KR20210123548A - Improvement composition for Hot flash comprising the extract of Salvia miltiorrhiza as an active ingredient - Google Patents

Abstract

The present invention relates to a composition for mitigating hot flash including an extract of Salvia miltiorrhiza Bunge roots as an active ingredient. According to the present invention, the extract of Salvia miltiorrhiza Bunge roots suppresses melanin increased by PGE2 induction, inhibits VEGF, MMP-2, and MMP-9 which increase angiogenesis, and inhibits activity of MMP-2 and MMP-9 which decompose collagen and elastin, which are components between skin cells surrounding blood vessels. Accordingly, due to the extract of Salvia miltiorrhiza Bunge roots, formation of new blood vessels in the skin is reduced and tissue destruction due to infiltration of inflammatory cells and the like is prevented, and the composition can be used as a composition for mitigating hot flush.

Description

Composition for improving hot flash comprising the extract of Salvia miltiorrhiza as an active ingredient}

The present invention includes Salvia (Salvia miltiorrhiza) extract as an active ingredient in skin inflammation, wake up the immune response that can improve the blood vessel expansion caused by nerve and vascular irritation of the skin facial flushing (Hot flash) happen to the composition.

Due to the aging of the modern society, the perception of health maintenance methods has changed from disease treatment-centered to disease prevention, and the industrial scope is expanding to anti-aging-related markets such as appearance and mental health prevention/management. Although the characteristics are different depending on the region, the demand for health functional food customized for women is increasing worldwide due to anti-aging and the improvement of women's status. We have very little penetration into the growth potential market.

Facial flushing refers to redness of the skin due to a sudden feeling of heat on the face, neck, and upper body repeatedly, and at this time, sweating, chest palpitations, and unpleasant feelings may appear together. The skin is divided into the epidermis, dermis, and fat layer. Hot flushes refer to abnormally enlarged blood vessels in the dermis that do not contract again and remain in a dilated state. It also means that blood vessels are stimulated to cause vasodilation. In addition, it may be caused by damage to the skin barrier function that blocks external harmful substances or antigens.

On the other hand, it is characterized by a decrease in the level of estrogen, a female hormone, due to a decline in ovarian function during menopause. In particular, hot flashes are the most frequent and chronic symptoms of menopause and are known to be experienced by more than 75% of women after menopause. It is a major cause of reduced quality of life, accompanied by excessive sweating. Hot flushes is a typical symptom of vasomotor disorder in menopause. Redness of the skin appears due to hyperemia of epidermal capillaries, skin blood flow increases, and skin moisture decreases as the skin temperature rises. Stress and estrogen deficiency are known as the causes of hot flashes, but the mechanism has not been clearly elucidated.

On the other hand, Salvia miltiorrhiza (丹蔘; Salvia miltiorrhiza BUNGE; SM) is in the medicines widely used from of one shot from a perennial dicotyledonous plant currency neck belonging to the Lamiaceae (Labiatae) origin is China. Dan ginseng removed the beard root and dried in the sun for medicinal purposes. It is harvested from early November to early March of the following year. The ingredients contained in the root of dandelion ginseng include cryptotanshinone, Danshensu, isotanshinone I, isotanshinone Ⅱ, tanshinone I. , Salvianolic acid B, tanshinone ⅡA, tanshinone IB, dihydrotanshinone, methyl tanshinonate, methylene tansiquinone (methylene) tanshinquinone), beta-sitosterol (betasitosterol), hydroxytanshinone, neotanshinone A B C, salviol, isocryptotanshinone, miltyrone ( miltirone), tanshinol I, tanshinol II, and vitamin E (vitamin E) have been reported. In addition, ginseng has been reported to have ischemic damage protection, coronary artery relaxation action, atherosclerosis inhibition, antihypertension, antihyperlipidemia, antidiabetic, antibacterial, antioxidant, anticancer, antimutagenic, and antithrombotic effects. Although research on various uses of ginseng extract using these functions is in progress, there is no research on improvement of hot flushes yet.

Therefore, in order to increase the usefulness of ginseng, the present inventors have continuously repeated studies on ginseng, and as a result, ginseng extract inhibits increased melanin due to PGE2 induction, and VEGF, MMP-2 and MMP that increase angiogenesis By inhibiting -9, it was confirmed that the activity of MMP-2 and MMP-9, which decomposes collagen and elastin, which are components between skin cells surrounding blood vessels, was inhibited. Therefore, it may be used as a composition for improving hot flushes by reducing the formation of any more new blood vessels in the skin by the ginseng extract and preventing tissue destruction due to infiltration of inflammatory cells.

It is an object of the present invention to provide a food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

In addition, it is an object of the present invention to provide a health functional food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

In addition, it is another object of the present invention to provide a cosmetic composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

Various problems to be solved in the present invention in the above are not limited thereto, but can be clearly understood by those of ordinary skill in the art to which the present invention pertains through the examples and claims to be described later. will be.

In order to solve the above problems, the present invention provides a food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

In one embodiment of the present invention, the "extract" is an alcohol having 1 to 4 carbon atoms, including purified water, methanol, ethanol, propanol, isopropanol, butanol, etc. , acetone, ether (ether), benzene (benzene), chloroform (chloroform), ethyl acetate (ethyl acetate), methylene chloride (methylene chloride), hexane (hexane) and cyclohexane (cyclohexane) any one or more solvents may be used, but is not limited thereto.

In one embodiment of the present invention, the "solvent" may be ethanol at a concentration of 60 to 80 wt%, but is not limited thereto.

In an embodiment of the present invention, the "extract" may be characterized in that it is extracted at 80 to 90 ℃ for 5 to 6 hours, filtered and concentrated under reduced pressure, but is not limited thereto.

In an embodiment of the present invention, the "extract" may be characterized in that the extraction process is repeated 2 to 5 times at 80 to 90 ℃ for 5 to 6 hours, but is not limited thereto.

In one embodiment of the present invention, the "composition" may be characterized by inhibiting the increased melanin by PGE2 induction, but is not limited thereto.

In one embodiment of the present invention, the "composition" may be characterized in that it inhibits the activity of VEGF, MMP-2 or MMP-9, but is not limited thereto.

In addition, the present invention provides a health functional food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

In addition, the present invention provides a cosmetic composition for preventing and improving hot flashes, comprising a ginseng extract as an active ingredient.

The present invention relates to a composition for preventing and improving hot flashes comprising a ginseng extract, which has an effect of inhibiting increased melanin due to PGE2 induction, and VEGF, MMP-2 and By inhibiting MMP-9, it has the effect of inhibiting the activity of MMP-2 and MMP-9, which decompose collagen and elastin, which are components between skin cells surrounding the blood vessels. Therefore, it may be used as a composition for improving hot flushes by reducing the formation of any more new blood vessels in the skin by the ginseng extract and preventing tissue destruction due to infiltration of inflammatory cells.

1 is a diagram showing an inhibitory effect on the expression of VEGF by PGE2 treatment using skin cells and confirming the increase in the expression of VEGF.
FIG. 2 is a diagram showing an inhibitory effect on the expression of MMP-2 by the PGE2 treatment using skin cells, and the expression of MMP-2 by the ginseng extract.
3 is a diagram showing the inhibitory effect on the expression of MMP-9 by the PGE2 treatment using skin cells, and confirming the increase in the expression of MMP-9 by the ginseng extract.
Figure 4 is a diagram showing the concentration-dependent inhibitory effect of melanogenesis (melanogenesis) in skin cells with PGE2, the melanin content by SME (Ginseng extract).

Hereinafter, with reference to the accompanying drawings, the present invention will be described in detail by way of embodiments of the present invention. However, the following examples are presented as examples of the present invention, and when it is determined that detailed descriptions of well-known techniques or configurations known to those skilled in the art may unnecessarily obscure the gist of the present invention, the detailed description may be omitted. , the present invention is not limited thereby. Various modifications and applications of the present invention are possible within the scope of equivalents interpreted therefrom and the description of the claims to be described later.

In addition, the terms (terminology) used in this specification are terms used to properly express the preferred embodiment of the present invention, which may vary depending on the intention of the user or operator or customs in the field to which the present invention belongs. Accordingly, definitions of these terms should be made based on the content throughout this specification. Throughout the specification, when a part "includes" a certain component, it means that other components may be further included, rather than excluding other components, unless otherwise stated.

Throughout this specification, '%' used to indicate the concentration of a specific substance is (w/w) % for solid/solid, (w/v) % for solid/liquid, and Liquid/liquid is (v/v) %.

All technical terms used in the present invention, unless otherwise defined, have the meaning as commonly understood by one of ordinary skill in the art of the present invention. In addition, although preferred methods and samples are described herein, similar or equivalent ones are also included in the scope of the present invention. The contents of all publications herein incorporated by reference are incorporated herein by reference.

In one aspect, an object of the present invention is to provide a method of extracting a dandelion extract from a food composition for preventing and improving hot flashes, comprising the danseng extract as an active ingredient.

The extract according to the present invention may be obtained by extraction and separation from nature using extraction and separation methods known in the art, and "extract" as defined in the present invention is extracted from dandelion using an appropriate solvent, For example, crude extracts, polar solvent-soluble extracts, or non-polar solvent-soluble extracts are included. As a suitable solvent for extracting the extract from dandelion ginseng, any pharmaceutically acceptable organic solvent may be used, and water or an organic solvent may be used, but is not limited thereto, for example, purified water, methanol ( methanol), ethanol, propanol, isopropanol, alcohols having 1 to 4 carbon atoms, including butanol, acetone, ether, benzene, chloroform ( Various solvents such as chloroform), ethyl acetate, methylene chloride, hexane and cyclohexane may be used alone or in combination. As the extraction method, any one of methods such as hot water extraction method, cold extraction method, reflux cooling extraction method, solvent extraction method, steam distillation method, ultrasonic extraction method, elution method, compression method, etc. can be selected and used. In addition, the desired extract may be further subjected to a conventional fractionation process, and may be purified using a conventional purification method.

There is no limitation on the method for preparing the extract of the present invention, and any known method may be used. For example, the extract included in the composition of the present invention may be prepared in a powder state by an additional process such as distillation under reduced pressure and freeze-drying or spray-drying the primary extract extracted by the hot water extraction or solvent extraction method described above. In addition, the first extract was further purified using various chromatography methods such as silica gel column chromatography, thin layer chromatography, and high performance liquid chromatography. you may get Therefore, in the present invention, the extract is a concept including all extracts, isolated compounds, fractions and purified substances obtained in each step of extraction, fractionation or purification, and dilutions, concentrates or dried products thereof.

In addition, the ginseng extract as defined in the present invention includes both a water-soluble component and a fat-soluble component, and preferably contains a fat-soluble component.

The ginseng extract is a solvent selected from lower alcohols having 1 to 4 carbon atoms, such as water, methanol, ethanol, butanol, or a mixed solvent thereof, preferably a mixed solvent of water and ethanol, more preferably 50 to 100% ethanol. It may be a ginseng extract, and the dandelion extract may be a dandelion extract obtained by a conventional extraction method.

Specifically, the dandelion extract contains about 1 to 1000 times the weight of dried ginseng, preferably about 10 to 100 times the volume (w/v%) of purified water containing purified water, methanol, ethanol, butanol, isopropanol, butanol, etc. carbon number In a solvent selected from the lower alcohols of 1 to 4 or a mixture thereof, for 1 to 24 hours, preferably 2 to 12 hours, at 10 to 100°C, preferably 30 to 80°C, cold extraction, hot water extraction, The first step of obtaining a crude extract through an extraction method such as ultrasonic extraction, reflux cooling extraction, or heating extraction method, preferably by reflux cooling extraction method, followed by filtration and concentration and drying under reduced pressure: 1 to 10 of the weight of the crude extract a second step of adding water, preferably 3 to 6 times the volume, and suspending it to obtain a water-insoluble residue by filtration; A solvent selected from water including purified water in the residue, lower alcohols having 1 to 4 carbon atoms, such as methanol, ethanol, butanol, or mixed solvents thereof, preferably 20 to 95% of alcohol as a mixed solvent of water and ethanol, more preferably A third step of obtaining a filtrate through stirring, dissolution and filtration by adding 50 to 95%, more preferably 70% ethanol; It is possible to obtain a dandelion extract, characterized in that it comprises the step of removing the residual solvent of the filtrate.

The danseng extract obtained by the above extraction process may be further subjected to processes such as concentration and drying, and in the process of drying, the danseng extract may be obtained in the form of a powdery dried product by freeze-drying. In the case of applying the freeze-drying method in the drying process, there is an advantage in that the loss of volatile organic substances in the ginseng extract can be reduced.

In one aspect, an object of the present invention is to provide a food composition or a health functional food composition for preventing and improving hot flashes, comprising a ginseng extract as an active ingredient.

When using the ginseng extract of the present invention as a health functional food composition, the ginseng extract may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The composition may include a food additive in addition to the active ingredient, and the mixing amount of the active ingredient may be suitably determined according to the purpose of use (prevention, health or therapeutic treatment).

The term "food supplement additive" used in the present invention refers to a component that can be added to food as an auxiliary, and is added to the manufacture of health functional food of each formulation, and those skilled in the art can appropriately select and use it. Examples of food supplement additives include various nutrients, vitamins, minerals (electrolytes), synthetic flavoring agents and flavoring agents such as natural flavoring agents, coloring agents and fillers, pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners , pH adjuster, stabilizer, preservative, glycerin, alcohol, carbonation agent used in carbonated beverages, etc., but the above examples are not limited to the type of food supplement additive of the present invention.

The food composition of the present invention may include a health functional food. The term "health functional food" as used in the present invention refers to food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc. using raw materials or ingredients useful in the human body. Here, the term 'functionality' refers to obtaining useful effects for health purposes, such as regulating nutrients or physiological effects on the structure and function of the human body. The health functional food of the present invention can be prepared by a method commonly used in the ordinary technical field, and at the time of the preparation, it can be prepared by adding raw materials and components commonly added in the conventional technical field. In addition, if the formulation of the health functional food is also recognized as a health functional food, it can be prepared without limitation. The composition for food of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage that there are no side effects that may occur during long-term administration of the drug using food as a raw material, and has excellent portability, and the present invention health functional food can be taken as a supplement to enhance the anti-inflammatory effect.

In addition, there is no limitation on the type of health food in which the composition of the present invention can be used. In addition, the composition comprising the ginseng extract of the present invention as an active ingredient can be prepared by mixing known additives with other suitable auxiliary ingredients that may be contained in health functional foods according to the selection of those skilled in the art. Examples of foods that can be added include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gums, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages and There are vitamin complexes and the like, and it can be prepared by adding the extract according to the present invention as a main component to juice, tea, jelly, juice, and the like.

Salvia miltiorrhiza BUNGE (SM) of the ginseng extract of the present invention is a medicinal herb widely used since ancient times in oriental medicine. When used as a food composition, side effects may be less than that of a general synthetic compound, so it can be safely included in pharmaceutical compositions and health functional food compositions to be usefully used.

Finally, an object of the present invention is to provide a cosmetic composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

The composition comprising the ginseng extract of the present invention can be used in various ways, such as for preventing and improving hot flushes. Products to which the present composition can be added include, for example, cosmetics such as various creams, lotions, skins, essences, and the like, shampoos, conditioners, cleansing agents, face washes, soaps, treatments, packs, and cosmetic liquids.

The cosmetic of the present invention includes a composition selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts.

The water-soluble vitamin may be any as long as it can be formulated in cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine hydrochloride, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, etc. and their salts (thiamine hydrochloride, sodium ascorbate salt, etc.) and derivatives (ascorbic acid-2-phosphate sodium salt, ascorbic acid-2-phosphate magnesium salt, etc.) are also included in the water-soluble vitamins that can be used in the present invention. Included. Water-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, an enzymatic method or a chemical synthesis method.

The oil-soluble vitamins may be any as long as they can be formulated in cosmetics, but preferably include vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol). , their derivatives (ascorbine palmitate, ascorbine stearate, ascorbine dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherol nicotinic acid, vitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as a microbial transformation method, a purification method from a microbial culture, an enzyme or a chemical synthesis method, and the like.

The macromolecular peptide may be any compound as long as it can be formulated in cosmetics, and preferred examples include collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, and keratin. Polymeric peptides can be purified and obtained by conventional methods such as purification from a microbial culture solution, enzyme method or chemical synthesis method, or can be purified and used from natural products such as dermis of pigs or cattle, silk fibers of silkworms, etc.

The high molecular weight polysaccharide may be any compound as long as it can be formulated in cosmetics, but preferably hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate, or a salt thereof (such as sodium salt). For example, chondroitin sulfate or a salt thereof can be used after purification from mammals or fish.

The sphingolipids may be any as long as they can be formulated in cosmetics, and ceramides, phytosphingosine, sphingoglycolipids and the like are preferred. The sphingolipid can be purified by a conventional method from mammals, fish, shellfish, yeast or plants, or can be obtained by chemical synthesis.

The seaweed extract may be any type as long as it can be formulated in cosmetics, but preferably brown algae extract, red algae extract, green algae extract, etc. Potassium alginate and the like are also included in the seaweed extract used in the present invention. The seaweed extract can be obtained by purification from seaweed by a conventional method.

In the cosmetic of the present invention, in addition to the above essential ingredients, if necessary, other ingredients usually blended in cosmetics may be blended. Other ingredients that may be added include oils and fats, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, UV absorbers, preservatives, disinfectants, antioxidants, plant extracts, pH adjusters, alcohols, pigments, fragrances, A blood circulation promoter, a cooling agent, an anti-inflammatory agent, purified water, etc. are mentioned. Examples of the fat and oil component include ester fats and oils, hydrocarbon oils and fats, silicone oils and fats, fluorine oils and fats, animal oils and fats, and vegetable oils and fats.

As ester-based fats and oils, glyceryl 2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl myristate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl myristate, isostearyl myristate, isostearyl palmitate, octyldodecyl myristate, isocetyl isostearate, diethyl sebacate, adipine Diisopropyl acid, isoalkyl neopentanoate, tri (caprylic acid, capric acid) glyceryl, trimethylol propane tri-2-ethylhexanoate, trimethylol propane triisostearate, tetra 2-ethylhexanoate pentaellithritol , cetyl caprylate, decyl laurate, hexyl laurate, decyl myristate, myristyl myristate, cetyl myristate, stearyl stearate, decyl oleate, cetyl ricinoleate, isostea laurate Lil, isotridecyl myristate, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecyl oleate, octyldodecyl oleate, octyldodecyl linoleate, isostearate isopropyl, 2-ethylhexanoate cetoster Aryl, stearyl 2-ethylhexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicapric acid, di(caprylic acid, capric acid) propylene glycol, dicaprylic acid propylene glycol, dicaprylate Neopentyl glycol phosphate, neopentyl glycol dioctanoate, glyceryl tricaprylate, glyceryl triundecyl, glyceryl triisopalmitate, glyceryl triisostearate, octyldodecyl neopentanoate, isostea octanoate Reel, octyl isononanoate, hexyldecyl neodecanoate, octyldodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, octyldecyl isostearate, polyglycerol oleate ester, polyglycerol isostearate ester , triisocetyl citrate, triisoalkyl citrate, triisooctyl citrate, lauryl lactate, myristyl lactate, cetyl lactate, octyldecyl lactate, triethyl citrate, acetyl triethyl citrate, acetyl tributyl citrate, trioctyl citrate, mal Diisostearyl acid, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipate, diisopropyl sebacate, sebacic acid dioctyl, cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, phytsteryl isostearate, phytsteryl oleate, 12 -ester types, such as stealoylhydroxy stearate isocetyl, 12-stealoyl hydroxy stearate stearyl, 12-stealoyl hydroxy stearate isostearyl, etc. are mentioned.

Examples of hydrocarbon-based oils and fats include hydrocarbon-based oils and fats such as squalene, liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, liquid isoparaffin, polybudene, microcrystalline wax and petrolatum.

Examples of silicone oils and fats include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane and methylcetyloxysiloxane copolymer, dimethylsiloxane and methylstealloxysiloxane copolymer, alkyl Modified silicone oil, amino modified silicone oil, etc. are mentioned.

Perfluoropolyether etc. are mentioned as fluorine-type fats and oils.

Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, saffron oil, soybean oil, corn oil, rapeseed oil, passerine oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil , cottonseed oil, palm oil, kukui nut oil, wheat germ oil, rice germ oil, shea butter, cranberry colostrum, marcadeumia nut oil, meadow home oil, egg yolk oil, tallow oil, horse oil, mink oil, orange rapie oil, jojoba oil , animal or plant oils and fats, such as candelabra wax, carnauba wax, liquid lanolin, and hydrogenated castor oil.

Examples of the moisturizing agent include a water-soluble low-molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.

As water-soluble low molecular weight moisturizers, serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (degree of polymerization n = 2 or more), polyglycerol B (degree of polymerization n = 2 or more), lactic acid, lactic acid salt, etc. are mentioned.

Cholesterol, cholesterol ester, etc. are mentioned as a fat-soluble low molecular weight humectant.

Examples of the water-soluble polymer include carboxyvinyl polymer, polyaspartate, tragacanth, xanthan gum, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylcellulose, carboxymethylcellulose, water-soluble chitin, chitosan, and dextrin. can

Examples of the fat-soluble polymer include polyvinylpyrrolidone and eicosene copolymer, polyvinylpyrrolidone and hexadecene copolymer, nitrocellulose, dextrin fatty acid ester, and high molecular weight silicone. Examples of the emollient include long-chain acylglutamic acid cholesteryl ester, hydroxystearic acid cholesteryl, 12-hydroxystearic acid, stearic acid, rosin acid, and lanolin fatty acid cholesteryl ester.

Nonionic surfactants, anionic surfactants, cationic surfactants, amphoteric surfactants, etc. are mentioned as surfactant.

Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid ester, glycerin fatty acid ester, polyglycerol fatty acid ester, sorbitan fatty acid ester, POE (polyoxyethylene) sorbitan fatty acid ester, POE sorbitan fatty acid ester, POE Glycerin fatty acid ester, POE alkyl ether, POE fatty acid ester, POE hydrogenated castor oil, POE castor oil, POE and POP (polyoxyethylene and polyoxypropylene) copolymer, POE and POP alkyl ether, polyether-modified silicone, lauric acid alkanolamides, alkylamine oxides, hydrogenated soybean phospholipids, and the like.

Examples of the anionic surfactant include fatty acid soap, alpha-acyl sulfonate, alkyl sulfonate, alkyl allyl sulfonate, alkyl naphthalene sulfonate, alkyl sulfate, POE alkyl ether sulfate, alkyl amide sulfate, alkyl phosphate, POE alkyl phosphate, alkyl amide. Phosphate, alkyloylalkyl taurine salt, N-acylamino acid salt, POE alkyl ether carboxylate, alkylsulfosuccinate, alkylsulfoacetate sodium, acylated hydrolyzed collagen peptide salt, perfluoroalkyl phosphate ester, etc. have.

Examples of the cationic surfactant include alkyltrimethylammonium chloride, stearyltrimethylammonium chloride, stearyltrimethylammonium bromide, cetostearyltrimethylammonium chloride, distearyldimethylammonium chloride, stearyldimethylbenzylammonium chloride, behenyltrimethylammonium bromide, chloride Benzalkonium, diethylaminoethylamide stearate, dimethylaminopropylamide stearate, quaternary ammonium salt of lanolin derivative, etc. are mentioned. Examples of the amphoteric surfactant include carboxybetaine type, amidebetaine type, sulfobetaine type, hydroxysulfobetaine type, amide sulfobetaine type, phosphobetaine type, aminocarboxylate type, imidazoline derivative type, amidamine type, etc. Amphoteric surfactant etc. are mentioned.

Examples of organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium-coated mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide. inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine, and complexes thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluororesin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene and styrene copolymer; and organic pigments such as silk powder, cellulose, CI pigment yellow and CI pigment orange, and composite pigments of these inorganic pigments and organic pigments.

Examples of the organic powder include metal soaps such as calcium stearate; alkyl phosphate metal salts such as sodium cetylate, zinc laurylate, and calcium laurylate; acylamino acid polyvalent metal salts such as calcium N-lauroyl-beta-alanine, zinc N-lauroyl-beta-alanine, and calcium N-lauroyl glycine; amidesulfonic acid polyvalent metal salts such as calcium N-lauroyl-taurine and calcium N-palmitoyl-taurine; N such as N-epsilon-lauroyl-L-lysine, N-epsilon-palmitoylizine, N-alpha-paritoylolnithine, N-alpha-lauroylarginine, N-alpha-hydrogenated beef fatty acid acylarginine, etc. -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glycyl glycine; alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene and a styrene copolymer, ethylene tetrafluoride, etc. are mentioned.

As UV absorbers, para-aminobenzoic acid, para-aminobenzoate ethyl, para-aminobenzoate amyl, para-aminobenzoate octyl, salicylate ethylene glycol, salicylate phenyl, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylate, benzyl cinnamate , para-methoxycinnamic acid-2-ethoxyethyl, para-methoxycinnamic acid octyl, dipara-methoxycinnamic acid mono-2-ethylhexaneglyceryl, para-methoxycinnamic acid isopropyl, diisopropyl and diisopropyl cinnamic acid ester mixture, Urocanic acid, ethyl urocanate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and its salts, dihydroxymethoxybenzophenone, dihydroxymethoxybenzophenonedisulfonate sodium, dihydroxybenzo Phenone, tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p-(carbo-2'-ethylhexyl-1'-oxy)- 1,3,5-triazine, 2-(2-hydroxy-5-methylphenyl) benzotriazole, etc. are mentioned.

Examples of disinfectants include hinokitiol, triclosan, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, zinc phyllithione, benzalkonium chloride, photosensitizer. So, No. 301, mononitroguaial sodium, undecyrenic acid, etc. are mentioned.

Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and ellisorbic acid.

Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fmalic acid, sodium fumarate, succinic acid, sodium succinate, sodium hydroxide, sodium monohydrogen phosphate, and the like.

Examples of the alcohol include higher alcohols such as cetyl alcohol.

In addition, the compounding component which may be added other than this is not limited to this, Moreover, any said component can be mix|blended within the range which does not impair the objective and effect of this invention.

The cosmetic of the present invention may take the form of a solution, an emulsion, a viscous mixture, or the like.

Components included in the cosmetic composition of the present invention may include components commonly used in cosmetic compositions as active ingredients, for example, conventional adjuvants and carriers such as stabilizers, solubilizers, vitamins, pigments and fragrances. include

The cosmetic composition for skin whitening and anti-aging of the skin of the present invention may be prepared in any formulation conventionally prepared in the art, for example, emulsion, cream, lotion, pack, foundation, lotion, serum, hair cosmetic, etc. can

Specifically, the cosmetic composition of the present invention is a skin lotion, skin softener, skin toner, milk lotion, astringent, lotion, moisture lotion, nourishing lotion, massage cream, nourishing cream, moisture cream, hand cream, foundation, essence, nourishing essence, Includes formulations of packs, soaps, cleansing foams, cleansing lotions, cleansing creams, hair lotions, hair tonics, hair essences, hair shampoos, hair conditioners, hair treatments, body lotions and body cleanser.

When the formulation of the present invention is a paste, cream or gel, animal fiber, vegetable fiber, wax, paraffin, starch, tracanth, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as a carrier component. can

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used as a carrier component, and in particular, in the case of a spray, additional chlorofluorohydrocarbon, propane /may contain propellants such as butane or dimethyl ether.

When the formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butylglycol oil, glycerol fatty esters, fatty acid esters of polyethylene glycol or sorbitan.

When the formulation of the present invention is a suspension, as a carrier component, water, a liquid diluent such as ethanol or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, microcrystalline Cellulose, aluminum metahydroxide, bentonite, agar or tracanth may be used.

When the formulation of the present invention is a surfactant-containing cleansing agent, aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide as carrier components Ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative or ethoxylated glycerol fatty acid ester may be used.

The present invention will be described in more detail through the following examples. However, the following examples are only for specifying the contents of the present invention, and the present invention is not limited thereto.

<Example 1> Preparation of ginseng extract

1.1 Preparation of hot water extract of dandelion ginseng

Distilled water 25 times the weight of dandelion ginseng was added to dry dandelion, heated at 100° C. for 6 hours, hot water extraction was performed to obtain an extract, and the obtained extract was filtered and concentrated to dryness at 50° C. An extract was obtained.

1.2 Preparation of ginseng alcohol extract

70% alcohol of 10 times the weight of dandelion ginseng by volume (w/v%) was added to dry dandelion ginseng, and primary extraction was performed at 80° C. for 5 hours at 1.5 atm or less, followed by filtration. The obtained extract was concentrated at 65° C. or lower using a reduced pressure concentrator to obtain an aloe vera extract.

1.3 Preparation of dandelion extract (essential oil by distillation method)

Ginseng was put into the distillation tank of the essential oil extraction device, and the boiler of the steam generator was operated to generate steam. Then, the steam was passed through a distillation tank containing ginseng. At this time, the temperature in the distillation tank was 110° C. and carried out at atmospheric pressure. While passing through the distillation tank, water vapor mixed with essential oil components was condensed through a cooling device to obtain a pale yellow dandelion distillation extract using an oil-water separator.

<Example 2> Redness improvement effect of ginseng extract

2.1 VEGF Expression Inhibitory Effect

Normal human dermal fibroblast (NHDF) cells were used for the cell line used in the experiment to investigate the capillary production and migration promoting effect of ginseng extract, and the cell culture medium was FGM-2 Fibroblast growth medium-2 bullet kit (LONZA, cc-3132) was used for culture. Specifically, 1) NHDF cells 1 x 10 ⁴ cells/ml were dispensed in a 24-well cell culture pate, and cultured in a _{37° C. CO 2 incubator for 72 hours after cell dispensing.} 2) After 72 hours, the medium was replaced, and capillary dilatation was induced by treatment with 30 nM PGE2, which was treated with 100 μg/ml ginseng extract (SME) and cultured for 72 hours. 3) After 72 hours, cells were harvested, RNA extraction and cDNA synthesis were performed, 4) qRT-PCR (forward primer used for PCR is AGGAGGAGGGCAGAATCATCA, reverse primer is CTCGATTGGATGGCAGTAGCT) indicated.

According to the above method, in order to investigate the effect of promoting the formation and movement of capillaries of ginseng extract, the experiment was conducted after inducing facial flushing and vasodilation by PGE2, which is an inflammatory substance that expands capillaries, and, accordingly, the generation of capillaries. , when the expression of VEGF, which promotes migration, is excessive, it can be seen that angiogenesis increases. As shown in FIG. 1, the experimental results confirmed that the expression of VEGF was increased by PGE2 treatment using skin cells, and it was confirmed that the expression of VEGF was suppressed by the ginseng extract.

2.2 MMP-2 and MMP-9 Expression Inhibitory Effect

Based on the research results that MMP-2 and MMP-9 gene expression affects the expression of VEGF, as previously known, the expression of VEGF was also regulated by the suppression of MMP-2 and MMP-9 expression by the ginseng extract. As it can be judged that it is, the following experiment was performed.

The cell line used for the experiment was normal human dermal fibroblast (NHDF) cells, and the cell culture medium was cultured using FGM-2 Fibroblast growth medium-2 bullet kit (LONZA, cc-3132). Specifically, 1) NHDF cells 1 x 10 ⁴ cells/ml were dispensed in a 24-well cell culture pate, and cultured in a _{37° C. CO 2 incubator for 72 hours after cell dispensing.} 2) After 72 hours, the medium was replaced, and capillary dilatation was induced by treatment with 30 nM PGE2, which was treated with 100 μg/ml ginseng extract (SME) and cultured for 72 hours. 3) After 72 hours, cells were harvested, RNA extraction and cDNA synthesis were performed, and 4) MMP-2 and MMP-9 gene expression was measured by qRT-PCR (primers used for PCR are as shown in Table 1 below). 2 and 3 are shown.

gene name Forward Reverse MMP-2 AGATCTTCTTCTTCAAGGACCGGTT GGCTCCTCAGTGGCTTGGGGTA MMP-9 TGAATCAGCTGGCTTTTGTG ACCTTCCAGTAGGGGCAACT

According to the above method, in order to examine the effect of promoting the formation and movement of capillaries of the ginseng extract, the experiment was conducted after inducing facial flushing and vasodilation by PGE2, an inflammatory substance that expands capillaries, and, accordingly, the generation of capillaries. , when the expression of VEGF, which promotes migration, is excessive, it can be seen that angiogenesis increases. In other words, in order to check whether the increased hot flashes caused by the increase in new blood vessels and vascular permeability according to the increase in new blood vessels can be improved, the expression of MMP-2 and MMP-9 in skin cells after PGE2 induction and ginseng extracts are treated. was measured. As shown in Fig. 2 (MMP-2) and Fig. 3 (MMP-9), it was confirmed that the expression of MMP-2 and MMP-9 was increased by the PGE2 treatment using skin cells. It was confirmed that the expression of MMP-2 and MMP-9 was suppressed.

<Example 3> Melanin inhibitory effect of ginseng extract

In addition, the following experiments were carried out to confirm whether the melanin content was increased by PGE2 induction in skin cells and to confirm the melanin inhibitory effect of the ginseng extract because the skin turns dark red as the hot flashes become chronic.

1) NHDF (normal human dermal fibroblast) cells 1 x 10 ⁴ cells/ml were dispensed into a 24-well cell culture pate, and serum free growth medium was used as the medium, and cultured in a _{37°C CO 2 incubator for 72 hours after cell dispensing.} did. 2) After 72 hours, the medium was replaced, and melanogenesis was induced by treatment with 30 nM PGE2, which was then treated with ginseng extract at different concentrations (25 μg/ml, 50 μg/ml, 100 μg/ml) and cultured for 72 hours. 3) After 72 hours, the medium was removed, the cells were dissolved by treatment with 1N NaOH, and the melanin content was measured at 405 nm using an ELISA LEADER, as shown in FIG. 4 . Through this, as shown in FIG. 4, it was confirmed that the increased melanin content by PGE2 induction was inhibited by the ginseng extract.

According to the above examples, the ginseng extract of the present invention inhibits increased melanin by PGE2 induction, inhibits VEGF, MMP-2 and MMP-9 that increase angiogenesis, and between skin cells surrounding blood vessels. It is characterized in that it inhibits the activities of MMP-2 and MMP-9, which decompose the constituent substances, collagen and elastin. Therefore, the present invention was completed by confirming that the ginseng extract can be used as a composition for improving facial flushing by reducing the formation of further new blood vessels in the skin and preventing tissue destruction due to infiltration of inflammatory cells, etc. This means that ginseng extract can prevent and improve hot flushes. Therefore, the ginseng extract may be used as a composition for preventing and improving hot flushes.

As described above, although specific embodiments of the present invention have been described in detail, those skilled in the art who understand the spirit of the present invention may add, change, delete, etc. other components within the scope of the same spirit, and other degenerate inventions However, other embodiments included within the scope of the present invention may be easily proposed. Therefore, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. The scope of the present invention is indicated by the following claims rather than the above detailed description, and all changes or modifications derived from the meaning and scope of the claims and their equivalents are included in the scope of the present invention. should be interpreted as

Claims (9)

A food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient. According to claim 1,
The extract is purified water, methanol (methanol), ethanol (ethanol), propanol (propanol), isopropanol (isopropanol), alcohol having 1 to 4 carbon atoms including butanol (butanol), acetone (acetone), ether (ether), Benzene (benzene), chloroform (chloroform), ethyl acetate (ethyl acetate), methylene chloride (methylene chloride), hexane (hexane) and cyclohexane (cyclohexane) to extract using any one or more solvent, hot flush prevention and food compositions for improvement. 3. The method of claim 2,
The solvent is ethanol at a concentration of 60 to 80% by weight, a food composition for preventing and improving hot flashes. According to claim 1,
The extract is extracted at 80 to 90 ℃ for 5 to 6 hours, filtered and concentrated under reduced pressure, a food composition for preventing and improving hot flushes. 5. The method of claim 4,
The extract is a food composition for preventing and improving hot flushes, characterized in that the extraction is repeated 2 to 5 times at 80 to 90° C. for 5 to 6 hours. According to claim 1,
The composition is to inhibit the increased melanin by PGE2 induction, hot flush prevention and food composition for improvement. According to claim 1,
The composition inhibits the activity of VEGF, MMP-2 or MMP-9, a food composition for preventing and improving hot flashes. A health functional food composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient. A cosmetic composition for preventing and improving hot flushes, comprising a ginseng extract as an active ingredient.

Images