LT3948B - Polypeptide, plasmids, method for the preparation of plasmids, method for the preparation of polypeptide, thrombolytic material and applicatio of polypeptide - Google Patents

Polypeptide, plasmids, method for the preparation of plasmids, method for the preparation of polypeptide, thrombolytic material and applicatio of polypeptide Download PDF

Info

Publication number
LT3948B
LT3948B LTIP1532A LTIP1532A LT3948B LT 3948 B LT3948 B LT 3948B LT IP1532 A LTIP1532 A LT IP1532A LT IP1532 A LTIP1532 A LT IP1532A LT 3948 B LT3948 B LT 3948B
Authority
LT
Lithuania
Prior art keywords
plasmid
pro
glu
ser
plasmids
Prior art date
Application number
LTIP1532A
Other languages
Lithuanian (lt)
Inventor
Gerd Josef Steffens
Wolfgang Amandus Guenzler
Leopold Flohe
Regina Elfried Brigelius-Flohe
Bernhard Wolf
Original Assignee
Gruenenthal Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gruenenthal Gmbh filed Critical Gruenenthal Gmbh
Publication of LTIP1532A publication Critical patent/LTIP1532A/en
Publication of LT3948B publication Critical patent/LT3948B/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6421Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
    • C12N9/6424Serine endopeptidases (3.4.21)
    • C12N9/6456Plasminogen activators
    • C12N9/6462Plasminogen activators u-Plasminogen activator (3.4.21.73), i.e. urokinase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/315Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
    • C07K14/3153Streptokinase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y304/00Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/21Serine endopeptidases (3.4.21)
    • C12Y304/21073Serine endopeptidases (3.4.21) u-Plasminogen activator (3.4.21.73), i.e. urokinase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Diabetes (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Saccharide Compounds (AREA)

Abstract

Polypeptides of the general formula Ser-X1-X2-rscuPA<143-411> (1) in which X1 and X2 are defined amino acids or lower peptide bridges, X2 can also be a single bond, and rscuPA<143-411> is the unglycosylated sequence region of amino acids 143 (Glu) to 411 (LeuOH) from scu-PA 54 k, which can be used as plasminogen activators are described. To obtain these compounds, plasmids which are described in detail as such or in terms of their isolation were produced and expression thereof in suitable bacterial hosts provides, in each case in high yields, an expression product which does not act as plasminogen activator but whose protein-chemical conversion then leads to the single-chain compounds of the formula I which are valuable as plasminogen activators. <IMAGE>

Description

Pagal šį aprašymą nauji polipeptidai yra efektyvūs plazminogeno aktyvatoriai, todėl jie su dideLe sėkme naudojami kaip trombolitinės medžiagos. Gydant fibrino sudarytus trombus kraujagyslėse, pavyzdžiui, miokardo infarktas, plaučių arterijos embolija, galūnių venų ir arterijų trombozė ir kt., didelę reikšmę turi plazminogeno aktyvatoriai. Apytikriai nuo 1950 m. pradžios žinoma, kad žmogaus šlapime yra mažiausia vienas proteolitinis fermentas, kuris paverčia plazminogeną į plazminą, tai yra, į fermentą, kuris suskaldo fibriną į tirpius polipeptidus ir tuo pačiu ištirpina fibrino trombus. Šis plazminogeno aktyvatorius buvo pavadintas urokinaze, po to pasirodė, kad faktiškai egzistuoja įvairios urokinazės formos, mažų mažiausia žinomas nuo 1970 metų urokinazės pirmtakas - prourokinazė. Ši prourokinazė turi vieną grandinę, taip pat yra vadinama scu-PA (urokinazės tipo vienos grandinės plazminogeno aktyvatorius). Šią scu-PA sudaro 441 aminorūgšties liekana, gamtinėje formoje yra glikozilinta 302 aminorūgšties liekanos. Šios scu-PA molekulinė masė (Mr) literatūroje yra nurodoma apytikriai 54 000 daltonų.According to this description, novel polypeptides are potent activators of plasminogen and are therefore used with thideLe success as thrombolytic agents. Plasminogen activators play an important role in the treatment of fibrin-derived thrombi in blood vessels such as myocardial infarction, pulmonary artery embolism, limb vein and arterial thrombosis, etc. Approximately since 1950 Beginning in the early 1990s, human urine contains at least one proteolytic enzyme that converts plasminogen into plasmin, that is, an enzyme that breaks down fibrin into soluble polypeptides while dissolving fibrin thrombi. This plasminogen activator was called urokinase, after which it appeared that various forms of urokinase actually exist, the smallest known urokinase precursor since 1970, the prourokinase. This prourokinase has a single chain and is also called scu-PA (urokinase-like single chain plasminogen activator). This scu-PA consists of 441 amino acid residues and is naturally glycosylated with 302 amino acid residues. The molecular weight (M r ) of this scu-PA is reported in the literature at approximately 54,000 daltons.

Po to, kai 1977 metais Nolan ir kiti (Biochim. Biophys. Actą 496, p. 384-400) nustatė žmonių audinių kultūroje, tarp kitko, urokinazės profermentą, kurio molekulinė masė atitiko žinomos mažos molekulinės masės formos urokinazės molekulinei masei (31 500 D) , Wijngaards ir kiti (Thrombosis Res. 42 (1986), p. 749-760) ir Pijken ir kiti (Thrombosis Res. 42 (1986), p. 761-768) pranešė, kad egzistuoja prourokinazė, kurios dydis 30kD (30 kilodaltonų), beždžionių audinių kultūroje, apie jos gryninimą ir fibrinolitines savybes. Taip pat 1986 metais Strump ir kiti pranešė (J. Biol. Chem. 261 p. 1712017126), kad žmonių auglio CALU-3 (ATCC, HTB 55) supernatente yra vienos grandinės prourokinazė, kurios molekulinė masė (Mr) yra apie 32 000 daltonų ir tam, kad skirti nuo didelės molekulinės masės prourokinazės ( scu-PA 54k ) buvo pavadinta scu-PA32k. Šis scu-PA 32k atitinka scu-PA 54k, kuriame nėra 143 aminorūgščių liekanų iš N-galo (nuo Ser1 iki Glu143) , glikozilinta yra ta pati aminorūgšties liekana 302 (Asn.).Following the discovery in 1977 of a urokinase proferment in human tissue culture, by Nolan et al., Biochim. Biophys. ), Wijngaards et al. (Thrombosis Res. 42 (1986), pp. 749-760) and Pijken et al. (Thrombosis Res. 42 (1986), pp. 761-768) reported the existence of a 30kD prourokinase (30 kilodaltons) in monkey tissue culture for its purification and fibrinolytic properties. Also in 1986, Strump et al. (J. Biol. Chem. 261, p. 1712017126) reported that the human tumor CALU-3 (ATCC, HTB 55) supernatant contains a single chain prourokinase with a molecular weight (M r ) of about 32,000. daltons and was designated scu-PA32k to distinguish them from high molecular weight prourokinase (scu-PA 54k). This scu-PA 32k corresponds to a scu-PA 54k lacking the N-terminus of 143 amino acids (Ser 1 to Glu 143 ), glycosylated being the same amino acid residue 302 (Asn.).

Publikuotoje Europos paraiškoje Nr. 247 674 Al aprašomas scu-PA32k gavimas iš ląstelių linijos CALU-3 maitinimo terpės ir iš transfekuotų plazmidėmis pSVscu-PA-32k ir pSVSDHFR ląstelių CHO- (kinietiškų žiurkėnų kiaušidžių ląstelės) maitinimo terpės. Nors ten minima galimybė panaudoti genetiškai pakeistus mikroorganizmus, norint gauti scu-PA 32k, bet papildomas aprašymas arba atitinkamas pavyzdys nepateikti.The published European application no. 247,674 Al describes the production of scu-PA32k from culture medium CALU-3 and from CHF (Chinese Hamster Ovary) cells transfected with plasmids pSVscu-PA-32k and pSVSDHFR. Although there is mention of the possibility of using genetically modified microorganisms to obtain scu-PA 32k, no further description or corresponding example is provided.

Europos paraiškoje Nr. 92 182 A2 aprašoma, tarp kitko, DNR koduojančių mažos molekulinės masės urokinazę, kurios molekulinė masė apie 33 000 daltonų, ir atitinkamų plazmidžių gavimas, o taip pat jų ekspresija E. coli K12 294 (ATCC, 31 446) ląstelėse neglikozilinto baltymo, kurio molekulinė masė apie 33 000 daltonų, su nurodyta ten fig. 2A aminorūgščių liekanų seka, kuri atitinka srityje nuo 133 iki 411 scu-PA 54k baltymui.In European application no. No. 92,182 A2 describes, among other things, the production of DNA encoding low molecular weight urokinase having a molecular weight of about 33,000 Daltons and the corresponding plasmids, as well as their expression in E. coli K12 294 (ATCC, 31,446) non-glycosylated protein with molecular having a mass of about 33,000 Daltons, with the order of fig. 2A amino acid residue sequence corresponding to region 133 to 411 of the scu-PA 54k protein.

Apie kai kurias neglikozilinto produkto, kuriame yra 136-411 aminorūgščių liekanos, aprašė 1987 Gunz-Iev ir kiti (Trombozė ir hemostazė, 58(1987) p. 216).Some of the non-glycosylated product containing amino acid residues 136-411 was described by Gunz-Iev et al., 1987 (Thrombosis and Hemostasis, 58 (1987), p. 216).

Publikuotame Europos patente Nr. 312 941 A2 aprašomi scu-PA 32k struktūros polipeptidai, turintys prourokinazės aktyvumą, kurie šiuo atveju turi papildomą sritį nuo 136 iki 143 aminorūgšties liekanų arba atskiras sritis, kuriose, esant būtinumui, (priklausomai nuo Ngalo prigimties) 156 aminorūgšties liekana (Arg) pakeista, ir jų gavimas, ekspresuoj ant atitinkamoms plazmidėms E. coli K12 JM105 ląstelėse, kurios metu vyksta šių peptidų ekspresija, produktas kaupasi viduląsteliniuose intarpiniuose kūneliuose.In the published European patent no. 312,941 A2 discloses scu-PA 32k structured polypeptides having prourokinase activity, which in this case have an additional region of 136 to 143 amino acid residues, or individual domains in which the 156 amino acid residue (Arg) is substituted, if necessary (depending on the nature of Ngal), and production thereof by expression on the appropriate plasmids in E. coli K12 JM105 cells, during which the expression of these peptides occurs, the product accumulates in intracellular inclusion bodies.

Pateikiamas išradimas yra naujų polipeptidų, kurių bendra formulė - I arba kurie atitinka struktūrinę schemą, pateiktai fig. 1, panaudojimas tepapijoje plazminogeno aktyvatoriais:The present invention provides novel polypeptides of the general formula I or according to the block diagram of FIG. Use of plasminogen activators in ointment 1:

Ser-X1-X2-rscu-PA143411 (I) , kurioje rscu-PA -neglikozilinta aminorugščių sekos sritis nuo 143 (Glu) iki 411(LeuOH) iš scu-PA 54k,Ser-X 1 -X 2 -rscu-PA 143 " 411 (I), wherein rscu-PA is a non-glycosylated amino acid sequence region of 143 (Glu) to 411 (LeuOH) from scu-PA 54k,

X2 - viena iš šių aminorugščių liekanų: Asn, Pro arba Ser irX 2 is one of the following amino acid residues: Asn, Pro or Ser and

X2 - vienguba jungtis arba Glu, Pro-Glu, Pro-Pro-Glu arba Giu-Leu-His-Leu-Leu-Gln-Val-Pro-Ser-Asn.X 2 is a single bond or Glu, Pro-Glu, Pro-Pro-Glu or Giu-Leu-His-Leu-Leu-Gln-Val-Pro-Ser-Asn.

Geriausia, kai X4 yra Asn arba ypatingai Ser. Geriausia, kai X2 yra paprasta jungtis arba Glu, Pro-Glu arba Pro-Pro-Glu.Ideally, X 4 is Asn or especially Ser. Ideally, X 2 is a simple bond either Glu, Pro-Glu or Pro-Pro-Glu.

Teikiama pirmenybė tiems junginiams, kurių bendra (I) formulė yra:Preference is given to compounds having the general formula (I):

Ser-Ser-Pro-Pro-Glu-rscu-PA143 411 (la) , kurioj e rscu-PA143 41 1 -turi tą pačią reikšmę, kuri nurodyta aukščiau, formulėje (I).Ser-Ser-Pro-Pro-Glu-rscu-PA 143 411 (la) wherein e rscu-PA 143 41 1 has the same meaning as given above in formula (I).

Nauji junginiai, kurių formulė yra (I), turi stipriai išreikštą specifiškumą lizuojant fibrino krešulius,The novel compounds of formula (I) have a strong specificity in lysing fibrin clots,

t.y., jie aktyvuoja plazminogeną, esant fibrinui, bet neskelia arba labai silpnai skelia cirkuliuojantį plazminogeną, paversdami jį į plazminą. Tokiu būdu pasieLT 3948B kiamas fibrino krešulių ištirpimas, išvengiama nepageidautinų terapijoje krešėjimo faktorių ir kitų baltymų suardymo, nes, esant plazminui, tai vyksta ne taip stipriai, kai naudojami nespecifiniai plazminogeno aktyvatoriai. Nauji junginiai, kurių formulė yra (I), skirtingai nei scu-PA 54k arba jo neglikozilintai baltyminei daliai ( zaruplaze), išsiskiria padidintu apytikriai 1.7 karto specifiniu amidolitiniu aktyvumu (matuojama naudojant chromogeninį substratą piro-GluArg-p-nitroanilidą po pervedimo į dvigrandžius plazminogeninius aktyvatorius plazmino pagalba). Jei matuojama tiesiogiai fibrinolitinis aktyvumas fibrino-agaro plėvelėje, tai nauji junginiai, kurių formulė yra (I), lyginant su scu-PA 54k, turi 2,5-3 kartus didesnį efektyvumą (lizuotas plotas mm miligramui baltymo). Be to, nauji junginiai, kurių formulė yra (I), priešingai nei scu-PA 54k arba zaruplaze , negali susirišti su specifiniais ląstelių urokinazės receptoriais ir deaktyvuotis. Tokiu būdu, jie ilgesnį laiko tarpą cirkuliuoja ir sustiprina terapinį veikimą. Dėka stipresnio, palyginus su įprastomis fibrinolitinėmis priemonėmis, specifinio veikimo ir didesnės galimybės biosintezei veikimo vietoje, pasiekiama patikimesnė ūžavimo terapija su mažesnėmis dozėmis ir mažesniais pašaliniais poveikiais, tokiais kaip kraujavimas.i.e., they activate plasminogen in the presence of fibrin but do not cleave or very weakly circulate plasminogen to convert it to plasmin. This prevents the dissolution of fibrin clots by preventing the cleavage of unwanted coagulation factors and other proteins, as in the case of plasmin this is less pronounced when nonspecific plasminogen activators are used. The novel compounds of formula (I), unlike scu-PA 54k or its non-glycosylated protein moiety (zaruplase), exhibit an increase in specific amidolytic activity of approximately 1.7-fold (measured using the chromogenic substrate pyro-GluArg-p-nitroanilide after transfer to double-stranded plasmin). activator with plasmin). When measured directly on fibrinolytic activity on a fibrin-agar film, the new compounds of formula (I) have a potency of 2.5 to 3-fold (lysed area per milligram of protein) compared to scu-PA 54k. In addition, in contrast to scu-PA 54k or zaruplase, novel compounds of formula (I) are unable to bind to specific cellular urokinase receptors and to be deactivated. In this way, they circulate for a longer period of time and enhance therapeutic activity. Stronger specific activity and increased on-site biosynthesis results in more reliable murmur therapy with lower doses and fewer side effects such as bleeding.

Efektyviai ir patikimai trombolizei, specialiai esant arterijų trombams, ypatingai esant miokardo infarktui, terapiškai efektyvi vienkartinė dozė suaugusiam yra tik iki 15 mg junginio, kurio formulė yra (I) . Palyginimui reikia pateikti darbo Bode ir kt. (Am. J. Cardiol. ¢21 (1988) p. 971-973) duomenis: įvedus 74 mg glikozilinto scu-PA 54k, sėkminga trombolizė vyksta tik 55% atvejų, ir reikia atkreipti dėmesį, kad šiam žinomam produktui pagal Bode ir kt. (Circulation 81 (1990) 907, p. 910), esant reikalingoms didelėms dozėms, beveik nespecifiškai lizuoja fibrininį krešulį ir, pagal daugelio tyriLT 3948B nėtojų duomenis, šios didelės dozės sukelia ryškų neigiamą poveikį hemostatinei sistemai.For effective and reliable thrombolysis, particularly in the presence of arterial thrombi, particularly in the presence of myocardial infarction, a therapeutically effective single dose to an adult is limited to 15 mg of the compound of formula (I). For comparison, the work of Bode et al. (Am. J. Cardiol. ¢ 21 (1988) pp. 971-973): After administration of 74 mg of glycosylated scu-PA 54k, successful thrombolysis occurs in only 55% of cases and it should be noted that this known product according to Bode et al. . (Circulation 81 (1990) 907, p. 910) lyses the fibrin clot almost nonspecifically at the high doses required and, according to data from many tyriLT 3948B suppressors, these high doses produce marked adverse effects on the hemostatic system.

Nauji junginiai, kurių formulė yra (I), gaunami rekombinantinės DNR technologijos pagalba. Tam, pagal šį išradimą, buvo sukurtos naujos plazmidės, jos ekspresuotos tinkamuose bakterijų šeimininkuose ir po produkto, gauto su didele išeiga, veikiančio ne kaip plazminogeno aktyvatoriai, procesingo, gauti nauji junginiai, kurių formulė yra (I).The novel compounds of formula (I) are obtained by recombinant DNA technology. For this purpose, novel plasmids were created, expressed in suitable bacterial hosts, and after processing of a product obtained with a high yield that does not act as plasminogen activators, the novel compounds of formula (I) were obtained.

Kaip ir daugumoje atvejų, ekspresuoj ant eukariotinius baltymus bakterijose, taip ir junginiai, kurių formulė yra (I), ląstelėje yra denatūruoti intarpų kūneliuose, kurie čia ir žemiau žymimi probaltymu, kuris po tarpinio procesingo turi būti surinktas atgal su teisinga norimo produkto tretine struktūra. Tokiu būdu gautų junginių, kurių formulė yra (I), plazminogeninio aktyvatoriaus kiekį galima nustatyti, pav., pridedant plazmino prie atitinkamo dvigrandžio neglikozilinto mažos molekulinės masės urokinazės darinio, kurio po to nustatomas fermentinis aktyvumas ir tai yra junginio, kurio formulė yra (I), kiekio matas. Bet, aišku, taip pat galima nustatyti probaltymo išeigą arba junginio, kurio formulė yra (I) ir tuo pačiu ekspresijos lygį, pavyzdžiui, elektroforegramos, kurioje yra visi produkuojami baltymai, desitometrijos pagalba.As in most cases, by expressing eukaryotic proteins in bacteria, the compounds of formula (I) are denatured in the cells in the cells, which are denoted herein as probaltim, which, after intermediate processing, must be re-assembled with the correct tertiary structure of the desired product. The amount of plasminogen activator thus obtained in the compounds of formula (I) can be determined, for example, by the addition of plasmin to the corresponding double-stranded, non-glycosylated, low molecular weight urokinase derivative, which is subsequently measured for enzymatic activity. , a measure of quantity. But, of course, it is also possible to determine the yield of probaltim or the level of expression of the compound of formula (I) and thereby the desitometry of an electrophoregram containing all the proteins produced.

Pagal šį išradimą plazmidės išsiskiria tuo, kad jų operonas turi reguliuojamą, duotu atveju sintetinį, promotorių, veikiantį, kaip ribosominė ryšio vieta, ShineDalgarno- seką, startinį kodoną, sintetinį junginio, kurio formulė yra (I), struktūrinį geną ir 5'- kryptimi struktūriniam genui mažų mažiausia grandinės nutraukimo agentą. Geriausia, kad būtų du vienas po kito sekantys grandinės nutraukimo agentai, ypatingai trpA grandinę nutraukiantis agentas ir/arba tetA/orfL grandinę nuLT 3948B traukiantis agentas iš ThlO (pal. Schollmeier ir kiti Nucl. Acids Res. 13 (1985) p. 4227-4237).The plasmids of the present invention are characterized in that their operon contains a regulated, in this case synthetic, promoter acting as a ribosomal linkage, a ShineDalgarnase sequence, a start codon, a synthetic structural gene of the compound of formula (I) and a 5 'direction. the smallest strand breaking agent in the structural gene. Preferably there are two successive chain breaking agents, in particular the trpA chain terminating agent and / or the tetA / orfL chain nuLT 3948B pulling agent from ThlO (cf. Schollmeier et al., Nucl. Acids Res. 13 (1985) pp. 4227- 4237).

Reguliuojamas promotorius - tai Trp promotorius arba 5 Tac promotorius.The regulated promoter is the Trp promoter or the 5 Tac promoter.

Kontroliuojamoje plazmidžių srityje, pagal išradimą, tarpas tarp Shine-Dalgarno-sekos ir startinio kodono yra 6 -12, geriau 8 -10 nukleotidųIn the controlled plasmid region of the invention, the gap between the Shine-Dalgarno sequence and the start codon is 6-12, preferably 8-10 nucleotides.

Konstruojant pagal šį išradimą, į plazmidės struktūrinį geną įterpia koduojančias aminorūgštis-tripletus, kurių bazių seka pateikta lentelėje. Be to, struktūriniame gene gali būti pakeisti ne visi tripletaiIn the construction of the present invention, coding amino acid triplets are inserted into the plasmid structural gene having the base sequence set forth in the table. In addition, not all triplets can be replaced in the structural gene

Aminorūgštis argininas leucinas valinas glicinasAmino acid arginine leucine valine glycine

TripietasTriptych

CGTCGT

CTGCTG

GTTGTT

GGTGGT

Iš kitos pusės, konstruojant struktūrinį geną tikslinga, esant galimybei, vengti šių kodonų (taip pat ir šiuo atveju struktūriniame gene gali būti pakeisti ne visi tripletai):On the other hand, when constructing a structural gene, it is advisable to avoid the following codons wherever possible (and not all triplets may be substituted in the structural gene):

Kodonas, kurio reikia vengtiA codon to avoid

ATAATA

GTCGTC

CCCCCC

AAGAAG

AGG, AGA, CGG, CGAAGG, AGA, CGG, CGA

GGA, GGGGGA, GGG

Aminorūgštis izoleucinas valinas prolinas lizinas argininas glicinasAmino acid isoleucine valine proline lysine arginine glycine

Dėka šio kodonų pasirinkimo struktūriniame gene ir dėka aukščiau nurodytų požymių kontroliuojančioje _ dalyje, stipriai sumažėja galimybė susidaryti antrinėms struktūroms tarp struktūrinio geno ir kontroliuojančios srities.Due to this choice of codons in the structural gene and due to the above-mentioned features in the controlling part, the possibility of secondary structures between the structural gene and the controlling region is greatly reduced.

Sintetinių struktūrinių genų, koduojančių junginius, kurių formulė yra (I), gavimui pirmiausia sintetina nukleotidus po 40 -80 bazių sekas. Tikslinga jas sintetinti po 1 uM ant nešiklio pagal Adams ir kt. J. Am. Chem. Soc. 105 (1983) p. 661 -663, naudojant DNR sintezatorių (Mode II Biosearch 8600 modelis, New Brunswick Scientific Co) . Kaip monomeriniai sintonai naudojami prekybiniai reikalingų dezoksiribonukleozidų β-cianetil-apsaugcci diizopropilaminofosforamiditai . Po nešiklio nuskėlimo, galinės triti1-apsaugotos grandinės steriliomis sąlygomis nudruskinamos gelfiltracijos pagalba ir valomos, po to du kartus frakcionuojamos atvirkščios fazės pirmąja preparatyvinę plonasluoksne chromatografija. Pagrindinis produktas detritilinamas ir po kitų dviejų valymų preparatyvinę plonasluoksne chromatografija gaunamas reikalingas švarus oligonukleotidas, jo švarumas tikrinamas gelelektroforezės pagalba (PAGE).To obtain synthetic structural genes encoding compounds of formula (I), nucleotides of 40 to 80 base sequences are first synthesized. It is appropriate to synthesize them at 1 µM per carrier according to Adams et al. J. Am. Chem. Soc. 105 (1983) p. 661 -663 using a DNA synthesizer (Mode II Biosearch Model 8600, New Brunswick Scientific Co.). Commercially available β-cyanoethyl-protecting diisopropylaminophosphoramidites of the required deoxyribonucleosides are used as monomeric synthons. After removal of the carrier, the final tritiated-protected chains are sterile desalted by gel filtration and purified, followed by fractional reversal of the first phase by preparative thin layer chromatography. The basic product is detritilated and the next two purifications are carried out by preparative thin layer chromatography to obtain the required pure oligonucleotide and its purity is checked by gel electrophoresis (PAGE).

Iš 4-9 grupių šių atskirų nukleotidų grandinių gaunami fragmentai, kurių ilgis apie 200 nukleotidų, dėl to, kad galiniai oligonukleotidai su atskiromis grandinėmis 5'-gale fosforilinami ir atitinkamos papildomos grandinės kartu su galiniais oligonukletidais persidengia. Gautus po persiklojimo fragmentus, kuriuos galima klonuoti ir jie turi sudvigubintas grandines, Įterpia Į tinkamus linijinius nešiklius. Tolesnis veiklos principas išplaukia iš pateiktų pavyzdžių.Groups 4-9 of these single nucleotide chains produce fragments of about 200 nucleotides in length because of the phosphorylation of the terminal oligonucleotides at the 5'-end and the overlapping of the corresponding additional chains with the terminal oligonucleotides. The resulting overlapping fragments, which can be cloned and have doubled chains, are inserted into suitable linear carriers. The following principle of operation follows from the following examples.

Panaudoti šiame išradime sutrumpinimai turi sekančias reikšmes:Abbreviations used in the present invention have the following meanings:

op op bazių poros pairs of bases DE52 DE52 anijonitas Whatman firmos anionite Whatman firm EDTA EDTA etilendiamintetraacto rūgštis ethylenediaminetetraacetic acid IPTG IPTG i zopropiΙ-β-D-tiogalaktopiranozidas i zopropiΙ-β-D-thiogalactopyranoside PA PA plazminogeninis aktyvatorius plasminogenic activator PAGE PAGE elektroforėzė poliakrilamidiniame gelyje electrophoresis in a polyacrylamide gel PU PU Ploug vienetai Ploug units SDS SDS natrio dodecilsufatas sodium dodecyl sulfate

S. D. - Seguenz Shine-Dalgarno seka tris-HCl trishidroksimetilaminometano hidrochloridasS.D. - Seguenz Shine-Dalgarno sequence tris-HCl trishydroxymethylaminomethane hydrochloride

Tween-80 Tween-80 polietilenoksido (20) sorbitanmonooleatas polyethylene oxide (20) sorbitan monooleate TMAC TMAC tetrametilamonio chloridas tetramethylammonium chloride

Pagal šį išradimą, konstruojant plazmides, pasirenkama prekybinė plazmidė pBR 332 (4363 bp). Dažniausia iš jos pašalinama nic/bom - sritis ir/arba tetraciklinui rezistentinis genas. Tam nebūtina pilnai pašalinti tetraciklino rezistentinį geną, pakanka tokių pakeitimų, kad plazmidė nesuteiktų atsparumo tetraciklinui transformuotiems jos pagalba bakterijų kamienams. Dėka šių priemonių (pašalinamas nic/bom - srities ir mažų mažiausia vienos srities iš tetraciklinui rezistentinio geno) gaunama taip vadinama saugi plazmidė.According to the present invention, the commercial plasmid pBR 332 (4363 bp) is selected when constructing plasmids. Most often, the nic / bom region and / or the tetracycline resistant gene is removed. This does not require the complete removal of the tetracycline resistance gene, but such modifications are sufficient that the plasmid does not confer resistance to the tetracycline-transformed bacterial strains. These tools (removing the nic / bom region and the smallest single region of the tetracycline-resistant gene) result in the so-called safe plasmid.

Pagal ši išradimą, pirmenybė teikiama plazmides konstravimui iš modifikuotos, kaip aprašyta aukščiau, plazmidės pBR 332 (arba iš kitų, minimų toliau), sekanti operacija yra sintetinės polilinkerinės sekos Įvedimas tarp EeoRI ir HindlII kirpimo vietos. Ši polilinkerinė seka (žiūr. fig. 3) turi nustatytas kirpimo vietas, esančias tarp jų bazes laisvai pasirenkant, išskyrus seką tarp Xbal ir NdeI, kuri turi ribosominę surišimo vietą (Shine-Dalgarno seka) iš B. subtilis Xyl operonas 5'-AAGGAG-3' (Wilheim ir kiti, Nucl. Acids Res. 13 (1985) p. 5717-5722) ir nustatytą fragmentą tarp S.D. sekos ir startinio kodono ATG. Po S.D. - sekos esančios bazės GAAAT, gautos iš Wilheim ir kt. ir sujungtos su CATATG NdeI kirpimo vietoje. Tokiu būdu, tarpas tarp S. D. - sekos ir ATG yra 8 bazių poros. Atstumai tarp atskirų kirpimo vietų polilinkerinėje sekoje pagal klonavimo teoriją turėtų turėti 20 nukleotidų ilgį, ko pasėkoje, palengvėja tarpinių fragmentų pašalinimas.In accordance with the present invention, preference is given to constructing a plasmid from the modified pBR 332 plasmid as described above (or others mentioned below), the following operation being the insertion of a synthetic polylinker sequence between EeoRI and the HindIII cleavage site. This polylinker sequence (see Fig. 3) has defined cleavage sites between their bases of choice, except for the sequence between Xbal and NdeI, which has a ribosomal binding site (Shine-Dalgarno sequence) from B. subtilis Xyl operon 5'-AAGGAG -3 '(Wilheim et al., Nucl. Acids Res. 13 (1985) pp. 5717-5722) and the identified fragment between SD sequence and start codon ATG. After S.D. - GAAAT-based sequences from Wilheim et al. and connected to CATATG at the NdeI clipping site. In this way, the spacing between S. D. - sequence and ATG is 8 base pairs. The distance between individual cleavage sites in the polylinker sequence should be 20 nucleotides in length, which in turn facilitates the removal of intermediate fragments.

Polilinkerinės sekos pagalba į plazmidę įvedamos kirpimo vietos, kurios - tikslingos įvesti po grandinės nutraukimo agento transkripcijos, - palengvina įterpti einančias viena po kitos struktūrinio geno sekas junginiui I, geriausia, pradedant nuo baltymo C-galo, t.y., nuo gaunamo struktūrinio geno DNR grandinės 3'-galo, taip pat, pavyzdžiui, sintetinio, išskirto iš kitos plazmidės, arba prekybinio Trp* arba Tac promotoriaus įterpimą.The polynucleotide sequence introduces cleavage sites into the plasmid which - purposefully introduced after transcription of the terminating agent - facilitate the insertion of successive structural gene sequences for compound I, preferably starting at the C-terminus of the protein, i.e. the resulting structural gene. insertion of a '-gal as well as, for example, a synthetic isolated from another plasmid, or a commercial Trp * or Tac promoter.

Panašiu būdu galima pradėti plazmidžių konstravimą iš kitų žinomų komercinių plazmidžių, kurios turi vieninteles EcoRI ir HindlII kirpimo vietas, tokių kaip: pHC9, pHC12, pHC13, pHC18, pHC19 ir kitos.Similarly, construction of plasmids from other known commercial plasmids having single EcoRI and HindIII restriction sites, such as: pHC9, pHC12, pHC13, pHC18, pHC19 and others, can be started.

Taip, pavyzdžiui, gaunama plazmidė pGR Tac 06 (žiūr. pavyzdi ir fig. 8) . Ši plazmidė koduoja junginį, kurio formulė I, kurioje Xx reiškia Asn ir X2 - seką: Glu-LeuHis-Leu-Leu-Gln-Val-Pro-Ser-Asn (žiūr. fig. 9). Šis junginys toliau žymimas PA/06.Thus, for example, plasmid pGR Tac 06 is obtained (see Example and Figure 8). This plasmid encodes a compound of formula I wherein X x represents Asn and X 2 represents: Glu-LeuHis-Leu-Leu-Gln-Val-Pro-Ser-Asn (see Figure 9). This compound is hereinafter referred to as PA / 06.

Šią seką koduoja nuo Nde I ir Xba I nukleotidų, kuriems laisvai buvo pasirinkti baltymo scu-PA 54k N-galo kodonai. Ši seka nutraukiama ties Leu-Leu, Pst I kirpimo vieta.This sequence is encoded by the Nde I and Xba I nucleotides for which the 54k N-terminal codons of the scu-PA protein were freely selected. This sequence is terminated at Leu-Leu, the Pst I intersection.

ioio

Šis ekspresuotas, pavyzdžiui i E. coli ląsteles, baltymas PA/06 po struktūros atstatymo, nelauktai pasižymėjo dideliu fibrinolitiniu aktyvumu, tikrinant ant fibrino-agarinės plėvelės.This PA / 06 protein, expressed, for example, in E. coli cells, unexpectedly exhibited high fibrinolytic activity when screened on a fibrin-agar film.

Jei plazmidėje pGR Tac 06 pakeičiamas Tac promotorius tarp Eco R I ir Xba I sintetiniu Trp promotoriumi (žiūr, fig. 10), tai gaunama pGR Trp 06 plazmidė.If the plasmid pGR Tac 06 replaces the Tac promoter between Eco R I and Xba I with the synthetic Trp promoter (see Fig. 10), the plasmid pGR Trp 06 is obtained.

Transformuotos pGR Trp 06 pagalba E. coli ląstelės K12JM 103 (ATCC 39 403) po indukcijos indolakrilo rūgštimi produkuoja intarpiniais kūneliais baltymą, kuris po ląstelių ūžavimo ir baltymo struktūros atstatymo pasižymi fibronolitiniu aktyvumu, tikrinant ant fibrino-agarinės plėvelės.Transformed with pGR Trp 06, E. coli cells K12JM 103 (ATCC 39 403), after induction with indolacrylic acid, produce an intercellular protein that exhibits fibronolytic activity upon cell fibrin-agar screening after cell lysis and protein structure repair.

Pagal šį išradimą, kitas plazmidės galima gauti iš sukonstruotų plazmidžių, aprašytų aukščiau, pavyzdžiui Eco R I ir Hind III pagalba gaunamas sintetinis struktūrinis genas su visais reguliacijos elementais ir įterpiamas į kitą enterobacteriaceae šeimos bakteriją, ypatingai sugebančią autonomiškai daugintis. E. coli, plazmidę, kuri tam buvo linerizuota ir sutrumpinta pjūviai nuo Eco R I ir Hid III. Principe, tokiu pat būdu, bet naudojant Eco R I ir Xba I, galima pakeisti bet kurioje šiame išradime esančių plazmidžių, pavyzdžiui, Trp’ promotorių Tac’ promotoriumi (ir atvirkščiai) .According to the present invention, the other plasmids can be obtained from the engineered plasmids described above, for example, by means of Eco R I and Hind III, a synthetic structural gene with all regulatory elements and inserted into another bacterium of the Enterobacteriaceae family. E. coli, a plasmid that has been linearized for this purpose and truncated from Eco R I and Hid III. In principle, in the same way, but using Eco R I and Xba I, it is possible to replace the plasmids of any of the present invention, such as the Trp 'promoter with the Tac promoter (and vice versa).

Pagal ši išradimą, plazmidės, prailgintas tarp ShineDalgarno sekos ir startinio kodono ATG, galima gauti, kaip aprašyta aukščiau, sukonstruota plazmidė, kur minimas tarpas yra, pavyzdžiui, 8 nukleotidai, kerpama su Nde I, užpildomos kirpimo vietos ir užciklinami nupjauti galai, taip gaunama pagal šį išradimą plazmidė, kuroje atstumas tarp S.D. - sekos ir startinio kodono yra 10 nukleotidų.According to the present invention, a plasmid elongated between the ShineDalgarn sequence and the start codon ATG can be obtained as described above by constructing a plasmid wherein said gap is, for example, 8 nucleotides crossed with Nde I, filled at the cleavage sites and clipped to the cut ends. a plasmid according to the present invention having a distance between SDs - The sequence and start codon contain 10 nucleotides.

Konstruojant struktūrinius genus, kurie koduoja junginius, kuriu formulė I, pasirenkamos tokios nukleotidų sekos, kurių 5' gale yra metionino kodonas, po kurio seka serino kodonas. Ekspresuo j ant ši. struktūrini, geną, dėl to kad ryšys tarp Met-Ser nestabilus, gaunami junginiai, kurių formulė I, su serinu aminorūgšties Ngale. Tinkami struktūriniai genai, kurie koduoja junkurių formulė I, atitinkami 5'galai (baltymų, gimus, kurių formuleIn constructing the structural genes encoding compounds of Formula I, nucleotide sequences having a methionine codon at the 5 'end, followed by a serine codon, are selected. Express it on this. structural gene, due to the unstable nature of the Met-Ser bond, yields compounds of Formula I with serine at the amino acid Ngale. Suitable structural genes encoding junkur's formula I, corresponding 5'-ends (protein, born of formula

I, N-galų atitinka sritį Ser-X1-X2 ir koduojamas, bet baltyme nesantis metioninas nurodytas skliausteliuose):I, the N-terminus corresponds to the Ser-X 1 -X 2 region and the encoded but non-protein methionine is indicated in parentheses):

(Met) (Met) Ser Ser Asn- Asn- ATG ATG AGC AGC AAT AAT (Met) (Met) Ser Ser Asn Asn Glu- Glu- ATG ATG AGC AGC AAT AAT GAA GAA (Met) (Met) Ser Ser Pro Pro Pro Pro Glu- Glu- ATG ATG AGC AGC CCA CCA CCA CCA GAA GAA (Met) (Met) Ser Ser Ser Ser Pro Pro Pro Pro Gi u - Gi u - ATG ATG AGC AGC AGC AGC CCA CCA CCA CCA GAA GAA (Met) (Met) Ser Ser Asn Asn Glu Glu Leu Leu His His ATG ATG AGC AGC AAT AAT GAA GAA CTT CTT CAT CAT

LeuLeu

CTGCTG

LeuLeu

CAGCAG

Gln VaiGln Vai

CAA GTTCAA GTT

ProPro

CCACCA

Ser Ser ASn ASn TGC TGC AAC AAC šio this iš- from

Kaip buvo pažymėta, bakterijos, transformuotos radimo plazmidėmis, pasižymi aukštu ekspresijos lygiu. Tinkamų transformavimui šeimininkų paieška atliekama žinomais būdais. Šio išradimo plazmidžių ekspresijai geriausia tinka E. coli arba giminingos Enterobacteriaceae šeimos bakterijoms, kaip Pseudomonas, Salmonella, Enterobacter, Klebsiella arba Serratia kamienai.As noted, the bacteria transformed with the find plasmids exhibit high expression levels. Finding suitable hosts for transformation is done in known ways. The plasmid expression of the present invention is best suited to bacteria of the E. coli or related Enterobacteriaceae family such as Pseudomonas, Salmonella, Enterobacter, Klebsiella or Serratia strains.

Labiausia tinkami šeimininkai yra E. coli, pavyzdžiui,The most suitable hosts are E. coli, e.g.

E. coli GRT-I kamienas ir ypatingai E. coli K12 pogrupio kamienai, tokie kaip: E. coli GRT-I kamienas ir ypatingai E. coli K12 pogrupio kamienai, tokie kaip:E. coli GRT-I strain and in particular E. coli K12 subgroup strains such as: E. coli GRT-I strain and especially E. coli K12 subgroup strains such as:

E. coli K12 JM101 (ATCC 33876), E. coli K12 JM103 (ATCC 39403), E, coli K12 JM105 (DSM 4162), E. coli K12 MM294 (ATCC 33625), E. coli K12 (ATCC 31446) arba E. coli K12 DHI (ATCC 33849).E. coli K12 JM101 (ATCC 33876), E. coli K12 JM103 (ATCC 39403), E. coli K12 JM105 (DSM 4162), E. coli K12 MM294 (ATCC 33625), E. coli K12 (ATCC 31446) or E. . coli K12 DHI (ATCC 33849).

E. coli ekspresijos sistemose, kuros turi Tac promotorių, indukciją galima atlikti, pavyzdžiui, pridedant laktozės arba pašalinant gliukozę, bet geriausia - β-Dtiogalaktopiranozidu (IPTG). Jei plazmidėje yra Trp promotorius, tai indukciją geriausia vykdyti indolakrilo, indolakrilacto arba indolakrilpropano rūgštimis. Taip pat suprantama, kad indukciją galima vykdyti ir su kitais žinomais induktoriais.In E. coli expression systems containing the Tac promoter, induction can be accomplished, for example, by the addition of lactose or glucose, but preferably by β-Dtiogalactopyranoside (IPTG). If the plasmid contains the Trp promoter, induction is best done with indolacrylic, indolacrylic acetic or indolacrylic propanoic acids. It is also to be understood that induction can be accomplished with other known inductors.

Po indukcijos ir pasiekus tam tikrą ląstelių tanki, ląstelės centrifuguojamos ir nuosėdos, suspenduotos druskos tirpale, homogenizuojamos ir ląstelės suardomos. Po pakartotino centrifugavimo, nuosėdose lieka probaltymas, kurio formulė yra I, kartu su ląstelių nuolaužomis. Probaltymas ištirpinamas gaunidinhidrochlorido tirpale ir paveikiamas redukcijos-oksidacijos sistema (pavyzdžiui, oksiduotu ir redukuotu glutationu), tam kad baltymas Įgautų natyvią konformaciją, t.y., susidarytų junginiai, kurių formulė I. Šie junginiai lieka reakcijos mišinyje ištirpę ir galima juos išgryninti Įprastinėmis operacijomis (pavyzdžiui, chromatografija ir po jos sekančia liofilizacija).After induction and at a certain cell density, the cells are centrifuged and the pellet suspended in saline, homogenized and the cells disrupted. After repeated centrifugation, a probalt of formula I remains in the precipitate along with cell debris. Probalt is dissolved in the resulting hydrochloride solution and subjected to a redox-oxidation system (e.g., oxidized and reduced glutathione) to give the protein its native conformation, i.e., compounds of formula I. These compounds remain in the reaction mixture and can be purified by conventional chromatography followed by lyophilization).

Analitiniams tikslams tikslinga dirbti taip: fermentuojamos transformuotos šio išradimo plazmidėmis E. coli, pasiekus reikiamą ląstelių suspensijos tanki, indukuojama baltymo ekspresija. Po reikiamo laiko fermentacijos, suspensija dalimis centrifuguojama, ląstelės liozuojamos lizocimu (1 mg lizocimo 1 ml 50 mM Tris-HCl buferinio tirpalo, pH 8.0, su 50 mM EDTA ir 15% sachrozės) . Homogenizuotos ląstelės tirpinamos 4-5 M gaunidino hidrochlorido tirpale, praskiedus iki guanidino hidrochlorido 1.2 M koncentracijos, pridedama reduktorių (glutationo, merkaptoetanolio arba cisteino) su priėjimu orui paliekama kelioms valandoms, kad atsistatytų baltymo struktūra (palyg. taip pat Winkler ir kiti Bioche. 25, 1986, p. 4041-4045) . Tokiu būdu gauti viengrandžiai junginiai, kurių formulė I, pridėjus plazmino, paverčiami i atitinkamus dvigrandžius polipeptidinius darinius, kurių aktyvumas nustatomas su chromogeniniu substratu piroGlu-Gly-Arg-p-nitroanilidu, kuris skaldomas tik dvigrandžių aktyvių urokinazių. Ši junginio, kurio formulė I, aktyvacija atliekama plazmino tirpalu 50mM Tris-HCL buferyje su 12 mM natrio chlorido, 0.02% Tween 80, kai pH 7.4 37°C temperatūroje keletą valandų. Junginio santykis su plazminu turi būti apytikriai nuo 100 iki 1500 vienam moliui plazmino, perskaičiavus moliais, arba nuo 8000 iki 36000 su 1, skaičiuojant pagal fermentų aktyvumo vienetus. Aktyvumo nustatymas atliekamas 50 mM Tris-HCl buferiniam tirpale su 0.36 mM natrio chlorido, kai pH 8.8, pridėjus 0.36 mM aprotinino (plazmino susilpninimui) ir 0.27 mM substrato 37°C temperatūroje. Priklausomai nuo junginio, kurio formulė I, kiekio, po 5-60 minučių inkubavimo reakcija stabdoma, pridedant 50% acto rūgšties ir optinis tankis matuojamas 405 nm bangoje. Taip nustatant aktyvumą, pagal substrato gamintoją (Kabi Vitrum, Švedija), 0.05 vienetais optinio tankio padidėjimas 405 nm bangoje per 1 minutę atitinka 25 Ploug urokinazės vienetams 1 ml standartinio tirpalo.For analytical purposes, it is convenient to work as follows: the transformed plasmids of the present invention are transformed into E. coli by inducing protein expression at the required cell suspension density. After the required time of fermentation, the suspension was centrifuged in portions and cells lysed with lysozyme (1 mg lysozyme in 1 ml 50 mM Tris-HCl buffer, pH 8.0, with 50 mM EDTA and 15% sucrose). The homogenized cells are solubilized in 4-5 M saline, diluted to 1.2 M guanidine hydrochloride, and the reducing agents (glutathione, mercaptoethanol or cysteine) are added with air and left for several hours to recover the protein structure (cf. Winkler et al. Bioche. , 1986, pp. 4041-4045). The single-chain compounds of formula I thus obtained are converted, after the addition of plasmin, to the corresponding double-chain polypeptide derivatives, the activity of which is determined with the chromogenic substrate pyroGlu-Gly-Arg-p-nitroanilide, which is cleaved only by double-chain active urokinases. This activation of the compound of Formula I is performed with a plasmin solution in 50 mM Tris-HCL buffer with 12 mM sodium chloride, 0.02% Tween 80 at pH 7.4 at 37 ° C for several hours. The ratio of compound to plasmin should be from about 100 to about 1500 per mole of plasmin, expressed in moles, or from 8000 to 36000 with 1, based on units of enzyme activity. Activity was determined in 50 mM Tris-HCl buffer with 0.36 mM sodium chloride at pH 8.8 with 0.36 mM aprotinin (for plasmin attenuation) and 0.27 mM substrate at 37 ° C. Depending on the amount of the compound of formula I, after incubation for 5 to 60 minutes, the reaction is stopped by the addition of 50% acetic acid and the optical density is measured at 405 nm. In this assay, the increase in optical density at 0.05 units at 405 nm per minute, according to the substrate manufacturer (Kabi Vitrum, Sweden), corresponds to 25 units of Ploug urokinase per ml of standard solution.

Išradimo figūrose pavaizduota:The figures of the invention show:

Fig. 1: Junginių, kurių formulė I, struktūros schema, nurodant būtinus disulfidinius tilteliusFIG. 1: Schematic diagram of compounds of Formula I, indicating required disulfide bridges

Fig. 2a ir 2b: Plazmidės pBF 158 konstravimas iš komercinės plazmidės pBR 332. Konstruojant, vienas po kito pašalinami nic/bom sritys ir didesnė dalis atsparumo tetraciklinui geno.FIG. 2a and 2b: Construction of plasmid pBF 158 from the commercial plasmid pBR 332. The nic / bom domains and the major part of the tetracycline resistance gene are sequentially deleted.

Fig. 3: Sintetinė polilinkerinė seka.FIG. 3: Synthetic polylinker sequence.

Fig. 4: Plazmidės pBF 158-01 konstravimas. Pateiktas intarpas sintetinės polilinkerinės sekos plazmidėje PBF 158 tarp EcoR I ir Hind III kirpimo vietas.FIG. 4: Construction of plasmid pBF 158-01. An insert is provided in the plasmid PBF 158 of the synthetic polylinker sequence between EcoR I and Hind III cleavage sites.

Fig. 5: Plazmidės pBF 158-01 konstravimas. Fragmentas Cla I - Hind III pakeičiamas atitinkamu fragmentu T iš plazmidės pRT 61 (žiūr. Jorgensen ir kiti J. Bacteriol. 138, 1978, p. 705-714), kuriame yra tetA/orf L grandinės nutraukimo agentas iš TnlO (žiūr. Sohollmeier ir kiti Nucl. Acids Res. 13, 1985, p. 4227-4237).FIG. 5: Construction of plasmid pBF 158-01. The Cla I to Hind III fragment is replaced by the corresponding fragment T from plasmid pRT 61 (see Jorgensen et al., J. Bacteriol. 138, 1978, pp. 705-714), which contains the tetA / orf L chain terminating agent from Tn10 (see Sohollmeier). and others Nucl. Acids Res. 13, 1985, pp. 4227-4237).

Fig. 6a-6e: Koduojančio geno sintetinių fragmentų nukleotidų sekos (Jų Įjungimas, sudarant struktūrini geną junginiams, kurių formulė I, pagal šį išradimą, į plazmidę pBF 158-01, T aprašomas I d pavyzdyje ir pavaizduotas fig. 7a-7c)FIG. 6a-6e: Nucleotide Sequences of Synthetic Fragments of a Coding Gene (Their Insertion to Constitute a Structural Gene for Compounds of Formula I according to the present invention into plasmid pBF 158-01, T is described in Example IId and shown in Figures 7a-7c).

Fig. 7a-7c: Plazmidžių pBF-02 T - pBF 158-06 konstravimas, Įterpiant oligonuleotidinius fragmentus M4-M8, pradedant nuo plazmidės pBF 158-01 T nuo C-galo.FIG. 7a-7c: Construction of plasmid pBF-02 T-pBF 158-06 by inserting oligonuleotide fragments M4-M8 starting from the C-terminus of plasmid pBF 158-01 T.

Fig. 8: Plazmidė pGR Tac 06, gauta iš pBF 158-06FIG. 8: Plasmid pGR Tac 06 obtained from pBF 158-06

T, Įterpiant Tac’promotorių tarp EcoRI ir Xbal (Žiūr. pavyzdį 1)T, Inserting a Tac promoter between EcoRI and Xbal (See Example 1)

Fig. 9:FIG. 9:

Fig. 10FIG. 10th

Fig. 11FIG. 11th

Fig. 12FIG. 12th

Nukleotidų seka, įterpta tarp Nde I ir Sac I kirpimo vietų plazmidėje pGR Tac 06 ir atitinkanti aminorūgščių seka. Aminorūgščių numeravimas toks pats kaip fig. 1.The nucleotide sequence inserted between the Nde I and Sac I cleavage sites in pGR Tac 06 and the corresponding amino acid sequence. The amino acid numbering is the same as in FIG. 1.

Sintetinio Trp~ promotoriaus nukleotidų seka.Nucleotide sequence of the synthetic Trp ~ promoter.

Junginių, kurių formulė I, arba jų probaltymų, sukonstruotų pagal fig. 9, transformuotų pGR Tac 06 plazmidė su Tac promotoriumi E. coli ląstelėse, ekspresijos lygio priklausomybė, indukuojant IPTG, kai laikas lygus 0. Nurodomi aktyvumai Ploug vienetais 1 ml kultūros skysčio, kurio optinis tankis lygus 1, matuojant 578 nm bangoje, nustatyti naudojant chromogeninį substratą (o-----o) po nuskėlimo plazminogenu ir be skėlimo (·- - -·). Nurodyti aktyvumai yra vidurkiai iš 4 fermentacijų.The compounds of formula I or their probal compounds constructed according to FIG. Figure 9: Expression dependence of expression level of transformed pGR Tac 06 plasmid with Tac promoter in E. coli cells by inducing IPTG at time 0. Reported activities in Ploug units per ml of culture fluid at 578 nm using chromogenic assay substrate (o ----- o) after plasminogen digestion and no digestion (· - - - ·). The indicated activities are the average of 4 fermentations.

Nukleotidų sekos ir atitinkanti aminorūgščių seka junginių, kurių formulė (Met)-Ser-XL-X2-rscu-?A143 411. Metioninas, nurodytas skliausteliuose, nukerpamas E. coli ląstelėje.Nucleotide sequences and corresponding amino acid sequences for compounds of formula (Met) -Ser-X L -X 2 -rscu? A 143 411 . Methionine, indicated in parentheses, is clipped in an E. coli cell.

Fig. 13FIG. 13th

Junginių, kurių formulė I, arba jų probaltymų, transformuotų pGR 318, pGR 319 arba pGR 327 tai yra su Trp promotoriumi E. coli K12 JM 103 ląstelėse, ekspresijos lygio priklausomybė. Indukcija buvo atliekama, kai laikas lygus 0 su indolakrilio vumai Ploug rūgštimi. vienetaisDependence on the expression level of the compounds of formula I or their probes transformed with pGR 318, pGR 319 or pGR 327, that is, with the Trp promoter in E. coli K12 JM 103 cells. Induction was performed at a time equal to 0 with indole acrylic vuma Ploug acid. in units

Nurodomi akty1 ml kultūros skysčio, kurio optinis tankis lygus 1, matuojant 578 nm bangoje, nustatyti naudojant chromogeninį substratą (o----o) po nuskėlimo plazminogenu ir be skėlimo (·---·) ·Report the presence of Akt1 ml culture medium with an optical density of 1, measured at 578 nm, using a chromogenic substrate (o ---- o) after plasminogen digestion and without digestion (· --- ·) ·

Pateikiamuose pavyzdžiuose eksperimentuose naudojami komerciniai fermentai (palygink Nachr. Chem. Techn. Nab. 35, 1987, p. 939).The examples provided use commercial enzymes in experiments (cf. Nachr. Chem. Techn. Nab. 35, 1987, p. 939).

Naudojamos pavyzdžiuose mitybinės terpės taip pat komercinės .The culture media used in the examples are also commercial.

Pavyzdys 1:Example 1:

Ekspresinės plazmidės pGR Tac 06, kuriose koduojami junginiai, kurių formulė I, pagal fig. 9, su sintetiniu Tac promotoriumi, konstravimas.The expression plasmid pGR Tac 06 encoding compounds of formula I according to FIG. 9, with a synthetic Tac promoter.

A. Plazmidės pBF 158 konstravimasA. Construction of plasmid pBF 158

i) Iš plazmidės pBR 322 (Farmacija, Nr. 27-4902, 4363 bp) pašalinama nic/bom sritis, kuri yra tarp 2207 ir 2263 bazių (žiūr. Winnacker, Genai ir klonai, leidykla VCH, Vainhaim, 1985, p. 296), sekančiu būdu (žiūr. taip pat fig. 2): pBR 322 plazmidė perkerpama su Nde I ties 2998 baze ir tuo pačiu plazmidė linerizuojama. Lipnūs galai užpildymo reakcijos pagalba užbukinami (žiūr. Maniatis ir kiti, Molecular Cloning, Cold Spring Harborlab, 1982). Po to kerpama ties 2068 baze su PvuII ir abu plazmidės pBR 322 lipnius galus įprastu būdu sujungia ligaze T4. Po to transformuojama į kompetentines E. coli K12 JM 103 (ATCC 39403) ląsteles (žiūr. Hanahan, DNA Cloning, T.I, IRL Press, Oksford, 1985, p. 109-135). Transformuotos ląstelės kultivuojamos terpėje, kurioje yra 150 pg/ml ampicilino. Iš gautų klonų atrenkami tie, kurie sąvyje turi plazmidę pBF 157, kuri skiriasi nuo pradinės plazmidės pBR 322i) Deletion of the nic / bom region between 2207 and 2263 bases from plasmid pBR 322 (Pharmacy, No. 27-4902, 4363 bp) (see Winnacker, Genes and Clones, VCH Vainhaim, 1985, p. 296 ), as follows (see also Fig. 2): The plasmid pBR 322 is cut with Nde I at 2998 base and the plasmid is thereby linearized. The adhesive ends are obfuscated by a filling reaction (see Maniatis et al., Molecular Cloning, Cold Spring Harborlab, 1982). It is then cleaved at base 2068 with PvuII, and both adhesive ends of plasmid pBR 322 are ligated in a conventional manner with T4 ligase. It is then transformed into competent E. coli K12 JM 103 (ATCC 39403) cells (see Hanahan, DNA Cloning, T.I, IRL Press, Oxford, 1985, pp. 109-135). Transformed cells are cultured in medium containing 150 pg / ml ampicillin. From the resulting clones, those which have the plasmid pBF 157, which is different from the parent plasmid pBR 322, are selected.

230 nukleotidų: a-Pst-BspMII, b-Pstl-Ball, c-Pstl-Aval fragmentais. Abiejų vienintelių PvuII ir NdeI _ kirpimo vietų, esančių plazmidėje pBR 332, plazmidėje pBF 157 nėra.230 nucleotides: a-Pst-BspMII, b-Pstl-Ball, c-Pstl-Aval fragments. Both single PvuII and NdeI cleavage sites are not present in pBF 337 in pBF 157.

i) Iš plazmidės pBF 157 didesnioji tetraciklinui atsparumo geno dalis pašalinama, kerpant EcoPV-NruI ir sujungiant lipnius galus. Po transformacijos į E. coli K12 JM 103 ir kutivavimo terpėje, kurioje yra 150 ųg/ml ampicilino, gaunami klonai, iš kurių atrenkami tokie, kurie turi sąvyje plazmidę pBF 158. Ši plazmidė mažesnė 787 nukleotidais, nei pBF 157 ir skiriasi tuo, kad joje nėra BamHI kirpimo vietos. Transformuoti kamienai plazmide pBF 158 neįgyja atsparumo tetraciklinui.i) The major part of the tetracycline resistance gene is removed from plasmid pBF 157 by cleavage of EcoPV-NruI and ligation of the sticky ends. Transformation into E. coli K12 JM 103 and digestion medium containing 150 µg / ml ampicillin results in the selection of clones containing the plasmid pBF 158. This plasmid is 787 nucleotides smaller than pBF 157 and is different. it has no BamHI clipping site. Transformed strains do not confer resistance to tetracycline in plasmid pBF 158.

B. pBF 158-01 plazmidės konstravimas, sintetinės polilinkerinės sekos įterpimasB. Construction of plasmid pBF 158-01, insertion of a synthetic polylinker sequence

Iš plazmidės pBF 158 EcoPI ir HindlII iškerpamas 31 nukleotido fragmentas ir į tą vietą įterpiamas multiklonavimo saitas, kurio seka parodyta fig. 3. Po transformacijos į E. coli K12 JM 103 ląsteles ir kultivavimo terpėje, kurioje yra 150 ųg/ml ampicilino, atrenkami klonai, kurie turi sąvyje plazmidę pBF 15801. Ši plazmidė nuo pBF158 skiriasi tuo, kad ji turi papildomas vieninteles kirpimo vietas Xbal, NdeI, EagI, KpnI, Spel ir turi antrą PstI kirpimo vietą (fig. 4).A 31 nucleotide fragment is excised from plasmid pBF 158 EcoPI and HindIII and inserted into this site by the multicloning site shown in FIG. 3. After transformation into E. coli K12 JM103 cells and culturing medium containing 150 µg / ml ampicillin, clones are selected which contain plasmid pBF 15801. This plasmid differs from pBF158 in that it has additional single cleavage sites on Xbal, NdeI, EagI, KpnI, Spel and has a second PstI cleavage site (Fig. 4).

Tarp Xbal ir NdeI yra Shine-Dagarno seka iš Xyl operonBetween Xbal and NdeI is the Shine-Dagarno sequence from the Xyl operon

B. subtilis (žiūr. Ihelm ir kt, cituotoje vietoje).B. subtilis (see Ihelm et al., Supra).

C. pBF 158-01, T plazmidės konstravimas, transkripcijos grandinės nutraukimo agento įterpimas.Construction of C. pBF 158-01, T plasmid, insertion of a transcription chain terminating agent.

Iš plazmidės pBF 158-01 pašalinamas Clal - HindlII polilinkerinės sekos fragmentas ir pakeičiamas Clal LT 3948BPlasmid pBF 158-01 deletes the Clal-HindIIIII polylinker sequence fragment and replaces it with Clal LT 3948B.

HindlII fragmentu iš pRT 61 (žiūr. Jorgensen ir kiti, cituojamoje vietoje).A HindIII fragment from pRT 61 (see Jorgensen et al., Supra).

Po transformacijos f E. coli K12 JM 103 ląsteles ir 5 kutivavimo terpėje, kurioje yra 150 ųg/ml ampicilino, atrenkami tie klonai, kurie turi savyje plazmidę pBFFollowing transformation with E. coli K12 JM 103 cells and 5 digestion media containing 150 µg / ml ampicillin, clones containing the plasmid pBF are selected.

158-01 T. Ši plazmidė nuo pBF158-01 skiriasi tuo, kad ji didesnė 297 nukleotidų Clal - HindlII fragmentu (fig. 5) .158-01 T. This plasmid differs from pBF158-01 in that it is larger by the 297 nucleotide Clal-HindIII fragment (Figure 5).

00

D. Plazmidžių pBF 158-02 T-pBF 158-06 T konstravimas, sintetinių fragmentų M4-M8 įterpimas į koduojantį geną.D. Construction of plasmids pBF 158-02 T-pBF 158-06 T, insertion of the M4-M8 synthetic fragments into the coding gene.

Visi sintetiniai fragmentai aprašyti fig. 6a-6e. Jie įvedami 200 nukleotidų fragmentais į atitinkamus vektorius. Tam vektoriai su žinomomis kirpimo vietomis fermentų pagalba užbukinami, perkerpami ir elektroforezės pagalba agarozėje, elektroeliucija ir valant per DE 52 celiuliozę, atskiriami nuo pašalinamo frag20 mento. Po to vykdomas surišimas ligazės T4 pagalba su atitinkamu sintetiniu dvispiraliu fragmentu, transformuojami į E. coli K12 JM 103 (fig. 7 a-7 c) ir vykdoma atranka terpėje su ampicilinu.All synthetic fragments are described in FIG. 6a-6e. They are introduced into fragments of 200 nucleotides into appropriate vectors. For this purpose, vectors with known cleavage sites are enzymatically quenched, cut and electrophoresed on agarose, electroeluted and purified via DE 52 cellulose to separate them from the fragments to be removed. This is followed by ligation with T4 ligase with the appropriate synthetic double-stranded fragment, transformed into E. coli K12 JM 103 (Figs. 7a-7c) and selection in medium containing ampicillin.

5 i) . Fragmento M8 įterpimas tarp BamHI ir Clal plazmidėje pBF 158-01 T5 i). Insertion of fragment M8 between BamHI and Clal in pBF 158-01 T

Gaunama plazmidė pBF 158-02 T.Plasmid pBF 158-02 T was obtained.

Oligonukleotidas 019 turi junginio, kurio formulė I, Cgalo seką.Oligonucleotide 019 contains the Cgal sequence of a compound of formula I.

Už stop kodono TAA yra NdeI kirpimo vieta po kurios yra papildomos transkripcijos galo trpA grandinės nutrau35 kimo agento sekos (žiūr. Shristie ir kiti, P.N.A.S. 78, 1981, p. 4180-4184) iki Clal.Behind the stop codon TAA is the NdeI cleavage site followed by additional transcriptional terminus trpA chain termination agent sequences (see Shristie et al., P.N.A.S. 78, 1981, pp. 4180-4184) up to Clal.

ii) Fragmento M7 įterpimas tarp Spel ir BamHI plazmideje pBF 158-02 T.ii) Insertion of fragment M7 between SpeI and BamHI in pBF 158-02 T.

Gaunama plazmidė pBF 158-03 T.Plasmid pBF 158-03 T was obtained.

iii) Fragmento M8 įterpimas tarp KpnI ir Spel plazmidėje pBF 158-04 T.iii) Insertion of fragment M8 between KpnI and Spel in pBF 158-04 T.

Gaunama plazmidė pBF 158-04 T.Plasmid pBF 158-04 T was obtained.

iv) Fragmento M5 įterpimas tarp EagI ir KpnI plazmidėje pBF 158-04 T.iv) Insertion of fragment M5 between EagI and KpnI in pBF 158-04 T.

Gaunama plazmidė pBF 158-05 T.Plasmid pBF 158-05 T was obtained.

v) Fragmento M4 įterpimas tarp SacI ir EagI plazmidėje pBF 158-05 T.v) Insertion of fragment M4 between SacI and EagI in pBF 158-05 T.

Gaunama plazmidė pBF 158-06 T.Plasmid pBF 158-06 T was obtained.

Iš gautų klonų i) - v) atrenkami tokie, kuriuose yra įterptas atitinkamas fragmentas su patikrinta taisyklinga seka.From the resulting clones i) - v), one is selected which contains the appropriate fragment with the verified regular sequence.

E. Plazmidės pGR Tac 06 konstravimas, Tac promotoriaus įterpimasE. Construction of plasmid pGR Tac 06, insertion of the Tac promoter

Plazmidė PBF 158-06 T kerpama Eco I ir Xba I. 26 nukleotidų fragmentas pašalinamas preparatyvine elektroforeze agarozės gelyje, likusioji plazmidės dalis eliuojama elektroeliucij a ir valoma per DE 52.Plasmid PBF 158-06 T is cleaved with Eco I and Xba I. The 26 nucleotide fragment is removed by preparative electrophoresis on an agarose gel, the remainder of the plasmid is eluted by electroelution and purified by DE 52.

Iš plazmidės ptacSDT (DSM 5018) išskiriamas Eco I ir Xba I fragmentas, kuriame yra Tac* promotorius. Tam plazmidė ptac SDT kerpama su Ecol ir Xba, ir atskiriamas fragmentas preparatyvinės elektroforezės agarozės gelyje. Fragmentas pašildomas iki 65°C amonio acetato - SDS buferiniame tirpale, pH 8.0, eliuojamas iš mechaniškai susmulkinto poliakrilamido ir valomas kelis kartus ekstrahuojant fenoliu prisotintu 1M TRISHC1 buferiu, pH 8.0.An Eco I and Xba I fragment containing the Tac * promoter is isolated from plasmid ptacSDT (DSM 5018). For this, the plasmid ptac SDT is cleaved with Ecol and Xba and the fragment is separated on preparative electrophoresis agarose gel. The fragment was warmed to 65 ° C in ammonium acetate - SDS buffer, pH 8.0, eluted from mechanically shredded polyacrylamide and purified by repeated extraction with phenol-saturated 1M TRISHC1 buffer, pH 8.0.

Gauti abu fragmentai sujungiami įprastu būdu su ligaze T4 ir transformuojami į E. coli K12 JM 103. Po kultivavimo terpėje, kurioje yra 150 ųg/ml ampicilino, atrenkami tie klonai, kurie po IPTG įdėjimo produkuoja probaltymą, PA/06, kurio formulė I pagal fig. 9. Šie klonai turi savyje plazmidę pGR Tac 06.Both fragments obtained are ligated in the usual manner to T4 ligase and transformed into E. coli K12 JM 103. After culturing in media containing 150 µg / ml ampicillin, clones which produce probaltim, PA / 06 of formula I according to the invention, are selected. FIG. 9. These clones contain the plasmid pGR Tac 06.

f) Ekspresijos testas(f) Expression test

i) Fermentacija(i) Fermentation

Transformuotos E. coli K12 JM 103 ląstelės plazmide pGR Tac 06 terpėje, kurioje yra: 38 mM amonio sulfato, 56 mM fosfatinio buferinio tirpalo, kurio pH 7.0, 1 mM magnio sulfato, 1% mielių ekstrakto, 1% gliukozės ir 150 mg/1 ampicilino. Probaltymo PA/06 indukcija atliekama 0.5 mM IPTG.Transformed E. coli K12 JM 103 cells in plasmid pGR Tac 06 medium containing: 38 mM ammonium sulfate, 56 mM phosphate buffer pH 7.0, 1 mM magnesium sulfate, 1% yeast extract, 1% glucose and 150 mg / L ampicillin. Induction of probalt PA / 06 is performed with 0.5 mM IPTG.

Prieš indukciją ir po kiekvienos valandos po indukcijos, viso 6 valandas, paimamas 1 ml ląstelių suspensijos taip, kad optinis tankis (OD) 578 nm bangoje būtų lygus 1, ir nustatomas ekspresijos lygis.Prior to and every hour after induction, a total of 6 ml of cell suspension is withdrawn for 6 hours so that the optical density (OD) at 578 nm is equal to 1 and the expression level is determined.

ii) Probaltymo struktūros atstatymas, jo suskaldymas iki atitinkamo dvigrandžio junginio PA/06 ir jo PAaktyvumo matavimas.(ii) Reconstitution of the probaltim, its cleavage to the corresponding PA / 06 double bond compound and measurement of its PAactivity.

Atskirtos centrifuguoj ant, ląstelės tirpinamos lizocime, po to ląstelių lizatas apdorojamas aukščiau aprašytu būdu.After centrifugation, the cells are lysozyme-solubilized, followed by treatment of the cell lysate as described above.

PA/06 arba jo probaltymo ekspresijos lygis nustatytas, matuojant dvigrandžio plazminogeninio aktyvatoriaus, gauto iš junginio PA/06 (gauto atstačius struktūrą probaltymui), aktyvumą. Gauti rezultatai pateikti fig. 11. Ši aktyvumą turi tik po skėlimo plazminu (žiūr. fig. 11), todėl junginys PA/06 (arba jo probaltymas) yra su viena grandine.The level of expression of PA / 06 or its probaltim was determined by measuring the activity of the double-stranded plasminogen activator obtained from PA / 06 (obtained after probalt restoration). The results obtained are shown in FIG. 11. This activity is present only after plasmin cleavage (see Figure 11), so that PA / 06 (or its probalt) is present with a single chain.

Pavyzdys 2Example 2

Ekspresinės plazmidės pGR Trp 06 konstravimasConstruction of the expressing plasmid pGR Trp 06

Aprašyta De Boer ir kitų PNAS, 80, 1983, p. 21-25 Trp promotoriaus seka yra iki Xbal kirpimo vietos prailginama 5' gale seka 5'-AATTCTGAAAT-3'.Described by De Boer et al., PNAS, 80, 1983, p. The 21-25 Trp promoter sequence is up to the Xba I site at the 5 'end of the 5'-AATTCTGAAAT-3' sequence.

Rezultate gaunama EcoRI kirpimo vieta (fig. 10, fragmentas Ml) . Atskiros grandinės 021 ir 021A surenkamos ir sujungiamos su EcoRI ir Xbal fragmentu iš plazmidės pGR tac 06. Po transformacijos į E. coli K12 JM 103 ląsteles ir kultivavimo terpėje, kurioje yra 150 mg/ml ampicilino, atrenkami tie klonai, kurie turi plazmidę pGR Trp 06. Plazmidė pGR Trp 06 skiriasi nuo aukščiau minėtų pirmtakų tuo, kad ja trasformuotos E. coli kamienų bakterijos, pridėjus indolakrilo rūgšties, produkuoja probaltymą junginio PA/06.The result is an EcoRI cleavage site (Fig. 10, fragment M1). Separate chains 021 and 021A are assembled and fused to the EcoRI and XbaI fragment from plasmid pGR tac 06. After transformation into E. coli K12 JM 103 cells and cultures containing 150 mg / ml ampicillin, clones containing plasmid pGR Trp are selected. 06. The plasmid pGR Trp 06 differs from the above precursors in that it transformed E. coli strain bacteria with the addition of indolacrylic acid to produce probaltim in PA / 06.

Pavyzdys 3Example 3

Ekspresinės plazmidės pGR 318 konstravimasConstruction of the expression plasmid pGR 318

Plazmidė pGR Trp 06 kerpama NdeI ir Sacl. Gautas 58 bp ilgio fragmentas, kuris yra polilinkerinė seka išskiriama preparatyvinės elektroforėzės pagalba agarozės gelyje, likusi plazmidės dalis pašalinama elektroeliucija ir fragmentas valomas per DE 52 celiuliozę.Plasmid pGR Trp 06 was cleaved with NdeI and Sacl. The resulting 58 bp fragment, which is a polylinker sequence is isolated by preparative electrophoresis on an agarose gel, the remainder of the plasmid is electroeluted and the fragment is purified via DE 52 cellulose.

Šis fragmentas su sintetiniu oiigonukleotidu 18This fragment contains a synthetic oligonucleotide 18

5'-TATG AGC AAT GAG CT-3 '5'-TATG AGC AAT GAG CT-3 '

AC TGG TTA CAC TGG TTA C

Įprastu būdu sujungiamas ligaze T4 ir transformuojamas Į E. coli K12, kultivuojamas ampicilino turinčioje terpėje. Atrenkami tie klonai, kurie, pridėjus indolakrilo rūgšties, produkuoja probaltymą junginio PA 318. Šie klonai turi plazmidę pGR 318, kuri koduoja junginius, kurių formulė I, PA 318. Šių junginių aminorugščių seka nurodyta fig. 12.Conventionally ligated with T4 and transformed into E. coli K12 cultured in ampicillin-containing medium. Clones are selected which, upon addition of indolacrylic acid, produce probaltimic compound PA 318. These clones contain the plasmid pGR 318, which encodes compounds of formula I, PA 318. The amino acid sequence of these compounds is shown in FIG. 12th

B. Ekspresijos testasB. Expression test

Po transformacijos E. coli K12 JM 103 plazmidę pGR 318, fermentuojamos tokiu pat būdu, kaip aprašyta pavyzdyje 1. Indukcija vykdoma 62 mg indoilakrilo rūgštimi 1 litrui fermentinei terpei prie 578 nm, kai ląstelių suspensijos optinis tankis pasiekia 2-3 optinius vienetus.After transformation, the plasmid pGR 318 of E. coli K12 JM 103 is fermented in the same manner as described in Example 1. The induction is carried out with 62 mg of indoyl acrylic acid per liter of enzyme medium at 578 nm when the cell suspension reaches 2-3 optical units.

Prieš indukciją ir po kiekvienos valandos po indukcijos, viso 5 valandas, paimamas 1 ml ląstelių suspensijos taip, kad optinis tankis (OD) 578 nm bangoje būtų lygus 1, ir nustatomas ekspresijos lygis.Prior to and every hour after induction, a total of 5 ml of cell suspension is withdrawn for 5 hours so that the optical density (OD) at 578 nm is equal to 1 and the expression level is determined.

Po junginio PA 318 probaltymo (žiūr. pavyzdį 1) struktūros atstatymo, surinktuose mėginiuose nustatomas amidolitinis aktyvumas, paveikus plazminu, prieš indukciją ir 1-5 valandą po indukcijos. Rezultatai pateikti fig. 13. Iš šių duomenų seka, kad pasiektas toks pats ekspresijos lygis kaip ir su plazmidę pGR Tac 06 (tiesa, tik kitam probaltymui) ir kad amidolitinis aktyvumas pasireiškia tik po apdorojimo plazminu. Todėl junginys PA 318, kurio formulė I, produkuojamas E. coli K12 su plazmidę pGR 318 kaip probaltymas su viena grandine.After reconstitution of the PA 318 probaltim (see Example 1), the collected samples were assayed for amidolytic activity after plasmin treatment before and 1 to 5 hours after induction. The results are shown in Figs. 13. It follows from these data that the same level of expression was achieved as with the plasmid pGR Tac 06 (but only for another probe) and that the amidolytic activity is only present after plasmin treatment. Therefore, PA 318 of formula I is produced in E. coli K12 with plasmid pGR 318 as a single-stranded probe.

C. Išskyrimas, gryninimas ir charakterizavimasC. Isolation, Purification and Characterization

Tam, kad išgrynintų baltymus, fermentuojama 1 litro tūryje, kontroliuojant pH ir temperatūrą (pH 7.0, 37°C) .To purify the protein, it is fermented in 1 liter volume, controlled by pH and temperature (pH 7.0, 37 ° C).

Šiomis sąlygomis galima išauginti ląsteles iki 20 optinių vienetų, matuojant 578 nm bangoje. Po ekspresijos pabaigos (apie 5-6 valandos) 50 ml ląstelių suspensijos centrifuguojama, nuosėdos suspenduojamos 40 ml vandens ir suardomos aukšto slėgio homogenizatoriuje. Po centrifugavimo nuosėdos, kuriose yra visas neaktyvus probaltymas, tirpinamos 100 ml 5 M guanidmhidrochlorido tirpale su 40mM cisteino, 1 mM EDTA (pH pasiektas 8.0) ir praskiedžiama 400 ml 25 mM TRIS-HC1 buferinio tirpalo, pH 9.0. Prieinant orui arba prapučiant deguonimi, baltymo struktūros atstatymas trunka apie 12 valandų .Under these conditions, cells can be grown to 20 optical units measured at 578 nm. After expression is complete (about 5-6 hours), 50 ml of cell suspension is centrifuged, the pellet is resuspended in 40 ml of water and digested in a high-pressure homogenizer. After centrifugation, the precipitate containing all inactive probaltim was dissolved in 100 ml of 5 M guanidine hydrochloride solution with 40 mM cysteine, 1 mM EDTA (pH 8.0) and diluted with 400 ml of 25 mM TRIS-HCl buffer, pH 9.0. It takes about 12 hours to recover the structure of the protein when exposed to air or flushed with oxygen.

Junginys PA 318 išskiriamas ir išgryninamas chromatografijos pagalba. Nustatant N-galus, buvo Įrodyta, kad baltymas turi vieną grandinę ir kad N-gale yra norima seka.PA 318 is isolated and purified by chromatography. In determining the N-terminus, it has been proved that the protein has a single strand and that the desired sequence is present at the N-terminus.

Pavyzdys 4:Example 4:

Ekspresinės plazmidės pGR 319 konstravimasConstruction of the pGR 319 expression plasmid

Plazmidė pGR Trp 06 kerpama kaip aprašyta pavyzdyje 3a, su NdeI ir SacI, išskiriamas didelis fragmentas.The plasmid pGR Trp 06 is cleaved as described in Example 3a with NdeI and SacI, and a large fragment is isolated.

Šis fragmentas su sintetiniu oligonukleotidu 19This fragment contains a synthetic oligonucleotide 19

5'-TATG 5'-TATG AG C AG C AAT AAT GAA GAG CT-3’ GAA GAG CT-3 ' AC AC TCG TCG TTA TTA CTT C CTT C įprastu būdu usual way sujungiamas merging ligaze T4 ir transformuojamas ligase T4 and transformed

E. coli K12, kultivuojamas ampicilino turinčioje terpėje. Atrenkami tie klonai, pridėjus indolakrilo rūgšties, kurie produkuoja junginio PA 318 probaltymą. Šie klonai turi plazmidę pGR 318, kuri koduoja junginius, PA 319, kurių formulė I. Šių junginių aminorūgščių seka nurodyta fig. 12.E. coli K12 cultured in ampicillin-containing medium. Clones are selected, with the addition of indolacrylic acid, which produce probalt of PA 318. These clones contain the plasmid pGR 318, which encodes compounds PA 319 of formula I. The amino acid sequence of these compounds is shown in FIG. 12th

B. Ekspresijos testasB. Expression test

E. coli K12, trasf ormuotos su plazmidę pGR 319, fermentuojamos, vykdoma indukcija ir surenkami pavyzdžiai bandymams tokiu pat būdu, Kaip aprašyta pavyzdyje 3b.E. coli K12, transfected with plasmid pGR 319, is fermented, induced, and assayed in the same manner as described in Example 3b.

Junginys PA 319 išskiriamas, išgryninamas ir charakterizuojamas taip pat, kaip pavyzdyje 3C.PA 319 is isolated, purified and characterized in the same manner as in Example 3C.

Junginio PA 319 probaltymo struktūros atstatymas ir ekspresijos lygio įvertinimas atliekamas kaip pavyzdyje 3B. Rezultatai pateikti fig. 13. Iš šių duomenų seka, kad pasiektas toks pats ekspresijos lygis kaip ir su plazmidę pGR Tac 06 ir kad amidolitinis aktyvumas pasireiškia tik po apdorojimo plazminu. Todėl junginys PA 319, kurio formmulė I, produkuojamas E. coli K12 plazmidę pGR 318 kaip probaltymas su viena grandine.Restoring the structure and expression level of probaltim of PA 319 is performed as in Example 3B. The results are shown in Figs. 13. It follows from these data that the same level of expression is reached as with the plasmid pGR Tac 06 and that the amidolytic activity is only present after plasmin treatment. Therefore, compound PA 319 of Formula I is produced in E. coli K12 plasmid pGR 318 as a single-stranded probe.

Pavyzdys 5:Example 5:

Ekspresinės plazmidės pGR 327 konstravimasConstruction of the expression plasmid pGR 327

Plazmidė pGR Trp 06 kerpama kaip aprašyta pavyzdyje 3a, su NdeI ir SacI, išskiriamas didelis fragmentas.The plasmid pGR Trp 06 is cleaved as described in Example 3a with NdeI and SacI, and a large fragment is isolated.

Šis fragmentas su sintetiniu oligonukleotidų 27This fragment with synthetic oligonucleotides 27

5'-TATG 5'-TATG AGC AGC AG T AG T CCA CCA CCA CCA GAG GAG CT-3 ' CT-3 ' AC AC TCG TCG TCA TCA GGT GGT CCT CCT CTT CTT C C įprastu normal būdu sujungiamas by way of connection ligaze ligase T4 ir T4 and trans formuoj amas trans formation

į E. coli K12. Selekcija ir klonų atranka atliekami kaip aprašyta pavyzdyje 3A. Atrinkti klonai turi plazmidę pGR 327, kuri koduoja junginius, PA 327_, kurių formulė I. Šių junginių aminorūgščių seka nurodyta fig. 12.to E. coli K12. Selection and clone selection are performed as described in Example 3A. The selected clones contain the plasmid pGR 327, which encodes compounds PA 327_ of formula I. The amino acid sequence of these compounds is shown in FIG. 12th

B. Ekspresijos testasB. Expression test

E. coli K12, trasformuotos su plazmidė pGR 327, fermentuojamos ir tikrinamas ekspresijos lygis taip pat kaip pavyzdyje 3B. Rezultatai pateikti fig. 13.E. coli K12 transformed with plasmid pGR 327 is fermented and the expression level tested as in Example 3B. The results are shown in Figs. 13th

Junginio PA 319 probaltymo struktūros atstatymas ir ekspresijos lygio įvertinimas atliekamas kaip pavyzdyje 3B. Rezultatai pateikti fig. 13. Iš šių duomenų seka, <ad pasiektas toks pats ekspresijos lygis kaip ir su plazmidė pGR Tac 06 ir kad amidolitinis aktyvumas pasireiškia tik po apdorojimo plazminu. Todėl junginys PA 327, kurio formulė I, produkuojamas E. coli K12 plazmidė pGR 327 kaip probaltymas su viena grandine. Išskyrimas, išgryninimas ir charakterizavimas buvo atliekami taip pat kaip pavyzdyje 3C.Restoring the structure and expression level of probaltim of PA 319 is performed as in Example 3B. The results are shown in Figs. 13. From these data, the same level of expression was reached as for the plasmid pGR Tac 06 and that the amidolytic activity is only present after plasmin treatment. Therefore, compound PA 327 of formula I is produced in E. coli K12 plasmid pGR 327 as a single-stranded probe. Isolation, purification and characterization were carried out in the same manner as in Example 3C.

Pavyzdys 6:Example 6:

Plazmidė pGR Trp 06 kerpama kaip aprašyta pavyzdyje 3a, su NdeI ir SacI, išskiriamas didelis fragmentas.The plasmid pGR Trp 06 is cleaved as described in Example 3a with NdeI and SacI, and a large fragment is isolated.

Šis fragmentas su sintetiniu oligonukleotidu 36This fragment contains a synthetic oligonucleotide 36

5'-TATG AC 5'-TATG AC AGC TCG AGC TCG CCA GGT CCA GGT CCA CCT CCA CCT GAA CTT GAA CTT GAG C GAG C CT-3 ' CT-3 ' įprastu būdu sujungiamas connected in the usual way ligaze T4 ligase T4 ir transformuojamas and transformative į E. coli to E. coli K12 Q12 JM 105. JM 105. Selekcija Breeding ir and klonų clones atranka selection

atliekami kaip aprašyta pavyzdyje 3A. Atrinkti klonai turi plazmidę pGR 336, kuri koduoja junginius, PAare performed as described in Example 3A. The selected clones contain the plasmid pGR 336, which encodes the compounds, PA

336, kurių formulė I. Šių junginių aminorūgščių seka nurodyta fig. 12.336 of formula I. The amino acid sequence of these compounds is shown in FIG. 12th

E. coli K12 JM 105, trasformuotos plazmide pGR 336, 5 fermentuojamos ir po indukcijos tikrinamas ekspresijos lygis taip pat kaip pavyzdyje 3B. Iš pirminio probaltymo gaunamas vienos grandinės junginys PA 336 (aminorūgščių seka parodyta fig. 12) . Pasiektas toks pats ekspresijos lygis kaip ir su plazmide pGR Tac 06.E. coli K12 JM 105, transformed with plasmid pGR 336, is fermented and after induction assayed for expression levels in the same manner as in Example 3B. The primary probaltim yields a single chain compound PA 336 (amino acid sequence shown in Figure 12). The same level of expression was achieved as with the plasmid pGR Tac 06.

IŠRADIMO APIBRĖŽTISDEFINITION OF INVENTION

Claims (27)

IŠRADIMO APIBRĖŽTISDEFINITION OF INVENTION 1. Nauji polipeptidai, kurių bendra formulė I:1. Novel polypeptides of general formula I: Ser-X1-X2-rscu-PA143'411 (I), kurioje rscu-PA143411 - negliukozilinta aminorūgščių sekos sritis nuo 143 (Glu) iki 411 (LeuOH) iš scu-PA 54k,Ser-X 1 -X 2 -rscu-PA 143 ' 411 (I), wherein rscu-PA 143 ' 411 is a non-glycosylated amino acid sequence region of 143 (Glu) to 411 (LeuOH) from scu-PA 54k, X! - viena iš šių aminorūgščių liekanų: Asn, Pro arba Ser, irX! - one of the following amino acid residues: Asn, Pro or Ser, and X2 - vienguba jungtis arba Glu, Pro-Glu, Pro-Pro-Glu arba Glu-Leu-His-Leu-Leu-Gln-Val-Pro-Ser-Asn.X 2 is a single bond or Glu, Pro-Glu, Pro-Pro-Glu or Glu-Leu-His-Leu-Leu-Gln-Val-Pro-Ser-Asn. 2. Polipeptidai pagal 1 punktą, besiskiriantis tuo, kad Xi yra Asn arba Ser.2. The polypeptides of claim 1, wherein X 1 is Asn or Ser. 3. Polipeptidai pagal 1 ir 2 punktą, besiskiriantys tuo, kad X! yra Ser.3. Polypeptides according to claims 1 and 2, characterized in that X! is Ser. 4. Polipeptidai pagal 1-3 punktus, besiskiriantys tuo, kad X2 yra vienguba jungtis arba Glu, Pro-Glu arba Pro-Pro-Glu.4. Polypeptides according to claims 1-3, wherein X 2 is a single bond or Glu, Pro-Glu or Pro-Pro-Glu. 5. Polipeptidai pagal 1 punktą, besiskiriantys tuo, kad Xx yra Asn arba Ser, o X2 yra vienguba jungtis arba Glu, Pro-Glu arba Pro-Pro-Glu ir rscuPA143 411 turi tą pačią reikšmę kaip 1 punkte.5. The polypeptides of claim 1, wherein X x is Asn or Ser and X 2 is a single bond or Glu, Pro-Glu or Pro-Pro-Glu and rscuPA 143 411 have the same meaning as in claim 1. 6. Polipeptidas pagal 1 ir 3 punktus, besiskiriantis tuo, kad jo formulė yra (I a) :6. The polypeptide of claims 1 and 3, wherein the polypeptide has the formula (I a): Ser-Ser-Pro-Pro-Glu-r scu-PA143 4 1 1 , kurioje rscu-PA14 41 turi tą pačią reikšmę kaip ir i punkte.Ser-Ser-Pro-Pro-Glu-r scu-PA 143 4 1 1 , wherein rscu-PA 14 41 has the same meaning as in (i). 7. Naujos plazmidės, naudojamos polipeptidams pagal 1-6 punktus gauti, besiskiriančios tuo, kad jų operonas turi reguliuojamą promotorių, pasireiškiantį kaip surišimo vieta su ribosomine Shine-Dalgarno seka, startini, kodoną, sintetinį struktūrinį geną polipeptidams pagal 1-6 punktus ir 5' kryptimi nuo struktūrinio geno nuo vieno iki dviejų terminacijos agentų, ir naudojami probaltymc ekspresijai Enterobacteriaceae šeimos bakterijose, geriausia Escherichia coli kamienuose.7. A novel plasmid used to obtain the polypeptides of claims 1-6, wherein the operon has a regulated promoter, which acts as a binding site with a ribosomal Shine-Dalgarn sequence, a start codon, a synthetic structural gene for the polypeptides of claims 1-6 and 5. in the direction of the structural gene from one to two termination agents, and are used for expression of probaltymc in Enterobacteriaceae, preferably Escherichia coli strains. 8. Plazmidės pagal 7 punktą, besiskiriančios tuo, kad atstumas tarp Shine-Dalgarno sekos ir startinio kodono yra 6-12, geriausia 8-10 nukleotidų.Plasmid according to claim 7, characterized in that the distance between the Shine-Dalgarn sequence and the start codon is 6-12 nucleotides, preferably 8-10 nucleotides. 9. Plazmidės pagal 7 ir 8 punktus, besiskiriančios tuo, kad reguliuojamas promotorius yra sintetinis Trp arba Tac promotorius.Plasmid according to claims 7 and 8, characterized in that the regulated promoter is a synthetic Trp or Tac promoter. 10. Plazmidės pagal 9 punktą, besiskiriančios tuo, kad reguliuojamas promotorius yra sintetinis Trp promotorius, kurio nukleotidų seka yra parodyta fig. 10, o fig. 10 yra šio punkto dalis.10. The plasmid of claim 9, wherein the regulated promoter is a synthetic Trp promoter having the nucleotide sequence shown in FIG. 10, and FIG. 10 is part of this paragraph. 11. Plazmidės pagal 9 punktą, besiskiriančios tuo, kad reguliuojamas promotorius yra plazmidės ptac SDT(DSM 5018) Tac* promotorius.Plasmid according to claim 9, characterized in that the regulated promoter is the Tac * promoter of ptac SDT (DSM 5018). 12. Plazmidės pagal 7-11 punktus, besiskiriančios tuo, kad terminacijos agentais operone yra einantys vienas po kito Trp A terminacijos agentas ir/arba tet A/orf L terminacijos agentas iš Th 10.Plasmid according to claims 7-11, characterized in that the termination agent in the operon is a successive Trp A termination agent and / or a tet A / orf L termination agent from Th 10. 13. Plazmides pagal 7-12 punktus, besiskiriančios tuo, kad struktūriname gene argininas koduojamas tnpletu CGT, leucinas - CTG, valinas - GTT ir/arba glicinas - GGT.Plasmids according to claims 7-12, characterized in that in the structural gene arginine is encoded by the tplet CGT, leucine-CTG, valine-GTT and / or glycine-GGT. 14. Plazmides pagal 7-13 punktus, besiskiriančios tuo, kad struktūrinis genas turi nukleotidų sekas, parodytas fig. 6a-6e, o fig. 6a-6e yra šio punkto dalis ir ypatingai vieną iš šių nukleotidų sekų:Plasmids according to claims 7-13, characterized in that the structural gene has the nucleotide sequences shown in FIG. 6a-6e, and figs. 6a to 6e are part of this paragraph, and in particular one of the following nucleotide sequences: ATGAGCAATATGAGCAAT ATGAGCAATGAAATGAGCAATGAA ATGAGCAGTCCACCAGAAATGAGCAGTCCACCAGAA ATGAGCCCACCAC-AA.ATGAGCCCACCAC-AA. 15. Plazmides pagal 7-14 punktus, besiskiriančios tuo, kad struktūrinis genas yra sudarytas iš šios nukleotidų sekos:Plasmids according to claims 7-14, characterized in that the structural gene is composed of the following nucleotide sequence: ATGAGCAATATGAGCAAT ATGAGCAATGAAATGAGCAATGAA ATGAGCAGTCCACCAGAAATGAGCAGTCCACCAGAA ATGAGCCCACCAGAA.ATGAGCCCACCAGAA. 16. Plazmides pagal 7-15 punktus, besiskiriančios tuo, kad struktūrinio geno nukleotidų sekos 5' gale yra metionino kodonas, po kurio eina serino kodonas.Plasmids according to claims 7 to 15, characterized in that the nucleotide sequence of the structural gene has a methionine codon at its 5 'end followed by a serine codon. 17. Plazmides pagal 7-16 punktus, besiskiriančios tuo, kad jose yra operonas plazmidėje pBR 322, iš kurio pašalinta nic/bom sritis.Plasmids according to claims 7-16, characterized in that they contain an operon in plasmid pBR 322, in which the nic / bom region has been removed. 18. Plazmides pagal 7-16 punktus, besiskiriančios tuo, kad jose yra operonas plazmidėje pBR 322, iš kurio pašalintas atsparumo tetraciklinui genas pilLT 3948B nai arba dalinai taip, kad plazmidė neturėtų atsparumo tetraciklinui.18. Plasmids according to claims 7-16, characterized in that they contain an operon in plasmid pBR 322, in which the tetracycline resistance gene pilLT 3948B has been deleted or partially so that the plasmid has no tetracycline resistance. 19. Plazmidės pagal 7-18 punktus, besiskiriančios tuo, kad jose yra operonas plazmidėje pBR 322, iš kurio pašalinta nic/bom sritis ir pašalinta tokia atsparumo tetraciklinui geno dalis, kad plazmidė neturėtų atsparumo tetraciklinui.Plasmid according to claims 7 to 18, characterized in that it contains an operon in plasmid pBR 322, in which the nic / bom region has been deleted and the portion of the tetracycline resistance gene has been deleted such that the plasmid has no tetracycline resistance. 20. Plazmidės pagal 7-19 punktus, besiskiriančios tuo, kad jos yra pGR, Trp 06, PGR 318, pGR 319, pGR 336 su sintetiniu struktūriniu genu, kontroliuojamu Trp promotoriumi.Plasmids according to claims 7-19, characterized in that they are pGR, Trp 06, PGR 318, pGR 319, pGR 336 with a synthetic structural gene under the control of the Trp promoter. 21. Plazmidė pagal 7-19 punktus, besiskiriant i tuo, kad ji yra tokia, kaip atvaizduota piešinyje:21. Plasmid according to claims 7-19, characterized in that it is as shown in the figure: 22. Plazmidžių pagal 7 punktą gavimo būdas, besiskiriantis tuo, kad į plazmidę pBR 322, iš kurios pašalinta nic/bom sritis ir/arba rezistentinio tetraciklinui geno bent dalis tarp EcoRI ir HindlII kirpimo vietų, Įterpia polilinkerinę seką, kurios nukleotidų seka parodyta fig. 3 (fig. 3 yra šio punkto dalis) ir kurios pagalba žinomais būdais įterpia transkripcijos terminavimo agentą, atskiros sintetinės struktūrinio geno sekos I formulės junginiams, geriausia pradedant nuo struktūrinio geno 3' C galo, bei sintetinis Trp promotorius.22. The method of generating plasmids according to claim 7, wherein the plasmid pBR 322 deleting the nic / bom region and / or at least a portion of the tetracycline-resistant gene between EcoRI and HindIIIII inserts has a polylinker sequence having the nucleotide sequence shown in FIG. 3 (FIG. 3 is a part of this paragraph) and by means of known methods inserts a transcription termination agent, separate synthetic structural gene sequences for compounds of formula I, preferably starting at the 3 'C terminus of the structural gene, and a synthetic Trp promoter. 23. Plazmidžių pagal 7 punktą gavimo būdas, besis k i r i a n t i s tuo, kad iš gautos pagal 22 punktą plazmidės EcoRI ir HindlII fragmentas kaip ekspresijos kasetė žinomais būdais įterpia į kitą, galinčią autonomiškai replikuotis enterobacteriacea šeimos bakterijose, geriausia E. coli, plazmidę.23. A method of producing plasmids according to claim 7, characterized in that the EcoRI and HindIII fragment of plasmid obtained according to claim 22 is inserted into another plasmid capable of autonomous replication in bacteria of the enterobacteriacea family, preferably E. coli, as an expression cassette. 24. Polipeptido pagal 1-6 punktus gavimo būdas, besiskiriantis tuo, kad žinomais būdais transformuoja plazmidėmis pagal 7-21 punktus enterobacteriacea šeimos bakterijų kamienus, geriausia E. coli kamienus, indukuoja struktūrinio geno ekspresiją, išskiria iš terpės ir ląstelių nuolaužų junginį, kurio formulė I, probaltymą, probaitymą ištirpina ir po to, naudojant oksidacijos-redukcijos sistemą, gauna polipeptidą pagal 1-6 punktus.24. A method of producing a polypeptide according to claims 1-6, which comprises, by known methods, transforming bacterial strains of the enterobacteriacea family, preferably E. coli strains, into a plasmid according to claims 7-21, inducing expression of a structural gene, isolating a compound of formula I, probaltim, probe is dissolved and then, using the oxidation-reduction system, obtain the polypeptide according to claims 1-6. 25. Būdas pagal 24 punktą, besiskiriantis tuo, kad plazmidę transformuoja E. coli kamieną, geriausia E. coli K12.25. The method of claim 24, wherein the plasmid is transformed with an E. coli strain, preferably E. coli K12. 26. Trombolitinis preparatas, besiskiriantis tuo, kad jo sudėtyje yra vienas iš junginių pagal 1-6 punktus, kaip aktyvuoj antis plazminogeną į aktyvų jungini, .26. A thrombolytic preparation comprising one of the compounds of claims 1-6 as an active duck plasminogen into an active compound. 27. Junginio pagal 1-6 punktus, kurio formulė I, panaudojimas trombolitinio preparato su plazminogeno aktyvatoriumi, kaip veikliąją medžiaga, gamybai.The use of a compound of the formula I as claimed in claims 1 to 6 for the preparation of a thrombolytic preparation with plasminogen activator as active ingredient.
LTIP1532A 1991-01-22 1993-12-06 Polypeptide, plasmids, method for the preparation of plasmids, method for the preparation of polypeptide, thrombolytic material and applicatio of polypeptide LT3948B (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE4101736A DE4101736A1 (en) 1991-01-22 1991-01-22 NEW PLASMINOGENACTIVATORS USEFUL POLYPEPTIDES, DAFUER CODING PLASMIDS AND METHOD FOR THE PRODUCTION THEREOF AND THEIR USE

Publications (2)

Publication Number Publication Date
LTIP1532A LTIP1532A (en) 1995-06-26
LT3948B true LT3948B (en) 1996-05-27

Family

ID=6423453

Family Applications (1)

Application Number Title Priority Date Filing Date
LTIP1532A LT3948B (en) 1991-01-22 1993-12-06 Polypeptide, plasmids, method for the preparation of plasmids, method for the preparation of polypeptide, thrombolytic material and applicatio of polypeptide

Country Status (14)

Country Link
EP (1) EP0496327B1 (en)
JP (1) JPH06169770A (en)
AT (1) ATE204326T1 (en)
DE (2) DE4101736A1 (en)
DK (1) DK0496327T3 (en)
ES (1) ES2164048T3 (en)
FI (1) FI920263A7 (en)
HU (1) HU212510B (en)
IE (1) IE914040A1 (en)
IL (1) IL100163A0 (en)
LT (1) LT3948B (en)
LV (1) LV10974A (en)
PT (1) PT496327E (en)
RU (1) RU2108387C1 (en)

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6521594B1 (en) 1990-04-06 2003-02-18 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
US6017877A (en) * 1990-04-06 2000-01-25 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
US5672585A (en) * 1990-04-06 1997-09-30 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
US5780303A (en) * 1990-04-06 1998-07-14 La Jolla Cancer Research Foundation Method and composition for treating thrombosis
KR100225511B1 (en) * 1994-12-30 1999-10-15 성재갑 Process for the mass production of bovine growth hormone
JP2003521222A (en) * 1998-03-06 2003-07-15 アボット・ラボラトリーズ Highly crystalline urokinase
US20030040095A1 (en) * 2001-03-16 2003-02-27 Achille Arini Method for the production of pharmaceutically active recombinant proteins
RU2236454C2 (en) * 2002-04-30 2004-09-20 Тараканов Борис Васильевич Method for construction of recombinant strains of microorganisms expressing procaryotic and eucaryotic genes

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0092182A2 (en) 1982-04-15 1983-10-26 Genentech, Inc. Preparation of functional human urokinase polypeptides
EP0247674A1 (en) 1986-05-15 1987-12-02 Leuven Research & Development V.Z.W. Plasminogen activator and thrombolytic composition
EP0312941A2 (en) 1987-10-23 1989-04-26 BASF Aktiengesellschaft Polypeptides with a prourokinase activity, their production and use

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2354588A (en) * 1987-10-09 1989-04-20 Collaborative Research Inc. Modified low molecular weight plasminogen activator and method of preparation
DE3810474A1 (en) * 1988-03-26 1989-10-05 Boehringer Ingelheim Int Expression vectors
GB8809093D0 (en) * 1988-04-18 1988-05-18 Erba Carlo Spa Low molecular weight derivatives of prourokinase
AU5515790A (en) * 1989-05-18 1990-11-22 Green Cross Corporation, The Human prourokinase variants, methods of producing same, dna sequences, plasmids and hosts therefor
IE901849A1 (en) * 1989-07-19 1991-06-19 Gruenenthal Gmbh Plasmids, their preparation and their use in the manufacture¹of a plasminogen activator

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0092182A2 (en) 1982-04-15 1983-10-26 Genentech, Inc. Preparation of functional human urokinase polypeptides
EP0247674A1 (en) 1986-05-15 1987-12-02 Leuven Research & Development V.Z.W. Plasminogen activator and thrombolytic composition
EP0312941A2 (en) 1987-10-23 1989-04-26 BASF Aktiengesellschaft Polypeptides with a prourokinase activity, their production and use

Non-Patent Citations (9)

* Cited by examiner, † Cited by third party
Title
CHRISTOPH BODE, MD,: "Intravenous Thrombolytic Therapy With a Combination of Single-Chain Urokinase-Type Plasminogen Activator and Recombinant Tissue-Type Plasminogen Activator in Acute Myocardial Infarction", CIRCULATION, 1990, pages 907 - 910
COHEN, E.J., KLATSKY, A.L., ARMSTRONG, M.A.: "Alcohol use and supraventricular arrhythmia", AM J CARDIOL., 1988, pages 971 - 973, XP023277756, DOI: doi:10.1016/0002-9149(88)90906-X
D.C. RIJKEN, D.J. BINNEMA, P. LOS: "Specific fibrinolytic properties of different molecular forms of pro-urokinase from a monkey kidney cell culture", THROMBOSIS RESEARCH, 1986, pages 761 - 768, XP022880198, DOI: doi:10.1016/0049-3848(86)90112-X
G. WIJNGAARDS ET AL.: "Characterization and fibrin-binding properties of different molecular forms of pro-urokinase from a monkey kidney cell culture", THROMBOSIS RESEARCH, 1986, pages 749 - 760, XP022880197, DOI: doi:10.1016/0049-3848(86)90111-8
KLAUS SCHOLLMEIER, DAGMAR GÄRTNER, AND WOLFG: "A bidirectionally active signal for termination of transcription is located between tetA and orfL on transposon Tn10", NUCL. ACIDS RES., 1985, pages 4227 - 4237
MARTIN WILHELM AND CORNELIS P. HOLLENBERG: "Nucleotide sequence of the Bacillus subtilis xylose isomerase gene: extensive homology between the Bacillus and Escherichia coli enzyme", NUCL. ACIDS RES., 1985, pages 5717 - 5722
NOLAN, C, HALL, LS, BARLOW, GH, TRIBBY, IIE: "Plasminogen activator from human embryonic kidney cell cultures: evidence for a proactivator", BIOCHIM BIOPHYS ACTA, 1977, pages 384 - 400, XP023498394, DOI: doi:10.1016/0304-4165(77)90321-X
STEVEN P. ADAMS ET AL.: "Hindered dialkylamino nucleoside phosphite reagents in the synthesis of two DNA 51-mers", J. AM. CHEM. SOC., 1983, pages 661 - 663
STUMP DC, LIJNEN HR, COLLEN D: "Purification and characterization of a novel low molecular weight form of single-chain urokinase-type plasminogen activator.", J BIOL CHEM., 1986, pages 17120 - 17126, XP001317375

Also Published As

Publication number Publication date
FI920263L (en) 1992-07-23
HU212510B (en) 1996-07-29
IE914040A1 (en) 1992-07-29
ATE204326T1 (en) 2001-09-15
IL100163A0 (en) 1992-08-18
LTIP1532A (en) 1995-06-26
DK0496327T3 (en) 2001-12-03
HU9200127D0 (en) 1992-04-28
EP0496327B1 (en) 2001-08-16
HK1010108A1 (en) 1999-06-11
JPH06169770A (en) 1994-06-21
DE59209915D1 (en) 2001-09-20
RU2108387C1 (en) 1998-04-10
PT496327E (en) 2002-02-28
FI920263A0 (en) 1992-01-21
LV10974A (en) 1995-12-20
DE4101736A1 (en) 1992-07-23
EP0496327A1 (en) 1992-07-29
HUT63877A (en) 1993-10-28
FI920263A7 (en) 1992-07-23
ES2164048T3 (en) 2002-02-16

Similar Documents

Publication Publication Date Title
CA1341580C (en) Tissue-type plasminogen activator mutants
JP2634193B2 (en) Expression of human proapolipoprotein A-1
JP2525438B2 (en) Factor-8: C manufacturing method
JP2610783B2 (en) Gene encoding polykringle plasminogen activator and vector containing the same
FI88932B (en) FRAMSTAELLNING AV FUNKTIONELLT MAENSKLIGT UROKINASPROTEIN
PT91236B (en) METHOD FOR THE PURIFICATION OF ACTIVATORS OF PASMINOGENEOUS SALIVARES GLANDULAS DE BATTLES VAMPIROS
EP0802983B1 (en) Expression of urokinase plasminogen activator inhibitors
US5073494A (en) Human tissue plasminogen activator substituted at position 275 or at positions 275 and 277
LT3948B (en) Polypeptide, plasmids, method for the preparation of plasmids, method for the preparation of polypeptide, thrombolytic material and applicatio of polypeptide
AU3055789A (en) Cleaved dimers of mullerian inhibiting substance-like polypeptides
JP3236284B2 (en) Plasmid, method for producing the same, and method for using the same for obtaining plasminogen activator
IE62832B1 (en) Methode and materials for expression of human plasminogen variant
JPS6312299A (en) Development factor for producing polypeptide, exchange development of polypeptide, host containing development vector and product made by said host
FI114102B (en) Process for preparing a plasminogen analog digested under the effect of thrombin
JPS62289181A (en) Novel compound, its production and pharmaceutical composition containing the same
EP0379890A1 (en) New tissue plasminogen activator
JPH01165379A (en) Novel compound, method for its preparation and drug composition composition containing it
HU202280B (en) Process for producing functional human urokinase proteins
JPH0739374A (en) Novel t-PA variant
PT89343B (en) PROCESS FOR THE PRODUCTION OF A PLASMINOGENIC ACTIVATOR OF THREE DOMAINS OF MULTIPLE BINDINGS WITH NEW INSERTING K2
JPH08291193A (en) Pharmaceutical composition containing a peptide having an action of promoting activation of protein C by thrombin
HU210541A9 (en) Tissue plasminogen activator having zymogenic or fibrin specific properties and substituted at amino acid positions 296-299, dna molecules encoding them, vectors, and host cells

Legal Events

Date Code Title Description
MM9A Lapsed patents

Effective date: 19961206