DD220335A5 - PREPARATION OF FUNCTIONAL HUMAN UROKINASE PROTEINS - Google Patents

Abstract

DESCRIBED HUMAN UROKINASE PROTEIN, DERIVATIVES THEREOF, THESE ASSOCIATED PHYSICAL AND BIOLOGICAL ACTIVITIES, AND THE PREPARATION OF THESE PROTEINS BY MEANS OF NEW RECOMBINANT DNA TECHNOLOGY IN THE PRESENT INVENTION.

Description

AP C12N / 249 874/8 62 307 11 18..10.B3-

Process for the preparation of a protein containing human urokinase

Application of the invention

The present invention relates to a human urokinase, to novel forms and compositions of human urokinase, and more particularly to means and methods for the in vitro production of functional human urokinase protein types.

The present invention is based, in part, on the discovery of the DNA sequence and the native urokinase amino acid sequence derived therefrom, and that portions associated with the urokinase molecule have been recognized as the functional bioactive portions. This discovery enabled the production of urokinase in various forms via recombinant DNA technology and, consequently, the production of materials of sufficient quality and quantity to carry out the necessary biological experiments to identify the biological-functional, and therefore useful, parts of the molecule. " Once determined, it was possible to produce tailored functional types of urokinase via genetic manipulation and in vitro processes, thus making it possible to efficiently produce previously unreachable, commercially viable quantities of active products. The present invention is related to these Areas aligned with all aspects ·

The human urokinase proteins produced according to the invention are used for the treatment of acute vascular diseases, for example myocardial infarction, shale attack, thrombosis of deep-seated veins, occlusion of peripheral arteries and other vein thrombosis.

CJC J \ J / Il

18/10/83

Characteristic of the known technical solutions

Publications and other references in this application which serve to explain the background of the invention and in particular cases to give additional details regarding the practice, are hereby incorporated by reference. For the sake of clarity, the publications have been included in the following text Figures are given and listed accordingly in the bibliographic annex.

A. Human urokinase

The fibrinolytic system is in dynamic equilibrium with the coagulation system, leaving the vessel opening intact and free · The coagulating system deposits fibrin as a matrix, which serves to restore a hemostatic condition. The fibrinolytic system removes the fibrin network after the hemostatic condition is reached. The fibrinolytic process is accomplished by the proteolytic enzyme plasmin, which is produced from a plasma protein precursor, plasminogen. Plasminogen is converted to plasmin by activation by means of an activator.

One such activator is urokinase. This and another activator streptokinase have recently become commercially available. Both are indicated for the treatment of acute vascular diseases such as myocardial infarction, stroke, deep venous thrombosis, occlusion of peripheral arteries and other vein thrombosis. Common to these diseases is that they pose serious health dangers and icing.

i -.

The etiological basis underlying these diseases indicates either partial or, in serious cases, total obstruction of a blood vessel.

'

a blood clot -pin thrombus or thromboembolus. The traditional anticoagulant therapy, for example, with heparin and coumarin, does not help to immediately intensify the dissolution of the thromboembolic or thromboembolism.

Streptokinase and urokinase are of practical and. effective as thrombolytic agents. Both substances, however, suffer from serious limitations. Neither has shown a high affinity for fibrin and therefore both circulating and fibring _r ebundenes plasminogen activate relatively indiscriminately .. formed in circulating blood the plasmin is neutralized relatively quickly and thus lost a suitable Ihrombolyse. Residual plasmin degrades various coagulation factor proteins, such as fibrinogen, factor V, and factor VIII, giving rise to hemorrhagic potential Streptokinase is also a potent antigen, and in patients with a high antibody titer the response to treatment is ineffective and these patients may Urokinase therapy is costly because urokinase is isolated from human urine or cell tissue and is therefore not widely accepted in clinical practice Urokinase has been the subject of much research - see, for example, references 1-9 in the appendix The presently available urokinase is, as mentioned, isolated from human urine or human cell culture, for example kidney cells (9A, 9B).

The urokinase molecule exists in various biologically active forms-high molecular weight (about 54,000 daltons) and low molecular weight (about 33,000 daltons), each composed of a single chain or two-chain material. Form

, low molecular weight is derived from the high molecular weight form by enzymatic cleavage. Biolo _; , The active material contains the so-called serine protease part which, in active form, is linked to a second chain via a disulfide bond. Any activity attributed to the high molecular weight material is believed to be due to the similar shape of these two interconnected chains and the strategic disulfide bond, and disorder in the sequence has been unequivocally located in the serine protease portion of the whole molecule (see Figure A). In any case, until the present invention, the identity and thus the function of the approximately 21,000 dalton residue was unknown and the assignment of the activity to one or the other known component of urokinase was controversial.

Recently, another form of urokinase peptide has been reported that has low but specific activity (10, 10A). It is believed that this material corresponds to native urokinase and is a preform of the previously isolated, active, type described above, most likely consisting of a single chain.

''. '; ''; -. '.' '; ·. Earlier attempts to obtain the gene required for urokinase

clones and the associated hopes of gaining expression in a microbial host do not appear

to have been successful (11.11A, 6). -. ·. ..

 It was understandable that the application of recombinant DNA and related technologies would be an extremely effective way to achieve

to provide the requisite large amount of high quality, bioactive human urokinase substantially free of other human proteins, as well as derivatives thereof which retain the functional bioactivity, thus providing the usefulness of this material in the clinical treatment of various vascular anomalies or illnesses would be used. .

B. Recombinant DNA / protein biochemistry and technology

* ° The technology of recombined DNA has entered a stage that already has some experience. Molecular biologists are able to recombine various DNA sequences with ease, thereby creating new DNA structures that are able to

'' "" '

to produce abundant quantities of an exogenous protein product in transformed microbes and cell cultures. One has the common means, and methods, for the in vitro association of various blunt-ended or sticky-end fragments of DNA in hand, thereby producing capable of expression vectors suitable for transforming particular organisms and thereby their efficient synthesis of the desired exogenous product. For a single product

however, the path still remains thorny and the knowledge-30

is not yet sufficiently developed to make reliable predictions of success. In fact, predictions about successful outcomes without the underlying experimental basis are

considerable risk of unfeasibility. 35

DNA recombination of the essential elements, i. the origin of replication, one or more phenotypic selection characteristics, an expression promoter of heterologous inserted genes, and the rest of the vector is usually performed outside the host cell. The resulting recombinant replicating expression vector, or plasmid, is introduced into the cells by transformation, and large quantities of the recombination vector are obtained by culturing the transformants. Where the gene is suitably inserted with respect to components that the transcription and translation of the encoded DNA message is suitably inserted, the resulting expression vector is useful to actually produce the polypeptide sequence encoded by the inserted gene , a process called expression. The final product may, if necessary, be by lysing the host cell in the case of microbial systems and then finding the product by appropriate purification from others. Proteins are obtained. , ".

2p . '':. :. ·. .- ':. ''''

In practice, the application of recombinant DNA technology can express a hereroid polypeptide alone -so-called direct expression or, alternatively, a heterologous polypeptide can be expressed fused to a portion of an amino acid sequence of a homologous polypeptide. In the latter case, the targeted bioactive product is sometimes bioinactive within the fused homologous heterologous polypeptide until it is cleaved in the extracellular environment. See publications (12) and (13). :

Similarly, the ability of cell or tissue culture for the study of genetic and

'. cellular physiology well developed. Man controls

, "'':;, '''.'''''.'' ^;

the means and methods for obtaining permanent cell lines produced by successive serial transfers from isolated normal cells. For use in research, cell lines are obtained on a solid carrier in the liquid medium or by growth in a suspension containing nutrients. When pulling up large preparations, there seems to be only mechanical problems. For more information see publications (14) and (15). '. '..-

Similarly, protein biochemistry is a useful, indeed necessary, component of biotechnology. Cells that produce the desired protein

Hundreds of other proteins, endogenous products of cell metabolism, are also produced. These contaminating proteins, as well as other compounds, have been found to be toxic when applied to an animal or human during therapeutic treatment with the animal.

*

Wanted to turn out protein if they are not removed from the desired protein. The technique of protein biochemistry is therefore geared to developing separation processes that are specific to the system

are suitable in the given circumstances and a 25 '. · ·

provide a homogeneous product that is safe for the intended purpose. Protein biochemistry also ensures the identity of the desired product by characterization, as well as whether the cell accurately determines the product, i. produced without changes or mutations.

: '

This branch of science is also involved in the development of bioassays, stability studies and other procedures that must necessarily be carried out before successful clinical trials and market

'_. use research. '

- 8 - 62 307 11

18/10/83

Object of the invention

- ^ - rr ι in ι - HiMIi ₁ ι ιτπ,.

The aim of the invention is to provide an improved process for the preparation of functional human urokinase proteins.

Explanation of the essence of the invention

The invention has for its object to use recombinant DNA-protein biochemistry technologies to successfully produce human urokinase in the form of biologically functional, tailor-made species.

According to the invention, active urokinase protein is provided which is suitable for use in all its forms in the prophylactic or therapeutic treatment of human beings in various vascular anomalies or diseases. Each of these forms has the bioactive part, ie. the enzymatic portion of the native material suspected of being located in a two-chain region containing the serine protease portion. In accordance with this invention, a series of urokinase-active products can be produced, either directly as a bioactive form or in a form which will provide the bioactive product only after an in vitro process. This invention also provides means and methods by which native urokinase molecules are fuller Length, in particular in bioactive or bioactivatable form, which have the additional serious advantage of specific affinity for fibrin, as it has not yet been demonstrated in any urecanase product isolated from natural sources. On

-8a - 62 3P7 1

18/10/83

The human urokinase product thus formed has the serious new ability of specific activity against noticeably existing blood clots. The products are produced by cell cultures containing the recombinant DNA that encodes the corresponding structure. "It is now possible to produce human urokinase in a much more efficient manner than has hitherto been possible, and to a greater extent in forms have biologically significant abilities · Additionally

, _; ... : .. · ... -9-. -. - ^..:: ι. .. ':. '' -. ' :

-; For example, the urokinase activator produced according to the invention may simultaneously undergo glycosylation, in comparison with. be natiyem material a greater or lesser extent provided, _r depending on the 'host cell.

The present invention encompasses the human urokinase products prepared in this manner and means and methods of their preparation. The present invention

aaf further targets a replicating DNA, 10

An expression vector bearing a gene sequence encoding the enzymatic portion of human urokinase in expressible form. The present invention furthermore relates to microorganism strains or cell cultures which have been treated with the above-described expression. , ... ''. , , , '. '

vector, as well as microbial or cell cultures of such transformed strains or cultures capable of directing the production of the human urokinase product. Further aspects

• te the present invention are in the disposal

, provide useful methods for preparing said urokinase gene sequences, DNA expression vectors, microorganism strains and cell cultures, as well as specific embodiments of these aspects. The invention. _ "-. Furthermore, it is aimed at the production of fermentation cultures of the mentioned microorganisms and cell cultures.

  ... ·. , '~. *

In the present description, the term

QQ describes "human urokinase" a polypeptide in bioactive form prepared by microbial or cell culture, or if desired, in an in vitro method, and containing the enzymatic portion corresponding to the native material. Human urokinase according to the present invention

Therefore, finding becomes full-length and thus sub-; 2. provided in other bioactive forms carrying the recognition sites of the enzymatic moiety which would be known to be essential for plasminogen activation or to become a human A urokinase is provided which contains methionine as the first amino acid or a signal polypeptide or conjugated polypeptide which, unlike the signal polypeptide, is fused at the N-terminus of the enzymatic part, wherein the methionine, the signal or conjugated polypeptide in an intra- or extra-cellular environment is specifically cleavable. (See publication 12). In any event, the human urokinase polypeptides prepared in this manner are recovered and purified in an amount which makes them useful for use in the treatment of various uterine anomalies or diseases.

Description of preferred embodiments

A. Microorganisms / cell cultures

1. Bacterial strains / promoters

The work to be described below was carried out 2 μl using the microorganisms inter alia : E. coli K-I2 strain GM 48 (thr ~, leu ", B ₁ ", lacYT, gal K12, gal T22, ara 14, ton .A31, tax 78, sup E44, dam 3, 6) deposited with the American Type Culture Collection on. April 9, 1982, under the 'No, ATCC 39099 and E. coli K-12 strain 294 (end A, thi ", hsr", j.hsm ⁺ ) described in the publication (16) deposited with the American Type Culture Collection, under number ATCCC 31446 on October 28, 1978. However, other microbial strains are also useful, including known E. coli.

35. '.' , ^! ·; '. ·. . '"·

;. ·. , ..; ; , -11- ':'^:.; , , ·. V · / · ''^;

Strains, for example E. coli B, E. coIi X 1776 χ. (ATCC 31537, filed June 3, 1979) and E. coli W 3110 (F ", λ", protroph) (accession number ATCC 27325, deposited on Tue February 1972) or other microbial strains, many of which are deposited and potentially of For example, from the American Type Culture Collection (ATCCX-for example, via the ATCC catalog, see (17), these other microorganisms } include, for example, Bacilli , according to Bacillus

subtilis and other enterobacteriaceae, among which Salmonella typhimurium , Serratia marcesans and Pseudomonas are mentioned as examples. These microorganisms must carry suitable plasmids that can replicate and express heterologous gene sequences in the cell.

For example, beta-lactamase and lactose promoter systems have been found to be particularly advantageous in order to initiate and maintain microbial production of heterologous polypeptides. Details relating to the preparation and construction of these promoter systems can be found in publications (18) and (19). Recently, a system based on the tryptophan pathway, the so-called trp promoter system, has been developed. Details regarding the manufacture and construction of this system can be found in publications (20) and (21). Furthermore, numerous other microbial promoters were discovered and utilized. details

with respect to the nucleotide sequences of these promoters, which enable a person skilled in the art, these promoters

, have been functionally linked to plasmide vectors / have also been published (see 22).

-. ^; · '. '-12-. ; , . ·

2. Yeast strains / yeast promoters.

The present expression system can also make use of a plasmid capable of selecting and replicating in either Ά- CpIi ₁ and / or the yeast Saccharomyces cerevisiae . For yeast selection, the plasmid may contain the TRP1 genes (23, 24, 25) that complement yeast (ie allow growth in the absence of tryptophan) containing mutations in this gene found to be present on the yeast Chromosome IV of the yeast are (26). A useful strain is the strain RH 218 (27) deposited with the American Type Culture Collection without notification on December 8, 1980 under the number ATCC 44076. It should be noted, however, that any strain of Saccharomyces cerevisiae containing a mutation that makes cell trp1 should be an effective environment for the expression of a plasmid containing the expression system. This is the case, for example, for the strain pep4-1 (28). This trypthophan

^The auxotrophic strain also has a point mutation in the TRP1 gene.

The 5 'flanking DNA sequence (promoter) of a yeast gene (for alcohol dehydrogenase 1) can be expressed

of a foreign gene in yeast when it is placed on the 5 'site of a non-yeast gene and in a plasmid used to transform yeast. Except one promoter requires one

correct expression of a non-yeast gene in yeast 30

second yeast sequence seconded at the 3 'end of the non-yeast gene on the plasmid to allow proper termination of transcription and polyadenylation in yeast. In a preferred embodiment

the 5 'flanking sequence of yeast gene 3 phospho-35

glycerate kinase (29) upstream of the

.; ..; ., - '· -13-. , _ '. ;

followed again by DNA-containing termination pölyaderiylation signals, e.g. the TRP1 (23-25) genes or the PGK (29) genes.

Since 5'-flanking sequences in yeast (in conjunction with 3'-yeast termination DNA) (infra) are capable of promoting the expression of foreign genes in yeast, it appears likely that the 5'-flanking sequence of each for example, glycolytic genes such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate Kinase, triosephosphate isomerase, phosphoglucose isomerase and glucokinase.

Any of the 3 'flanking sequences of these genes could also be used for correct termination and mRNA polyadenylation in such expression systems. '. ',

Finally, many yeast promoters also contain control elements for transcription so that they can be switched on and off by varying the growth conditions. Some examples of such yeast promoters are the genes that produce the following proteins: alcohol dehydrogenase II, acid phosphatase, degrading enzymes associated with nitrogen metabolism, glyceraldehyde-3-phosphate dehydrogenase, and enzymes for use

responsible for maltose and galactose (30). An identical control region would be very useful for controlling the expression of a protein product, especially if its production is toxic to yeast.

It should also be possible to combine the control region of a 5 'flanking sequence with a 5' flanking sequence containing a promoter of a highly expressed gene. One would become one with it

Hybrid promoters, which should be possible because the control region and the promoter appear to be physically different DNA sequences.

3 · Cell Culture Systems / Cell Culture Vectors The proliferation of vertebrate cells in culture (tissue culture) has become a routine procedure in recent years (see 31). A useful host for the production of heterologous proteins is the COS-7 line of Kidney fibroblasts from monkeys (32). The

 15 '·. , . '.

However, lying invention can be used in any given

; line capable of replicating and expressing a compatible vector, for example. For example, cell lines WI38, BHK, 3T3, CHO, VERO and HeLa. What additional overall from an expression vector ^J a

must be required, an origin of replication and a promoter located in front of the gene to be expressed, with any necessary ribosome binding sites, RNA attachment sites, polyadenylation sites, and sequences encoding the translocation.

     ., '. , '· - ..

Terminate the term. It should be noted that although this invention describes a preferred embodiment, it does not apply to these sequences.

\. · -. ·. ...

should be limited. For example, the replication> origin of other virus vectors (e.g., Polyoma,

Adeno, VSV, BVP, etc. Be used, as well as cellular origins of DNA replication, which are also in a non-integrated state

function. ·. , ...

In these hosts, consisting of vertebrate cells,

like the genetic expression vector for a Uro.kinas.e-

, product polypeptide as described herein as well

 '"a second genetically encoded sequence under the Kono

contain the same promoter. The second sequence provides a common screening marker, both for transformants in general and for transformants showing a high expression level for the first sequence. The second is served ^{by the} sequence ^: as a control means, whereby the expression of the desired urokinase polypeptide can be regulated and, in most cases, increased. '

This is especially important if the two proteins are prepared separately in mature form. While both DNA coding sequences are controlled by the same transcriptional promoter to form a fused messenger RNA (mRNA), they are translated by a transit stop signal for the first and a start signal for the second sequence separated,. so that two independent proteins are produced.

Environmental conditions have often been found to control the amount of certain enzymes produced by cells under certain growth conditions; become effective. In a preferred embodiment, one makes use of the fact that certain cells are sensitive to methotrexate (MTX), which is an inhibitor of dihydrofolate reductase (DHFR). DHFR is an enzyme that is required indirectly in synthesis reactions in which a 'carbon unit' is 'transferred'. The lack of DHFR activity manifests itself in the inability of cells to grow unless in the presence of such compounds that otherwise

require a carbon unit for their synthesis. However, cells lacking DHFR grow in the presence of a mixture of glycine, thymidine and

Hypoxanthine. ., ··

, '' '. .-. ·

Cells that normally produce DHFR are known to be inhibited by methotrexate. Mostly, the addition of appropriate amounts of

, Methotrexate to normal cells with the death of the cell. ^

However, certain cells appear to survive methotrexate treatment by producing increased levels of DHFR, thus exceeding the ability of methotrexate to inhibit the enzyme. It used to be

In this case, it has been shown that in such cases there is an increased amount of interfering RNA coding for the DHFR sequence, '. This is explained by the assumption of an increased amount of DNA in the genetic material coding for this messenger RNA. Obviously, the addition causes

2Q. of methotrexate a gene amplification of the / DHFR gene. Genetic sequences that are physically linked to the DHFR sequence, although not regulated by the same promoter, are also amplified. It is thus possible to use the amplification of the DHFR gene to amplify genes accompanying methotrexate treatment which code for another protein, in the present case the gene for the desired urokinase polypeptide.

Furthermore, DHFR serves as a convenient marker for the selection of successfully transfected cells when the host cells into which the second sequence for DHFR is introduced are in turn DHFR-deficient. When the DHFR sequence is effectively attached to the sequence for the desired peptide, this capability serves as a marker

for a successful transfection with the desired sequence. , . · · ·

, B. Vector Systems. ,

    · '' '

1 .: Expression in the bacterial system

Expression plasmids for use in bacteria, for example JE. coli , are generally obtained by using indempBR322 as a vector in which the heterologous gene sequence is appropriately inserted along with a translational start and stop signal in a functioning reading phase with a functioning promoter is derived from customary or synthetically produced restriction

recognition sites. The vector carries one or more '

phenotypically characteristic selection genes and. a replication origin to ensure multiplication within the host. The heterologous insert can be re-arranged to express together with a fused presequence, e.g. from .,·.

trp system genes is derivable.

, 2. Expression in yeast For a heterologous gene, such as the cDNA for : '

expressing human urokinase in yeast is it

.'25. '. '' i '

necessary to construct a plasmid vector containing four components. One component is the part that transforms both in JE. coli and yeast and therefore must contain a selectable gene from each organism. This may be the gene for ampicillin resistance from E. coli and the gene TRP1 for yeast. This component also requires a replication origin from both organisms to be maintained as plasmid DNA in both organisms. That can be the IC. coIi- origin from pBR322 and the ars1-oligin from the chromosome III of yeast.

A second component of the plasmid is a 5 'flanking sequence of a yeast gene to promote transcription of a downstream structural gene. The 5' flanking sequence can be the 3-phospho-glycerate (PGK) gene The fragment is constructed by removing the ATG of the PGK structural sequence and replacing it with a sequence containing alternative restriction recognition sites, for example XbaI and EcoRI restriction recognition sites, to form a suitable compound of these 5'-flanking Sequence to allow the structural gene.

A third component of the system is a structural gene constructed in such a way that it both

  '"..

an ATG translation start and a translation stop

Signal contains. '

A fourth component is a yeast DNA sequence,

containing the 3 'flanking sequence of a yeast gene, 20

which contains the necessary signals for transcription termination and polyadenylation.

3- Expression in cell cultures of mammals

Carrying out the synthesis of a heterologous peptide 25 ''. '....

in a mammalian cell culture is based on the development of a vector capable of both autonomously performing replication and expression of a foreign gene under the control of a heterologous transcription unit. The replication of this vector in cell cultures is accomplished in full by providing a DNA replication origin (e.g., SV40-Viru5) of helper function (T antigen) and introducing the vector into a cell line, which endogenously expresses this antigen (33 , 34). The late one

.:::. , ⁱ ... · '- ¹⁹ -''.·':''

Promoter of the SV40 virus precedes the structural genes and thus ensures the transcription of the gene.

A useful vector to obtain expression. ·

consists of pBR322 sequences that provide a selectable marker for selection in E. coli (ampicillin resistance) and an E. coli origin of DNA replication. These sequences can be derived from the plasmid pML-1. The SV40-0rigin is derivable from one

, 342 base pair PvuII-HindIII fragment comprising this region 035, 36) (both ends are convertible to EcoRI ends). The orientation of the SV40 origin region is

; that the promoter for the late transcription units is proximal with respect to the interferon coding genes

    -., '

is arranged. ,

Brief description of the drawings

Fig. A is a schematic diagram of urokinase-20

Polypeptide. The low molecular weight urokinase starts at amino acid 136 and ends at, amino acid 412. The high molecular weight urokinase starts with amino acid 1 and ends with the amino acid

412. Conversion of the single chain form of both urokinase 25

high and low molecular weight bioactive double-chain forms are provided by proteolytic cleavage between amino acids 158 and 159. Pre-urokinase begins at amino acid 20.

'_risen' position of the disulfide compounds baoU.

based on analogy with other serine proteases.

Figures 1A to 1C are a graph showing the nucleotide sequence and restriction endonuclease map of plasmid pD2 with the cDNA insertion for the low molecular weight bioactive urokinase protein of 33,000 Da.I.'s. 5 again. The nucleotide portion of the synthetic deoxyoligonucleotide CB6B insert is underlined.

Figures 2A, B describe the amino acid sequence deduced from the cDNA sequence of Figure 1, wherein the amino acids of the cDNA inserted portion are numbered from 1 to 279.

Figures 3A to 3C graphically depict the nucleotide sequence and restriction endonuclease map of the full length human urokinase protein cDNA. The CB6B insertion is again underlined.

Figures 4A, B show the full length urokinase amino acid sequence deduced from the cDNA sequence of Figure 3.

2O ₁ ... -; j . '''·''; ,

Figure 5 illustrates the preparation of the plasmid, pUK33, trpLE, for the expression of the long 33QOO Daltons fusion protein.

- Fig. 6 illustrates the construction of plasmid pUK33trpLE _S for expression of short, 330Q0 Daiton fusion protein.

/. . '.

Fig. 7 shows the preparation of the plasmid for the

direct expression of the 33,000 dalton protein

Fig. 8 illustrates another construction of a

Plasmids for direct expression of the 33,000 dalton protein. 3>

21 ~ 62 307 11

18..Ί0 · 83

Figures 9 and 10 illustrate the construction of the plasmid for direct expression of the 54,000 dalton T chinokase and a precursor form of the 54,000 dalton urokinase.

Figure 11 shows the construction of a plasmid (p-pEH3-Bal14preUi: 54) for the expression of the 54,000 dalton urokinase in eukaryotic cells.

Figure 12 illustrates the time dependence of the activation of and the requirement for plasminogen in a plasmin assay of urokinase prepared as described herein.

.13 illustrates the activity of a urokinase extract described herein in terms of activating plasminogen and inhibiting this activity by antibodies raised against natural urokinase. "

Aüsführungsbeiapiel

The invention is explained below with reference to examples.

A «source of urokinase mRNA

Detroit 562 (human pharyngeal Kar ζ inom) "cells (38) (A (TCONR ₉ CCL 138) are (39) to the iConfluenz cultured in Eagle's minimal essential medium, wherein said medium with 3% Hatriumbicarbonat ( pH 7.5) 1% L-Glutamine (Irvine), 10% fetal remover serum 1% sodium pyruvate (Irvine), 1% nonessential amino acids (Irvine), 2.4% HEPBS (pH 7> 5 ) 50 / suplementiert Ug / ml Garamycin, and incubated at 37 ⁰ C in a 5% COG atmosphere. Confluent cells are purified by centrifugation after treatment with 0 ₉ 25% trypsin for 15 min at 37 ⁰ C harvested

B. Isolate the messenger RNA.

The total RNA from Detroit 562 cells is extracted essentially as described in Lynch et al. (40). The cells are centrifuged

pelleted and about 1g of the cells wird.in 10ml. , 10 mM NaCl, 10 mM Tris HCl (pH 7.4) and 1.5 mM MgCl ₂ 'resuspended. The cells are lysed by addition of a non-ionic detergent NP-40 at a final concentration of 1%. The nuclei are removed by centrifugation and the RNA is further purified by two phenol (redistilled) / chloroform: isoamyl alcohol extractions at 4 ° C. The aqueous phase 'is made 0.2 M NaCl and total RNA is precipitated by adding two volumes of jg units of a 100% ethanol and stored at -20 ⁰ C overnight. After centrifugation, polyA mRNA is purified from total RNA by oligo-dT cellulose chromatography (41). 1 gram quantities of the cells typically contain 10-15 mg ^ · ^η total RNA and about 2% of it was polyA mRNA.

C. Size fractionation of polyA mRNA

Size fractionation of 200 μg polyA mRNA was performed by electrophoresis through an acid urea gel composed of 1.75% agarose, 25 mM sodium citrate (pH 3.8) and 6 M urea (40.42) Electrophoresis was carried out at 25 mA and 4 ° C for 7 hours. The gel was then fractionated by hand with a razor blade. The individual gel slices were melted at 7O ⁰ C, in 12 ml of 10 mM NaCl, 10 mM Tris HCl (pH 7.4), 1.5 mM MgCl _2, and 0.1% SDS, and then twice dissolved m ^ t Water-saturated, redistilled phenol and extracted once with chloroform. The fractions were then ethanol precipitated and then translated in vitro (43) to determine the size fractionation and purity of the polyA mRNA.

D. Preparation of a "library" of oligo d.T-started colonies containing the urokinase sequences

Poly A mRNA is size fractionated in acid urea gels. MRNA fractions larger than 12S are pooled and used as templates for oligo dT-primed production of double-stranded cDNA using standard methods (44,45).

The cDNA is size fractionated with 6% polyacrylamide gel electrophoresis and 132 ng of double-stranded cDNA that is more than 350 base pairs long is obtained by electroelution. 30 ng of the double-stranded (ds) cDNA is digested with deoxy-C residues using a '' '' x.

extended deoxynucleotidyl transferase (.46) and fused with 200 ng of plasmid pBR322 (37), which was extended in a similar manner with deoxy-G-r residues at the PstI site (46). Every merge mix

was then transformed into E. coli K12 strain 294 (ATCC No. 31446).

transformed. About 10000 ampicillin-sensitive, tetraelycline-resistant transformants were obtained. ,.

E. Preparation of Synthetic DNA Oligomers for

Screening of urokinase 25

Eight synthetic, 14-base DNA

Oligomers complementary to mRNA derived from a Met-Tyr-Asn-Asp-Pro amino acid sequence of a cyanogen bromide polypeptide fragment of urokinase called CB6. These eight desoxo-nucleotides are prepared by the phosphotriester method (17) to the following two-pool: (CB6A) 5 'GGGTCGTTA / GTACAT 3V, (CB6B) 5' GGATCGTTA / GTACAT 3 ', (CB6C) 5' GGGTCATTA / GTACAT 3 ' , (CB6D) 5 'GGATCATTA / GTACAT 3'.

Each pool of two oligomers is then radioactively phosphorylated as follows: 250 ng of deoxyoligonucleotides are dissolved in 25 μl of 60 mM Tris HCl (pH'8), 10 mM MgCl ₂ , 15 mM beta-mercaptoethanol, and 100 μCi of Xy- P) ATP (Amersham, 5000 Ci / mmol). Then, 5 units of T4 polynucieotide kinase are added. The reaction then proceeds at 37 ° C for 30mins by the addition of 20mM EDTA.

Reaction then proceeds at 37 C for 30 minutes and becomes

F. Screen Oligo dT-primed colony collection for urokinase sequences

About 10,000 colonies are individually inoculated into wells of a microtiter plate containing LB (48 x). + 5 μg / ml

l§ tetracycline and stored after addition of 7% DMSO at -20 ⁰ C. Individual colonies from this collection are transferred to Schleicher and Schuell BA85 / 20 nitrocellulose filters and grown on agar plates containing LB + 5 μg / ml tetracycline. After about 10 hours of growth at 37 ° C, the colony filters are transferred to agar plates containing LB + 5 μg / ml tetracycline and 12.5 μg / ml chloramphenicol and incubated overnight at 37 ° C. The DNA of each colony is then denatured and fixed to the filter with a modified Grunstein-Hogness method (49). Each filter is rinsed in 0.5 N NaOH, 1.5 M NaCl for 3 minutes to lyse the colonies and denature the DNA, followed by rinsing for 15 minutes in 3 M NaCl, 0.5 M Tris HCl (pH 7 , 5) neutralized. The filters are then rinsed in 2XSSC for an additional 15 minutes and then baked in an 80 ° C vacuum oven for 2 hours. The filters are then prehybridized for about 2 hours at room temperature in 0.9M NaCl, 1X Denhardts, 100mM Tris HCl (pH 7.5),

5 mM Na-EDTA, 1 mM ATP, 1 M sodium phosphate (dibasic), 1 mM sodium pyrophosphate, 0.5% NP-40 and 200 μg / ml S. coli t-RNA and then essentially according to the method described in Wallace et al , described method (50) in the same

6

Solution hybridized overnight using approximately 40x10 cpm of each kinased CB6 deoxy-oligonucleotide pool of two. After extensive washing at 37 ° C in oXSS ^ and 0, 1% SDS _5, the filters are exposed to a more intensive screening 16 to 24 hours at -80 ⁰ C Kodak XR-5 X-ray film with DuPont Lightning-Plus. Two colonies hybridized with the mixture of eight samples: UK513dT69D2 (pD2) and ÜK513dT73D12 (pD12).

G. Characterization of pD2 and pD12 Plasmid DNA

The plasmid DNA isolated from E. coli colonies UK513dT69D2 and UK513dT73P12 was isolated by the rapid miniscreen method (51) and subjected to PstI restriction end-disruption analysis. From this analysis, it can be concluded with some certainty that pD2 and pD12 are identical. Each plasmid DNA has 3 PstI restriction fragments that migrate at the same speed when electrophoresed in a 6% polyacrylamide gel. The complete

Nucleotide sequence of cDNA insertion in plasmid pD2 wur-25

de by the dideoxynucleotide chain termination method

(52) after the PstI restriction fragments have been subcloned into the M13 vector mp7 (53). Fig. 1 shows the nucleotide sequence and FIG. 2 illustrates the translatier-O ₀ th nucleotide sequence of the cDNA-inserted fragment of pD2. For this one large fragment of pD2 the complete coding region of urokinase was' (low-molecular weight 33000 Daltons = 33K ) isolated.

, - ν- ... '.... _26- -' V- .; :. -. ,

As can be seen from the map, the nucleotide sequence of the CB6B (5 'GGATCGTTA / GT'ACATJ-deoxyoligq nucleotide includes nucleotides 466 to 479. Between amino acids 222 and 227 is a typical serine protease active site (Gly-Asp-Ser The coding region consists of 838 base pairs or 279 amino acids of the carboxy-terminal portion of the high molecular weight (54,000 daltons = 54K) urokinase. The stopoud UGA at amino acid position 280 begins approximately from nucleotide 935 of the 3 'untranslated Sequence up to the polyÄ sequence, since only 31413 daltons of full length urokinase are encoded by the cDNA insertion of pD2 In addition, it was necessary to additionally produce additional colony collection sera containing urokinase sequences to identify high molecular weight urokinase.

H. Preparation of Two Different Specially Started Colonial Collections for the Aminoterminal Extension of the Existing Urokinase Clone

The first special primer cDNA library utilizes a 45 base pair DNA restriction endonuclease fragment of urokinase starting with a Haell site at position 225 and ending with Accl at position 270 (Figure 1) as a primer instead of a 01igo-dT ₁₂ ^. , This fragment was denatured in the presence of 20yug unfraktionienter Detroit 562 polyA mRNA and the cDNA according to the methods described in Section D

prepared. 11.5 ng of double-stranded cDNA, the '..'

greater than 200 bp is eluted from a 6% permacrylamide gel and used to make approximately 6000 clones in E. coli 294. ·.;

A second cDNA library with specific primer,

called UK89CB6 with about .4000 colonies is thereby produced

provided that a pool of 4 μg of polyA raRNA derived from the acid-urea agarose gel fraction 8 and 4 μg of polyA mRNA in fraction 9 are used (see section 'C). From each CB6 deoxyoligonucleotide pool (see Section E), 250ng instead of oligo dT _1? -o used as a primer.

I. Screening of a colony collection containing full-length cDNA. Colonies containing full-length cDNA are transferred directly to nitrocellulose filters and grown at 37 ° C. The colonies are lysed and the DNA is denatured and bound to the filters as described in section F (49). From a 143 base pair to Hinfl

¹ ^ HaeTI restriction endonuclease fragments from the cDNA.

    32 '

Insertion of pD2 will produce a P-labeled DNA sample and use the full-length cDNA attached to the filter

is bound, hybridized. 8x10 CPM of the sample are hybridized for 16 hours, then washed as described (55) and exposed to an X-ray film. Two colonies showed strong hybridization: A3 and E9

J. Characterization of full-length urokinase cDNA pA3 and pE9. ^

A PstI restriction analysis of the A3 plasmid DNA shows cDNA insert fragments of about 360 bp and about 50 bp as well as the E9 plasmid DNA fragment at about 340 bp. «Shows a Pstl EcoRI double restriction of each plasmid DNA

a common cDNA insertion fragment of about 190 bp, \

as predicted where each plasmid DNA urokinase sequence information encodes 5 'to the Haell AccI primer fragment. Plasmid pA3 has an additional PstI EcoRI cDNA insert fragment of 185 bp and plasmid E9 has an additional 160 bp fragment. The

, -28-

larger, approximately 360 bp PstI cDNA insert fragment of pA3 was subcloned into the M13 vector mp7 (53) and sequenced by the didexynucleotide chain termination method (52). The urokinase coding sequence of pA3 is located from approximately position 405 to position 785 in the cPNA sequence of the full length urokinase protein (see Figure 3).

K. Screening of urokinase colony collection UK89CB6 The DNA from colonies containing approximately 1900 UK89CB6 cDNA insertions was denatured and fixed to nitrocellulose filters as described in Section F. From the 146 bp PstI HinfI fragment of the ¹ CDNA

       '32' '' '' '

Insertion fragment of pA3 is prepared a P-labeled DNA probe (54). 40x10 CPM are then exposed to filter-bound DNA from UK89CB6 colonies: hybridized for 16 hours and then washed as described (55) and exposed to X-ray film. Two colonies that showed positive hybridization were named UK89CB6FI (pF1) and UK89CB6H1O (pH10).

L. Characterization of pF1 and pH10 urokinase cDNA. PstI restriction pre-pF1 shows cDNA insert fragments of about 450 bp and about 125 bp, and pH10 shows a Psti cDNA insert fragment of about 500 bp. PstI EcoRI double restriction of pF1 shows no EcoRI restriction site and has cDNA insertion fragments identical to a PstI restriction alone. pH10 shows an EcoRI restriction site, causing

cDNA insertion fragments of about 375 bp and about 110 bp are formed. This Eco RI site of pH10 is probable ^(Lich same Eco RI site, as it is characterized in position in Fig. 3. The pF1 cDNA insert does not contain this EcoRI restriction site.

^;

pF1, which has a cDNA insert fragment longer than that of pH10, is selected for sequencing. Both PstI restriction fragments of the pFicDNA insert are sequenced by M13 subcloning and di-desoxy sequencing. The composite nucleotide sequence of the UK cDNA insert of pF1, pA3 and pD2 encodes the full length amino acid sequence of the full-length high molecular weight urokinase shown in FIG. The urokinase coding sequence of pF1 is characterized from position 1 to approximately position 570. The urokinase coding sequence of pD2 is located from position 532 to position 2304 in FIG.

The A.mino terminal serine at amino acid position 1, as determined by amino acid sequence analysis, is shown in Figs. The preceding 20 amino acids at the amino terminus beginning with Met and terminating with Gly likely to serve as a signal sequence for secretion of the remaining 411 amino acids of the urokinase _w ith a high-molecular weight. This presumed signal sequence has properties, such as size and hydrophobicity (56, 57), which are also found in other characteristic signal sequences.

r. ·

² ·. The trypsin cleavage sites that give rise to the 33K two-chain low molecular weight urokinase from high molecular weight urokinase are the following: Lys at position 136 is the amino terminal amino acid of the short chain and He at position 159 is the amino acid.

 '.'

end of the long chain (Figs. A, 4).

j M. Expression of the low-molecular-weight derivatives of urokinase in E. coli

, 1. The long Trp LE fusion (Figure 5), construct a plasmid (pNCV, 58) having the following properties: 1. The plasmid is a derivative of pBR322 and is present in about 20 copies per Cell before. 2. The plasmid makes its host cell E.coli resistant to tetracycline. 3. The plasmid contains an inducible tryptophan promoter that directs the synthesis of a protein JQ, which consists of a fusion between the trp leader peptide and the trp E structural gene (LE fusion gene). 4. A single PstI restriction site is constructed in the trp Ε gene which can be used to clone PstI DNA fragments by placing the EcoRI site at the distal end of the LE gene in plasmid pSOM74iA4 into a PstI site flanked and flanked by a synthetic sequence of two EcoRI sites, ie, *

AATTCTGCAG GACGTCTTAA. '-

The DNA fragment containing the trp promoter and the LE gene is then introduced into the plasmid pBR322 to give the plasmid pNCV (Fig. 47A). '

The urokinase PstI fragment from nucleotide at position 5 (the PstI 5 'site) to nucleotide position 1130 (Figure 1) is cloned into the PstI site of pNCV such that a fusion protein is made with induction of the trp promoter becomes. The N-terminal part is trp LE and the C-terminal part is the low molecular weight urokinase.

As shown in Fig. 5, 5 μg of the plasmid pUK513dT69D2 (pD2) is digested with 20 units of PstI and the 1125 bp cDNA insert fragment containing the low molecular weight PstI

Urokinase is coded by 6% polyacrylamide gel.

, Electrophoresis isolated. Approximately this insert is electroeluted from the gel, phenol / chloroform extracted and ethanol precipitated. 1 μg of the vector plasmid pNCV (58) is digested with 10 units of PstI and precipitated after phenol / chloroform extraction. Approximately 100 ng of this 1125 bp fragment is probed with about 100 ng PstI digested pNGV in 20 μl of 20 mM Tris'HCl (pH 7.5) , 10 mM MgCl ₂ , 10 mM DTT, 2.5 mM ATP and 30 units T4 DNA Ligase united. After overnight binding at 14 ° C, one half of the mixture is transformed into E. coil K12, strain 294. By BamHI digestion of the DNA of 12 transformants could be shown in three cases, a correct orientation. Expression of this plasmid (pUK33trpLE _L ) (Figure 5) in E. coli yielded a long trp LE fusion protein containing 33000 urokinase. The 33000 urokinase is active by digestion with trypsin like a ^v

Enzyme between pos. 3 and 4 and position 26 and 27 activated (see Fig. 2).

2. Short trp LE fusion (Figure 6). \ . The plasmid pINCV is constructed. It is similar to pNCV in every respect (see supra) except ² ^ fact that the majority of the trp E gene is deleted.

In this plasmid, the BglII site was converted to a PstI site and the region between this new PstI site and the original PstI site is removed.

About 100 ng of pINCV is digested with PstI and HindIII,

then phenol / CHClo extracted and ethanol precipitated.

About 3 μg of pUK33trpLE _L (Figure 6) is digested completely with HindIII and partially with PstI to give a PstI HindIII DNA fragment of 1150 bp, which is purified by electroelution after electrophoresis in a 6% polyacrylamide gel , The Pstl | ite within

of the UK structural gene is exempt from digestion.

The entire PstI HindIII-digested pINCV material is probed with approximately 50 ng of the 1150 bp HindIII partial PstI fragment

from pUK33trpLE. mixed and overheated at 14 ° C ligated. : 5. ' ^iJj ''-. ·

This mixture is then transformed into E. coli K12, strain 294. BaraHI digestion confirms the correct construction of this plasmid (pUK33tr.pLE, j) (Figure 6). Expression of this plasmid in E. coil provides a fusion protein from which 33000 urokinase is activated, as described above.

3. Direct expression of 33K urokinase (Figures 7 and 9) A urokinase DNA fragment encoding nucleotide 16

(Figure 1) is cloned in a pBR322 derivative,

        '' '' '' '..'

whereby a construction is obtained in which the trp promoter is located immediately in front of this urokinase fragment encoding the low molecular weight urokinase. The Plasnid pLeIFAtrpiP3 (Figure 7) is a derivative of the. Plasmid pLs IFA25 (59), in which the EcoRI - * s Ite distal to the LelFA gene was removed (59). 10 μg of pLeIFAtrp103 (Figure 7) are digested with 20 units of EcoRI, phenol / CHCl-, extracted and ethanol precipitated. The cohesive ends of the plasmid produced by EcoRI digestion

__ DNA molecule are filled up to blunt ends

-, -. - ·.

Use of 12 units of DNA polymerase I in a 50-yl reaction containing 60 mM NaCl, 7 mM MgCl ₂ , 7 mM Tris-HCl (pH 7.4) and 1 mM of each ribonucleotide triphosphate.

The reaction is for 1 hour at 37 ° C

OQ incubated, phenol / CHC extracted with ethanol and precipitated with ethanol. The DNA is then resuspended in 50μl of 10mM Tris'HCl (pH8), 1mM EDTA. And treated with 500 units of bacterial alkaline phosphatase at 65 ° C for 30 minutes, extracted twice, and ethanol extracted.

3g precipitated. After digestion with Pstl the mixture is in

"·. '. ·' Ί '

electrophoresed on a 6% polyacrylamide gel and / or electroeluted about 3900 bp vector fragment.

The plasmid pUK33trpLE _T is transformed into E. coli K12, strain g GM48 (deoxyadenosine methylase ") so that the DNA purified from this E. coli strain can be digested with the restriction endonuclease Bell (60) 4 μg of this DNA is allowed to incubate for 1 hour at 50 ⁰ C with 6 units of Bell treated (in 75 mM KCl, 6 mM Tris'HCl (pH 7.4), 10 mM MgCl ₃₅ 1 mM DTT), then taken up in 50 mM NaCl and digested with 10 units PstI. A 6% gel electrophoresis is performed and the 914 bp fragment electroeluted.

The phosphotriester method (47) is used to synthesize a 14-nucleotide DNA primer coding for the amino acid sequence Met-Lys-Lys-Pro and having the following sequence:

MetLysLysPro. · 5 'CTATGAAAAAGCCC 3' ''

500 ng of this primer is phosphorylated at the 5 'end with 10 U of TU DNA kinase in a 20 μL reaction containing 0.5 mM ATP. The 264 bp PstI AccI cDNA insert fragment from pUK33trpLEj (grown in E. coli GM48) is isolated. Approximately 500 ng of this fragment is resuspended in 10 μl of deionized water and mixed with 20 μl of the phosporylated primer, heated at 95 ° C for 3 minutes, and rapidly frozen in a dry ice-ethanol bath. The denatured DNA solution was adjusted to 60 mM NaCl and 7 mM MgCl ₂ , 7 mM Tris'HCl (pH 7.4), VmM from each deoxyribonucleotide

.'triphosphate and 12 units of DNA polymerase I, large

Fragment, admitted. After two hours incubation of this primer repair reaction at 37 ° C, this phenol /. CHCl., Extracted, ethanol precipitated and completely with

Bell at 5O ⁰ C digested. This reaction mixture then passes through a 6% polyacrylamide gel and about 50 ng of the 200 bp BcII fragment, which is blunt-ended at the amino-terminus, is electroeluted. Then, about 50 ng of the blunt-ended Bcl I primer-repair fragment, alloyed about 100 ng of the Bell PstI-earboxy-terminal fragment and about 100 ng of the 3900 bp vector fragment overnight at '14 ⁰ C, and transformed into E. coli 294th EcoRI digestion of numerous transformants showed that the construction was correct and DNA sequence analysis

indicated the desired sequence by the initiation codon of TS ···. ".

plasmid, pUK33trp1O3 (Figure 7). In this construction, the N-terminal methionine is followed by two lysines, which in turn follow the amino acid sequence 5 to 279 ', -, as shown in Fig. 2A. The expression of this

Plasmids in E. coli delivered the synthesis of the low-20

, molecular urokinase. This protein was activated by a trypsin-like active enzyme, as described above, which serves to cleave the N-terminal lysine pair and also between the lysine in pos. 26 and

to split the isoleucine in Pos. 27 (Figure 2A). 25

We found it desirable to construct a pUK33trp1O3-derived plasmid that confers tetracycline resistance to its host cell. In Fig. 8, 2Q is shown the construction of the plasmid pUK33trp1O3Ap ^R ~ Tc ^{R described} below. 5 μg of the plasmid pHGH207-1 (see infra) are digested with Hpal and PvuII. The vector fragment is isolated and purified. 5 μg of the plasmid pUK33trp1O3 are digested with Hpal and BamHI, electrophoresed in a 6% polyacrylamide gel.

'ί and the 836 bp DNA fragment purified. A second 5 μg aliquot of the plasmid pUK33trp1O3 is digested with BamHI and PvuII to isolate and purify the 119 bp DNA fragment. Äquiraorale amounts of each of these three DNA fragments are joined overnight at 14 ⁰ C and used to transform E. coli 294th Restriction endonuclease analysis of different plasmid DNA

ampicillin resistant transformant secures the

R proper construction of the plasmid pUK33trp103Ap and reversal of the orientation of the trp promoter / UK33 .cOdleren.den DNA.

Approximately 5 μg of the pBR322 DNA is digested with EcoRI and the cohesive ends filled in with Klenow Poll. After! 5 PstI digestion, the large vector fragment containing the DNA encoding tetracycline resistance and containing the origin of replication and a portion of the ampicillin resistance gene are isolated and purified. About 5 ug 'R of the plasmid pUK33trp1O3Ap ^il are digested with BamHI and PstI. Then, the DNA fragment encoding the remaining portion of the ampicillin resistance gene, the trp promoter and the RESIZE ^(ssten part of the low molecular weight urokinase purified. There are approximately equimolar amounts of these two DNA fragments and the 119 bp BamHI-PvuII DNA fragment ligated overnight at 14 ⁰ C from the plasmid pUK33trp103Ap ^R to complete the construction of plasmid pUK33trp103Ap ^R Tc ^R. This plasmid is used for the construction of a plasmid containing the high molecular weight full length urokinase

expressed (see Section N and Fig. 9)

'^;'','''' / '''' N. Expression of High Molecule Derivatives * ¹ of

Urokinase • 1. Direct expression of 54K urokinase Figure 10 illustrates the construction of urokinase more full

The plasmid pHGH207-1, which contains a single trp promoter, was prepared by removing the double lac promoter from the plasmid pHGH 207. This plasmid has a double lac promoter followed by a single trp promoter. This is done as follows: the trp promoter 310bp DNA fragment is obtained by digestion with EcoRI, the plasmid pFIF trp 69 (20). This fragment is inserted into the plasmid pHGH107 (44), which is opened with 5 EcoRI. In this way a plasmid (pHGH 207) is obtained which has a double lac promoter followed by the trp promoter flanked by EcoRI sites. The plasmid pHGH thus obtained is digested with BamHI; it will continue partly with

EcoRI is digested and the largest fragment is isolated. 20

This fragment thus has the complete trp promoter. From pBR322 the largest EcoRI-BamHI fragment is isolated. Both fragments are ligated and the mixture used to transform E. coli 294. Tet ^r , Amp ^r colonies are isolated and most of them have the plasmid with the structure shown for pHGH 207-1. The plasmid pHGH 207-1 is thus a derivative of the plasmid pHGH 107 (44) and has the following properties: 1. The gene for human growth hormone is flanked by the trp promoter instead of the lac promoter, as in pHGH107, 2. the plasmid transmits ampicillin and tetracycline resistance when expressed in E. coli (see also 47A).

20 μg of pHGH207-1 are partially digested with EcoRI and. completely digested with BgIII. Purification of the large vector fragment is performed by 5% polyacrylamide electrophoresis, electroelution, phenol / CHCl-j extraction and

Ethanol precipitation performed. 14 μg of the plasmid pF1 are digested with BglII and TaqI and the 236 bp DNA fragment is isolated from a 6% polyacrylamide gel and purified. The following complementary DNA fragments are synthesized by the phosphorous triester method (47):

MetSerAsnGluLeuHlsGlnValPro 5 ¹ AATTATGAGCAATGAATTACATCAAGTTCCAT

TACTCGTTACTTAATGTAGTTCAAGGTAGC 5 '

  ...

As can be seen, the amino acid sequence Met-Ser-Asn-Glu-Leu-His-Gln-Val-Pro is replaced by the initiation codon, by ATG and the nucleotide sequences for the eight amino end

Amino acids aer high molecular weight urokinase encoded. / ·.

50 ng of each synthetic DNA fragment are phosphorylated, the fragments are mixed, heated for one minute at 65 ° C and cooled at room temperature for 5 minutes.

10ng of phosphorylated and mixed synthetic

DNA fragments are partially degraded by about 200 ng of the 25

EcoRI, BglII-pHGH207-1 vector fragments and ca.

50 ng of the 236 bp BglII, Taql DNA fragment, ligated overnight at 14 ° C and transformed into E. coli 294. Out of 24 ampicillin-resistant colonies, single plasmid

DNAs digested with EcoRI and BgIII and a plasmid (plntD 30

which showed the desired correct construction was chosen for DNA sequence analysis. This analysis confirmed the correct DNA sequence by the ATG initiation codon and the amino-terminus of the high molecular weight

  urokinase. : 35

-38-; ':

4 μg of pNCV (see section M) are digested with BglII and CIla and the large vector fragment is isolated and purified by 5% polyacrylamide gel electrophoresis. 30 μg of the plasmid pF1 is digested with PstI and BglII and electrophoresed through a 6% polyacrylamide gel. The 44 bp DNA fragment is electroeluted, tPhenol / CHCln extracted and etahaholoprecipitated. 4 μg of pA3 DNA are digested with PstI and TaqI and the 192 bp fragment is purified from a 6% polyacrylamide gel. About 100 ng of the Bglll ClaI vector DNA fragment, ca. 50 ng. of the 192 bp fragment and about 50 ng of the 44 bp fragment are pooled and ligated overnight at 14 C, then transformed into E. coli 294. A BgIII Clal double

Digestion of the plasmid DNA of various tetracycline-15

resistant transformants showed the correct construction of this new plasmid, which was named plnt2.

5 μ of & E.coli GM48 in (ATCC no. 39,099.9 .April 1982) cultured pUK33trp1O3Ap ^R Tc ^R are digested with Bell and Sail for isolating and purifying the 1366bp DNA fragment. From the same plasmid, the 108 bp EcoRI-BclI DNA fragment was isolated. Approximately equimolar amounts

RR of the EcoRI-Sall DNA fragment from pUK33trp1O3Ap T _c and

the EcoRI-Sall DNA fragment from pUK33trp103Ap ^R Tc ^R and 25

of the Eco R to DNA fragment, also from pUK; 33trp103

R R Ap Tc will be over!

PInt3 is obtained.

RR 'ο

Ap Tc are ligated overnight at 15 ° C, yielding

5 μg of plnt3 DNA are electrophoresed with BglII and Sail in a 6% polyacrylamide gel and the 1701 bp fragment containing the Carboxv end portion of the full length urokinase and the amino end portion of the gene: for tetracycline resistance is purified. About 5 Ug of the

g ₅ ρ Intermediate 1 DNA is digested with BglII and Sail and electrophoresed in 6% polyacrylamide gel

: -39-.

- subjected and the large vector fragment, ^v that the carboxy

End part of the gene for tetracycline resistance, the origin ·. .... the replication, the ampicillin resistance gene, the _ trp promoter, the initiation codon ATG and the amino acid

End of the full length urokinase containing ", is cleaned. About 100 ng of the vector fragment and about 100 ng of the 1701 bp fragment were combined, ligated overnight at 14 ·· ⁰ C, and transformed into E.eoli 294th A plasmid Q from < a tetracycline and ampicillin-resistant colony showing the correct PvuII restriction nnducleass pattern

ί ''' ^v , ..';' was identified and confirmed the

• position the full length urokinase downstream of the ':'' ί trp promoter.' This is the plasmid pUK54trp207-1. The full length urokinase is prepared by expression of this plasmid in E. coli C 294.

2. Direct Expression of Pre-UK 54K in E. coli, (Figure 10). The following scheme was used to construct a plasmid for. to produce the direct expression of preUK54. With .- ',' using the Phosph'ortriestermethode (47), two ^com-; : complementary DNA fragments synthesized for. which encodes the ATG coding amino acid sequence followed by the first three N-terminal amino acids of the

V. '. 25 "urokinase precursor sequence Arg-Ala-Leu, as described below.

J * '. ,

''; the represented: -, '.

; 'EcoRl' MetArgAlaLeu BgII

'.' ·. 5 ^f AATTATGCGTGCCCTGC

', ^] TACGCACGGGS'

This portion of the precursor sequence is flanked by EcoRI and BglI restriction endonuclease sites. 50 ng · each synthetic. DNA 'fragments become phosphorylie.rt., Which phosphorylated. Fragments are mixed ,, :. ' ' heated to 65 ° C for one minute and at room temperature off

cooled. 5 μg of a pF1 DNA is mixed with BglII and BglII. daut and the 310 bp UK DNA fragment are isolated and purified. About 50 ng of the 310 bp UK DNA fragment, about 150 ng of the partially digested EcoRI, BglII vector DNA fragment from pHGH207-1 (see Section N) and 10 ng of the .phosphorylated and mixed synthetic DNA fragments are transduced Ligated overnight at 14 ° C and transformed into E. coli 294. Single plasmid DNAs obtained from different λ ampicillin-resistant transformants are analyzed to confirm the correct construction and nocleation sequence of the high molecular weight urokinase precursor.

One of the correct plasmids was called plnt4.

5 μg of pint4 DNA was digested with BglII and EcoRV to isolate and purify a vector DNA fragment containing the N-terminal nucleotides of the pre-UK5U, the trp promoter, the ampicillin resistance genes, the Origin

2Q of the replication and a part of the coding for tetracycline resistance DNA. 5 μg of pUK54trp207-1 DNA was digested with BglII and EcoRV. The BglII EcoRV DNA fragment encoding the DNA encoding the remainder of the UK54 and the tetracycline resistance was isolated / purified and ligated with the Bglll EcoR V vector DNA fragment to construct the plasmid p-preUK54trp207 -1 to complete.

0. Direct Expression of (Pre-) Urokiriase in Cell- QX) cultures

Fig. 11 illustrates the introduction of the gene coding for prourokinase into a eukaryotic otic expression vector. p342E (62), which is capable of performing the replication and expression of pre-urokinase in permissive monkey cells. 10 μg of p342E DNA are included

XBaI is digested and about 100 base pairs are removed using Ba 131 nuclease in each direction (fragment Ϊ). 100 ng of the HindIII linker 5 'CTCAAGCTTGAG, synthesized by the phosphotriester method (47), are phosphorylated, heated to 65 C for 1 minute, and cooled at room temperature. The phosphorylated linker and fragment 1 are ligated overnight at 14 ° C and transformed E. coli 294. Restriction endonuclease analysis of a transformant called pEH3-Ball4 · detected the introduction of a HindIII restriction endonuclease site and the loss of the XBal site. 5 μg of the pEH3-Bali4 DNA is digested with HmdIII and Hpal. The cohesive ends are filled to blunt ends using Klenow Poll. The DNA is treated with BAP and the vector fragment containing the SV40 early promoter, the genes for ampicillin resistance and the replication origin, are isolated and purified (fragment 2). 5 Ug ppreUK54trp2O7-1 are digested with CIaI and XBaI. The cohesive ends are filled in with Klenow Foil and the DNA fragment coded for preUK54 is isolated and purified (fragment 3). About 100 ng of fragment 2 and about 100 ng of fragment 3 are ligated overnight at 14 C and E. coli is transformed. Restriction endonuclease analysis of the plasmid DNA, called pEH3-Bali4 preUK54 from a transformant, confirmed the correct production. pEH3-Bali4 preUK54 DNA was then used for the transaction of permissive monkey cells (62) to add preUK54

, express and high molecular weight urokinase full length

, , ^!

to secrete.

, , '·; , '"τ ⁴² - · ^; ·'. <: '- ..-';'-.

P. Isolation and Characterization From E. coli, a urokinase-containing residue was isolated. The. Molecule was dissolved in £ 'M guanidine-HCl containing 50 mM Tris, pH 8.0. The solution was continued in guanidine-HCl, 50 mM Tris HCl, pH 9, at a protein concentration of V'ng / ml. The solution was then added to 2 mM reduced glutathione (GSH) and 0.2 mM oxidized glutathione (GSSG) and incubated overnight at room temperature. The solution thus obtained contains refolded solution. Protein and was then dialyzed in aqueous medium. The resulting solution contained urokinase, which showed an activity of 100 PU / m ^. '

'' ''

After one made according to conventional techniques

Purification, the protein was characterized by showing the N-terminal sequences expected for the low molecular weight bioactive material for both chains.

Λ s \ - '. ... '

C-terminal analysis still shows the correct sequence

'. -

; for both chains. The protein migrates at a molecular weight of about 300Q0 Daltons. It has a specific activity of about 170000 PU '/ mg 9225.000 IU / mg), assuming that: 1 mg / ml has an ODpRO ^of ^ »3.

- -

Q. Assays for Detecting Expression of Urokinase 1. Chromogenic substrates

a. theory

The assay is based on the proteolytic cleavage of a tripeptide from a chromophore group. The rate of cleavage can be directly related to the specificity and concentration of protease to be tested. Urokinase cleaves the chromogenic substrate S2444 (purchased from Kabi Group Inc., Greenwich, CT).

By monitoring the genesis of the chromophore, the amount of a functional urokinase present in a sample can be determined. Urokinase is synthesized as an inactive precursor form and activation occurs via cleavage between amino acid 26 (lysine) and 27 (isoleucine) (the numbering refers to the protease clone in Figure 2A). Some urokinase preparations were found to be autoactivated and / or activated by E. coli proteases. In order to ensure the activation of urokinase "which allows chromogen retrieval, it is necessary to treat the sample with small amounts of trypsin." Trypsin is a protease that cleaves the lysine-isoleucine bond, a cleavage , which is required for the activation of urokinase.

However, trypsin also cleaves the chromogenic substrate and must therefore be removed from the assay. One protein that inactivates trypsin but has no effect on urokinase is the soybean trypsin inhibitor (STI). The assay therefore consists of the urokinase trypsin activator, STI inhibition of trypsin, and finally addition of the chromogenic substrate to measure the functional urokinase present.

b. method

The assay is carried out as follows: 0.2 ml of 0.1 M Tris, pH 8.0, 50 μί of the sample to be determined and 5 μΐ trypsin (O, 1 mg 7 ml in 0.1 M Tris, pH 8.0 plus 0.25M CaCIp-) are placed in a test tube and the sample is incubated for 10 minutes at 37 ⁰ C. The trypsin is inactivated by adding 2 μΐ of a 10 mg / ml STI (in 0.1 M Tris, pH 8.0). The urokinase activity is determined by adding 50 μΐ a 1mM solution of S2444 (in water) and incubating the reaction at 37 ⁰ C for 10 minutes. The reaction is stopped by adding 50 μl of acetic acid, the solution is centrifuged to remove the precipitate, and the absorbance at 405 nm is determined. The actual amount of urokinase can be estimated by comparative reading with a sample prepared by making an assay of dilutions of a standard solution with known amount of urokinase (available from Calbiochem, San Diego, CA). , '.

2. Direct Assay of Piasmin Formation

a. Theory '. '

, A much more sensitive urokinase assay

can be obtained by observing the urokinase-catalyzed conversion of plaminogen to plasmin. For the enzyme plasmin, according to the same principle as described under point 1, there are ssays with chromogenic substrates. The basis for the assay is the determination of the amount of piasmin after the incubation of a urokinase entha.l-

³ ^ solution with a solution containing plasminogen. The larger the amount of urokinase, the greater the amount of plasmin formed. ,.

b. Procedure -;

An aliquot of the sample is mixed with 0.10 ml of a. 0.7 mgs / ml plasminogen solution (0.5M in. Tris'HCl, pH 7.4. Containing 0.012M NaCl) and the volume to east, 15 ml eingestellt.Die mixture is stirred at 37 ⁰ C at various times (As shown) incubated, there are added 0.35 ml of S2251 (1, OMM solution in the above buffer) and the reaction is continued for 5 minutes at 37 ⁰ C. Then acetic acid (25 μl) is added to stop the reaction and then the absorbance at 405 nm is measured.

The extent of activity can be determined by comparison with dilutions of a standard urokinase solution.

3- Indirect Assay of Plasmin Formation \

a. theory

A sensitive assay for urokinase activity has been developed (61). The assay is based on the determination of plasmin formation by measuring the extent of ilasmin digestion of fibrin on an agar plate containing fibrin and plasminogen. Plasmin creates a clear lysis zone on the fibrin plates. The extent of this lysis zone can be correlated to the amount of urokinase in the sample.

b. method

In accordance with the Granelli-

Piperno and Reich (61), the plates are incubated at 37 ° C for 1 to 3 hours and the lysis zones are measured. A quantification is obtained by performing an assay

° ^w with dilutions of a standard urokinase solution.

R. Find the urokinase activity

1. .Bacteria breeding and production of a

Urokinase sample 35

A strain of E. coil (W3110) is transformed using a plasmid (pUK33trpLE g) containing a urokinase fusion protein. This expression vector (short trpLE fusion) has been described above. The cells are grown overnight in minimal medium to an optical density at 550 nm of 1.2. Then an additional 200 ml of the medium are added. Continue. Indole-acrylic acid was added to a concentration of 10 yg / ml, a compound that appears to enhance the expression of tryptophan operon control genes. The cells are incubated for 2 hours and harvested. The cells obtained from 400 ml of the medium are suspended in water and then guanidine is added to a concentration of 7M (final volume 40 ml). The solution is incubated at room temperature for 90 minutes. Insoluble material is removed by centrifugation. The supernatant is added to 0.01 M Tris'HCl, pH 7.5,

, containing 0.1 M NaCl for 4 hours. Insoluble material is removed by centrifugation and the sample is again dialyzed against 0.01 M Tris'HCl, pH 7.5 for 2.5 hours.

The sample is placed on a 3.9 x 9 cm DE-52 column

buffered with 0.01 M Tris'HCl, pH 7.5, the column is washed with the same buffer and eluted with 0.01 M Tris'HCl, pH 7.5, containing 0.15 M NaCl ,

The peak of the activity is pooled and for all further 30

Investigations used. .

2. Find aer activity

12 shows the result of a direct activation of plasminogen by fractionated E. coli

Extracts, when under conditions, - similar to section Q.2. described above.

The result is an activity that depends on the presence of plasminogen. The activity to be observed is thus a plasminogen-dependent activity. The measured activity is still dependent on time, indicating a time-dependent, catalytic generation of the plasmid. These properties are consistent with those of urokinase, namely, catalytic activation of plasminogen. Extractions from E. coli performed under similar conditions but not containing the urokinase plasmid do not activate plasminogen under these conditions.

The extracts are also tested in the assays as described above to detect and quantify urokinase activity. Fig. 13 shows the effect of various amounts of bacterial fractions in the section Q.2. described assay after a 10-minute activation. The values obtained are compared with those obtained using a standard urokinase (Plough Unit) solution. The extent of plasminogen activation is directly proportional to the amount of cloned urokinase added.

It is known that antibodies raised against purified natural urokinase reduce the activity of natural urokinase. The effect of these antibodies when added to the assay at time 0 are also shown in FIG. 'It can be one

° ^ distinct inhibition of E. coli-derived material can be observed. This ensures that the activity observed in the E. coli-derived material has the same antigenic sites as the natural urokinase, and thus actually urokinase is microbially synthesized.

With regard to finding activity and inhibition by antibodies, similar results are observed when the fibrin plating assay described in section Q.3- is used. These results are shown in Table I.

Table I

FIBRIN PLATING ASSAY OF UROKINASE PROTEIN

sample

Activity. Activity in

('Plow Units / ml) Presence of

Urokinase bodies; (Plow Units / ml)

Percentage of inhibition

Urokinase standard 112 2 5 11 0 45 1.1 0 the here presented urokinase 1 J 480 224 1, 0 12

100

99 100

V) Standard curve obtained by adding a known amount of urokinase standard to the batches. Values for E. coli fractionation and antibody inhibition are obtained by extrapolating from these standard curves.

Standard urokinase activity is inhibited 96% or more by the addition of urokinase antibodies raised against this protein. The TAjSsay ^! The E.G'oli-derived extracts had significant urokinase activity. This activity was almost completely inhibited when natural urokinase antibodies were added to the assay. :

  , -49-

The third assay (chromogenic substrate assay) also found urokinase-like activity in E. coli extracts. Since this is the least sensitive assay, antibody inhibition studies could not be performed because large amounts of antibody are needed to inhibit it; know.

The quantitative determinations with the three assays mentioned above were carried out using a standard urokinase which can be obtained from Calbiochem. The values obtained (plough units per ml) were all of the same order: 500 for ¹ fibrin plating, 100 for plasminogen activation

and 350 for the chroiogenic substrate (S2444). The deviations that occur are undoubtedly due to the relative uncleanness of the material at the time of the investigations.

Pharmaceutical compositions

The compounds of the present invention may be formulated by known methods to produce pharmaceutically acceptable compositions.

wherein the urokinase product described herein is in admixture with a pharmaceutically-acceptable carrier. is joined together. Suitable carriers and their formulation are, for example, in Remington's Pharmaceutical

_on Sciences by EWMartin, herewith part 30

to be the revelation. These compositions contain an effective amount of the protein described herein together with a suitable amount of a carrier to produce a pharmaceutically acceptable composition suitable for effective use in the patient.

; A. Parenteral application

''. The human urokinase described herein may be used parenterally in subjects suffering from anth'romomboembolic diseases or anomalies.

Posing and dosage rates can be in the same way. ' "For example, as recently established for the use of clinical applications of other cardiovascular and thrombolytic agents, for example, about 4400 IU / kg of body weight as intravenous, initial dosage, followed by a continuous intravenous infusion of about 4400 IU / kg / hr for 12 hours in patients with pulmonary embolism.

/. · '^.

, As an example of a suitable dosage form for substantially homogeneous human urokinase in parenterally administrable form, a solution containing 250,000 urokinase activity, 25 mg mannitol and 45 mg sodium chloride can be prepared for injection

2Q contains 5ml of sterile water. For intravenous use, this solution is mixed with a suitable volume of 0.9% NaCl injection or 5% dextrose injection. · .....

The human urokinase protein described here is determined by a specific DNA gene and subsequent amino acid sequences. It is known that natural, allelic variations exist and occur in different individuals. -This variations can come through a oder.mehrere differences in the complete amino acid sequence expressed or ertionen by deletions, substitutions, Ins _t, inversions or by 'adding an odor more amino: acids in the overall sequence. In addition, the use of recombinant DNA technology

./ _r -51-. ,

possibility of producing further, different derivatives of human urokinase, which can be modified in various ways, namely; by single or multiple substitution of an amino acid, deletions, by addition or replacement, for example by means of site-specific mutagenesis of the underlying DNA. All such modifications and allelic variations that result in derivatives of human urokinase are included within the scope of this invention as long as the essential, characteristic activity of human urokinase remains intact.

Although particular embodiments have been described in the present invention, it should be understood that the invention is not limited thereto, rather the scope of protection is determined by the scope of the claims. ''.

  , '. ;

Claims (4)

AP C 12 N / 249 874/8 . ·. ' -, producing functional human Urokinase proteins (New) invention claims 1. Method for producing a protein. geke η η ζ e ic hne t.ddurch that it is from a Gene in a microorganism or cell culture. expressed for the enzymatic part of the. . ' human urokinase and expressed. Protein substantially free of other protein. , : of human origin is available. , ','; '.'; ''. ·.; .2. A method for producing a protein according to point g e k e η η ζ eic h η e t in that it of a S3 Ί; , ^: ·. Recombinant Wirt cell is produced. 3- A method for producing a protein according to item 1 and / or 2, g e k e -.η η ze i c h η e t thereby, 5- ·· ·. , , · that it is unaccompanied by associative native , Glycosylation is available. . 4., Method for producing a protein according to at least one of the points 1 to 3, g e k e η η ζ e i ch -  - · ' net by expressing a sequence of a polypeptide extending from the N-terminus of the usually first amino acids of said protein. ' 5. Method for producing a protein Item .1, characterized in that it is expressed in the form of a homogeneous polypeptide of full-length bioactive human urokinase. 6. A method for producing a protein after Item 1, characterize t by expressing it in the form of a bioactive human urokinase polypeptide in a homogeneous form. 25-. '. '' '', ·. '' ' HknvJO pages drawing