTTAGCCATATCATTAGGGGGGAGGAAAAAAAAAAAGGTGGCACCGAATAGCCAAAAAAAAAAATAAATAAAGAAAAGACAAAAAAGAGAAAACGGAAGAGAACGGGAAATGGGAGAGGCATTACAAAGGAGAACGACAAAAGAAGGGGAGGAAAACAAGGCGGAGGGGGGGGGGACGGGGAGGAAGAGGCAGGGAGGAGAAAAAGGGAGAAAAAAGAAGAGCGAGAGACAAAGATATAGAGGTACAGAGCCACCACAGCAGCCCCTGAAAACCACGCCGCTACTAACATACTCATACGAAACAGAGAAATAAGAAATTAAAATGGATAAATGGGACGGTCAAGCGAACGTCTGCATACGAACGCGTTAAAGTGTGGCGTCGTAGTCGAGGTATATGATGTAGTGACGTAAGAGCACTGAGATATCAATCACCTACCAGATGTCGACC are provided.
3. The fungus according to claim 1, wherein: the culture conditions of the fungus strain are as follows: culturing on PDA plate for 7 days, wherein the mycelium is white, aerial, regular colony morphology, circular, growth rate of 1.700 + -0.385 cm every two days, and long culture time, and secondary metabolite is light yellow.
4. The fungus according to claim 1, wherein: the molecular biology identification method of the fungus strain comprises the following steps:
1) extracting fungus DNA by a CTAB method;
2) primers used for PCR amplification are ITS1 and ITS 4;
3)25 μ l of PCR reaction system comprises 2.5 μ l of 10 × PCR buffer, 0.4 μ l of dNTP, and 1.5 μ l of Mg2+1.5. mu.l ITS1, 1.5. mu.l ITS4, 0.2. mu.l Taq enzyme, 15.4. mu.l ddH2O, 2. mu.l of DNA template;
4) the amplification reaction was performed on a PCR instrument Perkin Elmer, with the following PCR cycles: pre-denaturation at 94 deg.C for 3min, and circulating for 1 time; denaturation at 94 deg.C for 1min, annealing at 51 deg.C for 1min, extension at 72 deg.C for 1min, and 30 times of circulation; finally, extending for 10min at 72 ℃;
5) sequencing the PCR amplification product for Shanghai biological engineering company Limited; submitting the sequence to a national information center database of the biotechnology for comparison, and preliminarily confirming the following classification status: the BLAST alignment analysis shows that the strain is most similar to KP050605.1 fungus Tulasnella sp, and the maximum similarity reaches 97.42%.
5. The fungus according to claim 1, wherein: the application of the fungus is as follows: is used for promoting the growth of medicinal dendrobium officinale seedlings.
6. The fungus according to claim 5, wherein: the substrate for symbiotic culture of the fungus strain and the dendrobium officinale comprises: the matrix is prepared by mixing bark, peat and coconut husk at equal volume ratio.
7. The fungus according to claim 5, wherein: the determination method for promoting the growth of the medicinal dendrobium officinale seedlings by using the fungus comprises the following steps:
1) transplanting the aseptic dendrobium officinale seedlings into an original habitat, separating when fungi are found to be infected into the roots of the young dendrobium officinale seedlings, performing morphological and molecular identification on the obtained fungi, performing symbiotic culture experiment on the aseptic dendrobium officinale seedlings and the obtained fungi, screening out a strain with the best growth promoting effect, and storing the strain in a refrigerator test tube inclined plane at 4 ℃ for later use;
2) taking out the test strains stored in the test tube inclined plane at 4 ℃, re-inoculating the test strains on a PDA plate culture medium, and placing the test strains in a climatic chamber for activated culture at 25 ℃; when the culture dish is full of fungus hyphae; taking out to be used as symbiotic culture material;
3) preparing a symbiotic culture medium: the matrix is prepared by mixing bark, peat and coconut husk in equal volume ratio; sterilizing the mixed matrix at 121 deg.C for 30 min; the total number of the treatments of 3 experimental groups and 1 blank control treatment is 4, each treatment comprises 24 pots, each pot comprises 5 dendrobium officinale seedlings, and the total number of the dendrobium officinale seedlings is 600;
4) preparing dendrobium officinale aseptic seedlings: sterile seedlings of the dendrobium officinale are obtained by sterile germination of dendrobium officinale seeds on culture, and seedlings are hardened by solar irradiation; selecting the dendrobium officinale aseptic seedlings which are sown in the same batch and grow consistently as experimental materials; before transplanting, cleaning a culture medium on the dendrobium officinale seedlings, soaking the dendrobium officinale seedlings for 30min by using carbendazim, and then airing the dendrobium officinale seedlings for later use;
5) symbiotic culture of the dendrobium officinale aseptic seedlings and fungi: transplanting the aseptic seedlings to be prepared into flowerpots containing sterilized mixed substrates with the radius of 5cm and the height of 10cm, inoculating agar blocks containing pure culture of single fungi on the mixed culture substrates in the flowerpots treated by the experimental group, and connecting aseptic PDA culture medium agar blocks with the same size in a blank control treatment group; 4 treatments of dendrobium officinale seedlings and fungus culture are respectively placed in 4 artificial culture boxes, and the temperature is 25 ℃, the photoperiod is 12h/12 h-illumination (2000 Lx)/darkness is achieved;
6) and (3) fungus colonization detection: after symbiotic culture, taking roots of dendrobium officinale seedlings every 30 days for bare-handed slicing, observing whether fungi are successfully colonized in the roots of the dendrobium officinale seedlings under a microscope, wherein no mycelial colonization is found in blank control treatment, no mycelial colonization is found in 30 days and 60 days of experimental group treatment, and fungi are found in 3 experimental group treatment in 90 days; judging that the colonization is successful;
7) judging the promotion effect of the fungus on the dendrobium officinale seedlings: the longest root length, the longest leaf length, the plant height, the fresh weight and the dry weight of the 4 treated dendrobium officinale seedlings are measured in 120 days, 150 days and 180 days respectively, 8 pots are randomly drawn for each treatment in each stage, 40 seedlings are measured, the experimental group and the control group are compared and analyzed, and whether the experimental group is different from the control group or not is judged.
8. The fungus according to any one of claims 1 to 7, wherein: the effective symbiotic fungus for promoting the growth of the medicinal dendrobium officinale seedlings is Tulasnella fungus of genus Tulasnella.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010657855.7A CN111763627B (en) | 2020-07-09 | 2020-07-09 | Fungus for promoting growth of medicinal dendrobium officinale seedlings |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010657855.7A CN111763627B (en) | 2020-07-09 | 2020-07-09 | Fungus for promoting growth of medicinal dendrobium officinale seedlings |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111763627A true CN111763627A (en) | 2020-10-13 |
| CN111763627B CN111763627B (en) | 2021-12-10 |
Family
ID=72726180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010657855.7A Active CN111763627B (en) | 2020-07-09 | 2020-07-09 | Fungus for promoting growth of medicinal dendrobium officinale seedlings |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111763627B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114381379A (en) * | 2022-01-11 | 2022-04-22 | 云南大学 | Mucuna strain TP-8 capable of improving sprouting capacity of dendrobium seedlings and application thereof |
| CN114395485A (en) * | 2022-01-11 | 2022-04-26 | 云南大学 | Mucuna strain TP-2 capable of promoting stem growth of dendrobium and application thereof |
| CN114395486A (en) * | 2022-01-11 | 2022-04-26 | 云南大学 | Murraya koenigii strain TP-3 with capacity of promoting high growth of dendrobium and application thereof |
| CN114717139A (en) * | 2022-01-11 | 2022-07-08 | 云南大学 | Turkey mycorrhiza strain TP-13 capable of promoting growth of new roots of dendrobium and application thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565676A (en) * | 2008-04-24 | 2009-10-28 | 中国医学科学院药用植物研究所 | Three fungus strains for promoting germination of arethusa seeds |
| CN101914456A (en) * | 2008-04-24 | 2010-12-15 | 中国医学科学院药用植物研究所 | Fungus for promoting orchid seeds to germinate |
| CN104651239A (en) * | 2015-02-13 | 2015-05-27 | 中国科学院西双版纳热带植物园 | Strain for promoting germination and seedling formation of Dendrobium devonianum seed and application thereof |
| CN106497838A (en) * | 2016-10-28 | 2017-03-15 | 云南山里红生物科技有限公司 | A kind of composite bacteria agent capable of Herba Dendrobii |
| CN109294930A (en) * | 2018-11-12 | 2019-02-01 | 云南大学 | A method of obtaining dendrobium candidum plantlet stage mycorrhizal fungi |
| CN110699261A (en) * | 2019-09-30 | 2020-01-17 | 云南大学 | Cuttlebone fungus strain for promoting germination of medicinal dendrobium seeds to form seedlings and application thereof |
-
2020
- 2020-07-09 CN CN202010657855.7A patent/CN111763627B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565676A (en) * | 2008-04-24 | 2009-10-28 | 中国医学科学院药用植物研究所 | Three fungus strains for promoting germination of arethusa seeds |
| CN101914456A (en) * | 2008-04-24 | 2010-12-15 | 中国医学科学院药用植物研究所 | Fungus for promoting orchid seeds to germinate |
| CN104651239A (en) * | 2015-02-13 | 2015-05-27 | 中国科学院西双版纳热带植物园 | Strain for promoting germination and seedling formation of Dendrobium devonianum seed and application thereof |
| CN106497838A (en) * | 2016-10-28 | 2017-03-15 | 云南山里红生物科技有限公司 | A kind of composite bacteria agent capable of Herba Dendrobii |
| CN109294930A (en) * | 2018-11-12 | 2019-02-01 | 云南大学 | A method of obtaining dendrobium candidum plantlet stage mycorrhizal fungi |
| CN110699261A (en) * | 2019-09-30 | 2020-01-17 | 云南大学 | Cuttlebone fungus strain for promoting germination of medicinal dendrobium seeds to form seedlings and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| TAO WANG等: "Functional Insights into the Roles of Hormones in the Dendrobium officinale-Tulasnella sp. Germinated Seed Symbiotic Association", 《INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES》 * |
| 杨建文等: "胶膜菌属真菌S7（Tulasnella sp.）及提取物对铁皮石斛种子萌发的影响", 《中国科学:生命科学》 * |
| 王伟英等: "一株铁皮石斛内生真菌的鉴定及对株型的影响", 《福建农业学报》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114381379A (en) * | 2022-01-11 | 2022-04-22 | 云南大学 | Mucuna strain TP-8 capable of improving sprouting capacity of dendrobium seedlings and application thereof |
| CN114395485A (en) * | 2022-01-11 | 2022-04-26 | 云南大学 | Mucuna strain TP-2 capable of promoting stem growth of dendrobium and application thereof |
| CN114395486A (en) * | 2022-01-11 | 2022-04-26 | 云南大学 | Murraya koenigii strain TP-3 with capacity of promoting high growth of dendrobium and application thereof |
| CN114717139A (en) * | 2022-01-11 | 2022-07-08 | 云南大学 | Turkey mycorrhiza strain TP-13 capable of promoting growth of new roots of dendrobium and application thereof |
| CN114717139B (en) * | 2022-01-11 | 2023-08-04 | 云南大学 | Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111763627B (en) | 2021-12-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111763627B (en) | Fungus for promoting growth of medicinal dendrobium officinale seedlings | |
| CN110699261B (en) | Cuttlebone fungus strain for promoting germination of medicinal dendrobium seeds to form seedlings and application thereof | |
| CN105794495B (en) | Armillaria mellea strain symbiotic with gastrodia elata and application thereof | |
| CN103468587B (en) | Fungi strain of Tulasnella and application thereof in promotion of germination of Cymbidium mannii seeds | |
| CN103981102B (en) | DSE bacterial strain 24L-4 and the application on Herba Dendrobii is produced thereof | |
| CN106416744B (en) | Gastrodia elata symbiotic armillaria mellea strain and preparation method thereof | |
| CN111876336B (en) | Mucuna fungus and application thereof in promoting germination of paphiopedilum brandisil seeds to form seedlings | |
| CN111793567B (en) | Mucoraceae fungus and application thereof in promoting paphiopedilum brandisil seeds to germinate and form seedlings | |
| CN114381379B (en) | Adhesive film fungus strain TP-8 with dendrobium seedling tillering improving capability and application thereof | |
| CN115537346A (en) | Mucillus mucilaginosus for promoting growth and differentiation of sansevieria trifasciata and application thereof | |
| CN106635821B (en) | A kind of mycorrhizal fungi and the preparation method and application thereof for promoting blueberry nutrient to absorb | |
| CN109749953B (en) | Bacillus cereus, microbial inoculum and preparation method and application thereof | |
| CN108913625A (en) | Salt tolerant streptomycete, its microbial inoculum and its microbial inoculum are promoting the application in plant growth | |
| CN114395486B (en) | Adhesive film fungus strain TP-3 with high growth promoting capability of dendrobium and application thereof | |
| CN114395485B (en) | Adhesive film fungus strain TP-2 capable of promoting stem thickness of dendrobium nobile and application | |
| CN104126508B (en) | The method of the quick Mycorrhizal of a kind of orchid aseptic seedling | |
| CN114507618B (en) | Oncomelania mycorrhizal fungus strain TP-11 with dendrobium new leaf growth promoting capability and application thereof | |
| CN114292759A (en) | Fusarium oxysporum with effect of preventing and treating continuous cropping obstacle of tobacco | |
| CN114717139B (en) | Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof | |
| CN115851447B (en) | Endophytic colletotrichum gloeosporioides S28 for promoting phosphorus absorption of fir plants | |
| CN116640670B (en) | Purple flower and sycamore endophytic fungus with growth promoting effect and application thereof | |
| CN112592838B (en) | Orchid mycorrhizal fungus PF07 and application thereof | |
| CN112795489B (en) | Orchid mycorrhizal fungus PF02 and application thereof | |
| CN112646734B (en) | Orchid mycorrhizal fungus PF06 and application thereof | |
| CN114480143B (en) | Trichoderma harzianum M6 for preventing and treating sclerotinia sclerotiorum of sunflower and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |