CN108770593A - A kind of Lepista mucla (Bull.:Fr.) Cooke bacterial strain and its sporocarp culture method - Google Patents

Abstract

The invention discloses a lilac mushroom strain and a fruiting body cultivation method thereof. The present invention provides lilac mushroom Lepista nuda DCH560, the preservation number of which is CGMCC No.15376. The lilac mushroom DCH560 (CGMCC No.15376) provided by the present invention is a bacterial strain isolated from specimens collected from Kuandian Manchu Autonomous County, Dandong, Liaoning, China, and the bacterial strain can obtain fruiting bodies after artificial domestication. The fruiting bodies cultivated by this strain have purple caps, thicker flesh, purple gills, and strong aroma, consistent with wild fruiting bodies. The present invention domesticates and obtains the fruiting body of Lilac mushroom, and develops a new variety of rare edible fungi, which is of great significance for protecting the germplasm resources of this species, enriching the resource of edible fungus species, enriching the vegetable basket, etc., and at the same time, the fungus is a typical grass-rot fungus , can use crop straw, which has ecological significance.

Description

A kind of lilac mushroom strain and its fruiting body cultivation method

technical field

The invention belongs to the technical field of microbes, and relates to a lilac mushroom strain and a fruiting body cultivation method thereof.

Background technique

Lilac mushroom Lepista nuda (Bull.) Cooke, also known as naked mushroom and amethyst mushroom, belongs to the family Agaricaceae, Tricholomaceae, and the genus Agaricus. Lilac Mushrooms. Lilac mushroom has a pleasant color, strong fragrance, tender and sweet, and excellent taste. It is known as "one family eats its taste, and ten families smell its fragrance". It is as popular as truffles and boletus in Europe, and is regarded as For the best ingredients.

As a rare edible and medicinal fungus, lilac mushroom has high research and development value, but so far the main source is wild collection, its natural resources are limited, and its quality cannot be guaranteed. Although some units have carried out the domestication and cultivation of Lilac mushroom, there is no report on the successful cultivation of fruiting bodies. The patent "A Lilac Mushroom Culture Medium Based on Yellow Distiller's Grain and Preparation Method of Lilac Mushroom Liquid Strain (CN201610552378.1)" provides a preparation method of Lilac Mushroom culture medium and Lilac Mushroom liquid strain based on rice distiller's grain , but no fruiting bodies were obtained; "A Lilac Mushroom Strain and Its Liquid Strain and Preparation Method CN201510877093.0" discloses a Lilac Mushroom strain and its liquid strains and preparation method, but also no fruiting body was obtained. Yanbian University's master's degree thesis "Syringa mycelium culture characteristics and artificial domestication cultivation" (Zhao Ting, 2010) studied the culture characteristics of Lilac mushroom mycelium, and carried out domestication research, but the results did not obtain children entity. Yao Zhiwei and others studied the induction synthesis of Lilac mushroom primordia, but did not obtain fruiting bodies (Yao Zhiwei; Yuan Yangbo; Gao Junwei, Preliminary Exploration of Lilac mushroom primordium-induced synthesis medium, Chemistry and Bioengineering, 2010, 27 (1): 59- 62.). In 1994, there was a report on the domestication and cultivation of the natural edible fungus Lilac mushroom in the tea garden (Dai Caiyun and Cui Xiaoming, 1994 Guizhou Tea 1: 24). It was reported that it was cultivated in the open field of the tea garden. After 7 months, the mushrooms were produced. The method used in the report was open field cultivation. There are many uncontrollable factors, and the fruiting time is long, so far no promotion has been seen.

Contents of the invention

One object of the present invention is to provide DCH560 strain of lilac mushroom (Lepista nuda).

The lilac mushroom (Lepista nuda) DCH560 strain provided by the present invention has a preservation number of CGMCC No. 15376.

The application of the above-mentioned lilac mushroom as a parent in cross breeding is also within the protection scope of the present invention.

The fruiting body obtained by cultivating the above-mentioned lilac mushroom is also within the protection scope of the present invention.

The mycelium obtained by cultivating the above-mentioned lilac mushroom is also within the protection scope of the present invention.

Another object of the present invention is to provide a method for cultivating the fruit body.

The method provided by the present invention comprises the following steps: the above-mentioned mycelium of Lilac mushroom is subjected to the preparation of original seed, the preparation of cultivated species, inoculation and germination, soil covering, fruiting management and fruiting in order to obtain fruiting bodies.

In the above method, the method for preparing the original seed comprises the following steps: inoculating the mycelium of the lilac mushroom described in claim 1 into the original seed culture medium, cultivating in the dark at 15-25°C, and the relative air humidity is 60%-70% until the culture medium is overgrown with mycelia to obtain the original species;

Or, the method for preparing the cultivar comprises the following steps: inoculating the original seed into the cultivation medium, cultivating in the dark at 15-25°C, and keeping the relative air humidity at 60%-70% until the culture medium is covered with mycelium, to obtain cultivars;

Alternatively, the method for inoculating and developing bacteria includes the following steps: inserting the cultivar into the cultivating material, cultivating in the dark at 15-25°C, and keeping the relative air humidity at 65%-75% until the mycelium is covered with the cultivating material;

Or, the method of covering soil includes the following steps: in the step of inoculating and developing bacteria, cover the material surface of the cultivation material with soil after the mycelium grows over the surface of the material, cultivate in the dark at 15-25°C, and the relative air humidity 70%-75%, the relative concentration of carbon dioxide in the air is 0.1%-0.5%, until the hyphae grow to the surface of the soil layer;

Or, the method for fruiting management includes the following steps: when the hyphae obtained in the step of covering soil grow to the surface of the soil layer, a layer of fine soil is added, the temperature is maintained at 15-23°C, the light intensity is 500-800Lux, and the air The relative humidity is 85%-95%, the relative concentration of carbon dioxide in the air is 0.05%-0.15%, and the mushroom primordium is obtained by culturing for 5-10 days;

Or, the method for fruiting includes the following steps: transferring the mushroom primordium obtained in the fruiting management step to an environment with an ambient temperature of 18-20°C, a relative air humidity of 75%-90%, and a relative concentration of carbon dioxide of 0.05%. Cultured under the condition of -0.15%, to obtain fruiting bodies.

The method also includes the step of harvesting the fruiting bodies, specifically, the mushrooms can be harvested after the fruiting bodies grow to eighth maturity and the mushroom caps are not fully unfolded.

In the above method, both the original seed medium and the cultivar medium are wheat grain medium or wheat cow dung medium; the original seed medium is the same as the cultivar medium.

The wheat grain medium is a medium obtained by adjusting the water mass fraction to 65% by using water as a raw material composed of 98% wheat grain, 1% gypsum and 1% lime;

The wheat grain and cow dung culture medium is a medium obtained by adjusting the water mass fraction to 65% with water from raw materials composed of 93% of wheat grain, 5% of cow dung, 1% of gypsum and 1% of lime.

In the above method, in the method for preparing the original seed, the dark culture at 15-25°C is dark culture at 22°C. The above-mentioned cultivation material is fermented dung grass material, which is fermented from crop straw, cow dung, soybean meal and gypsum.

The above-mentioned cultivation materials can be obtained by secondary fermentation of the following cultivation materials: the cultivation materials are mixed by crop straw (rice straw, wheat straw), animal manure (such as dried cow dung and/or chicken manure), bean foil and gypsum powder. The mass (dry weight) ratio of crop straw, animal manure, soybean foil and gypsum powder is 55:45:1.2:4.

In the present invention, the secondary fermentation is divided into pre-fermentation and post-fermentation. The pre-fermentation is: pre-wet the crop straw and cow dung 3-4 days before the composting, the moisture content is 65%-70%, composting and fermenting in a north-south direction, monitoring the temperature of the compost, as long as the internal temperature of the compost reaches 70°C or more Carry out a compost turning when beginning to descend last, through after 3-4 times compost turning, finish described pre-fermentation. The post-fermentation is as follows: re-fermenting the pre-fermented cultivation material, raising the internal temperature of the heap to 58-62°C and maintaining it for 12-24 hours, and then ventilating to reduce the temperature of the heap to 50-52°C and maintaining it for 4 hours. -6d, then lower the temperature of the pile to normal temperature (25-28°C). After completing the post-fermentation, the secondary fermentation is over. The cultivation raw materials through the secondary fermentation should have no ammonia smell, no excrement odor, and the obvious white actinomycete layer on the material surface can be seen, and the water content of the cultivation raw materials through the secondary fermentation is adjusted to 65% ( mass fraction), the pH value is adjusted to 7.0-7.5 to obtain the cultivation material.

In the method, the cultivation method may specifically be shelf cultivation.

The layer frame cultivation is as follows: the layer frame specification is 3-5 layers, the layer height is 0.6m, the width is 1.5m, and the bottom layer is 0.3m away from the ground (the length depends on the needs); Cultivation and fruiting.

The application of the above-mentioned fruiting bodies in food processing is also the protection scope of the present invention.

The lilac mushroom DCH560 (CGMCC No.15376) provided by the present invention is a bacterial strain isolated from specimens collected from Kuandian Manchu Autonomous County, Dandong, Liaoning, China, and the bacterial strain can obtain fruiting bodies after artificial domestication. The fruiting bodies cultivated by this strain have purple caps, thicker flesh, purple gills, and strong aroma, consistent with wild fruiting bodies. The present invention domesticates and obtains the fruiting body of Lilac mushroom, and develops a new variety of rare edible fungi, which is of great significance for protecting the germplasm resources of this species, enriching the resource of edible fungus species, enriching the vegetable basket, etc., and at the same time, the fungus is a typical grass-rot fungus , can use crop straw, which has ecological significance.

Preservation instructions

Proposed taxonomic name: Lilac mushroom

Latin name: Lepista nuda

Reference biological material: DCH560

Preservation institution: General Microbiology Center of China Committee for the Collection of Microorganisms

Depository institution abbreviation: CGMCC

Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing

Deposit date: April 17, 2018

Registration number of the collection center: CGMCC No.15376

Description of drawings

Figure 1 is a sample of Lilac mushroom collected in the field.

Fig. 2 The test tube culture (parent species) of Lilac mushroom DCH560 (CGMCC No.15376).

Fig. 3 is the mycelium growth status of DCH560 (CGMCC No.15376) cultured on PDA plate for 20 days.

Fig. 4 shows the growth status of DCH560 (CGMCC No. 15376) strain inoculated in 3 kinds of stock media with different formulations.

Fig. 5 shows the condition of full bacteria after 30 days of sowing of Lilac mushroom DCH560 (CGMCC No.15376) strain.

Fig. 6 shows the primordia differentiation status of the strain DCH560 (CGMCC No. 15376) of Syringa syringae.

Fig. 7 shows the fruiting status of the fruiting body of Lilac mushroom DCH560 (CGMCC No.15376).

Fig. 8 shows the basidiocarp and basidiospores obtained from the cultivation of the strain of Syringa syringae DCH560 (CGMCC No.15376).

Detailed ways

The experimental methods used in the following examples are conventional methods unless otherwise specified.

The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified.

Example 1. Acquisition and Identification of Lilac Mushroom DCH560 (CGMCC No.15376)

The bacterial strain DCH560 of the present invention is isolated from natural Lilac mushroom specimens (Lilac mushroom specimens were collected from Kuandian Manchu Autonomous County, Dandong, Liaoning, China in 2016), through the observation of its colony and hyphae morphological characteristics, combined with nuclear rDNA-ITS sequencing, the The strain was classified and identified.

1. Morphological features

Bacterial strain DCH560 was cultured on potato dextrose agar medium (PDA) at 20°C for 2 weeks. The diameter of the colony was about 5cm. See Figures 1 and 2). The hyphae are septate, transparent, with clavicle joints, 1.2-5μm in diameter, no asexual spores were observed.

2. Molecular biological characteristics

The rDNA-ITS sequence is used as a barcode (Schoch, C.L. et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences, 2012.109:6241-6246), widely used in fungal species identification . In the present invention, DNA extraction and rDNA-ITS amplification and sequencing are carried out on strain DCH560 (primers used are a primer pair composed of ITS4 and ITS5), and the sequencing result is shown in sequence 1 in the sequence table. The BLAST online alignment of the sequence in the NCBI database showed that the homologous similarity was 99% compared with the corresponding sequence of Lilac mushroom (Lepista nuda) (GenBank: KJ577474).

ITS4: 5'-TCCTCCGCTTATTGATATGC-3';

ITS5: 5'-GGAAGTAAAAGTCGTAACAAGG-3'.

In view of the above-mentioned morphological characteristics and the taxonomic identification research of the rDNA-ITS sequence, the strain DCH560 of the present invention was determined to be Lepista nuda. The strain has been preserved in the General Microorganism Center of China Committee for Culture Collection of Microorganisms (CGMCC for short, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing), and the preservation number is CGMCC No.15376.

Embodiment 2, the method for the fruiting body cultivation of Lilac mushroom DCH560 (CGMCC No.15376)

1. Cultivation process

The cultivation process of the fruiting body of Lilac mushroom DCH560 (CGMCC No.15376) is as follows: mother seed preparation→original seed preparation→cultivar seed preparation→inoculation and germination→covering soil→fruiting management→fruiting→harvesting.

(1) Preparation of mother species: inoculate the hyphae of Lilac mushroom DCH560 (CGMCC No.15376) after tissue separation and domestication into the mother species medium (test tube slant), 15-25°C (such as 20-23°C) ) in the dark and cultivated until the mycelium is covered with medium, and the obtained mycelium is used as the mother species (Fig. 3).

(2) Preparation of the original seed: transfer the mother seed obtained in step (1) to the original seed medium, and the inoculum size is to evenly insert 6-10 cells with a diameter of 1.0 cm in the original seed medium of every 750 mL volume. The size of the mother species of the bacterial strain block, the relative air humidity of 60%-70%, 15-25 ° C (such as 20-23 ° C) in the dark and culture until the mycelium is covered with the culture medium to obtain the original species.

(3) Preparation of cultivar: transfer the original seed obtained in step (2) to the cultivar culture medium, inoculate 30 bottles of 750mL cultivar in every 750mL bottle of original seed, 15-25°C (such as 20-23°C) ) in the dark, the relative humidity of the air is 60%-70%, and the medium is cultivated until the hyphae are covered with the culture medium to obtain the cultivar.

(4) Inoculation and germination: the cultivars gained in step (3) are inserted into the cultivation materials, and the ratio of access is to inoculate 2 bottles of cultivars (750mL) with the cultivation materials of every square meter of cultivation area. The inoculation method is layer sowing, and the Cultivated species are evenly sprinkled on the surface of the material, and then a layer of material is spread, covered with a film to keep moisture, cultivated in the dark at 15-25°C (such as 20-23°C), and the relative air humidity is 65%-75% (Figure 5).

(5) Overburden: after step (4) mycelium grows over the material surface, cover soil on the material surface of the above-mentioned cultivation material, cultivate in a dark place at 15-25°C (such as 20-23°C), and the relative air humidity is 70%-75% , Ventilate once a day to maintain the relative concentration of carbon dioxide in the air at 0.1%-0.5% (volume fraction);

The soil covering the soil is peat soil, which requires good air permeability and strong water holding capacity.

(6) Fruiting management: when the mycelium cultivated in step (5) grows to the surface of the soil layer, add a layer of fine soil, start to cool down, and light intensity is 500-800Lux weak light stimulation, and the relative air humidity is 85%- 95%, ventilate 2-3 times a day to reduce the relative concentration of carbon dioxide to 0.05%-0.15% (volume fraction), and cultivate for 5-10 days.

(7) Fruiting: After finding a large number of mushroom primordia (Fig. 6), transfer to an environment where the temperature is 18-20°C, the relative air humidity is 75%-90%, and the relative concentration of carbon dioxide is 0.05%-0.15% (volume fraction) cultured under conditions (Figure 7).

(8) Harvesting: When the fruiting body grows to eighth maturity and the cap is not fully unfolded, the first damp mushroom can be harvested. After picking, clean up the remaining mushroom roots and fill the mushroom holes. After the mycelium recovers, repeat the above operations to produce mushrooms, and harvest the next tide mushrooms.

The above-mentioned mother seed medium can be PDA medium, enriched PDA medium or bran soaking medium;

Each liter of PDA medium was prepared as follows: put 200g of potatoes into 900mL of water and boil for 20min, add the filtrate to 20g of agar and heat it to completely dissolve, add water to make up to 1000mL, and sterilize at 121°C for 30min to obtain 1LPDA medium.

Each liter of enriched PDA medium is prepared according to the following method: put 200g of potatoes into 900mL of water and boil for 20min, take the filtrate and add 20g of agar, 20g of sucrose or glucose, 3g of potassium dihydrogen phosphate, and 1.5g of magnesium sulfate, and heat to dissolve it completely , add water to make up to 1000mL, and sterilize at 121°C for 30min to obtain 1L enriched PDA medium.

Per liter of bran infusion medium is prepared as follows: put 100g of bran into 900mL water and boil for 20min, take the filtrate and add 20g of agar, 20g of sucrose or glucose, 3g of potassium dihydrogen phosphate, and 1.5g of magnesium sulfate, and heat to make it Completely dissolve, add water to make up to 1000mL, obtain 1L of the bran infusion medium;

The above-mentioned original seed medium and the above-mentioned cultivar medium are wheat grain medium or wheat grain cow dung medium.

Wheat grain medium formula: 98% wheat grain, 1% gypsum, and 1% lime (mass fraction). The preparation method is to soak the wheat grains for 12-24 hours, boil for about 20 minutes, and pay attention to prevent the wheat grains from bursting. After cooking, take it out, rinse with clean water, drain the water, add the rest of the ingredients, dissolve and stir well.

The wheat grain and cow dung medium is 93% of wheat grain, 5% of cow dung, 1% of gypsum, and 1% of lime (mass fraction). The preparation method is to soak the wheat grains for 12-24 hours, boil for about 20 minutes, and pay attention to prevent the wheat grains from bursting. After cooking, take it out, rinse with clean water, drain the water, add the rest of the ingredients, stir well and serve.

The above-mentioned cultivation material is dung grass fermented material, which is fermented from crop stalks, cow dung, soybean meal and gypsum. Specifically, it is obtained by secondary fermentation of the following cultivation materials:

The above-mentioned cultivation raw materials are mixed by crop straw (rice straw, wheat straw), animal manure (such as dry cow dung and/or chicken manure), bean foil and gypsum powder. The mass of crop straw, animal manure, bean foil and gypsum powder (dry Heavy) ratio is 55:45:1.2:4.

The above-mentioned secondary fermentation is divided into pre-fermentation and post-fermentation. The pre-fermentation is: pre-wet the crop straw and cow dung 3-4 days before the composting, the moisture content is 65%-70%, composting and fermenting in the north-south direction, and monitoring the temperature of the compost , as long as the internal temperature of the heap reaches 70°C and starts to drop, turn the pile once, and after turning the pile 3-4 times, the pre-fermentation is completed.

The above post-fermentation is: ferment the pre-fermented cultivation material again, raise the internal temperature of the pile to 58-62°C and keep it for 12-24h, and then ventilate to lower the temperature of the pile to 50-52°C and keep it for 4-6d. Then lower the temperature of the stack to normal temperature (25-28°C). After the fermentation is completed, the secondary fermentation is over.

The cultivation raw material through secondary fermentation should have no ammonia smell, no excrement odor, and obvious white actinomycetes layer can be seen on the material surface, and the water content of the cultivation raw material through secondary fermentation should be adjusted to 65% (mass fraction) , the pH value is adjusted to 7.0-7.5, and the cultivation material is obtained.

The cultivation method of the above-mentioned step (4) can specifically be layered cultivation.

The cultivation of the above-mentioned shelf is as follows: the specification of the shelf is 3-5 floors, the floor height is 0.6m, the width is 1.5m, and the bottom layer is 0.3m from the ground (the length depends on the need); mushroom.

2. Condition optimization

The following factors in the cultivation process were optimized respectively: the cultivation temperature of the original seed and the formula of the original seed medium.

1. Determination of the original seed culture temperature

The hyphae of the lilac mushroom DCH560 (CGMCC No.15376) obtained by tissue separation was inoculated on the PDA medium according to the inoculation block amount of 1.0 cm in diameter by punching, and placed at different temperatures (15, 20 , 22, 25, 30° C.) for culture in the dark, measure the growth rate of the mycelium during the culture process, and observe the growth of the mycelium.

The experiment was repeated three times, and the quantitative data were averaged.

The results are shown in Table 1. It can be seen that under the condition of 22°C, the growth rate of mycelium of Lilac mushroom DCH560 (CGMCC No.15376) is faster, which is significantly higher than that under other temperature conditions.

Table 1 is the measurement result of mycelium growth rate under different temperatures (unit: mm/d)

Note: The same letters in the same column indicate no significant difference in multiple tests (P=0.05).

2. Determination of the original seed medium

Inoculate the mother species of the same batch of Lilac Mushroom DCH560 (CGMCC No.15376) cultivated under the same conditions in 750mL culture bottles of different original seed media (see below for the formula), and place them in a constant temperature incubator at 22°C to avoid Light continuous culture, the relative air humidity is 60%-70%, observe and count the germination time of mycelia and the time for mycelium to fill the bottle.

The original seed medium for testing is the following three kinds (Fig. 4, A wheat grain cow dung medium, B wheat grain medium, C sawdust medium):

Recipe 1: Cottonseed Hull Sawdust Medium

40% cottonseed hulls, 50% sawdust, 8% wheat bran, 1% gypsum, 1% sucrose;

Recipe 2: Wheat Grain Medium

Wheat grain 98%, gypsum 1%, quicklime 1%;

Recipe 3: Wheat Grain and Cow Dung Medium

Wheat grain 93%, cow dung 5%, gypsum 1%, quicklime 1%;

The parts of each material in the above formula are parts by weight (dry weight). On the basis of the above formulas, water was added to adjust the humidity until the water mass fraction was 65%, that is, the three original culture media for testing were obtained.

Quicklime and gypsum powder are produced by Tianjin Zhiyuan Chemical Reagent Co., Ltd.

The results show (Fig. 4), the germination time of Lilac mushroom DCH560 (CGMCC No.15376) is earlier in the original seed medium (named wheat grain medium and wheat grain medium) corresponding to formula 2 and formula 3 , The mycelium grows faster, the mycelium is thicker, and the growth condition is better. On the formula 1 wood chip medium, the growth rate of mycelia was slow and stopped growing gradually.

3. The characteristics of the fruiting body obtained from the cultivation of Lilac mushroom DCH560 (CGMCC No.15376)

According to one method, get the subentity.

Not only the fruiting bodies of Lilac Mushroom DCH560 (CGMCC No.15376) were successfully cultivated, but also basidiospores and basidiospores were observed (Fig. 8, A B: basidiospores, C basidiospores growing on the basidiospores). The diameter of the cultivated fruiting body cap is 3-12cm, the cap is purple, and the edge is involuted. Thin-walled to slightly thick-walled hyphae, moderately branched, curved, and some hyphae are swollen and interlaced, usually 4-10 μm in diameter, and the diameter of expanded hyphae is up to 15 μm. Mycelia in gills are colorless, thin-walled, less branched, frequently separated, slightly curved, regularly arranged, 2.5-6 μm in diameter; no cysts in hymenium; basidiocarp nearly club-shaped, with 2-4 A small stem with a size of (24.0-26.0)×(5.0-7.0)μm. Basidiospores are oblong, colorless, thin-walled to slightly thick-walled, and the size is (6.7-9.0)×(4.0-5.5) μm.

sequence listing

<110> Institute of Microbiology, Chinese Academy of Sciences

<120> A kind of lilac mushroom strain and its fruiting body cultivation method

<160> 1

<170> PatentIn version 3.5

<210> 1

<211> 649

<212>DNA

<213>Lilac mushroom Lepista nuda (Bull.)

<400> 1

atcattattg aataaacttg gttgggttgt gctggctttt cggagcatgt gcacgcctag 60

cgccattttt accacctgtg cacattttgt agatttggaa caattctcga gtttactcgg 120

tttgaggaat gctatgccaa aagcttagct ttccttgtgtttcaagtcta tgtttttata 180

tacccccatac gaatgtaata gaatgtcatt aatggggctta tagcctttaa attaatacaa 240

ctttcaacaa cggatctctt ggctctcgca tcgatgaaga acgcagcgaa atgcgataag 300

taatgtgaat tgcagaattc agtgaatcat cgaatctttg aacgcacctt gcgctccttg 360

gtattccgag gagcatgcct gtttgagtgt cattaaattc tcaacctttt cagcttttac 420

aagttgtatt ggcttggatg tggaggtttt gcaggcttct taagaagtca gctcctctta 480

aatgcattag cggaaccttt gtggaccagc tttggtgtga taattatcta cgccatggtt 540

gtaaagcagc tttatatggg gttcagcttc taacagtcca tttacttgga caatttctga 600

catcttgacc tcaaatcagg tagggactacc cgctgaactt aagcattca 649

Claims (9)

1. Lilac mushroom (Lepista nuda) DCH560, its preservation number is CGMCC No.15376. 2. the application of the lilac mushroom described in claim 1 in carrying out cross-breeding as parent. 3. the fruit body obtained by cultivating the lilac mushroom described in claim 1. 4. cultivating the mycelium that the lilac mushroom described in claim 1 obtains. 5. the cultivation method of fruiting body described in claim 3, comprises the steps: the mycelia of lilac mushroom described in claim 1 is carried out successively original seed preparation, cultivated species preparation, inoculation and send out bacterium, cover soil, fruiting Management and fruiting, to obtain fruiting bodies. 6. The method according to claim 5, characterized in that: The method for preparing the original seed comprises the following steps: inoculating the mycelium of the lilac mushroom described in claim 1 into the original seed culture medium, cultivating in the dark at 15-25°C, and the relative air humidity is 60%-70 % to mycelia overgrown with the culture medium to obtain the original species; Or, the method for preparing the cultivar comprises the following steps: inoculating the original seed into the cultivation medium, cultivating in the dark at 15-25°C, and keeping the relative air humidity at 60%-70% until the culture medium is covered with mycelium, to obtain cultivars; Alternatively, the method for inoculating and developing bacteria includes the following steps: inserting the cultivar into the cultivating material, cultivating in the dark at 15-25°C, and keeping the relative air humidity at 65%-75% until the mycelium is covered with the cultivating material; Or, the method of covering soil includes the following steps: in the step of inoculating and developing bacteria, cover the material surface of the cultivation material with soil after the mycelium grows over the surface of the material, cultivate in the dark at 15-25°C, and the relative air humidity 70%-75%, the relative concentration of carbon dioxide in the air is 0.1%-0.5%, until the hyphae grow to the surface of the soil layer; Or, the method for fruiting management includes the following steps: when the hyphae obtained in the step of covering soil grow to the surface of the soil layer, a layer of fine soil is added, the temperature is maintained at 15-23°C, the light intensity is 500-800Lux, and the air The relative humidity is 85%-95%, the relative concentration of carbon dioxide in the air is 0.05%-0.15%, and the mushroom primordium is obtained by culturing for 5-10 days; Or, the method for fruiting includes the following steps: transferring the mushroom primordium obtained in the fruiting management step to an environment with an ambient temperature of 18-20°C, a relative air humidity of 75%-90%, and a relative concentration of carbon dioxide of 0.05%. Cultured under the condition of -0.15%, to obtain fruiting body. 7. The method according to claim 6, characterized in that: Both the original seed medium and the cultivar medium are wheat grain medium or wheat grain cow dung medium; The wheat grain medium is a medium obtained by adjusting the water mass fraction to 65% by using water as a raw material composed of 98% wheat grain, 1% gypsum and 1% lime; The wheat grain and cow dung culture medium is a medium obtained by adjusting the water mass fraction to 65% with water from raw materials composed of 93% of wheat grain, 5% of cow dung, 1% of gypsum and 1% of lime. 8. The method according to claim 6 or 7, characterized in that: In the method for preparing the original seed, the dark culture at 15-25°C is dark culture at 22°C. 9. the application of fruit body described in claim 3 in food processing.