KR20220084802A - Cosmetic composition comprising Potentilla glabra extract as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for preventing or improving at least one selected from the group consisting of skin wrinkles, lowering of skin moisture content, and skin aging, which includes an extract of white mulberry flower as an active ingredient. Since it is non-toxic, it is expected to be widely used as a skin protectant against UV rays as well as skin problems such as skin wrinkles, moisture loss, and skin aging.

Description

Cosmetic composition comprising Potentilla glabra extract as an active ingredient}

The present invention relates to a composition for preventing or improving at least one selected from the group consisting of skin wrinkle, lowering of skin moisture content, and skin aging, comprising an extract of white mulberry flower as an active ingredient.

The skin protects internal organs from external environmental stimuli and plays an important role in maintaining body homeostasis, such as thermoregulation. As the skin ages, it is accompanied by external changes such as a decrease in skin elasticity, a change in skin color, and the formation of skin wrinkles. This skin aging process appears as a result of the complex action of intrinsic aging (or natural aging) that occurs naturally as we age, and photoaging in the surrounding environment, which is extrinsic aging, particularly ultraviolet (UV) light. Although there are differences in the mechanism of wrinkle generation between the two types of aging, in the skin, the proliferation or metabolism of epidermal cells is reduced, the bond between the epidermis and the dermis is weak, so it is easy to be damaged by even a small stimulus, and the decrease in collagen synthesis and excessive Physiological changes such as increased expression of MMPs (Matrix Metalloproteinases), which are collagen degrading enzymes, appear, and the skin becomes dry, and the skin loses elasticity and appears sagging due to structural changes in the epidermis and dermis, and wrinkles gradually deepen. Even if natural aging is inevitable in skin aging, effectively blocking photoaging caused by ultraviolet rays, an environmental factor, is a way to delay and suppress skin aging.

Recently, ozone layer depletion due to environmental pollution has increased the amount of UV rays, and accordingly, research on photoaging is attracting attention. Appearance features such as roughness, loss of elasticity, and wrinkles are observed in photoaging skin, and the main research area of photoaging is on changes in skin wrinkles. A number of research results have been reported on basic physiological metabolic changes such as synthesis, decomposition, and moisture content of collagen, which is a major component of the skin, in relation to skin wrinkle formation due to photoaging.

On the other hand, recently, as a number of cases in which side effects occur due to chemical components of cosmetics are known, consumers' interest in cosmetics manufactured by containing natural ingredients is increasing. Accordingly, many cosmetics using natural products have been developed to reduce skin irritation caused by various chemicals. Natural ingredients have fewer side effects on the skin, and as consumers' response to cosmetics using natural ingredients increases, the value of development as a cosmetic raw material is further increasing. However, little is known about whether or not the natural material white mulberry flower is effective in reducing skin moisture content and improving skin aging.

Korean Patent Registration No. 10-1961152

Accordingly, the present inventors confirmed that the white mulberry extract was effective in reducing skin moisture content and improving elasticity while not having cytotoxicity, and completed the present invention.

Accordingly, it is an object of the present invention to provide a composition for preventing or improving at least one selected from the group consisting of skin wrinkle, reduced skin moisture content, and skin aging, including extract of white mulberry flower as an active ingredient.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of inflammatory skin diseases, comprising an extract of white mulberry flower as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

In order to achieve the object of the present invention, the present invention provides a composition for preventing or improving at least one selected from the group consisting of skin wrinkle, lowering of skin moisture content, and skin aging, comprising an extract of white mulberry flower as an active ingredient. .

In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory skin disease, comprising the extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a cosmetic composition for the prevention or improvement of inflammatory skin diseases comprising the extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a food composition for the prevention or improvement of inflammatory skin disease, comprising the extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a cosmetic composition for protecting the skin against ultraviolet rays comprising an extract of white mulberry flower as an active ingredient.

In one embodiment of the present invention, the composition may be a pharmaceutical composition, a cosmetic composition, or a food composition, but is not limited thereto.

In another embodiment of the present invention, the extract is water, an alcohol having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, It may be an extract using one or more solvents selected from the group consisting of methylene chloride, hexane, cyclohexane, petroleum ether, subcritical fluid, and supercritical fluid, but is limited thereto it is not going to be

In another embodiment of the present invention, the extract of white mulberry flower may increase filaggrin expression or activity, but is not limited thereto.

In another embodiment of the present invention, the extract of white mulberry flower may increase the expression or activity of HAS-1 (Hyaluronan synthase 1) or HAS-2, but is not limited thereto.

In another embodiment of the present invention, the white mulberry flower extract may regenerate the skin, but is not limited thereto.

In another embodiment of the present invention, the inflammatory skin disease may be one or more selected from the group consisting of atopic dermatitis, systemic lupus erythematosus, contact dermatitis, allergic skin disease, acne, acne, and urticaria, but is not limited thereto. .

In another embodiment of the present invention, the composition may prevent or improve skin damage caused by ultraviolet rays, but is not limited thereto.

In another embodiment of the present invention, the skin damage disease caused by ultraviolet rays is skin redness (erythema), photosensitivity, sunburn, skin edema, sun inflammation, skin photoaging, skin wrinkles, decreased elasticity, decreased moisture in the skin, skin capillaries It may be one or more selected from the group consisting of vasodilation and skin cancer, but is not limited thereto.

In addition, the present invention provides a method for preventing or improving at least one selected from the group consisting of skin wrinkles, lowering of skin moisture content, and skin aging, comprising administering to an individual a composition comprising an extract of white mulberry flower as an active ingredient do.

In addition, the present invention provides a use for preventing or improving at least one selected from the group consisting of skin wrinkles, reduced skin moisture content, and skin aging of a composition comprising a white mulberry extract as an active ingredient.

In addition, the present invention provides a use for producing one or more preventive or ameliorating medicaments, cosmetics, or foods selected from the group consisting of skin wrinkles, skin moisture content reduction, and skin aging of the white mulberry flower extract.

In addition, the present invention provides a method for treating an inflammatory skin disease comprising administering to an individual a composition comprising an extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a use for the prevention and / or treatment of inflammatory skin diseases of the composition comprising the extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a use for producing a medicament used for inflammatory skin disease of the extract of white mulberry flower.

The present invention relates to a composition for preventing or improving skin wrinkles, lowering of skin moisture content, and skin aging, and the like, which contains an extract of white mulberry flower as an active ingredient. It is expected to be widely used as a skin protectant against UV rays as well as skin problems such as decreased skin moisture content, skin aging, and skin inflammation.

1 shows that the cytotoxicity of the ethanol extract (Pg-EE) of H. oleracea on HaCaT cells (Keratinocytes) is not significant at concentrations up to 50 μg/ml.
Figure 2 shows that when Pg-EE was treated in HaCaT cells (Keratinocytes), the expression level of Nitric Oxide was decreased in a concentration-dependent manner.
Figure 3 shows that when HaCaT cells (Keratinocytes) were treated with Pg-EE and irradiated with UVB, the protein expression level of COX-2, an inflammation-related gene, was decreased.
Figure 4 shows that when HaCaT cells (Keratinocytes) are treated with Pg-EE and irradiated with UVB, the expression level of the active protein of the AP-1 related genes (TAK1, MKK3/6, p38), which is an inflammation-related signal, is decreased. will be.
5 shows that when HaCaT cells (Keratinocytes) were treated with Pg-EE and irradiated with UVB, the expression level of the activated protein of AP-1 related genes (MEK 1/2, ERK 1/2), which is an inflammation-related signal, decreased. is shown.
6 shows that the expression level of the apoptosis regulatory protein is regulated when HaCaT cells (Keratinocytes) are treated with Pg-EE and irradiated with UVB.
FIG. 7 shows that when HaCaT cells (Keratinocytes) were treated with Pg-EE and irradiated with UVB, mRNA levels of FLG, known as a marker of differentiation of keratinocytes, and HAS-1 and HAS-2, which are moisture-related genes, increased were confirmed.
FIG. 8 confirms that the DPPH radical scavenging ability increases in a concentration-dependent manner with respect to Pg-EE.
9 confirms that the ABTS radical scavenging ability increases in a concentration-dependent manner with respect to Pg-EE.
10 shows a mechanism showing the anti-inflammatory, moisturizing, and apoptotic inhibitory effects through increased cell signal transduction by Pg-EE and induction at the transcription level when HaCaT cells are irradiated with UVB.
11 shows the results of confirming the cell growth rate by treating HaCaT cells (Keratinocytes) with ethanol extracts of other species of Potentilla such as Pg-EE, Potentilla viscosa Donn ex Lehm., Potentilla centigrana Maxim., and Potentilla ancistrifolia Bunge, respectively.
12 is a treatment with an ethanol extract of Potentilla viscosa Donn ex Lehm., Potentilla centigrana Maxim., Potentilla ancistrifolia Bunge, which is another species plant of the genus Potentilla, such as Pg-EE, which confirmed the fact that it does not have cytotoxicity to HaCaT cells (Keratinocytes) and UVB This shows the results of confirming the mRNA levels of FLG, known as a marker of differentiation of keratinocytes, and HAS-1, a moisturizing-related gene.

The present invention provides a composition for preventing or improving at least one selected from the group consisting of skin wrinkle, lowering of skin moisture content, and skin aging, comprising an extract of white mulberry flower as an active ingredient.

In addition, the present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory skin disease, comprising the extract of white mulberry flower as an active ingredient.

Hereinafter, the present invention will be described in detail.

Potentilla glabra var. mandshurica (Maxim.) of the present invention is a plant belonging to the genus Potentilla that inhabits high mountains such as Mt. Baekdu. White mulberry is a deciduous broad-leaved shrub plant that grows in high mountains such as Mt. Baekdu and is known to be easy to cultivate due to its strong nature. The flowers of the white water lily bloom in June-August in white, about 3cm in diameter, hanging on the tip of a new branch or 2-3 axillary. The calyx lobe is ovate triangular, with silk hair on the outside, yellow-green, and the minor flakes are linear or lanceolate, and they are apex. It is known to have vellus hairs (National Species Knowledge Information System).

The white water lily of the present invention may preferably be a white mulberry flower ( Potentilla glabra var. mandshurica (Maxim.) Hand.-Mazz.), but is not limited thereto.

Since the white mulberry flower of the present invention is mainly collected in China, it can be purchased and used in China, so it has the advantage of easy supply and demand.

The white mulberry flower of the present invention can be used as it is without damaging its original form, or after performing a pre-treatment process in consideration of the process speed and process (manufacturing) efficiency intended by those skilled in the art, the pre-treatment process includes, for example, Conventional screening, washing, cutting, powdering, drying, etc. steps may be performed.

The extract of white mulberry flower of the present invention may be obtained from the whole plant or a part of a plant, for example, it may be obtained from a site comprising one or more selected from the group consisting of stems, roots, leaves, fruits, and flowers.

The extract of white mulberry flower of the present invention may be extracted by a known natural extracting method. For example, extraction may be performed with one or more solvents selected from the group consisting of water, an organic solvent having 1 to 6 carbon atoms, and a subcritical or supercritical fluid. The organic solvent having 1 to 6 carbon atoms is alcohol, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, having 1 to 6 carbon atoms. chloride), hexane, cyclohexane, and petroleum ether may be at least one selected from the group consisting of, but is not limited thereto.

The extract of white mulberry flower of the present invention may be preferably extracted with ethanol, but is not limited thereto. As the extraction method, conventional extraction methods such as cold extraction, warm soaking, and heating using the above solvent can be used.

The ethanol is not limited in concentration, for example, 30 to 100%, 40 to 100%, 50 to 100%, 60 to 100%, 70 to 100%, 80 to 100%, 90 to 100% ethanol extract can

In the present invention, the white mulberry flower extract may increase the filaggrin expression or activity, but is not limited thereto.

In the present invention, the white water lily flower extract may increase the expression or activity of HAS-1 (Hyaluronan synthase 1) or HAS-2, but is not limited thereto.

In one embodiment of the present invention, as a result of verifying the activity of the extract, the extract has no cytotoxicity (see Example 3), has an excellent antioxidant effect (see Examples 4 and 7), and is an inflammation-related gene COX-2, TAK1, MKK3/6, p38, MEK1/2 and ERK1/2 and the like were decreased in a concentration-dependent manner (see Example 5), moisturizing-related genes HAS-1 (hyaluronan synthase-1), and HAS-2 to increase (see Example 6), and it was confirmed that the moisturizing effect was significantly superior to that of the same plant (see Comparative Example 1).

Therefore, the extract of white mulberry flower of the present invention is used as an active ingredient in a cosmetic, drug, quasi-drug, food or health functional food composition for preventing and improving one or more selected from the group consisting of skin wrinkles, lowering of skin moisture content, and skin aging. can

In the present invention, the 'skin anti-aging effect' refers to the effect of suppressing the roughness, loss of elasticity, the occurrence of wrinkles, etc. that occur naturally due to aging or photoaging caused by ultraviolet (UV) rays as people age.

In the present invention, the 'wrinkle improvement effect' refers to inhibiting or inhibiting the generation of wrinkles on the skin by inhibiting collagen degrading enzymes and promoting collagen production, or alleviating already generated wrinkles.

In the present invention, 'enhancement of elasticity' or 'improvement of lowering elasticity' refers to an increase in skin elasticity, inhibiting or inhibiting loss of skin elasticity by inhibiting collagen degrading enzymes and promoting collagen production, or already reduced elasticity means to alleviate

In the present invention, 'skin moisturizing' or 'improving skin moisture content reduction' refers to promoting the differentiation of keratinocytes to inhibit or inhibit the decrease in moisture in the skin or increase the moisture content of the skin to smooth the skin surface, It is said to give shine.

In the present invention, the inflammatory skin disease includes, but is not limited to, atopic dermatitis, systemic lupus erythematosus, contact dermatitis, allergic skin disease, acne, acne, and urticaria.

In the present invention, ultraviolet rays induce various skin damage such as photoaging, pigmentation and erythema of the skin by inducing the generation of reactive oxygen species, free radicals, and various intracellular signaling molecules that promote skin cell damage. When reactive oxygen species are excessively generated by ultraviolet rays, biopolymers such as proteins, nucleic acids, and fats in cells are damaged. In particular, reactive oxygen species that are excessively generated by ultraviolet rays are known to be the main cause of skin aging. In addition, the cosmetic composition according to the present invention can be used before or after exposure to ultraviolet rays. Preferably, the cosmetic composition according to the present invention can be used before exposure to ultraviolet rays to prevent skin cell damage caused by ultraviolet rays.

The present invention is characterized in that it has been found that the extract of white mulberry flower can protect the skin from UV rays by inhibiting the apoptosis of skin cells by inhibiting the generation of various types of skin damage-related mediators induced by UV rays. More specifically, it was confirmed that the present inventors have the activity of preventing skin damage caused by ultraviolet rays by inhibiting the apoptosis of skin cells by inhibiting the generation of reactive oxygen species and intracellular signaling molecules by ultraviolet rays. (See one embodiment of the present invention).

In the present invention, the composition for protecting the skin against ultraviolet rays may be used for preventing, improving or treating skin damage diseases caused by ultraviolet rays. The UV-induced skin damage disease is selected from the group consisting of erythema, photosensitivity, sunburn, skin edema, solar inflammation, skin photoaging, skin wrinkles, elasticity loss, moisture loss in the skin, skin capillary dilatation, and skin cancer. It may include more than one disease.

The content of the H. oleracea extract in the composition of the present invention can be appropriately adjusted depending on the symptoms of the disease, the degree of progression of the symptoms, the patient's condition, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50, based on the total weight of the composition. It may be a weight %, but is not limited thereto. The content ratio is a value based on the dry amount from which the solvent is removed.

The pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the preparation of pharmaceutical compositions. The excipient may be, for example, at least one selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a humectant, a film-coating material, and a controlled-release additive.

The pharmaceutical composition according to the present invention can be prepared according to a conventional method, respectively, in powders, granules, sustained-release granules, enteric granules, liquids, eye drops, elsilic, emulsions, suspensions, alcohols, troches, fragrances, and limonaade. , tablets, sustained release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusates, Warnings, lotions, pasta, sprays, inhalants, patches, sterile injection solutions, or external preparations such as aerosols can be formulated and used, and the external preparations are creams, gels, patches, sprays, ointments, warning agents , lotion, liniment, pasta, or cataplasma.

Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In the case of formulation, it is prepared using commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants.

Corn starch, potato starch, wheat starch, lactose, sucrose, glucose, fructose, di-mannitol, precipitated calcium carbonate, synthetic aluminum silicate, phosphoric acid as additives for tablets, powders, granules, capsules, pills, and troches according to the present invention Calcium monohydrogen, calcium sulfate, sodium chloride, sodium hydrogen carbonate, purified lanolin, microcrystalline cellulose, dextrin, sodium alginate, methyl cellulose, sodium carboxymethyl cellulose, kaolin, urea, colloidal silica gel, hydroxypropyl starch, hydroxypropyl methyl excipients such as cellulose, 1928, 2208, 2906, 2910, propylene glycol, casein, calcium lactate, and Primogel; Gelatin, gum arabic, ethanol, agar powder, cellulose acetate phthalate, carboxymethylcellulose, calcium carboxymethylcellulose, glucose, purified water, sodium caseinate, glycerin, stearic acid, sodium carboxymethylcellulose, sodium methylcellulose, methylcellulose, microcrystalline cellulose, dextrin , hydroxycellulose, hydroxypropyl starch, hydroxymethylcellulose, purified shellac, starch powder, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinyl alcohol, polyvinylpyrrolidone, etc. Hydroxypropyl methylcellulose, corn starch, agar powder, methylcellulose, bentonite, hydroxypropyl starch, sodium carboxymethylcellulose, sodium alginate, calcium carboxymethylcellulose, calcium citrate, sodium lauryl sulfate, silicic anhydride, 1-hydroxy Propyl cellulose, dextran, ion exchange resin, polyvinyl acetate, formaldehyde treated casein and gelatin, alginic acid, amylose, guar gum, sodium bicarbonate, polyvinylpyrrolidone, calcium phosphate, gelled starch, gum arabic, Disintegrants such as amylopectin, pectin, sodium polyphosphate, ethyl cellulose, sucrose, magnesium aluminum silicate, di-sorbitol solution, light anhydrous silicic acid; Calcium stearate, magnesium stearate, stearic acid, hydrogenated vegetable oil, talc, lycopodite, kaolin, petrolatum, sodium stearate, cacao butter, sodium salicylate, magnesium salicylate, polyethylene glycol 4000, 6000, liquid paraffin, hydrogenated soybean oil (Lubri) wax), aluminum stearate, zinc stearate, sodium lauryl sulfate, magnesium oxide, macrogol, synthetic aluminum silicate, silicic anhydride, higher fatty acid, higher alcohol, silicone oil, paraffin oil, polyethylene glycol fatty acid ether, starch, sodium chloride, A lubricant such as sodium acetate, sodium oleate, dl-leucine, light anhydrous silicic acid; may be used.

As additives for the liquid formulation according to the present invention, water, diluted hydrochloric acid, diluted sulfuric acid, sodium citrate, monostearate sucrose, polyoxyethylene sorbitol fatty acid esters (Twinester), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, etc. can be used.

In the syrup according to the present invention, a sucrose solution, other sugars or sweeteners may be used, and if necessary, a fragrance, colorant, preservative, stabilizer, suspending agent, emulsifying agent, thickening agent, etc. may be used.

Purified water may be used in the emulsion according to the present invention, and if necessary, an emulsifier, preservative, stabilizer, fragrance, etc. may be used.

Suspending agents such as acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC1828, HPMC2906, HPMC2910 may be used in the suspending agent according to the present invention. and, if necessary, surfactants, preservatives, stabilizers, colorants, and fragrances may be used.

The injection according to the present invention includes distilled water for injection, 0.9% sodium chloride injection solution, ring gel injection solution, dextrose injection solution, dextrose + sodium chloride injection solution, PEG (PEG), lactated ring gel injection solution, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; Solubilizing aids such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, tweens, nijeongtinamide, hexamine, and dimethylacetamide; Weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, buffers such as albumin, peptone, gum; isotonic agents such as sodium chloride; Stabilizers such as sodium bisulfite (NaHSO ₃ ) carbon dioxide gas, sodium metabisulfite (Na ₂ S ₂ O ₅ ), sodium sulfite (Na ₂ SO ₃ ), nitrogen gas (N ₂ ), ethylenediaminetetraacetic acid; sulphating agents such as sodium bisulfide 0.1%, sodium formaldehyde sulfoxylate, thiourea, disodium ethylenediaminetetraacetate, acetone sodium bisulfite; analgesic agents such as benzyl alcohol, chlorobutanol, procaine hydrochloride, glucose, and calcium gluconate; suspending agents such as SiMC sodium, sodium alginate, Tween 80, or aluminum monostearate.

The suppository according to the present invention includes cacao fat, lanolin, witepsol, polyethylene glycol, glycerogelatin, methyl cellulose, carboxymethyl cellulose, a mixture of stearic acid and oleic acid, Subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lanet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolene (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Butyrum Tego -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hydro Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium, A, AS, B, C, D, E, I, T, Massa-MF, Masupol, Masupol-15, Neosupostal-N, Paramound-B, Suposiro (OSI, OSIX, A, B, C, D, H, L), Suppository IV type (AB, B, A, BC, BBG, E, BGF, C, D, 299), supostal (N, Es), Wecobi (W, R, S, M, Fs), tester triglyceride base (TG-95, MA, 57) and The same mechanism may be used.

Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations include at least one excipient in the extract, for example, starch, calcium carbonate, sucrose ) or lactose, gelatin, etc. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used.

Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. have. Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspending agents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is determined by the type, severity, drug activity, and type of the patient's disease; Sensitivity to the drug, administration time, administration route and excretion rate, treatment period, factors including concurrent drugs and other factors well known in the medical field may be determined.

The pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or may be administered in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered singly or multiple times. In consideration of all of the above factors, it is important to administer an amount capable of obtaining the maximum effect with a minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention pertains.

The pharmaceutical composition of the present invention may be administered to an individual by various routes. All modes of administration can be contemplated, for example, oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, rectal insertion, vaginal It can be administered according to internal insertion, ocular administration, ear administration, nasal administration, inhalation, spraying through the mouth or nose, skin administration, transdermal administration, and the like.

The pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient along with several related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and the severity of the disease.

In the present invention, "individual" means a subject in need of treatment for a disease, and more specifically, human or non-human primates, mice, rats, dogs, cats, horses, cattle, etc. It may be a mammal of, but is not limited thereto.

In the present invention, "administration" means providing a given composition of the present invention to a subject by any suitable method.

In the present invention, "prevention" means any action that inhibits or delays the onset of a desired disease, and "treatment" means that the desired disease and metabolic abnormalities are improved or It means all actions that are advantageously changed, and "improvement" means all actions that reduce the parameters related to the desired disease, for example, the degree of symptoms by administration of the composition according to the present invention.

In addition, the present invention provides a food composition comprising an extract of white mulberry flower as an active ingredient.

In the present invention, food includes functional food and health functional food.

Preferably, the health functional food has the advantage of having a more excellent effect by ingesting it in the form of inner beauty food. The inner beauty is a food called 'eating cosmetics or beauty food'. You can choose and consume inner beauty foods that are suitable for each individual by considering your skin condition and lifestyle. More preferably, when mixing the cosmetics containing the cosmetic composition and the inner beauty food containing the extract of the present invention, compared to using only cosmetics or drugs, it is selected from the group consisting of skin wrinkles, reduced skin moisture content, and skin aging. The effect of preventing or improving one or more is significantly increased, which has the advantage of being able to see a more effective skin improvement effect.

In the case of using the extract of the present invention as a food additive, it may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixed amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). In general, in the production of food or beverage, the extract of white mulberry flower of the present invention may be added in an amount of 15% by weight or less, or 10% by weight or less based on the raw material. However, for health and hygiene purposes or health control In the case of long-term ingestion for the purpose of

There is no particular limitation on the type of the food. Examples of foods to which the above substances can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, There are alcoholic beverages and vitamin complexes, and includes all health functional foods in the ordinary sense.

The health beverage composition according to the present invention may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage. The above-mentioned natural carbohydrates are monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, polysaccharides such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol. As the sweetener, natural sweeteners such as taumartin and stevia extract, synthetic sweeteners such as saccharin and aspartame, and the like can be used. The proportion of the natural carbohydrate is generally about 0.01-0.20 g, or about 0.04-0.10 g per 100 mL of the composition of the present invention.

In addition to the above, the composition of the present invention includes various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, Carbonating agents used in carbonated beverages, etc. may be contained. In addition, the composition of the present invention may contain the pulp for the production of natural fruit juice, fruit juice beverage, and vegetable beverage. These components may be used independently or in combination. The proportion of these additives is not critical, but is generally selected in the range of 0.01-0.20 parts by weight per 100 parts by weight of the composition of the present invention.

In addition, the present invention provides a cosmetic composition comprising an extract of white mulberry flower as an active ingredient.

The formulation of the cosmetic composition according to the present invention includes skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, foundation, essence, nourishing essence, It may be in the form of a pack, soap, cleansing foam, cleansing lotion, cleansing cream, body lotion or body cleanser.

The cosmetic composition of the present invention may further include a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high molecular weight peptides, high molecular weight polysaccharides, and sphingolipids.

As the water-soluble vitamin, any one can be used as long as it can be formulated in cosmetics. Preferably, vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, etc. are mentioned. Also, their salts (thiamine hydrochloride, sodium ascorbate salt, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-phosphate magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods, such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method, or a chemical synthesis method.

The oil-soluble vitamin may be any as long as it can be formulated in cosmetics, but preferably includes vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), etc. , their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinic acid, vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, and an enzyme or chemical synthesis method.

The macromolecular peptide may be any type of peptide as long as it can be formulated in cosmetics. Preferably, collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin, and the like are mentioned. Polymeric peptides can be purified and obtained by conventional methods such as purification from a microbial culture solution, enzyme method or chemical synthesis method, or can be purified and used from natural products such as dermis of pigs or cattle, silk fiber of silkworms, etc.

The high molecular weight polysaccharide may be any compound as long as it can be formulated in cosmetics, but preferably hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate, or a salt thereof (such as sodium salt). For example, chondroitin sulfate or a salt thereof can be used after purification from mammals or fish.

The sphingolipid may be any as long as it can be formulated in cosmetics, and ceramide, phytosphingosine, sphingoglycolipid and the like are preferred. The sphingolipids can be purified by conventional methods from mammals, fish, shellfish, yeast or plants, or can be obtained by chemical synthesis.

In the cosmetic composition of the present invention, in addition to the above essential ingredients, other ingredients usually blended in cosmetics may be blended as needed.

Other ingredients that may be added include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, bactericides, antioxidants, plant extracts, pH adjusters, alcohols, colorants, fragrances, A blood circulation promoter, a cooling agent, a restrictive agent, purified water, etc. are mentioned.

Examples of the fat or oil component include ester fats and oils, hydrocarbon oils, silicone oils, fluorine oils, animal fats, and vegetable oils.

As ester-based fats and oils, tri2-ethylhexanoate glyceryl, 2-ethylhexanoate cetyl, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri(caprylic acid, capric acid) glyceryl, trimethylol propane tri-2-ethylhexanoate, trimethylol propane triisostearate, pentaelysitol tetra2-ethylhexanoate , cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristyl myristate, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinoleate, isostea laurate Lil, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isostearic acid isopropyl, 2-ethylhexanoate cetoster Aryl, 2-ethyl hexanoate stearyl, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicapric acid, di(caprylic acid, capric acid) propylene glycol, dicaprylic acid propylene glycol, dicapric acid Neopentyl glycol phosphate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecyl, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostearyl octanoate , octyl isononanoate, hexyldecyl neodecanoate, octyldodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, octyldecyl isostearate, polyglycerol oleate, polyglycerol isostearate, Triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyl triethyl citrate, acetyl tributyl citrate, trioctyl citrate, dimalate Isostearyl, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, dioctyl sebacate, Cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phytsteryl isostearate, phytsteryl oleate, 12-stealoyl Ester types, such as isocetyl hydroxy stearate, 12-stealoyl hydroxy stearyl stearate, and 12-stealoyl hydroxy stearate isostearyl, etc. are mentioned.

Examples of hydrocarbon-based fats and oils include hydrocarbon-based fats and oils such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybudene, microcrystalline wax, petrolatum.

Examples of silicone-based oils and fats include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane/methylcetyloxysiloxane copolymer, dimethylsiloxane/methylstealloxysiloxane copolymer, and alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.

Perfluoropolyether etc. are mentioned as fluorine-type fats and oils.

Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, saffron oil, soybean oil, corn oil, rapeseed oil, passerine oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , cottonseed oil, palm oil, kukui nut oil, wheat germ oil, rice germ oil, shea butter, moonflower colostrum, marker damian nut oil, meadow home oil, egg yolk oil, tallow oil, horse oil, mink oil, orange rapie oil, jojoba oil , animal or plant oils and fats such as candelabra wax, carnauba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizing agent include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.

As water-soluble low molecular weight moisturizers, serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n=2 or more), polyglycerol B (polymerization degree n=2 or more), lactic acid, lactic acid salt, etc. are mentioned.

Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low molecular weight humectant.

Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water-soluble chitin, chitosan, and dextrin. can

Examples of the fat-soluble polymer include polyvinylpyrrolidone/eicocene copolymer, polyvinylpyrrolidone/hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular weight silicone.

Examples of the emollient include long-chain acylglutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

Nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, etc. are mentioned as surfactant.

Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE/POP (polyoxyethylene/polyoxypropylene) copolymer, POE/POP alkyl ether, polyether-modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Examples of the anionic surfactant include fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkyl amide sulfate, alkyl phosphate, POE alkyl phosphate, and alkyl amide phosphate. , alkyloylalkyltaurine salts, N-acylamino acid salts, POE alkylethercarboxylate salts, alkylsulfosuccinate salts, alkylsulfoacetate sodium, acylated hydrolyzed collagen peptide salts, perfluoroalkylphosphate esters, and the like. .

Examples of the cationic surfactant include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, chloride Benzalkonium, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, quaternary ammonium salt of lanolin derivative, etc. are mentioned.

Examples of the amphoteric surfactant include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amidesulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amidamine type, etc. Amphoteric surfactant etc. are mentioned.

Examples of organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide. inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene/styrene copolymer, and organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these inorganic pigments and organic pigments.

Examples of the organic powder include metal soaps such as calcium stearate; alkyl phosphate metal salts such as sodium cetylate, zinc laurylate, and calcium laurylate; acylamino acid polyvalent metal salts such as calcium N-lauroyl-beta-alanine, zinc N-lauroyl-beta-alanine, and calcium N-lauroyl glycine; amidesulfonic acid polyvalent metal salts such as calcium N-lauroyl-taurine and calcium N-palmitoyl-taurine; N such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hydrogenated beef fatty acid acylarginine, etc. -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, a divinylbenzene-styrene copolymer, ethylene tetrafluoride, etc. are mentioned.

As UV absorbers, para-aminobenzoic acid, para-aminobenzoate ethyl, para-aminobenzoate amyl, para-aminobenzoate octyl, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylate, benzyl cinnamate , para-methoxycinnamic acid-2-ethoxyethyl, para-methoxycinnamic acid octyl, dipara-methoxycinnamic acid mono-2-ethylhexaneglyceryl, para-methoxycinnamic acid isopropyl, diisopropyl diisopropyl cinnamic acid ester mixture, uro Cannic acid, ethyl urokanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and salts thereof, dihydroxymethoxybenzophenone, sodium dihydroxymethoxybenzophenonedisulfonate, dihydroxybenzophenone , tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)-1 ,3,5-triazine, 2-(2-hydroxy-5-methylphenyl)benzotriazole, etc. are mentioned.

Examples of disinfectants include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinc phyllithione, benzalkonium chloride, photosensitizer. So, No. 301, mononitroguaial sodium, undecyrenic acid, etc. are mentioned.

Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and ellisorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fmalic acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like.

Examples of the alcohol include higher alcohols such as cetyl alcohol.

In addition, blending components that may be added other than this are not limited thereto, and any of the above components can be blended within a range that does not impair the object and effect of the present invention, but preferably 0.01-5% by weight relative to the total weight, More preferably, it is blended in 0.01-3% weight percentage.

When the formulation of the present invention is a lotion, paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide, etc. can be used

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component. In particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative or ethoxylated glycerol fatty acid ester and the like may be used.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experimental Preparation

Potentilla glabra var. mandshurica (Maxim.) Hand.-Mazz.) Ethanol extract (Pg-EE) (FBM108-016), Potentilla viscosa (FBM136-008), Potentilla centigrana (FBM234-037), Potentilla ancistrifolia (FBM237-055) was purchased from the Center for Overseas Biological Materials (www.ibmrc.re.kr, Daejeon, Korea), Korea Research Institute of Bioscience and Biotechnology.

Example 2. Cell culture method

Human keratinocyte cell HaCaT cells were cultured using DMEM (Dulbecco's modified Eagle's medium) culture medium containing 10% fetal bovine serum (FBS) and penicillin-streptomycin at 37°C, 5% carbon dioxide (CO ₂ ) condition. It was cultured at a density of 70-80% in 100 mm cell culture dishes in a cell culture medium.

Example 3. Confirmation of cell viability

To measure the toxicity of Pp-EE to cells in the steady state, HaCaT cells were plated at 3.5 × 10 ⁵ cells/ml in a 96-well plate, and Pg-EE (final concentration was 3.125 μg at 200 μg/ml). /ml by 1/2 dilution) extract was treated and cultured. Next, using the MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphinyltetrazolium bromide) assay, the cell viability of the extract-treated cells as described above was confirmed. Specifically, 10 μl MTT solution (stock concentration: 5 mg/ml) was added to the cultured cells after the extract treatment in the above, and an additional reaction was induced for 3 hours. 100 μl MTT stopping solution (10% Sodium dodecyl sulfate in 0.01M HCl) was additionally added to each well for completion of the reaction and dissolution of formazan crystals. Cell viability was calculated using the OD value obtained by measuring the absorbance at 570 nm in the amount of MTT reduced to promazan.

As shown in FIG. 1 , it was confirmed that Pg-EE did not have toxicity up to a concentration of 50 μg/ml.

Example 4. Confirmation of NO production amount

HaCaT cells, which are human keratinocyte cells, were adjusted to a concentration of 3.5 × 10 ⁵ cells/ml using DMEM medium containing penicillin (100 IU/ml) and streptomycin (100 μg/ml) and 10% FBS, 96 Inoculated in a well plate, and pre-incubated for 18 hours at 5% CO ₂ and 37 ℃. After removing the medium, 50 μl of the Pg-EE (half dilution from 200 μg/ml to 3.125 μg/ml final concentration) extract prepared at a 4-fold concentration was treated and 30 minutes later, Sodium Nitroprusside (SNP, final concentration 1.5) mM) and incubated. After 24 hours, 100 μl of the supernatant was transferred to another 96 well plate, and NO quantification was measured by measuring the absorbance at 540 nm using Griess solution (0.5% naphthylethylenediamine dihydrochloride, 5% sulfanylamide, 25% H ₃ PO ₄ ). carried out. A calibration curve was prepared using sodium nitrite (0 to 100 μM) as a standard material.

As shown in Figure 2, after treating the HaCaT cells with Sodium Nitroprusside (SNP), which is a nitric oxide (NO) donor used as an inflammatory index, Pg-EE was treated for each concentration, and then the concentration of the generated NO was measured. As a result of performing the NO assay to check, the amount of NO production was decreased in a concentration-dependent manner by Pg-EE.

Example 5. Confirmation of protein expression level using Western blot

5-1. Confirmation of protein expression level of inflammation-related genes

Keratinocyte cells, HaCaT, were pre-cultured in a 60 mm cell culture dish at a concentration of 3X10 ⁶ cells/ml using DMEM medium containing penicillin (100 IU/ml) and streptomycin (100 μg/ml) and 10% FBS. . After 18 hours, Pg-EE at a concentration of 12.5, 25, and 50 μg/ml was treated for 30 minutes, washed with PBS, and exposed to UVB of 30 mJ/cm ² . After that, the same concentration of Pg-EE was again treated for 8 hours. Thereafter, the cells were collected, a lysis buffer was added, and the cells were lysed to obtain a western sample. And the protein concentration of each sample was measured with BSA as a standard. Based on the value thus obtained, a Western blot assay was performed with each sample amount serving as the protein concentration. First, SDS-PAGE is performed and the protein is transferred to the PVDF membrane, then the membrane is blocked using 3% BSA solution, and the target protein antibody and signaling protein antibody (p-TAK1, TAK1, p-MKK3/6, MKK3, p-p38, p38, p-CREB, CREB, p-MEK1/2, MEK1/2, p-ERK1/2, ERK1/2, Bcl-2, Bax, Caspase 3, Cleaved Caspase 3, β-actin (Cell Signaling Technology)) solution, treated with a secondary antibody solution (anti-mouse IgG, HRP-linked Antibody or anti-rabbit IgG, HRP-linked Antibody (Cell Signaling Technology)) after washing, and washed again . Then, ECL solution (Amersham, England) was uniformly treated on the membrane in a dark room and photosensitized with an X-ray film.

As shown in FIG. 3 , it was confirmed that the protein expression level of the inflammation-related gene clooxygenase (Cyclooxygenase-2, COX-2) increased by UVB irradiation was decreased. The COX-2 (cyclooxygenase-2) is an enzyme expressed in large amounts by external stimuli such as ultraviolet rays in skin cells, and promotes cell damage by converting arachidonic acid in the cell membrane into prostaglandins. In particular, there are reports that COX-2 and prostaglandins are associated with skin damage such as skin aging and skin carcinogenesis.

In addition, as shown in FIG. 4, Transforming Growth Factor Beta-Activated Kinase 1 (TAK1), which is an AP-1 related gene, which is an inflammation-related signal increased by UVB, mitogen-activated protein kinase kinase ( It was confirmed that the expression level of the activated protein of mitogen activated protein kinase kinase, MKK3/6) and p38 mitogen activated protein kinase was decreased.

In addition, as shown in FIG. 5, MEK1/2 (MAPK/ERK kinase 1/2), an AP-1 related gene, which is an inflammation-related signal increased by UVB, and Extracellular Signal-Regulated Kinase 1 /2, it was confirmed that the expression level of the active protein of ERK1/2) decreased in a concentration-dependent manner on Pg-EE.

5-2. Confirmation of expression level of apoptosis regulation protein

As shown in FIG. 6, when HaCaT cells were irradiated with UVB of 30 mJ/cm ² and then treated with Pg-EE at different concentrations (12.5, 25, 50 μg/ml), the degree of apoptosis decreased. could confirm that When Pg-EE was treated, it was confirmed that the expression of the anti-natural cell death gene, Bcl-2, was increased in a concentration-dependent manner, and the expression of the pre-natural cell death gene, Bax, was decreased. In addition, it was confirmed that Pg-EE inhibits apoptosis when treated with HaCaT cells through a decrease in the expression level of activated cleaved caspase-3 of caspase-3, which activates apoptosis signal transduction.

Example 6. Confirmation of mRNA expression level of moisturizing factors using RT-PCR

HaCaT cells were aliquoted in a 6-well plate so that 5 × 10 ⁴ cells per well were cultured for 24 hours, and then treated with ethanol extract of H. Cells were cultured for 24 hours in a cell incubator at 37° C., 5% carbon dioxide (CO ₂ ) condition. After 24 hours, all of the cell culture medium was removed, the cells were decomposed using TRI-Zol, and neutralized using BCP. mRNA was precipitated in the neutralized liquid using isopropanol. Then, using a centrifuge, only the precipitated mRNA was collected and used for the experiment. Intracellular mRNA was synthesized into cDNA using a cDNA kit, and the expression levels of HAS-1 and HAS-2 genes, which are important genes for moisturizing, were confirmed through PCR.

As shown in FIG. 7 , it was confirmed that the white mulberry extract exhibits a moisturizing effect by up-regulating HAS-1 and HAS-2, which are genes important for moisturizing.

In addition, it was confirmed that the extract of white mulberry flower exhibits a moisturizing effect by up-regulating the expression of filaggrin (FLG), which is a moisturizing factor differentiation marker. Filaggrin acts as an adhesive that binds keratin to each other, and at the same time is involved in the binding of proteins constituting the keratinocyte membrane. Skin lipids play an important role as a barrier function, and may have various effects on the skin as a signal transmitter along with defense mechanisms such as antibacterial action.

The above results are results supporting the improvement of the skin barrier function and the moisturizing effect of the white mulberry extract.

primer order sequence(5'->3') SEQ ID NO: FLG Forward AGGGAAGATCCAAGAGCCC One Reverse ACTCTGGATCCCCTACGCTT 2 HAS-1 Forward CCACCCAGTACAGCGTCAAC 3 Reverse CATGGTGCTTCTGTCGCTCT 4 HAS-2 Forward TTCTTTATGTAGCTCATCTGTCTAACCGG 5 Reverse ATTGTTGGTTACCAGTTTATCCAAACG 6 GAPDH Forward GGTCACCAGGGCTGCTTTTTA 7 Reverse GATGGCATGGACTGTGGTCA 8

Example 7 Check the antioxidant effect

7-1. DPPH assay

After dissolving in methanol so that the concentration of DPPH becomes 250 mM, 495 μl of DPPH and 5 μl of Pg-EE (0-200 μg/ml) or ascorbic acid (50 μM) were mixed and incubated at 37° C. for 30 minutes. The DPPH scavenging ability was calculated from the O.D value obtained by measuring the absorbance at 517 nm.

As shown in FIG. 8 , as the DPPH scavenging ability was increased in a concentration-dependent manner on Pg-EE, it was confirmed that Pg-EE had an antioxidant effect on HaCaT cells. Specifically, the absorbance was measured using a spectrophotometer to determine how much DPPH radicals are removed after treating DPPH, which is in a stable free radical state, with Pg-EE (3.125~200 μg/ml) and ascorbic acid (50 μM), which is known as an antioxidant. was measured and it was confirmed that the DPPH scavenging ability increased in a concentration-dependent manner.

7-2. ABTS assay

7.4 mM ABTS and 2.4 mM potassium persulfate were mixed at a ratio of 1:1 and incubated at room temperature for about 18 hours. After 100 μl of ABTS solution was transferred to a 96 well plate, 100 μl of Pg-EE (0-200 μg/ml) or ascorbic acid (50 μM) was added. After incubation at 37 °C for 30 minutes, absorbance was measured at 730 nm.

As shown in FIG. 9 , even when the ABTS scavenging activity test was conducted, when Pg-EE (3.125-200 μg/ml) and ascorbic acid (50 μM) were treated, the radical scavenging activity increased as the concentration increased. It was confirmed that the .

Comparative Example 1. Comparison of effects with the same plant

Using ethanol extracts of Potentilla viscosa Donn ex Lehm., Potentilla centigrana Maxim., and Potentilla ancistrifolia Bunge, which are plants belonging to the genus Potentilla Ancistrifolia Bunge, a comparative experiment was conducted to confirm that the effect differs depending on the specific species, even if it is the same plant. .

1-1. Cytotoxicity check

According to the method of Example 3, the cytotoxicity of each plant extract was confirmed.

As shown in FIG. 11 , it was confirmed that all four plant extracts, including Pg-EE, did not have cytotoxicity. That is, based on the fact that the plant extracts do not have cytotoxicity to HaCat cells, the following experiment was performed.

1-2. Confirmation of expression of moisture-related genes

According to the method of Example 6, the effect on HAS-1 and FLG expression of each plant extract was confirmed.

As shown in FIG. 12 , when the ethanol extract of other Potentilla species, Potentilla viscosa Donn ex Lehm., Potentilla centigrana Maxim., and Potentilla ancistrifolia Bunge, was tested in the same manner as Pg-EE, Pg-EE cells were It was confirmed that the effect was insignificant compared to when treated in

Summarizing the above examples, the present inventors found that the extract of white mulberry flower has no cytotoxicity, has an excellent antioxidant effect, reduces inflammation factors and apoptosis increased by UV rays, and increases the expression level of moisturizing factors. was confirmed.

Therefore, it can be seen that the extract of white mulberry flower can be used as a composition for moisturizing and improving skin aging, in pharmaceuticals, health functional foods and cosmetics, and materials for their development.

The description of the present invention described above is for illustration, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified into other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive.

<110> Research & Business Foundation SUNGKYUNKWAN UNIVERSITY <120> Cosmetic composition comprising Potentilla glabra extract as an active ingredient <130> MP20-223 <160> 8 <170> KoPatentIn 3.0 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> FLG_F <400> 1 agggaagatc caagagccc 19 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> FLG_R <400> 2 actctggatc ccctacgctt 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-1_F <400> 3 ccacccagta cagcgtcaac 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> HAS-1_R <400> 4 catggtgctt ctgtcgctct 20 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HAS-2_F <400> 5 ttctttatgt agctcatctg tctaaccgg 29 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> HAS-2_R <400> 6 attgttggtt accagtttat ccaaacg 27 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_F <400> 7 ggtcaccagg gctgctttta 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> GAPDH_R <400> 8 gatggcatgg actgtggtca 20

Claims (15)

Contains white mulberry flower extract as an active ingredient,
A composition for preventing or improving at least one selected from the group consisting of skin wrinkles, reduced skin moisture content, and skin aging.
According to claim 1,
The composition is a cosmetic composition or a food composition, characterized in that the composition.
According to claim 1,
The extract is water, alcohol having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane (hexane), cyclohexane (cyclohexane), petroleum ether (petroleum ether), subcritical fluid, and a composition characterized in that the extract by one or more solvents selected from the group consisting of supercritical fluid.
According to claim 1,
The white mulberry flower extract is characterized in that to increase the filaggrin (Filaggrin) expression or activity, the composition.
According to claim 1,
The white mulberry flower extract is characterized in that it increases the expression or activity of HAS-1 (Hyaluronan synthase 1) or HAS-2, the composition.
According to claim 1,
The white mulberry flower extract is characterized in that it regenerates the skin, the composition.
A pharmaceutical composition for the prevention or treatment of inflammatory skin diseases, comprising an extract of white mulberry flower as an active ingredient.
8. The method of claim 7,
The inflammatory skin disease is atopic dermatitis, systemic lupus erythematosus, contact dermatitis, allergic skin disease, acne, acne, and a pharmaceutical composition, characterized in that at least one selected from the group consisting of acne and urticaria.
8. The method of claim 7,
The extract is water, alcohol having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane (hexane), cyclohexane (cyclohexane), petroleum ether (petroleum ether), subcritical fluid, and a pharmaceutical composition characterized in that the extract by one or more solvents selected from the group consisting of supercritical fluid.
A cosmetic composition for protecting the skin against UV rays comprising an extract of white mulberry flower as an active ingredient.
11. The method of claim 10,
The extract is water, alcohol having 1 to 6 carbon atoms, acetone, ether, benzene, chloroform, ethyl acetate, methylene chloride, hexane (hexane), cyclohexane (cyclohexane), petroleum ether (petroleum ether), subcritical fluid, and a cosmetic composition, characterized in that the extract by one or more solvents selected from the group consisting of supercritical fluid.
11. The method of claim 10,
The composition is a cosmetic composition, characterized in that preventing or improving skin damage caused by ultraviolet rays.
13. The method of claim 12,
The UV-induced skin damage disease is selected from the group consisting of skin redness (erythema), photosensitivity, sunburn, skin edema, sun inflammation, skin photoaging, skin wrinkles, reduced elasticity, decreased moisture in the skin, skin capillary dilatation, and skin cancer. A cosmetic composition, characterized in that at least one.
A cosmetic composition for the prevention or improvement of inflammatory skin diseases, comprising an extract of white mulberry flower as an active ingredient.
A food composition for the prevention or improvement of inflammatory skin diseases, comprising an extract of white mulberry flower as an active ingredient.

Images