HU202280B - Process for producing functional human urokinase proteins - Google Patents

Abstract

The invention relates to a method for producing a microorganism. The aim of the invention is to provide a novel process with which microorganisms and cell cultures, in particular functional human urokinase proteins can be prepared in a simple and economical manner. According to the invention, the method for producing a microorganism or a cell culture is characterized in particular by the fact that the microorganism or the cell culture have been genetically modified in such a way that they control the production of a protein which contains the enzymatic part of the human urokinase. The invention is further characterized in that the microorganism or cell culture is transformed with a vector capable of expressing, in the transformed microorganism or transformed cell culture, a DNA sequence coding for a protein encoding the enzymatic portion of the human Urokinase contains.

Description

The present invention relates to human urokinase, novel forms and novel formulations thereof, and to a process for the production of functional protein types of human urokinase in vitro.

The invention is based, in part, on understanding the DNA sequence of the native urokinase and the amino acid sequence derived therefrom, as well as on other parts of the urokinase molecule. This knowledge makes it possible to produce various forms of urokinase using DNA recombination technology to obtain products of appropriate quality and quantity to perform the biological assays to determine their biological function and to identify valuable parts of the molecule. With this knowledge, pre-engineered functional types of urokinase can be engineered and in vitro to produce commercially significant amounts of active products that were previously unavailable.

For the sake of clarity and in some cases further details of the background of the invention, publications are designated herein by Arabic numerals and are listed at the end of the description.

The state of the art relating to the invention is described below.

Human urokinase

The fibrinolytic system is in dynamic equilibrium with that of the coagulation system, thereby maintaining an intact, good vascular system. As a result of the coagulation system, fibrin is deposited as an intracellular stock to restore the hemostatic state. Once this is achieved, the fibrinolytic system removes the fibrin mesh. The fibrinolytic process is created by a proteolytic enzyme called plasmin, which is formed from plasminogen. Plasminogen is converted to plasmin by activation by plasma protein precursor s.

One such activator is urokinase, which is currently commercially available with another activator, streptokinase. Both formulations are indicated for the treatment of acute vascular diseases such as myocardial infarction, stroke, pulmonary embolism, deep thrombosis, peripheral arterial occlusion and other venous thromboses. taken as a whole, these diseases constitute an extremely serious threat to human life.

In the diseases listed above, one of the vasculature is partially - or in severe cases - completely obstructed by a blood clot: a thrombus or thromboembolism. Conventional anticoagulant therapy, such as heparin and coumarin, does not directly increase the dissolution of thrombi or thromboembolism.

Streptokinase and urokinase are used in practice as thrombolytic agents. So far, however, there have been serious problems with their application. Neither substance has a high affinity for fibrin and consequently activates both circulating and fibrin-bound plasminogen in a relatively non-discriminatory manner. Plasma formed in flowing blood is rapidly neutralized and lost for efficient thrombolysis. Residual plasmin damages proteins involved in the formation of blood clots such as fibrinogen, factor V and factor VIII. factor and may result in bleeding.

Further, it is disadvantageous that streptokinase is highly antigenic and does not respond adequately to patients with high antibody titres and treatment cannot be continued for an extended period.

Treatment with urokinase is costly - since urokinase can only be isolated from human urine or pulmonary culture and is therefore not generally accepted in healing practice. Urokinase has been the subject of numerous studies (see, for example, references 1-9). Currently available urokinase is isolated from human urine or pulmonary culture, such as kidney cells (9A, 9B).

The urokinase molecule exists in several biologically active forms, which may be high molecular weight (about 54,000 daltons) or low molecular weight (about 33,000 daltons). Each of these consists of a single chain or two chains. The low molecular weight form is formed by enzymatic cleavage from the high molecular weight form. The biologically active substance contains the so-called serine protease moiety linked via a disulfide bond to a second chain. Any activity attributed to the high molecular weight material is likely due to the similar presence of these two linked chains, the strategic disulfide bond, and the breaker is undoubtedly present in the sequence in the molecular protease. [See Figure A]. In any event, however, until the present invention, the identity and consequent function of the residual molecular weight of about 21,000 daltons was unknown and it was not possible to determine with certainty which part of the activity was attributable to urokinase.

Recently, another form of urokinase peptide has been reported which is not highly active but specific (10, 10A). This material was believed to correspond to native urokinase, a precursor of the previously isolated active forms described above, and is likely to consist of a single chain.

HU 202280 Β

Previous attempts to clone the urokinase-related gene and achieve production in a microbiological host cell have failed (11, 11A). See also (6). Conference reports (63, 64) summarizing the results reported by Ratzkin et al. (11) and Bollen et al. (11A) and the results reported by them (based on the papers of Hung et al.) Are the same for cloning Jnvfixnlüik urokinase and E. coli. which has not proved to be expedient, either through our own attempts at reproduction or through experience over the years. No urokinase or other plasminogen activator protein was produced during the reproduction of the method described by these researchers. Experimental evidence suggests that the clone deposited and accessible by the researchers is not capable of encoding urokinase or other plasminogen activator or any of its sub-sequences; the clone map they provide is incorrect; the authors have an approx. They describe a 4,200 base pair insert for the substance they suspect to be urokinase, even though it is much larger than the actual urokinase coding sequence, which is in fact ca. Contains 2300 base pairs.

We believed that DNA recombination and related methods could be the most effective way to obtain higher levels of high-quality, bioactive, human-free urokinase and other urokinase derivative virtually free of other human proteins, which retain their functional biological activity, and thus open the way to the widespread use of these agents in the treatment of various circulatory disorders or diseases.

DNA recombination technology

DNA recombination technology has made significant advances. Molecular biologists can easily recombine various DNA sequences and thus generate new DNA which can produce abundant amounts of exogenous protein in transformed microbes and cell cultures. There are general methods available for in vitro linking of various DNA fragments with end-to-end or adhesive ends, thereby providing efficient expression vehicles for the transformation of individual organisms, which then synthesize the desired exogenous product.

However, the synthesis of individual products remains quite complex and knowledge has not yet reached the stage where the success of the process can be evaluated in advance. In fact, anyone who predicts positive results without an experimental basis 4 assumes the risk that the procedure will be impracticable in practice.

In general, DNA recombination of the essential elements, i.e., the origin of reproduction, one or more selection features associated with the phenotype, the heterologous gene insert and the remaining vector, is expressed outside the host cell. The resulting recombinant expression carrier or plasmid thus obtained for reproduction is introduced into the cells by transformation and cultures of the transformed cell yield a large amount of recombinant carrier. If the gene is inserted correctly relative to the sites that direct transcription and translation of the encoded DNA message, the resulting expression carrier will actually produce the polypeptide sequence encoded by the inserted gene. This process is called an expression. The product may be isolated by, if necessary, disrupting the host cell in the microbiological system and purifying the product appropriately from other proteins.

In practice, DNA recombination technology can be used to produce fully heterologous polypeptides, a so-called direct term, or to produce a heterologous polypeptide that is linked to a portion of the amino acid sequence of a homologous polypeptide. In the latter case, the desired biologically active product is sometimes biologically inactive within the linked homologous / heterologous polypeptide and remains inactive until cleaved in the extracellular environment. See refs. (12) and (13).

Similarly, knowledge of cell or tissue cultures for the study of genetics and cellular physiology is well developed. There are methods available to maintain constant cell lines. These cell lines are made by sequential transfer of separate normal cells. For use in the research, these cell lines are maintained on a solid support in liquid medium or cultured in suspension containing a nutrient carrier. Increasing the size seems to be more of a mechanical problem. The relevant state of the art is described in more detail in references (14) and (15).

Knowledge of protein biochemistry is also essential for genetic engineering procedures. Cells producing the desired protein also produce hundreds of other proteins, which are endogenous products of cellular metabolism. These contaminating proteins, along with other compounds, are toxic and, if not purged of the desired protein, would be detrimental to therapeutic treatment. Therefore, there is a need for protein biochemistry, which allows for the appropriate mode of separation for the particular system.

EN 202280 Β and produce a homogeneous product that can be safely used for the intended purpose. Protein biochemistry allows us to identify the desired product and verify that it has been produced by the cells faithfully, without alterations or mutations. This discipline also plays an important role in the design of biological tests, stability tests and other successful clinical trials and pre-marketing operations.

The present invention is based on the recognition that DNA recombination technology and protein biochemical technology can be used to successfully produce human urokinase. The present invention provides an active urokinase which can be used in all its forms for the prophylactic or therapeutic treatment of humans to eliminate various circulatory disorders and diseases. Each form of human urokinase produced according to the invention contains a biologically active moiety; it is believed that the enzyme moiety of the natural substance is comprised of two chains containing the serine protease.

According to the invention, a number of active urokinase products can be prepared either directly in the biologically active form or in the form available for in vitro treatment, when the biologically active product is finally obtained. Further, the present invention provides a process for the production of full-length, native, biologically active, or bioactivated urokinase molecules, wherein the resulting products have the additional advantage of having a specific affinity for fibrin. This has not been the case so far with a single urokinase product of natural origin.

Thus, the present invention provides a human urokinase product which has the novel property of having specific activity on detectable residual thrombi. Because the preparation is carried out on a cell culture that contains recombinant DNA encoding the product, it is possible to produce human urokinase with much greater efficiency than was previously possible and in a form with biologically significant properties. In addition, depending on the host cell, the urokinase activator of the invention may contain less or greater glycosylation than the native substance.

The present invention relates to human urokinase products so prepared, a process for their production, reproducible DNA expressing carriers comprising gene sequences encoding the enzymatic portion of human urokinase, and directing the production of crude cell cultures of the transformed microorganism strains and human urokinase products. microbiological or cell cultures of transformed strains or cultures as described above. The invention also encompasses methods for producing the above urokinase gene sequences, DNA expressing carriers, microorganism strains, and cell cultures. The invention also encompasses a process for the fermentation of said microorganisms and cell cultures.

As used herein, human urokinase refers to a polypeptide in biologically active form, produced by microbial or cell culture, or optionally in vitro, and comprising the enzyme moiety corresponding to the native substance. The human urokinase is thus according to the invention

(1) provided in its full length, as distinguished from material hitherto isolated from natural sources, or

2) provided in other biologically active forms which contain the sites of the enzyme moiety found to be essential for plasminogen activation, or

3) provided in a form wherein the first amino acid or signal polypeptide of methionine or a conjugated polypeptide other than the latter is attached to the nitrogen terminus of the enzyme moiety and the methionine, signal peptide or conjugated polypeptide can be specifically cleaved within or outside the cell. In each case, the human urokinase polypeptides produced in this manner are recovered and purified to an extent useful for the treatment of various circulatory diseases.

Microorganisms / Cell Cultures

Bak terium strains / promoters

The following microorganisms were used in our experiments: Escherichia coli strain K-12 GM 48 (thr *, leu *, Br, lacYl, gal K12, gal T22, ara 14, tone A31, tsx 78, Sup E44, dam 3, dcm) 6) deposited on April 9, 1982, in the American Type Culture Collection at ATCC 39,099, and Escherichia coli strain K-12,294 (End, thi *, hsr *, khsm *), which is designated as ( 16) and deposited on October 28, 1978 in the American Type Culture Collection under ATCC No. 31,446. However, other microbial strains have also proved useful, including known Escherichia coli strains, such as Escherichia coli B, Escherichia coli X 1776 (ATCC 31 537, deposited July 3, 1979) and Escherichia coli W 3110 (F *, lambda *, prototroph) (ATCC 27,325, deposited February 10, 1972), or other microbial strains, many of which are deposited and available from accepted microorganism depositories, such as the American Type Culture Collection (ATCC) - cf. the list of the ATCC catalog. (See ref. 17).

HU 202280 Β

For example, beta-lactamase and lactose promoter systems have been advantageously used to initiate and maintain microbial production of heterologous polypeptides. Details of the preparation of these promoter systems are discussed in references 18 and 19. Recently, a tryptophan-mediated system, the so-called trp promoter system, has been developed. Refer to (20) and (21) for details on the production of this system. Numerous other microbiological promoters have been discovered and utilized, and details of the nucleotide sequences - which allow one of skill in the art to insert them into plasmid vectors - have been published. See (22).

Cell culture systems / cell culture vectors

The proliferation (tissue culture) of cells derived from vertebrates has become a routine procedure in recent years (see 31). A host cell useful for producing heterologous protein is the COS-7 line of monkey kidney fibroblasts (32). However, any cell line capable of reproduction and production of a compatible vector can be used according to the invention. Such cell lines are, for example, WI38, BHK, 3T3, CHO, CYCL and HeLa cell lines. In addition, the production vector must contain the following: the reproductive origin and promoter, the ribosome binding sites, the RNA insertion sites, the polyadenylation site, and the transcription termination sequences, before the gene to be expressed.

It will be understood that the invention, although described in the context of a preferred embodiment, is not limited to these sequences. For example, the origin of reproduction of other viral vectors (e.g., Polyoma, Adeno, VSV, BPV, etc.) may be used, as well as the set region of DNA reproduction, which may function in its own right.

Host cells from vertebrates-. The genetic expression vector for the urokinase polypeptide of the invention may also contain a secondary genetic coding sequence under the control of the same promoter. The secondary sequence will generally provide adequate screening for transforman many as well as those transformants that produce high levels of the primary sequence, and may serve as a regulatory structure that most frequently increases the production of the desired urokinase polypeptide.

This is particularly important because the two proteins are formed in a mature form. Although both DNA coding sequences are regulated by the same transcriptional promoter so that a linked message (mRNA) is generated, they are separated by a translation stop signal at the first and a start signal at the second, resulting in two independent proteins.

We have discovered that environmental conditions often effectively regulate the amount of enzymes produced by cells under conditions that they determine. In a preferred embodiment of the invention, certain cells are sensitive to methotrexate (MTX), an inhibitor of dihydrofolate reductase (DHFR). DHFR is an enzyme that is indirectly required for the synthesis of a carbon unit transfer. The lack of DHFR activity results in the cells being unable to grow except in the presence of compounds which otherwise require the transfer of a carbon moiety for their synthesis. However, DHFR-deficient cells grow in the presence of glycine, thymidine and hypoxanthine.

Methotrexate is known to inhibit cells that normally express DHFR. In most cases, adding a sufficient amount of methotrexate to normal cells will kill them. However, certain cells appear to survive methotrexate treatment by producing an increased amount of DHFR, thereby outpacing the ability of methotrexate to inhibit this enzyme. These cells have previously been shown to contain increased levels of messenger RNA encoding the DHFR sequence. This can be explained by the assumption of an increased amount of DNA in the genetic material encoding this messenger RNA. Indeed, the addition of methotrexate causes the DHFR gene to be amplified. Genetic sequences physically linked to the DHFR sequence but regulated by the same promoter are also increased. Consequently, it is possible to use amplification of the DHFR gene induced by treatment with methotrexate to co-amplify the gene for another protein, in this case the desired urokinase polypeptide.

In addition, if the host cells into which the secondary sequence for DHFR is introduced are deficient in DHFR, then DHFR also serves as a suitable marker for the selection of successfully transfected cells. When the DHFR sequence is actually linked to the sequence of the desired polypeptide, this image also serves as a marker for successful transfection with the desired sequence.

HU 202280 Β

Vek torren d agents

Production of bacterial agents in

Expression plasmids for use in bacteria, such as an Escherichia coli strain, can usually be constructed by using pBR322 (37) as a vector and inserting the heterologous gene sequence together with the translation initiation and stop signals into the functional promoter. into a functional reading phase using common or site-created restriction sites. The vector carries one or more phenotype-selectable genes and a reproduction origin to provide amplification within the host cell. The heterologous insert may be arranged such that it is expressed in conjunction with a linked precursor derived, for example, from the genes of the trp system.

Production in cell culture of a mammalian cell

Production of a heterologous peptide in a mammalian cell culture is based on the development of a vector capable of autonomously reproducing and producing a foreign gene under the control of a heterologous transcription unit. Reproduction of this vector in tissue culture is accomplished by providing a DNA replication origin (such as from SV40 virus) and a helper function (T antigen) by introducing the vector into a cell line that produces this antigen endogenously. (33, 34). The late promoter of the SV40 virus precedes the structural gene and provides for transcription of the gene.

The production-inducing vector consists of a pBR322 sequence that serves as an selectable marker for selection in Escherichia coli (resistance to ampicillin) and provides for the origin of DNA reproduction in Escherichia coli. These sequences can be deduced from plasmid pML-1. The SV40 origin is derived from a PvuII-Hind III fragment of 342 base pairs that covers this region (35, 36) (both ends can be converted to EcoR1 ends). These sequences, in addition to containing the viral origin of DNA reproduction, encode the promoter for the early and late transcriptional units. The orientation of the SV40 origin region is such that the promoter of the late transcription unit is located in the immediate vicinity of the interferon coding gene. 60

The invention will be described in detail with reference to the accompanying drawings.

Figure A is a schematic diagram of urokinase polypeptides. Low molecular weight urokinase begins at amino acid 136 and gg

It ends at amino acid number 412. High molecular weight urokinase starts at amino acid number 1 and ends at amino acid number 412. If the single chain form of the high molecular weight or low molecular weight urokinase is converted to the biologically active double chain form, this is the result of proteolytic cleavage between amino acids 158-159. The urokinase precursor (pre-urokinase) starts at amino acid number 20. The indicated conformational position of the disulfide bonds is based on analogy with other serine proteases.

1A-1C. Figure 3B shows the nucleotide sequence and restriction endonuclease sites of the cDNA insert of the low molecular weight (33,000 Dalton) biologically active urokinase protein. The nucleotide portion of the CB6B synthetic deoxyoligonucleotide sample is underlined.

2A. 2B and 2B. Figure 1A shows the deduced amino acid sequence of the cDNA sequence of Figure 1. The amino acids of the cDNA insert were numbered from 1 to 279.

3A-3C. Fig. 6A shows the nucleotide sequence and restriction pattern of the cDNA for the full length human urokinase protein. Similarly, the CB6B sample was underlined.

4A. 4B and 4B. Figure 3B shows the deduced amino acid sequence for full length urokinase based on the cDNA sequence of Figure 3.

Figure 5 is a pUK33trpLEi required for the production of a long linked protein of about 33,000 daltons. plasmid.

Figure 6 illustrates the construction of the pUK33trpLEs plasmid, which is required for the production of a short, linked protein of about 33,000 daltons.

Figure 7 shows the construction of a plasmid for direct production of 33,000 Dalton protein.

Figure 8 illustrates a further construction of a plasmid for direct production of 33 kdalton protein.

Figures 9 and 10 show the construction of plasmids for the direct production of 54 kdalton urokinase and its prodrug.

Figure 11 shows the construction of plasmid p-pEH3-Ball4 preUK54 for the production of 54 kdalton urokinase in eukaryotic cells.

Figure 12 shows the time-dependent activation of plasminogen by the urokinase of the invention.

Figure 13 illustrates the plasminogen activating activity of urokinase extracts of the present invention and how antibodies to natural urokinase inhibit this activity.

-611

HU 202280 Β

Production of urokinase mRNA

Detroit 562 (human pharyngeal cancer) cells (38) (ATCC # CCL 138) were grown to confluence in Eagle's medium (39) supplemented to contain: 3% sodium bicarbonate, pH 7.5 , 1% L-glutamine (Irvine), 10% fetal bovine serum, 1% sodium pyruvate (Irvine), 1% non-essential amino acids (Irvine), 2.4% HEPES (pH 7.5), 50 pg / ml Garamycin. The cells were incubated at 37 ° C in a 5% carbon dioxide atmosphere. Concentrated cells were isolated by centrifugation after treatment with 0.25% trypsin for 15 minutes at 37 ° C.

Isolation of messenger ribonucleic acid (mRNA)

From the Detroit 562 cells, all ribonucleic acids were isolated essentially as described by Lynch et al. (40). The cells were pelleted by centrifugation and approximately 1 g of cells were suspended in 10 ml of a solution containing 10 mM sodium chloride, 10 mM tris hydrochloride (pH 7.4) and 1.5 mM magnesium chloride. Cell lysis was accomplished by adding NP-40 nonionic detergent to a final concentration of 1%.

After centrifugation, the ribonucleic acid was further purified by two successive extractions at 4 ° C. One extraction was performed with a mixture of redistilled phenol and chloroform, the other extraction was with isoamyl alcohol. The aqueous phase was adjusted to 0.2 M sodium chloride and all RNA was precipitated by adding two volumes of 100% ethanol and storage at -20 ° C overnight. After centrifugation, the polyA mRNA was purified by oligo-dT cellulose chromatography (41, total RNA). Generally, 10-15 mg of total RNA was obtained per 1 g of cell, and approximately 2% of this polyA mRNA was .

.4 size fractionation of polyA mRNA

Size fractionation of 200 pg of polyA mRNA was achieved by electrophoresis through an acid urea gel. The gel contained 1.75% agarose, 25 mM sodium citrate (pH 3.8) and 6 M urea (40, 42). Electrophoresis was performed for 7 hours at 25 mA and 4 ° C. The gel was then manually cut using a razor blade. Each gel slice was thawed at 70 ° C and diluted with a solution of 10 mM sodium chloride, 10 mM tris hydrochloride (pH 7.4), 1.5 mM magnesium chloride, and 0.1% SDS. t and contained 12 ml. The solution was extracted twice with water, redistilled phenol and once with chloroform. The fractions were precipitated with ethanol and then subjected to in vitro translation (43) to determine the size fractionation achieved and the integrity of the polyA mRNA.

Construction of an oligo-dT colonial set containing urokinase DNA sequences

PolyA mRNA was fractionated on acid urea gels by size. Fractions of mRNA greater than 12S were pooled and used as templates for the preparation of the cDNA double helix by known methods (44, 45) supplemented with oligo-dT. The cDNA was fractionated by size electrophoresis on a 6% polyacrylamide gel. 132 ng of cDNA double helix was obtained, which was longer than 350 base pairs. at Pst I (46) with deoxy G residues Each linked mixture was transformed into Escherichia coli strain K-12 294 (ATCC 31446) to give approximately 10,000 transformants that were ampicillin-sensitive to tetracycline.

Preparation of synthetic DNA oligomers for use as a urokinase screening template

Eight synthetic 14-base DNA oligomers complementing the mRNA were constructed from the Met-Tyr-Asn-Asp-Pro amino acid sequence of the CB6 urokinase cyanogen bromide polypeptide fragment. These eight deoxyoligonucleotides were synthesized by the phosphoric acid triester method (17) in the following mixtures of two oligomers: (CB6A) 5 'GGGTCGTTA / GTACAT 3', (CB6B) 5 'GGATCGTTA / GTACAT 3', (CB6C) 5 ' GGGTCATTA / GTACAT 3 ', (CB6D) 5' GGATCATTA / GTACAT 3 '. Each mixture of two oligomers was then radioactively phosphorylated as follows: 250 µg deoxyoligonucleotide in 25 µl of 60 mM tris hydrochloride (pH 8), 10 mM magnesium chloride, 15 mM beta-mercaptoethanol and 100 µCi (--32 P). ATP (Amersham, 5000 Ci / mmol) was added. 5 units of T4 polynucleotide kinase were added and the reaction was allowed to proceed for 30 minutes at 37 ° C. The reaction was carried out for 30 minutes at 37 ° C and it was stopped by adding ethylenediaminetetraacetic acid to a concentration of 20 mM.

-713

HU 202280 Β

Screening of colony set supplemented with oligo dT for urokinase sequences

Approximately 10,000 colonies each were added to the wells of LB and 5 mg / ml of tetracycline (48) into the wells of the microtiter wells, and dimethylsulfoxide was added to a concentration of 7% and stored at -20 ° C. Certain cultures of the kit were transferred to Scleicher and Schuell BA85 / 20 nitrocellulose filters and grown on agar plates containing LB medium and 5 mg / ml tetracycline. Cultivation was continued for approximately 10 hours at 37 ° C, and the colonies were transferred to agar plates containing LB medium, 5 mg / ml tetracycline and 12.5 mg / ml chlorarophenicol, and incubated overnight. 37 “C-on.

DNA from each colony was denatured and attached to the filter using a modification of the Grunstein-Hogness method (49). Each filter was kept on top of a solution containing 0.5 N sodium hydroxide and 1.5 M sodium chloride for 3 minutes to disrupt the cultures and denature the DNA. The filters were then neutralized by floating on top of a solution containing 3N sodium chloride and 0.5 M tris hydrochloride, pH 7.5 for 15 minutes. The filters were kept on the surface of a 2XSSC solution (an aqueous solution of sodium chloride and sodium citrate providing the salt components required for hybridization) for an additional 15 minutes and then dried in a vacuum oven for 2 hours at 80 ° C.

The filters were pre-hybridized for approximately 2 hours at room temperature in 0.9 M sodium chloride, 1 L Denhardts' solution (commercially available solution containing polyvinylpyrrolidone and bovine serum albumin), 100 mM tris hydrochloride (pH = 7.5), 5 mM sodium salt of ethylenediaminetetraacetic acid, 1 mM ATP, 1 M sodium phosphate (dibasic), 1 mM sodium pyrophosphate, 0.5% NP-40 and 200 mg / ml of Escherichia coli. RNA was then hybridized overnight in the same solution essentially as described by Wallace et al. (50) using approximately 40 x 10 x cpm from kinase-treated mixtures of two CB6 deoxyoligonucleotides. The filters were thoroughly washed at 37 ° C in 6X SSC and 0.1% SDS and exposed to Kodak XR-5 X-ray film using DuPont Lightning-Plus amplifier filters for 16-24 hours at -80 ° C. Two cultures showed hybridization with a mixture of eight samples: UK513dT69D2 (pD2) and UK513dT73D12 (pD12).

. Characterization of plasmid pD2 and pD12 DNA

Plasmid DNA isolated from Escherichia coli UK513dT69D2 and UK513dT73D12 cultures by rapid microarray (51) was subjected to PstI restriction endonuclease analysis. This analysis showed that pD2 and pD12 are identical. Each plasmid DNA had three PstI restriction fragments that migrated together during electrophoresis on a 6% polyacrylamide gel. The complete nucleotide sequence of the plasmid pD2 cDNA insert was determined by the dideoxynucleotide chain termination method (52) after PstI restriction fragments were subcloned into the mp7 vector M13 (53). Figure 1 shows the nucleotide sequence of the insert fragment of pD2 cDNA and Figure 2 shows the translated amino acid sequence.

The entire coding region of the low molecular weight (33 kdalton) urokinase was isolated on this single large pD2 fragment. As shown in the figure, the nucleotide sequence of the deoxyoligonucleotide CB6B (5 'GGATCGTTA / GTACAT) contains nucleotides 466-479. A typical serine protease active site (gly, asp ser gly gly pro) is located between amino acids 222 and 227. The coding region consists of 838 base pairs of the 279 amino acids of the high molecular weight (54 kdalton) portion of the urokinase terminating in the carboxyl moiety. Approximately 935 nucleotides of the 3 'translated n sequence extend from the UGA stop codon at position 280 to the polyA sequence. Given that only 31,413 daltons of full length urokinase were encoded by the pD2 cDNA insert, additional cultures containing urokinase sequences were required to identify the high molecular weight urokinase.

Development of two different specific colonies to extend the amino terminus of an existing urokinase clone.

For the first specific cDNA set, a 45 base pair urokinase DNA restriction endonuclease fragment was used as a primer instead of oligo dTn-le, with Haell starting at position 225 and ending with AccI at position 270 (Figure 1). This fragment was denatured by heat treatment in the presence of 20 pg of unfractionated Detroit 562 poly A mRNA and cDNA was prepared as described previously. 11.5 ng of cDNA double helix greater than 200 base pairs was electroeluted from a 6% polyacrylamide gel and used to generate about 6000 clones in Escherichia coli strain 294.

-815

HU 202280 Β

A second set of specific based cDNAs, called UK89CB6, was generated and consisted of approximately 4,000 colonies. For preparation, 4 pg poly A mRNA acid urea agarose gel fraction 8 and 4 pg poly A mRNA fraction 9 were mixed (see section on size fractionation of poly A mRNA). Instead of oligo dTi2-ls, 250 ng of each of the CB6 deoxyoligonucleotide mixtures was used as a primer (see Preparation of Synthetic DNA Oligomers for Use as a Urokinase Screening Pattern).

.4 screening of a full-length urokinase battery pack

Colonies containing full-length cDNA were directly transferred to nitrocellulose filters and cultured at 37 ° C. The colonies were disrupted, the DNA denatured, and attached to the filters as described in Screening for the oligo dT-based colonies for urokinase sequences (49). ³² P-labeled DNA samples (54) were prepared from a 143 bp HinfI-Haell restriction endonuclease fragment from the pD2 cDNA insert and hybridized (55) with the full length cDNA attached to the filter. An 8 x 10® CPM sample was hybridized for 16 hours and washed as described in (55) and exposed to X-ray film. Two cultures experienced strong hybridization: A3 and E9 cultures.

Characterization of full-length urokinase cDNA plasmids pA3 and pE9

Restriction analysis of plasmid A3 DNA with PstI revealed a fragment of cDNA insert of about 360 and 50 base pairs, and similar analysis of plasmid E9 DNA showed a fragment of about 340 base pairs. When each plasmid DNA was subjected to two restriction analysis with PstI and EcoR1, a common cDNA insert fragment was obtained, consisting of about 190 base pairs. Each plasmid encoded DNA information at the 5 'position of the urokinase sequence relative to the Haell AccI core fragment. Plasmid pA3 also contains an additional fragment of cDNA insert between PstI-EcoR1 consisting of 185 bp and E9 an additional fragment of 160 bp.

A fragment of the larger PstI cDNA insert of plasmid pA3, about 360 beige pairs, was subcloned into the vector vector M13 mp7 (53) and sequenced by the dideoxynucleotide chain termination method (52). The urokinase coding sequence of plasmid pA3 is located approximately between position 405 and position 785 in the full length urokinase protein cDNA sequence shown in Figure 3.

Screening of the UK89CB6 urokinase battery pack

DNA from colonies containing UK89CB6 cDNA insert of about 1900 base pairs was denatured and fixed to nitrocellulose filters as described in 'Screening for oligo dT based colonies for urokinase sequences'. ^3Z P-labeled DNA samples (54, 146 bp fragment of the plasmid pA3 cDNA insert fragment between PstI and HinfI) were prepared. Positive hybridization was observed in two cultures: UK89CB6F1 (pF1) and UK89CB6H10 (pH10).

Characterization of pF1 and pH 10 urokinase cDNA

Restriction analysis of plasmid pF1 with PstI shows fragments of cDNA insert of about 450 to about 125 base pairs. A similar assay with plasmid pH 10 yielded a single fragment of approximately 500 base pairs of cDNA. The double restriction assay of plasmid pF1 with PstI and EcoR1 does not show an EcoR1 restriction site and provides the same cDNA insert fragments as restriction with PstI alone.

Cleavage of the EcoR1 restriction sites on the pH10 plasmid yields cDNA insert fragments of about 375 to about 110 base pairs. This EcoRl site for pH 10 is likely to be the same as that observed at position 627 (Figure 3). The cDNA insert of plasmid pF1 does not contain this EcoR1 restriction site.

Plasmid pF1 with a cDNA insert fragment longer than the cDNA insert fragment of the pH10 plasmid was selected for sequencing. Both PstI restriction fragments of the cDNA insert of pF1 were subcloned into the M13 mp7 vector and sequenced by the dideoxynucleotide chain termination method. The nucleotide sequence of the urokinase cDNA from the plasmids pF1, pA3 and pD2 encoding the full amino acid sequence of the high molecular weight full chain urokinase is shown in Figure 3. The urokinase coding sequence of plasmid pF1 is shown from position 1 to position 570. The urokinase coding sequence of plasmid pD2 is located between position 532 and position 2304 in Figure 3.

-917

HU 202280 Β

The amino acid sequence analysis, as determined by amino acid position 1 at the amino acid position, is shown in Figure A and Figure 4. The preceding 20 amino acids at the amino terminus, starting with methionine (meth) and ending with glycine (gly), are likely to serve as signal sequences to select the remaining 411 amino acids of the high molecular weight urokinase. The characteristics of this putative signal sequence, such as size and hydrophobic property (56, 57), are the same as those of other characterized signal sequences.

The following are the cleavage sites at which trypsin cleaves and which results in the formation of 33 kdalton low molecular weight double-stranded urokinase: lysine (lys) at the 136-position of the short-chain amino terminus and 159 at the 159-position. isoleucine (ile) is the amino acid residue of the long chain (Fig. A and Fig. 4).

Production of low molecular weight urokinase derived coke

Strain of Escherichia coli

Long trp LE coupling (Figure 5)

A plasmid, pNCV (58), was constructed which has the following properties:

1) The plasmid is a derivative of pBR322 and is present in about 20 copies per cell.

2) The plasmid makes the host cell of Escherichia coli resistant to tetracycline.

3) The plasmid contains an inducible tryptophan promoter that directs the synthesis of the trp leader peptide and the protein formed by the trp E structural gene (LE linked gene).

4) A unique Pstl restriction site has been formed in the trp E gene, which can be used to clone DNA fragments prepared with Pstl. The EcoRI site at the far end of the LE gene in plasmid pSOM7ala4 is then converted to two Pst I sites adjacent to the EcoRI site using the following synthetic sequence:

AATTCTGCAG

GACGTCTTAA

The DNA fragment containing the trp promoter and the LE gene was then introduced into pBR322 to give plasmid pNCV (47A).

The PstI urokinase fragment between position 5 (PstI 5 'cleavage site) and nucleotide 1130 (Figure 1) was cloned into the PstI site of plasmid pNCV so that a fusion protein was formed upon induction of the trp promoter. The nitrogen-terminated moiety is trp LE and the carbon-terminated moiety is the low molecular weight urokinase.

Referring to Figure 5, 5 µg of plasmid pUKS13dT69D2 (pD2) was digested with 20 units of PstI and the 1125 base pair cDNA insert fragment encoding low molecular weight urokinase was separated by electrophoresis on 6% polyacrylamide gel. About 1 µg of the pad was recovered from the gel by electroelution, phenol and chloroform, and then precipitated with ethanol. One pg of pNCV vector plasmid (58) was digested with 10 units of PstI and extracted with ethanol after phenol and chloroform extraction. To about 100 ng of the above 1125 bp fragment, the following components were added: 100 ng Pstl digested pNCV in 20 µl solution containing 20 mM tris hydrochloride (pH 7.5), 10 mM magnesium chloride, mM DTT, 2.5 mM ATP and 30 units T4 DNA ligase. Coupling was performed overnight at 14 ° C and half of the mixture was transformed with Escherichia coli K-12,294. When the twelve transformant DNAs were digested with BamHI, we found that three of them had the proper orientation. This plasmid (pUK33trpLEx.) (Fig. 5) was produced in Escherichia coli strain to obtain a long trp LE fused protein containing 33,000 daltons of urokinase. The 33,000 dalton urokinase was activated by cleavage with a trypsin-like active enzyme between positions 3 and 4 and positions 26 and 27 (see Figure 2).

Short trp LE splicing (Figure 6) In pNCV plasmid, the BglII site was converted to the Pst I site in a known manner. [Maniatis, Molecular Cloning A Laboratory Manual, 1982; Dr. Freifelder: Molecular Biology, Boston, 1983]. The region between the new PstI site thus created in pNCV and the original single PstI site in the region of the trpE gene is removed by PstI digestion and the sequence is joined. Thus, plasmid pINCV, which is completely similar to pNCV (see above) is obtained, except that most of the trp E gene is deleted. In this plasmid, the BglII site was converted to the Pst I site and the region between this new Pst I site and the original Pst I site was deleted.

Approximately 100 ng of plasmid pINCV were digested with PstI and Hind III, then extracted with phenol and chloroform and precipitated with ethanol. About 3 pg of pUK33trpLEL (Figure 6) was completely digested with Hind III and partially digested with PstI. This gave a Pstl-HindIII DNA fragment of 1150 base pairs,

-1019

HU 202280 Β was further purified by electroelution after electrophoresis on a 6% polyacrylamide gel. The Pst I site within the structural urokinase gene was protected from digestion.

The total amount of plasmid pINCV digested with PstI and HindIII was completely mixed with the HindIII enzyme fragment of pUK33trpLEL, 1150 base pairs partially digested with PstI I. The coupling was performed overnight at 14 ° C. The mixture was then transformed into Escherichia coli strain K-12,294. BamHI digestion confirmed the structure of this plasmid (pUK33trpLEs) (Figure 6). When this plasmid was expressed in Escherichia coli, a fusion protein was obtained from which the 33,000 molecular weight urokinase can be activated as described above.

Direct expression of 33 kdalton molecular weight urokinase (Figures 7 and 9)

The urokinase DNA fragment starting at nucleotide 16 (Figure 1) was cloned into a pBR322 derivative to give a construct in which the trp promoter is located immediately downstream of this urokinase fragment that encodes a low molecular weight urokinase. Plasmid pLeIFAtrp03 (Figure 7) is a derivative of pLeIFA25 (58) from which the Eco RI site distant from the LelFA gene has been removed (59).

Plasmid pLeIFAtrp03 (Figure 7) was digested with 20 units of EcoRI, phenol and chloroform and then ethanol precipitated. EcoRI adhesive ends of plasmid DNA molecules were blunt-ended using 12 units of DNA polymerase I in a 50 μΐ reaction mixture of 60 mM sodium chloride, 7 mM magnesium chloride, 7 mM tris hydrochloride (pH 7.4) and 1 mM contained the amount of each ribonucleotide triphosphate. The reaction mixture was incubated for 1 hour at 37 ° C, extracted with phenol and chloroform and precipitated with ethanol. The DNA was resuspended in 50 μΐ solution containing 10 mM tris hydrochloride (pH 8) and 1 mM ethylenediaminetetraacetic acid and treated with 500 units of bacterial alkaline phosphatase for 30 minutes at 65 ° C and extracted twice, and precipitated with ethanol. After digestion with PstI, the mixture was electrophoresed on a 6% polyacrylamide gel and the vector fragment of about 3900 base pairs was separated by electroelution.

Plasmid pUK33trpLEL was transformed into Escherichia coli K-12 GM48 (deoxyadenosine methylase) strain to allow highly purified DNA obtained from this Escherichia coli strain to be well digested with Bell restriction endonuclease (60). 4 µg of DNA thus obtained were treated for 1 hour at 50 ° C with 6 units of Bell enzyme in the presence of 75 mM magnesium chloride, 6 mM tris hydrochloride (pH 7.4), 10 mM magnesium chloride and 1 mM DTT, then 50 mM sodium chloride was added and digested with 10 units of PstI. Electrophoresis was performed on a 6% polyacrylamide gel and the 914 bp fragment was electroeluted.

A DNA base encoding the amino acid sequence of met lys lys pro was synthesized by the phosphoric acid triester method (47). Its sequence is as follows:

MetLysLysPro 5 'CTATGAAAAAGCCC 3'

500 ng of this base was phosphorylated at its 5 'end with 10 units of T4 DNA kinase in a 20 μΐ reaction containing 0.5 mM ATP. PUK33trpLEi grown in Escherichia coli GM48 was isolated. a fragment of 264 bp PstI - AccI cDNA insert. About 500 ng of this fragment was resuspended in 10 μΐ deionized water, mixed with 20 μΐ of the phosphorylated base, heated at 95 ° C for 3 minutes, and quickly frozen in an ethanol dry ice bath. The denatured DNA solution was adjusted to 60 mM sodium chloride, 7 mM magnesium chloride, 7 mM tris hydrochloride, pH 7.4, 1 mM of each deoxyribonucleotide triphosphate and 12 units. DNA polymerase I large fragment. After incubation at 37 ° C for 2 hours, this basic pairing reaction mixture was extracted with phenol and chloroform, precipitated with ethanol and completely digested with Bell at 50 ° C. The reaction mixture was subjected to electrophoresis on a 6% polyacrylamide gel and approximately 50 ng of a 200 base pair amino terminated, blunt end Bell fragment was isolated by electroelution. Then, about 50 ng of a blunt-ended Bell fragment, about 100 ng of a Bell-PstI carboxyl-terminal fragment, and about 100 ng of a vector fragment of about 3900 base pairs were then linked. Coupling was performed overnight at 14 ° C and transformed into Escherichia coli strain 294. Digestion of many of the products obtained by transformation with EcoRI indicated the correct structure and DNA sequence analysis confirmed the presence of the desired sequence via the start codon of the resulting new plasmid, pUK33trplO3 (Figure 7). This structure is followed by two lysine molecules followed by the nitrogen-terminated methionine and is shown in Figure 2A. 5 to 279 depicted in FIGS. When this plasmid was produced in Escherichia coli, a low molecular weight urokinase was synthesized. This protein is activated by a trypsin-like active enzyme-1121

HU 202280 Β needles as described above, whereupon the two lysines terminating in the N atom were cleaved, and cleavage occurred between the lysine at position 26 and the isoleucine at position 27 (Fig. 2A).

It has been found desirable to construct a derivative of plasmid pUK33trp03, which may confer resistance to tetracycline to its host cell. Figure 8 shows the construction of plasmid ^{pUK33trp103Ap B-} Tc ^B. We did this as follows:

pg of plasmid pHGH207-l (see below) was digested with Hpal and PvuII. The vector fragment was isolated and purified. Plasmid pUK33trp103 Mg was digested with Hpal and BamHI, electrophoresed on a 6% polyacrylamide gel, and the 836 bp DNA fragment was purified. Another 5 Mg aliquot of pUK33trp103 was digested with BamHI and PvuII and the 119 bp DNA fragment was isolated and purified. Equimolar amounts of each of the three DNA fragments obtained were pooled overnight at 14 ° C and used to transform Escherichia coli strain 294. Analysis of plasmid DNA from various ampicillin-resistant transformation products by restriction endonucleases confirmed the proper structure of pUK33trp103Ap ^B and the reversal of the trp promoter / UK33 coding for the DNA.

About 5 mg of PBR322 DNA was digested with EcoRI and the cohesive ends were filled with Klenow polymerase 1. After digestion with PstI, a large vector fragment containing DNA encoding a portion of the tetracycline resistance, the origin of reproduction and a portion of the ampicillin resistance gene was isolated and purified. About 5 Mg of plasmid pUK33trp103Aβ ^{B was} digested with BamHI and PstI. The DNA fragment encoding the trp promoter, the remainder of the ampicillin resistance gene, and most of the low molecular weight urokinase was purified. Approximately equimolar amounts of these two DNA fragments and the 119 bp BamHI-PvuII DNA fragment obtained from plasmid pUK33trplO3Ap ^B were ligated overnight at 14 ° C, thus completing the construction of plasmid pUK33trpl03Ap ^B Tc ^B. This plasmid was used to generate a plasmid which was directed to the production of high molecular weight full length urokinase (see next section and Figure 9).

Production of high molecular weight urokinase derivatives

Direct production of 54 kdalton urokinase

Figure 9 shows the construction of full-length urokinase. Plasmid pHGH207-1 with a single trp promoter was obtained by removing the double lac promoter from pHGH 207 containing the double lac promoter followed by a single trp promoter. We did this as follows:

The 310 bp fragment of the trp promoter was obtained from plasmid pFIF trp 69 (20) by digestion with EcoRI. This fragment was inserted into plasmid pHGH 107 (44) which had been pre-opened with EcoRI. This resulted in a plasmid (pHGH 207) containing the double lac promoter, followed by the trp promoter, and adjacent to Eco RI sites. The resulting plasmid pHGH 207 was digested with BamHI. This was partially digested with EcoRI and the largest fragment isolated. Therefore, this fragment has the entire trp promoter.

The largest fragment of EcoRI - BamHI was isolated from pBR322. The above two fragments were linked and the product transformed with Escherichia coli strain 294. Tet ^r , Amp ^r (tetracycline and ampicillin resistant) cultures were isolated and most of them contained plasmids with the same structure as the plasmid pHGH207-l.

Therefore, plasmid pHGH207-1 is a derivative of plasmid pHGH107 (44) and has the following properties:

1) the human growth hormone (HG) gene is preceded by the tryptophan promoter and not by the lac promoter like plasmid pHGH107.

2) The plasmid confers resistance to ampicillin and tetracycline when produced in Escherichia coli. (See also 47A).

Plasmid pHGH207-l was partially digested with EcoRI restriction endonuclease and fully digested with BglII restriction endonuclease. The large vector fragment was purified by electrophoresis on a 5% polyacrylamide gel, electroelution, phenolic and chloroform extraction and then ethanol precipitation.

-1 223

Plasmid pF1 202280 µg was digested with BglII and Taql, the 236 bp DNA fragment was isolated and purified from 6% polyacrylamide gel. The following additional DNA fragments were synthesized by the phosphoric acid triester method (47):

MetSerAsnGluLeuHisGlnValPro 5 'AATTATGAGCAATGAATTACATCAAGTTCCAT

TACTCGTTACTTAATGTAGTTCAAGGTAGC 5 '

As indicated, the DNA sequence corresponding to the Met Ser Asn Glu Leu His Gin Val Pro amino acid sequence encodes the ATG start codon and the eight amino acids at the amino terminus of the high molecular weight urokinase.

50 ng of each synthetic DNA fragment was phosphorylated, the fragments were mixed, heated at 65 ° C for 1 minute and then allowed to cool to room temperature for 5 minutes. 10 ng of the phosphorylated and mixed synthetic DNA fragments were ligated at 14 ° C overnight with about 200 ng partial EcoRI, BglII pHGH207-1 vector fragment and about 50 ng 236 bp BglII-Taql DNA fragment and the product was Escherichia. coli 294. Twenty-four plasmids from ampicillin-resistant cultures were digested with EcoRI and BglII, and one plasmid (plnt1) with the appropriate structure was selected for analysis of the DNA sequence. This analysis confirmed the correct DNA sequence through the ATG start codon and amino terminus of the high molecular weight urokinase.

Plasmid pNCV pg (see above) was digested with BglII and Clal, the large vector fragment isolated and purified from a 5% polyacrylamide gel. Plasmid 30 mg pF1 was digested with PstI and BglII and electrophoresed on a 6% polyacrylamide gel. The 44 base pair DNA fragment was electroeluted, extracted with phenol and chloroform, and precipitated with ethanol. 4 pg of pA3 DNA was digested with PstI and Taq1 and the 192 bp fragment was purified from a 6% polyacrylamide gel.

100 ng of BglII-Clal vector DNA fragment, 50 ng of 192 bp fragment and 50 ng of 44 bp fragment were ligated overnight at 14 ° C and transformed into Escherichia coli strain 294. Double digestion of the plasmid DNA from the various tetracycline-resistant products obtained by transformation with BglII and Clal showed the correct structure of this new plasmid (plnt2).

5 mg of plasmid pUKSStrplOSAp ^ Tc® produced in Escherichia coli GM48 strain (ATCC 39099, deposited April 9, 1982) was digested with Bell and Sali, and 14 fragments of 1366 bp were isolated and purified. The 108 bp EcoRI-Bell fragment was isolated from the same plasmid. Near equimolar amounts of the SalI-Bell fragment from plasmid pUK33trp03Ap ^R Tc ^R and the EcoRI Bell fragment from the same plasmid and the EcoRI-SalI fragment from plasmid pnt2 were ligated at 14 ° C overnight. In this way, plasmid plnt3 was obtained.

Mg plnt3 DNA was digested with BglII and SalI, electrophoresed on a 6% polyacrylamide gel, and purified with a 1701 bp fragment containing the carboxyl-terminal portion of the full-length urokinase and the amine moiety conferring resistance to tetracycline. Approximately 5 Mg plntl DNA was digested with BglII and SalI, electrophoresed on a 6% polyacrylamide gel, and the large vector fragment purified for the carboxyl-terminal portion of the tetracycline resistance gene, the origin of reproduction, the gene conferring resistance, the trp promoter, the ATG initiation codon, and the amino terminus of the full length urokinase. To about 100 ng of vector fragments, about 100 ng of 1701 base pair fragments were added, ligated overnight at 14 ° C, and transformed with Escherichia coli strain 294. A plasmid derived from a culture resistant to tetracycline and ampicillin was identified which gave the correct image for analysis with PvuII restriction endonuclease. The assay confirmed the structure of full-length urokinase downstream of the trp promoter. This identified plasmid is pUK54trp207. Full-length urokinase is obtained when this plasmid is produced in Escherichia coli strain 294.

Direct production of 54 kdalton pre-urokinesis (Pre-UK) in Escherichia coli (Figure 10)

The following procedure was used to construct a plasmid capable of direct production of 54 kdalton pre-urokinase (preUK54). Two additional DNA fragments encoding the ATG amino acid sequence start codon were synthesized by the phosphoric acid triester method (47). This is followed by the first three nitrogen-terminal amino acid residues of the urokinase precursor (Arg Ala Leu) as follows:

EcoRI MetArgAlaLeu Bgll 5 'AATTATGCGTGCCCTGC

TACGCACGGG 5 '

Adjacent to this portion of the pre-sequence are EcoRI and BglII

-1 325

HU 202280 Β Cleavage sites for restriction endonucleases.

50 ng of each synthetic DNA fragment was phosphorylated. The phosphorylated fragments were mixed, heated at 65 ° C for 1 min, then allowed to cool to room temperature, digested with 5 mg pFl DNA with Bgll and Bglll, and the 310 bp urokinase DNA fragment was isolated and purified. Approximately 50 ng of 310 base pair urokinase DNA fragments, approximately 150 ng of vector DNA fragment obtained by partial Eco RI digestion of plasmid pHGH207-l and Bgl II digest (see above), and 10 ng of phosphorylated and mixed synthetic DNA fragments were mixed and combined. overnight at 14 ° C and then transformed with Escherichia coli strain 294. The DNA of each plasmid isolated from various ampicillin-resistant transformation products was analyzed to confirm the structure and nucleotide sequence of the high molecular weight urokinase precursor.

One of the appropriate plasmids was designated plnt4. 5 mg plnt4 DNA was digested with Bglll and EcoRV and the vector DNA fragment containing the pre-UK54 nitrogen-terminal nucleotides, the trp promoter, the ampicillin resistance genes, the origin of reproduction and tetracycline was isolated and purified. contained part of the DNA encoding resistance.

Mg amount of plasmid pUK54trp207-1 DNA was digested with BglII and EcoRV. The Bglll-EcoRV DNA fragment encoding the remainder of the 54 kdalton urokinase was isolated, purified, and linked to the Bglll-EcoRV vector DNA fragment to complete plasmid p-preUK54trp207-1.

Direct production of (pre) urokinase in tissue culture

Figure 11 depicts the introduction of the pre-UK (pre-urokinase) gene encoding into the eukaryotic production vector p342E (62), which is capable of reproducing and producing pre-urokinase in COS-7 lineage monkey kidney fibroblast cells (Gluzman, 32).

Plasmid Mg p342E DNA was digested with Xba I and approximately 100 base pairs removed in each direction using Bal31 nuclease. (Fragment 1)

100 ng of Hindlll 5 'CTCAAGCTTGAG coupler synthesized by the phosphoric acid triester method (47) was phosphorylated, heated at 65 ° C for 1 minute, and allowed to cool to room temperature. The phosphorylated linker and fragment 1 were linked overnight at ° C and the product transformed with Escherichia coli strain 294. Analysis of a transformed product designated pEH3-Ball4 by restriction endonuclease revealed the introduction of a HindIII restriction site and loss of the Xba I site.

Mg amount of plasmid pEH3-Ball4 DNA was digested with Hind III and Hpal. The cohesive ends were annealed to blunt ends using Klenow Pol I. The DNA was treated with BAP and the vector fragment isolated and purified (fragment 2) containing the SV 40 early promoter, genes conferring resistance to ampicillin and origin of reproduction.

An amount of Mg was digested with plasmid p preUK54trp207-1 with Clal and XBal. The cohesive ends were lengthened with Klenow Pol I and the DNA fragment encoding the 54 kdalton pre-urokinase was isolated and purified (fragment 3).

About 100 ng of fragment 2 and about 100 ng of fragment 3 were linked overnight at 14 ° C and transformed with Escherichia coli strain 294. Restriction endonuclease analysis of plasmid pEH3-BAL14 preUK54, obtained from one transformation product, confirmed the correct structure. Next, pEH3-BAL14 preUK54 DNA was used to transfect monkey cells (62) to produce preUK54 and select full-length, high molecular weight urokinase.

Isolation and characterization

The urokinase-containing residue was isolated from Escherichia coli culture. The residue was dissolved in a solution of pH 8 containing 5M guanidine hydrochloride and 50 mM Tris. The solution was diluted until the concentration of guanidine hydrochloride was 1M, the concentration of tris hydrochloride was 50 mM (pH 9) and the protein concentration was 1 ng / ml. The solution was then treated with 2 mM reduced glutathione and 0.2 mM oxidized glutathione (GSH or GSSG) and incubated overnight at room temperature. The protein-containing solution was then dialyzed into an aqueous medium. The resulting solution contained urokinase having an activity of 100 PU (mg unit) per mg.

After purification by conventional methods, the protein contained the expected nitrogen terminating sequence for both chains of the low molecular weight biologically active substance. Carbon termination analysis also showed the correct sequence for both chains. The protein migrated at a molecular weight of about 30,000 daltons. The specific activity is 170,000 PU / mg

-1 427

EN 202280 Β (9 225 000 Ne / mg) assuming an OD280 of 1.3 mg / ml.

Detection of urokinase production Chromogenic starting material

Theoretical background of the study

The assay is based on the proteolytic cleavage of a tripeptide from a chromophore group. The degree of cleavage is directly proportional to the specificity and concentration of the protease tested. Urokinase cleaves the S2444 chromogenic substrate (available from Kabi Group Inc., Greenwich, CT). By monitoring the formation of the chromophore group, the amount of functional urokinase present in the sample can be determined. During synthesis, urokinase is formed in the form of an inactive prodrug and is activated when cleavage occurs between residue 26 (lysine) and residue 27 (isoleucine). (The numbering is based on the protease clone shown in Figure 2A).

Some urokinase preparations have been found to self-activate and / or to be activated by Escherichia coli proteases. To ensure urokinase activation, allowing the detection by the above chromogenic method, the sample should be treated with a small amount of trypsin. Trypsin is a protease capable of breaking down the binding between lysine and isoleucine, which is needed to activate urokinase. However, trypsin can also cleave the chromogenic substrate and must be removed for testing. Soya bean trypsin inhibitor (STI) is a protein that inactivates trypsin but has no effect on urokinase. Therefore, during the assay, urokinase is activated by trypsin, then trypsin is inhibited by a soybean trypsin inhibitor, and finally, the chromogenic base is added to determine the functional urokinase present.

and the absorbance of the solution was measured at 405 nra.

The actual amount of urokinase can be calculated by comparing the sample with appropriate dilutions of a standard solution containing a known amount of urokinase. (Urokinase was obtained from Calbiochem, San Diego, California).

Direct examination of plasmin formation

Theoretical background of the study

A much more sensitive method is to measure urokinase by monitoring urokinase-catalyzed conversion of plasminogen to plasmin. Plasmin is an enzyme for which assays are available using chromogenic feedstock. Their principle is the same as that described above. The assay is based on the determination of the amount of plasmin formed after incubation of the urokinase-containing solution with a plasminogen solution. The greater the amount of urokinase present, the greater the amount of plasmin produced.

Execution of the test

An aliquot of the sample was mixed with 0.10 ml of plasminogen at 0.7 mg / ml (the plasminogen solution contained 0.5 M tris hydrochloride, pH 7.4) and 0.012 M sodium chloride, and the volume was 0. Adjust to 15 ml. The mixture was incubated at 37 ° C for various times as indicated, then 0.35 mL of S2251 solution (1.0 mM solution in the above buffer) was added and further reacted for 5 minutes at 37 ° C. To complete the reaction, 25 μΐ of acetic acid was added and the absorbance at 405 nm was measured. Numerical activity was obtained by comparison with dilutions of standard urokinase solution.

Execution of the test

The test is carried out as follows. 0.2 ml of 0.1 M Tris pH 8, 50 μΐ of the sample to be examined, and 5 μΐ of trypsin (0.1 mg / ml of 0.1 M Tris, pH 8 and 0.25 M calcium chloride) was weighed into a test tube and the sample incubated for 10 minutes at 37 ° C. Trypsin was inactivated with 2 μΐ of a 10 mg / ml STI solution containing 0.1 M tris (pH 8.0). Urokinase activity was determined by adding 50 μΐ of 1 mM aqueous solution of S2444 and incubating for 10 min at 37 ° C. The reaction was quenched by the addition of 50 μΐ acetic acid and centrifuged to remove any precipitate formed.

Indirect study of plasmin formation

Theoretical background of the study

A sensitive method for the determination of urokinase activity has been developed (61). The method is based on the determination of plasmin formation by measuring the degree of plasmin digestion of fibrin on agar plates containing fibrin and plasminogen. Plasmin creates a sharp degradation zone on the plate containing fibrin. A relationship can be established between the size of the degradation zone and the amount of urokinase present in the sample.

-15HU 202280 B

Execution of the test

According to Granelli-Piperno and Reich (61), the plates were incubated for 1 to 3 hours at 37 ° C and disintegration zones were measured. Numerical results were obtained by diluting a standard urokinase solution.

Detection of urokinase activity

Bacterial production and urokinase production

Escherichia coli strain W3110 was transformed with a plasmid (pUK33trpLEs) containing a linked urokinase protein. This expression vehicle (short trpLE linkage) was described above. Cells were cultured in minimal volume of medium overnight at 1.2 O.D. up to 550 nm. An additional 200 ml of culture medium was added. Indole acrylic acid was added to a concentration of 10 pg / ml as this compound is likely to increase the production of genes regulated by the tryptophan operon. Cells were incubated for 2 hours and harvested. Cells from 400 ml of culture medium were suspended in water and guanidine was added to a concentration of 7 M (final volume was 40 ml). The solution was incubated for 90 minutes at room temperature. The insoluble material was removed by centrifugation. The supernatant was dialyzed against 0.01 M tris hydrochloride (pH 7.5) and 0.1 M sodium chloride for 4 hours. The insoluble material was removed by centrifugation and the sample was dialyzed against 0.01 M tris hydrochloride (pH 7.5) for 2.5 hours.

The sample was loaded onto a 3.9 x 9 cm DE-52 column pre-equilibrated with 0.01 M tris hydrochloride pH 7.5. The column was washed with the same buffer and then eluted with 0.01 M tris hydrochloride pH 7.5 containing 0.15 M sodium chloride. Fractions with activity were mixed and used for further assays.

Demonstration of activity

Figure 12 shows the results obtained by direct activation of plasminogen with fractionated extracts of Escherichia coli under assay conditions similar to those described above. The activity generated depends on the presence of plasminogen. Therefore, the activity measured depends on plasminogen. In addition, the measured activity increases with time, indicating a time-dependent catalytic plasmin formation. These properties are consistent with those of urokinase, that is, catalytic activation of plasminogen. When similar studies were performed on Escherichia coli extracts that did not contain the urokinase plasmid in the Escherichia coli strain, plasminogen was not activated under these conditions.

The extracts were also subjected to the assays described above to detect and quantify urokinase activity. Figure 13 shows the effect of different amounts of bacterial fractions by direct assay of plasmin formation with 10 min of activation. The values obtained are compared with those obtained with a standard urokinase solution (determination in relative units). The extent of plasminogen activation is directly proportional to the amount of cloned urokinase added. Antibodies to purified natural urokinase are known to reduce the activity of natural urokinase. Figure 13 also illustrates the effect of these antibodies on the addition of an antibody to the test mixture at zero time. Significant inhibition of the material from the Escherichia coli strain is observed. This confirms that the activity observed in the material from the Escherichia coli strain has the same antigenic sites as the natural urokinase, and therefore is indeed a microbial urokinase.

Similar results can be observed with respect to the detection of activity and the inhibitory effect of the antibody in the fibrin plate assay. These results are summarized in Table I below.

Table I

Fibrin plate assay of urokinase protein

Sample Activity, relative units / ml ¹ Activity in the presence of urokinase antibody, relative units / ml ¹ Inhibition X Standard urokinase 112 2.5 98 11 0:45 96 1.1 0 100

According to the invention,

set urokinase 480 1:12 99 224 0 100

¹ The standard curve was obtained using a known amount of standard urokinase.

Values for Escherichia coli fractions and antibody inhibition a

-1 631

HU 202280 Β obtained from the standard curve by extrapolation.

Standard urokinase activity was inhibited by 96% or more by the addition of urokinase antibodies raised against this protein. Extracts from Escherichia coli had significant urokinase activity. Antibodies to natural urokinase, when added, almost completely inhibited this activity.

A third assay (assay based on chromogenic starting material) also showed urokinase-like activity in Escherichia coli extracts. Given that this is the least sensitive of the assays described, inhibition with antibodies could not be performed as very large amounts of antibodies would be required to achieve inhibition.

The results of the above three assays were quantified using standard urokinase from Calbiochem. The values obtained (relative units per ml) were all of the same order of magnitude: 500 for the fibrin plate method, 100 for plasminogen activation and 350 for the chromogenic substrate (S2444) assay. The discrepancies observed were probably due to the availability of relatively contaminated material for the studies.

The compounds of the invention may be formulated into pharmaceutical compositions in a manner known per se. The human urokinase of the invention is then admixed with a pharmaceutically acceptable carrier (s). Suitable carriers for this purpose are described, for example, in Remington's Pharmaceutical Sciences, edited by E. W. Martin. The pharmaceutical compositions contain an effective amount of the protein of the invention together with the necessary carrier.

The human urokinase produced according to the invention may also be administered parenterally to subjects suffering from thromboembolic diseases. The dose used may be similar to other cardiovascular thrombolytic agents used in medical practice, for example, an intravenous induction dose of 4400 IU / kg body weight followed by a continuous intravenous infusion of 4400 IU / kg / h for 12 hours in patients with pulmonary embolism suffer.

For example, a suitable dose of parenteral pharmaceutical preparation contains substantially homogeneous human urokinase with 250,000 IU of urokinase activity in the vial, along with 25 mg of mannitol and 45 mg of sodium chloride. The injectable solution is prepared by adding 5 ml of sterile water to the contents of the ampoule and diluting with 0.9% sodium chloride solution for injection or 5% dextrose solution for injection.

The human urokinase protein of the present invention is defined by a defined DNA gene and amino acid sequences derived therefrom. It will be apparent to those skilled in the art that natural allele variants exist and occasionally occur. In these variants, the entire sequence is different in one or more amino acids, or deletions, substitutions, insertions, inversions, or additions to one or more amino acids may occur in the sequence. In addition, the use of the DNA recombination method allows the preparation of various human urokinase derivatives which may be modified in various ways by substitutions, deletions, additions or substitutions involving one or more amino acids. The invention encompasses all such modifications and allelic variants as long as the essential, characteristic human urokinase activity type remains unchanged.

Although the invention has been described in some preferred embodiments, the invention is not limited thereto, and the scope of the claims is defined by the claims.

List of references in the specification

No. 3,335,361 U.S. Pat.

No. 3,926,727 U.S. Pat.

No. 4,029,767 U.S. Pat.

No. 4,258,030 U.S. Pat.

No. 4,271,150 U.S. Pat.

European Patent Application 0 037 687.

No. 3,555,000 U.S. Pat.

Wallen, P., Proc. Serono Symp., 9, 91 (1977).

Thorsen S. et al., Thrombos.

Diathes. Haemorrh., 28, 65 (1972).

9A Bar Nett and Baron, Proc. Soc. Exptl. Biok,

102, 308 (1959).

9B Banlow and Lazer, Thrombosis Slit, 1,

201 (1972).

10. Husain, S.S., et al., Thrombosis and Hemostasis, 46, 11 (1981).

10A Wun et al., J. Bioi. Chem., 257,

3276 (1982).

Ratzkin et al., Proc. Natl. Acid

Sci. (USA), 78, 3313 (1981).

11A Bollen, A., et al., Biochem. Biophys. Gap. Commun., 103, 391 (1981).

No. 2,007,676A Published British Patent Application.

Wetzel, American Scientist, 68, 664 (1980).

-1 733

HU 202280 Β

Microbiology, 2nd Edition, Harper and Row Publications, Inc., Hagerstown, Maryland (1973), especially pages 1122 and following.

Scientific American, 245, 66, et seq. (1981).

No. 2,055,382A published British Patent Specification.

No. 2,644,432; German Federal Publication Document.

Chang et al., Natura, 275, 617 (1978).

Itakura et al., Science, 1987, 1056 (1977).

Goeddel et al., Nucleic Acids Research, 8, 4057 (1980).

0 036776 published European patent application.

Siebenlist et al., Cell, 20, 269 (1980).

Stinchcomb et al., Natura, 282, 39 (1979).

Kingsman et al., Gene, 1979, 7, 141.

Tschumper et al., Gene, 10, 157 (1980).

Mortimer et al., Microbiological Reviews, 44, 519 (1980).

Miozzari et al., Journal of Bacteriology, 134, 48 (1978).

Jones, Genetics, 85 23 (1977).

Hitzeman et al., J. Bioi. Chem. 255, 1273 (1980).

Holland et al., Biochemistry, 17, 4900 (1978).

Tissue Culture, Academic Press, Kruse and Patterson editors, 1973.

Gluzman, Cell, 23, 175 (1981).

Lusky et al., Natura, 293, 79 (1981).

Gluzman et al., Cold Spring

Harbor Symp. Quant. Biol., 44, (1980). 293 35 Fiers et al., Natura, 273 (1978). 113 36 Reddy et al., Science, 200, (1978). 494 37 Bolivar et al., Gene, 2, (1977). 95 38 Vetterlein et al., J, Chem., 255, 3665 (1980). Biol. 39 Eagle H., Science, 130, 432 (1959).

Lynch et al., 1979, Virology 98, 251.

Aviv et al., Proc. Natl. Acad. Sci. USA, 69, 1408 (1972).

Lehrach et al., Biochemistry, 16, 4743 (1977).

Jackson et al., Proc. Natl. Acad. Sci. (USA), 74, 5598 (1977).

Goeddel et al., Natur., 281, 544 (1979).

Wickens et al., J. Bioi. Chem., 253, 2483 (1978).

Chang et al., Natura, 275, 617 (1978).

Crea et al., Proc. Natl. Acad. Sci. (USA), 75, 5765 (1978).

No. 47A 0 036 776 published European patent application.

Miller, Experiments in Molecular Genetics, 431-33. Cold Spring Harbor Foot, Cold Spring Harbor, New York, 1972.

Grunstein et al., Proc. Natl. Acad. Sci. (USA), 72, 3961 (1975).

Wallace et al., Nucleic Acids Research, 9, 879 (1981).

Bimbóim et al., Nucleic Acids Research, 7, 1513 (1979).

Smith, Methods Enzymol., 65, 560 (1980).

Messing et al., Nucleic Acids Res., 9, 309 (1981).

Taylor et al., Biochem. Biophys. Acta, 442, 324 (1976).

Fritsch et al., Cell, 19, 959 (1980).

Goeddel et al., Natur., 290, 20 (1981).

Blobel et al., Biomembranes, Volume 2, page 193, edited by Manson, Plenum Publisher.

Goeddel et al., Natura, 287, 411 (1980).

Itakura et al., Science, 1987, 1056 (1977).

Bingham et al., Nucleic Acids Research, 5, 3457 (1978).

Granelli-Piperino and Reich, J. Exp. Med. 148, 223.

Crowley et al., Mol. and Cellular Bioi., 3, 44 (1983).

Proc. Serono Symp., 48, 43-54 (1982).

Proc. Batelle Conf. Eng., 5, 68-90

Claims (3)

PATENT CLAIMS A process for the preparation of a human urokinase polypeptide comprising the amino acid sequence of amino acids 1-412 of Figure A, and portions or variants thereof encoded by DNA which hybridizes to a DNA sequence encoding said human urokinase polypeptide, which comprises urokinase activity. 3A to 3C incorporating said DNA sequence encoding said full-length human urokinase polypeptide or portions or variants thereof that hybridize to said DNA sequence into an appropriate expression vector, thereby expressing said vector by expressing said polypeptide from an expression vector. E. coli or mammalian cell culture host cell, culturing the resulting transformants in an appropriate medium, isolating the expression product, cleaving the resulting product, if desired, and biologically activating said polypeptide. v in the form of urokinase. 2. The method of claim 1, wherein the plasmids pUK33 trpLEL, pUK33 trpLEs, pUK33 trp 103, pUK54 trp 207-1, or p-preUK54 trp207-1 are generated and transformed into host cells. 30 The method of claim 1, wherein the substantially biologically inactive protein is cleaved at the Lys-Ile-Ile-Ile-Gly-Gly sequence at position 158-159 of Figure A at the Lys-Ile junction. 35