KR20190101090A - Cosmetic composition for preventing thermal skin aging comprising kudzu root extract - Google Patents

Cosmetic composition for preventing thermal skin aging comprising kudzu root extract Download PDF

Info

Publication number
KR20190101090A
KR20190101090A KR1020180021030A KR20180021030A KR20190101090A KR 20190101090 A KR20190101090 A KR 20190101090A KR 1020180021030 A KR1020180021030 A KR 1020180021030A KR 20180021030 A KR20180021030 A KR 20180021030A KR 20190101090 A KR20190101090 A KR 20190101090A
Authority
KR
South Korea
Prior art keywords
extract
lotion
acid
weight
aging
Prior art date
Application number
KR1020180021030A
Other languages
Korean (ko)
Other versions
KR102019592B1 (en
Inventor
박창욱
손성오
김초록
최재원
최광열
Original Assignee
비거트유산균 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 비거트유산균 주식회사 filed Critical 비거트유산균 주식회사
Priority to KR1020180021030A priority Critical patent/KR102019592B1/en
Publication of KR20190101090A publication Critical patent/KR20190101090A/en
Application granted granted Critical
Publication of KR102019592B1 publication Critical patent/KR102019592B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q17/00Barrier preparations; Preparations brought into direct contact with the skin for affording protection against external influences, e.g. sunlight, X-rays or other harmful rays, corrosive materials, bacteria or insect stings
    • A61Q17/04Topical preparations for affording protection against sunlight or other radiation; Topical sun tanning preparations
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Dermatology (AREA)
  • Botany (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Engineering & Computer Science (AREA)
  • Cosmetics (AREA)

Abstract

The present invention relates to a cosmetic composition for preventing thermal skin aging comprising a kudzu root extract. The kudzu root extract activates a heat shock protein to inhibit a thermal skin aging process caused by infrared irradiation, and thus can be easily used as a cosmetic composition excellent in collagen synthesis promotion and wrinkle reduction efficacy.

Description

칡 추출물을 함유하는 열노화 방지용 화장료 조성물 {COSMETIC COMPOSITION FOR PREVENTING THERMAL SKIN AGING COMPRISING KUDZU ROOT EXTRACT}열 Cosmetic composition for preventing heat aging containing extract {COSMETIC COMPOSITION FOR PREVENTING THERMAL SKIN AGING COMPRISING KUDZU ROOT EXTRACT}

본 발명은 칡 추출물을 함유하는 열노화 방지용 화장료 조성물에 관한 것이다. The present invention relates to a cosmetic composition for preventing heat aging containing 칡 extract.

피부 노화는 크게 내인성 노화(Intrinsic aging)와 광노화(Photoaging)의 과정으로 나눌 수 있다. 광노화를 일으키는 주요인자는 태양광선의 자외선으로, 이에 대해서는 이미 많은 연구가 이루어 졌으며, 관련 제품들도 다양한 형태로 판매되고 있다. 그러나 피부노화를 일으키는 외부인자들 중에서, 열노화(Thermal aging)는 아직은 생소한 개념이다. 열노화란, 외부의 높은 온도로 인해 피부 온도가 상승하여 진행되는 수분 감소와 탄력저하, 주름 생성 등의 노화 현상을 말한다. 사람의 피부 온도는 평균 31~32℃에서 유지되고 있는데, 피부 온도가 그 이상으로 올라가게 되면 피부 염증 반응이 나타나면서 열노화가 시작된다. 흥미롭게도 이러한 열노화 과정은 자외선에 의한 광노화와 유사한 증상을 보인다. 대표적으로 일광탄력섬유증(Solar Elastosis)은 자외선에 의해 광노화된 피부의 대표적인 현상으로 알려졌으나, 적외선에 의해서도 같은 증상이 나타나는 것으로 밝혀졌다. 따라서 기존에 보고되었던 광노화의 증상 중 많은 부분은, 열노화에 기인한 것이라는 보고가 이어지고 있다. 이와 같은 연구결과를 토대로 최근에는 광노화와 열노화를 합친 "Solar Aging" 의 개념이 생겨났다. Skin aging can be roughly divided into the processes of intrinsic aging and photoaging. The main factor causing photoaging is the ultraviolet rays of sunlight, and much research has been done on this, and related products are also sold in various forms. However, among the external factors that cause skin aging, thermal aging is an unfamiliar concept. Thermal aging refers to aging phenomena such as moisture reduction, elasticity reduction, and wrinkle formation, which are caused by an increase in skin temperature due to an external high temperature. Human skin temperature is maintained at an average of 31 ~ 32 ℃, when the temperature rises above the skin inflammatory reactions and heat aging begins. Interestingly, this thermal aging process is similar to photoaging caused by ultraviolet light. Solar Elastosis is known to be a typical phenomenon of skin photoaging due to ultraviolet rays, but the same symptom is also revealed by infrared rays. As a result, many of the previously reported symptoms of photoaging are reported to be due to thermal aging. Based on these findings, the concept of "Solar Aging" that combines photo aging and thermal aging has emerged in recent years.

열노화 메커니즘에 따르면, 열에 의한 피부 온도 상승이 피부의 콜라겐 섬유를 분해하는 MMP 생성을 촉진하여 피부 탄력 저하, 모공 확장, 울긋불긋한 피부 등의 노화반응을 일으킨다. 하지만, 현재 시중에 판매되고 있는 열노화 대응 화장료 제형의 제품들은 주로 피부 온도를 낮춰주기 위한 기능성 소재를 사용하는 제품들이 대부분이다. 그 중 가장 대표적인 것이 알로에 성분 함유 제품인데, 이는 알로에 성분이 피부에 수분을 공급하고 유지시켜 열에 대한 완충작용을 하기 때문이다. 이는 근본적인 해결책이 아님에도 불구하고 항노화 화장품에 대한 수요가 증가하면서 여름철이면 꾸준한 인기를 나타내고 있다. 하지만, 열노화란 피부 온도 상승 자체가 원인이라기보다는, 피부 온도 상승에 의한 세포 스트레스와 손상이 근본 원인이다. 그러므로 일시적인 피부 온도 하강을 통해서는, 열노화의 근본적인 원인을 제거할 수가 없다. 뿐만 아니라, 순간적인 쿨링에 의한 피부 온도의 급격한 변화는 오히려 민감성 피부에 더 큰 자극과 손상을 초래할 수 있다. 열노화는 메커니즘 상 자외선에 의한 노화와 구분되는 특징을 가지고 있다. 그리고 열노화 메커니즘의 핵심에 있는 MMP 작용을 조절하는 것은 근본적인 열노화 방지 해법이라 할 수 있다. 현재는 열노화에 대한 일반인들의 인지 부족으로 인해 열노화의 개념이 쉽게 이해되지 못하고 있는 실정이다. 열노화가 자외선에 의한 노화와 구별된다는 개념인식이 보편화되고 MMP 작용을 막는 근본적인 열노화 대응 화장료가 개발된다면, 이들의 수요는 여름철에만 국한되지 않고 사계절 내내 유지될 것으로 전망된다. According to the heat aging mechanism, the increase in skin temperature caused by heat promotes the production of MMPs that break down the collagen fibers of the skin, causing aging reactions such as decreased skin elasticity, pore expansion, and bloated skin. However, most of the heat-aging cosmetic formulations currently on the market mainly use functional materials to lower the skin temperature. The most representative of them is aloe containing products, because the aloe ingredient moisturizes and maintains the skin to buffer against heat. Although this is not a fundamental solution, the demand for anti-aging cosmetics is increasing, showing a steady popularity in summer. However, heat aging is not caused by skin temperature rise itself, but is caused by cellular stress and damage caused by skin temperature rise. Therefore, temporary skin temperature drops cannot eliminate the root cause of thermal aging. In addition, sudden changes in skin temperature due to instantaneous cooling may result in greater irritation and damage to sensitive skin. Thermal aging is distinguished from the aging caused by ultraviolet rays due to its mechanism. And regulating MMP action at the core of the heat aging mechanism is a fundamental solution to preventing heat aging. Currently, the concept of thermal aging is not easily understood due to the lack of public awareness of thermal aging. If the concept that thermal aging is distinguished from aging by ultraviolet light is developed and fundamental thermal aging cosmetics to prevent MMP action are developed, their demand is expected to be maintained throughout the four seasons.

생약으로 이용되는 칡은 한국, 중국, 일본 모두 콩과의 덩굴식물 칡(Pueraria montana var. lobata: Pueraria lobata 로도 표기)의 뿌리를 말하며, 갈근이라고도 한다. 칡의 주요 화학성분은 이소플라본의 일종인 Daidzin, Glycitin, Genistin, Daidzein, Puerarin 등으로 알려져 있고(Hirayama K et al. 2011, Reppert A et al. 2008, Yamaki K et al. 2002.), 다양한 생리학적 효과가 있다고 보고된 바 있다. 칡은 맛이 달면서도 매운 맛이 나며, 근육을 풀어주면서 열을 내리는 기전으로 감기, 고열, 두통, 근육통, 뒷목의 뻣뻣함 등을 치료한다. 양기를 끌어 올리고 설사를 멈추게 할 때도 쓰인다. 또한 체내의 진액을 보충해주고 갈증을 멎게 하며, 술독을 풀 때도 사용한다. 그 외에 이질, 고혈압, 심장관련 질환, 당뇨, 암 등에 칡을 활용하고 있다.Is used as a herbal medicine and refers to the root of the legume vine (Pueraria montana var. Lobata: Pueraria lobata). The main chemical composition of the larvae is known as Daidzin, Glycitin, Genistin, Daidzein, Puerarin, etc. (Hirayama K et al. 2011, Reppert A et al. 2008, Yamaki K et al. 2002.). It has been reported to have a scientific effect. Tastes sweet and spicy, and the mechanism to lower the heat while releasing the muscles to treat colds, high fever, headache, muscle pain, stiffness in the back neck. It is also used to lift up the energy and stop diarrhea. It also replenishes the body's essences, quenches thirst, and is used to soothe alcohol. In addition, dysentery, high blood pressure, heart-related diseases, diabetes, cancer, etc. are utilized.

이에 본 발명자들은 칡 추출물이 갖는 다양한 생리활성을 연구하던 중, 상기 칡 추출물 및 이로부터 분리 정제된 화합물이 열충격 단백질을 활성화하여 적외선 조사시에 피부세포의 증식, 콜라겐 합성 등을 촉진하는 효과가 있어 상기 칡 추출물이 열노화 방지용 화장료 조성물로서 이용될 수 있음을 확인하여 본 발명을 완성할 수 있었다. The present inventors while studying the various physiological activity of the extract 칡, the extract 및 and the compound purified therefrom has the effect of activating the thermal shock protein to promote the proliferation of skin cells, collagen synthesis, etc. during infrared irradiation By confirming that the 칡 extract can be used as a cosmetic composition for preventing heat aging could be completed the present invention.

대한민국 등록특허 제10-1752147호 (발명의 명칭 : 갈근 추출물을 유효성분으로 함유하는 피부 광노화 예방 또는 치료용 조성물, 출원인 : 계명대학교 산학협력단, 등록일 : 2017년06월22일)Republic of Korea Patent Registration No. 10-1752147 (Invention: Composition for preventing or treating skin photoaging containing the root extract as an active ingredient, Applicant: Keimyung University Industry-Academic Cooperation Foundation, Registered Date: June 22, 2017) 대한민국 등록특허 제10-1661802호 (발명의 명칭 : 갈근탕 부산물의 에탄올 추출물을 함유하는 항산화, 항균, 미백 및 주름개선 기능성 화장료 조성물, 출원인 : 조효제, 등록일 : 2016년09월26일)Republic of Korea Patent No. 10-1661802 (Invention: Antioxidant, antibacterial, whitening and anti-wrinkle functional cosmetic composition containing ethanol extract of Galguntang by-product, Applicant: hyoje, registered date: September 26, 2016) 대한민국 공개특허 제10-2015-0024502호 (발명의 명칭 : 피부 주름 예방 및 개선용 화장료 조성물, 출원인 : 경희대학교 산학협력단, 공개일 : 2015년03월09일)Republic of Korea Patent Publication No. 10-2015-0024502 (Invention name: cosmetic composition for preventing and improving skin wrinkles, Applicant: Kyung Hee University Industry-Academic Cooperation Group, Publication Date: March 09, 2015)

Hirayama K et al., Metabolism of Isoflavones Found in the Pueraria thomsonii Flower by Human Intestinal Microbiota. Biosci Microflora. 2011;30(4):135-40. Hirayama K et al., Metabolism of Isoflavones Found in the Pueraria thomsonii Flower by Human Intestinal Microbiota. Biosci Microflora. 2011; 30 (4): 135-40. Reppert A et al., Isolation of radiolabeled isoflavones from kudzu (Pueraria lobata) root cultures. J Agric Food Chem. 2008 Sep 10;56(17):7860-5. Reppert A et al., Isolation of radiolabeled isoflavones from kudzu (Pueraria lobata) root cultures. J Agric Food Chem. 2008 Sep 10; 56 (17): 7860-5. Yamaki K et al., Effects of naturally occurring isoflavones on prostaglandin E2 production. Planta Med. 2002 Feb;68(2):97-100.Yamaki K et al., Effects of naturally occurring isoflavones on prostaglandin E2 production. Planta Med. 2002 Feb; 68 (2): 97-100.

본 발명의 목적은 칡 추출물을 함유하는 열노화 방지용 화장료 조성물을 제공하는 데에 있다. It is an object of the present invention to provide a cosmetic composition for preventing heat aging containing a botanica extract.

본 발명은 칡 추출물을 함유하는 열노화 방지용 화장료 조성물에 관한 것이다. The present invention relates to a cosmetic composition for preventing heat aging containing 칡 extract.

상기 칡 추출물은 열수 추출물인 것을 특징으로 한다. 또한 상기 칡 추출물은 옥타데실실란(C18)으로 충전된 컬럼으로 정제한 것일 수 있다. The 칡 extract is characterized in that the hot water extract. In addition, the extract may be purified by a column filled with octadecylsilane (C18).

상기 조성물에는 오리스 뿌리 추출물, 지유 추출물, 병풍 추출물, 마텔 추출물 및 초피나무 열매 추출물이 첨가될 수 있다. 이 때 오리스 뿌리 추출물 등이 포함될 때, 상기 조성물에는 승마 추출물, 상황버섯 추출물, 차가버섯 추출물, 감초 추출물, 블루베리 추출물, 한련 추출물 및 할미꽃 추출물이 더 첨가될 수도 있다. Oris root extract, fat extract, folding screen extract, Mattel extract and berry fruit extract may be added to the composition. At this time, when the Oris root extract, etc., the composition may be further added to the horse riding extract, situation mushroom extract, chaga extract, licorice extract, blueberry extract, nasturtium extract and pasqueflower extract.

더 바람직하게는, 상기 조성물에는 칡 추출물 100 중량부 기준으로 오리스 뿌리 추출물 1~20 중량부, 지유 추출물 1~20 중량부, 병풍 추출물 1~20 중량부, 마텔 추출물 1~20 중량부 및 초피나무 열매 추출물 1~20 중량부가 포함될 수 있으며, 또한, 오리스 뿌리 추출물 등이 포함된 상기 조성물에는 칡 추출물 100 중량부 기준으로 승마 추출물 1~20 중량부, 상황버섯 추출물 1~20 중량부, 차가버섯 추출물 1~20 중량부, 감초 추출물 1~20 중량부, 블루베리 추출물 1~20 중량부, 한련 추출물 1~20 중량부 및 할미꽃 추출물 1~20 중량부가 더 포함될 수 있다. 이 외에, 이 조성물에는 칡 추출물 100 중량부 기준으로 어스니어 추출물이 1~20 중량부 더 포함될 수도 있다. 이 때, 칡 추출물에 포함되는 각종 추출물이 이러한 범위를 벗어나서 첨가될 경우에는 오히려 칡 추출물의 효능을 저해할 수 있다. More preferably, the composition contains 1-20 parts by weight of Oris root extract, 1-20 parts by weight of oil extract, 1-20 parts by weight of pneumatic extract, 1-20 parts by weight of Mattel extract, and bark wood The fruit extract may contain 1 to 20 parts by weight, and, in addition, the composition containing the Oris root extract, etc., based on 100 parts by weight of 칡 extract, 1 to 20 parts by weight of horse riding extract, 1 to 20 parts by weight of mushroom extract, chaga extract 1 to 20 parts by weight, licorice extract 1 to 20 parts by weight, blueberry extract 1 to 20 parts by weight, 1 to 20 parts by weight of nasturtium extract and 1 to 20 parts by weight of pasqueflower extract may be further included. In addition, the composition may further include 1 to 20 parts by weight of the Ersni extract based on 100 parts by weight of the extract. At this time, when the various extracts included in the extract 칡 is added outside this range may rather inhibit the efficacy of the extract 칡.

이에 본 발명은 상기 조성물을 함유하는 열노화 방지용 화장료를 제공할 수 있다. 상기 화장료는 마스크팩, 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션 및 바디클렌저로 이루어진 그룹에서 선택되는 제형의 화장료일 수 있다. Accordingly, the present invention can provide a cosmetic for preventing heat aging containing the composition. The cosmetics are mask pack, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisturizing cream, hand cream, foundation, essence, nutrition essence, pack, soap It may be a cosmetic of a formulation selected from the group consisting of, cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser.

상기 화장료 제형에는 부형제로서 디프로필렌글라이콜, 글리세린, 카보머, 아크릴레이트/C10-30, 베타인, 트레할로스, 호모베타-글루칸, 다이메틸설폰, 소듐하이알루로네이트, 하이드록시아세토페논, 부틸렌글라이콜, 글리세린, 피이지-40 하이드로제네이티드 캐스터 오일, 피이지-60 하이드로제네이티드 캐스터 오일, 비스-피이지-18 메칠에틸디메칠실란, 디메치콘, 향료, 포타슘하이드록사이드, 에칠헥실글리세린, 프로판디올, 징크설페이트, 레티닐팔미테이드 및 해수가 포함될 수 있고, 정제수 및 에탄올이 더 첨가될 수 있다. 상기 카보머는 Acrylates/C10-30Alkyl Acrylate Crosspolymer 로서 40,000~60,000 cps의 점도 및 중량평균분자량 400,000~5,000,000인 폴리아크릴산일 수 있다. The cosmetic formulation includes dipropylene glycol, glycerin, carbomer, acrylate / C10-30, betaine, trehalose, homobeta-glucan, dimethylsulfone, sodium hyaluronate, hydroxyacetophenone, butyl as excipients. Lenglycol, Glycerin, PIG-40 Hydrogenated Castor Oil, PIG-60 Hydrogenated Caster Oil, Bis-PIG-18 Methylethyldimethylmethylsilane, Dimethicone, Fragrance, Potassium Hydroxide, Ethylhexyl Glycerin, propanediol, zinc sulfate, retinyl palmitate and seawater may be included, and purified water and ethanol may be further added. The carbomer may be Acrylates / C10-30 Alkyl Acrylate Crosspolymer, which may be polyacrylic acid having a viscosity of 40,000 to 60,000 cps and a weight average molecular weight of 400,000 to 5,000,000.

더 바람직하게는 칡 추출물 또는 상기 칡 추출물에 식물 추출물이 포함된 복합 추출물이, 화장료 100 중량% 기준, 0.5~2 중량%로 포함될 때, 디프로필렌글라이콜 0.1~6 중량%, 글리세린 1~5 중량%, 카보머 0.01~1 중량%, 아크릴레이트/C10-30 0.001~1 중량%, 베타인 0.1~2 중량%, 트레할로스 0.01~1 중량%, 호모베타-글루칸 0.01~0.5 중량%, 다이메틸설폰 0.01~1 중량%, 소듐하이알루로네이트 0.1~1 중량%, 하이드록시아세토페논 0.01~1 중량%, 부틸렌글라이콜 0.01~1 중량%, 글리세린 0.01~1 중량%, 피이지-40 하이드로제네이티드 캐스터 오일 0.01~1 중량%, 피이지-60 하이드로제네이티드 캐스터 오일 0.01~1 중량%, 비스-피이지-18 메칠에틸디메칠실란 0.01~1 중량%, 디메치콘 0.01~1 중량%, 향료 0.001~0.1 중량%, 포타슘하이드록사이드 0.01~1 중량%, 에칠헥실글리세린 0.001~0.1 중량%, 프로판디올 0.01~1 중량%, 징크설페이트 0.01~1 중량%, 레티닐팔미테이드 0.01~1 중량% 및 해수 0.01~1 중량%가 포함될 수 있고, 정제수 및 에탄올이 더 첨가될 수 있다. 이 때, 에탄올은 0.001~1 중량%로 포함될 수 있고, 정제수는 총 조성물의 잔량으로서 포함될 수 있다. 이 때 화장료에 포함되는 각 성분이 이와 같은 범위를 벗어나서 포함될 경우, 고유의 광노화 억제 효능이 저하될 수 있다. More preferably, when the 복합 extract or the complex extract containing the plant extract in the 칡 extract, based on 100% by weight of cosmetics, 0.5 to 2% by weight, dipropylene glycol 0.1 to 6% by weight, glycerin 1 to 5 Weight%, Carbomer 0.01-1%, Acrylate / C10-30 0.001-1%, Betaine 0.1-2%, Trehalose 0.01-1%, Homobeta-glucan 0.01-0.5%, Dimethyl 0.01-1% by weight of sulfone, 0.1-1% by weight of sodium hyaluronate, 0.01-1% by weight of hydroxyacetophenone, 0.01-1% by weight of butylene glycol, 0.01-1% by weight of glycerin, Fiji-40 Hydro 0.01 to 1% by weight Generated Castor Oil, 0.01 to 1% by weight Fiji-60 Hydrogenated Caster Oil, 0.01 to 1% by weight Bis-Pig-18-Methylethyldimethylsilane, 0.01 to 1% by weight Dimethicone, Perfume 0.001-0.1 wt%, Potassium hydroxide 0.01-1 wt%, Ethylhexylglycerine 0.001-0.1 wt%, Propanediol 0.01-1 wt% , 0.01 to 1% by weight of zinc sulfate, 0.01 to 1% by weight of retinyl palmitate and 0.01 to 1% by weight of seawater, purified water and ethanol may be further added. At this time, ethanol may be included in 0.001 ~ 1% by weight, purified water may be included as the balance of the total composition. At this time, if each component included in the cosmetic is included outside this range, the inherent photoaging inhibitory effect may be lowered.

이하, 본 발명을 상세하게 설명한다.EMBODIMENT OF THE INVENTION Hereinafter, this invention is demonstrated in detail.

본 발명에서 사용되는 칡 추출물은 열수 추출물인 것을 특징으로 한다. 더 바람직하게는 칡 뿌리 100 중량부 기준 500~2000 중량부의 70~90℃의 열수를 가하여 얻은 것을 특징으로 한다. 보다 바람직하게는 칡 뿌리 100 중량부 기준 500~2000 중량부의 70~90℃의 열수를 가하여 12~24시간 동안 추출한 후 건더기를 제거하여 얻은 것을 특징으로 한다. 칡 extract used in the present invention is characterized in that the hot water extract. More preferably, it is obtained by adding hot water of 500 to 2000 parts by weight of 70 to 90 ℃ by 100 parts by weight of roots. More preferably, after the extraction for 12 to 24 hours by adding hot water of 500 ~ 2000 parts by weight of 70 ~ 90 ℃ by weight 100 parts by weight of roots, characterized in that obtained by removing the dust.

또한 상기 칡 추출물은 칡의 열수 추출물을 옥타데실실란(C18)으로 충전된 컬럼으로 정제한 것일 수 있으며, 보다 바람직하게는 옥타데실실란(C18)으로 충전된 역상 비극성 컬럼으로 정제한 것일 수 있다. In addition, the extract 칡 may be purified by a column filled with octadecylsilane (C18) of the hydrothermal extract of 보다, more preferably may be purified by a reversed phase non-polar column filled with octadecylsilane (C18).

본 발명의 조성물에 포함되는 추출물에서, 칡 추출물을 제외한 각종 식물 추출물은 각각의 원료시료를 물, C1~C4 알코올, 부틸렌글라이콜 또는 이들의 혼합용액을 용매로 하여 추출할 수 있으며, 상기 C1~C4 알코올은 메탄올, 에탄올, 프로판올, 이소프로판올, 부탄올 및 이소부탄올로 이루어진 군에서 선택될 수 있다. 이 때 보다 바람직하게는 각각의 원료시료를 물, 10~90%(v/v) 에탄올 수용액 또는 10~90%(v/v) 부틸렌글라이콜 수용액을 용매로 하여 추출할 수 있다. In the extracts included in the composition of the present invention, the various plant extracts except for the extract 칡 can be extracted with each raw material of water, C1 ~ C4 alcohol, butylene glycol or a mixed solution thereof as a solvent, the C1 ˜C4 alcohol may be selected from the group consisting of methanol, ethanol, propanol, isopropanol, butanol and isobutanol. At this time, more preferably, each raw material sample may be extracted with water, 10-90% (v / v) ethanol aqueous solution or 10-90% (v / v) butylene glycol aqueous solution as a solvent.

상기 추출물의 제조시 사용되는 물, C1~C4 알코올, 부틸렌글라이콜 또는 이들의 혼합용액은 원료시료 사용 중량 기준 1~40배 부피(1kg 기준 1~40ℓ)를 사용할 수 있으며, 바람직하게는 5~40배 부피를 사용할 수 있다. 상기 원료시료의 추출조건은 20~100℃에서 1분~48시간일 수 있다. 상기 과정은 1~4번까지 반복할 수 있다. 이 때, 칡 추출물은 용매로서 물 만을 사용한다는 것만 차이점이 있을 뿐 각 추출조건은 동일하게 할 수 있다. Water, C1 ~ C4 alcohol, butylene glycol or a mixed solution thereof used in the preparation of the extract may be used 1 to 40 times the volume (1 ~ 40L based on 1kg) based on the weight of the raw material sample, preferably 5 ~ 40 times volume can be used. Extraction conditions of the raw material sample may be 1 minute to 48 hours at 20 ~ 100 ℃. The process may be repeated 1 to 4 times. At this time, 칡 extract is the only difference is that only water is used as a solvent, each extraction condition can be the same.

추출물의 제조에 이용되는 추출용 기기로는 통상의 추출기기, 초음파분쇄추출기 또는 분획기를 이용할 수 있다. 이렇게 제조된 추출물은 열풍건조, 감압건조 또는 동결건조하여 용매를 제거할 수 있다. 또한, 상기 추출물은 칼럼크로마토그래피를 이용하여 정제하여 사용할 수 있다. As an extraction device used for the preparation of the extract may be used a conventional extraction device, ultrasonic grinding extractor or fractionator. The extract thus prepared may be removed by hot air drying, reduced pressure drying or lyophilization. In addition, the extract can be purified using column chromatography.

상기 추출물은 상법에 따라, 유기용매(알코올, 에테르, 아세톤 등)에 의한 추출, 헥산과 물의 분배, 칼럼크로마토그래피에 의한 방법 등, 식물체 성분의 분리 추출에 이용되는 공지의 방법을 단독 또는 적합하게 조합한 방법을 이용하여 분획 또는 정제하여 사용할 수 있다. According to the conventional method, the extract can be used alone or suitably by a known method used for separation and extraction of plant components, such as extraction with an organic solvent (alcohol, ether, acetone, etc.), hexane and water distribution, column chromatography, and the like. It can be used by fractionation or purification using a combined method.

상기 크로마토그래피는 실리카겔 컬럼 크로마토그래피(silica gel column chromatography), 엘에이취-20 컬럼 크로마토그래피(LH-20 column chromatography), 이온교환수지 크로마토그래피(ion exchange resin chromatography), 중압 액체 크로마토그래피(medium pressure liquid chromatography), 박층 크로마토그래피(TLC; thin layer chromatography), 실리카겔 진공 액체 크로마토그래피(silica gel vacuum liquid chromatography) 및 고성능 액체 크로마토그래피(high performance liquid chromatography) 중에서 선택될 수 있다. The chromatography may include silica gel column chromatography, LH-20 column chromatography, ion exchange resin chromatography, and medium pressure liquid chromatography. chromatography, thin layer chromatography (TLC), silica gel vacuum liquid chromatography, and high performance liquid chromatography.

본 발명의 칡 추출물을 함유하는 열노화 방지용 조성물이 포함된 주름개선용 화장료 조성물이 포함되는 화장료의 제형은 특별히 제한되지 않으나, 바람직하게는 마스크팩, 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션 및 바디클렌저로 이루어진 그룹에서 선택될 수 있다. 가장 바람직하게는 마스크팩일 수 있다. Formulation of the cosmetic composition containing a cosmetic composition for improving wrinkles containing a composition for preventing heat aging containing a heat extract of the present invention is not particularly limited, preferably mask pack, skin lotion, skin softener, skin toner, astringent, lotion Milk Lotion, Moisture Lotion, Nutrition Lotion, Massage Cream, Nutrition Cream, Moisture Cream, Hand Cream, Foundation, Essence, Nutrition Essence, Pack, Soap, Cleansing Foam, Cleansing Lotion, Cleansing Cream, Body Lotion and Body Cleanser Can be selected from. Most preferably, it may be a mask pack.

본 발명의 화장료에는 수용성 비타민, 유용성 비타민, 고분자 펩티드, 고분자 다당, 스핑고 지질 및 해초 엑기스로 이루어진 군에서 선택된 성분이 추가로 포함될 수 있다.The cosmetic of the present invention may further include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, polymer peptides, polymer polysaccharides, sphingolipids and seaweed extract.

수용성 비타민으로서는 화장품에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 B1, 비타민 B2, 비타민 B6, 피리독신, 염산피리독신, 비타민 B12, 판토텐산, 니코틴산, 니코틴산아미드, 엽산, 비타민 C, 비타민 H 등을 들 수 있으며, 그들의 염(티아민염산염, 아스코르빈산나트륨염 등)이나 유도체(아스코르빈산-2-인산나트륨염, 아스코르빈산-2-인산마그네슘염 등)도 본 발명에서 사용할 수 있는 수용성 비타민에 포함된다. 수용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 수득할 수 있다.The water-soluble vitamins may be any compound that can be incorporated into cosmetics, but preferably vitamin B1, vitamin B2, vitamin B6, pyridoxine, pyridoxine, vitamin B12, pantothenic acid, nicotinic acid, nicotinic acid amide, folic acid, vitamin C, vitamin H, and the like. Their salts (thiamine hydrochloride, sodium ascorbate salt, etc.) and derivatives (ascorbic acid-2-sodium phosphate salt, ascorbic acid-2-magnesium phosphate salt, etc.) may also be used in the water-soluble vitamins that can be used in the present invention. Included. The water-soluble vitamins can be obtained by conventional methods such as microbial transformation, purification from microorganism culture, enzyme or chemical synthesis.

유용성 비타민으로서는 화장료에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 비타민 A, 카로틴, 비타민 D2, 비타민 D3, 비타민 E(d1-알파 토코페롤, d-알파 토코페롤, d-알파 토코페롤) 등을 들 수 있으며, 그들의 유도체(팔미틴산아스코르빈, 스테아르산아스코르빈, 디팔미틴산아스코르빈, 아세트산dl-알파 토코페롤, 니코틴산dl-알파 토코페롤비타민 E, DL-판토테닐알코올, D-판토테닐알코올, 판토테닐에틸에테르 등) 등도 본 발명에서 사용되는 유용성 비타민에 포함된다. 유용성 비타민은 미생물 변환법, 미생물의 배양물로부터의 정제법, 효소 또는 화학 합성법 등의 통상의 방법에 의해 취득할 수 있다.The oil-soluble vitamin may be any compound that can be formulated into cosmetics, but preferably vitamin A, carotene, vitamin D2, vitamin D3, vitamin E (d1-alpha tocopherol, d-alpha tocopherol, d-alpha tocopherol), and the like. And derivatives thereof (ascorbic palmitate, ascorbic stearate, ascorbic acid dipalmitate, dl-alpha tocopherol acetate, dl-alpha tocopherolvitamin E, DL-pantothenyl alcohol, D-pantothenyl alcohol, pantothenyl ethyl) Ethers, etc.) are also included in the oil-soluble vitamins used in the present invention. Oil-soluble vitamins can be obtained by conventional methods such as microbial transformation, purification of microorganism culture, enzyme or chemical synthesis.

고분자 펩티드로서는 화장료에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 콜라겐, 가수 분해 콜라겐, 젤라틴, 엘라스틴, 가수 분해 엘라스틴, 케라틴 등을 들 수 있다. 고분자 펩티드는 미생물의 배양액으로부터의 정제법, 효소법 또는 화학 합성법 등의 통상의 방법에 의해 정제 취득할 수 있으며, 또는 통상 돼지나 소 등의 진피, 누에의 견섬유 등의 천연물로부터 정제하여 사용할 수 있다.The polymer peptide may be any compound as long as it can be blended into cosmetics. Preferably, collagen, hydrolyzed collagen, gelatin, elastin, hydrolyzed elastin, keratin and the like can be given. Polymeric peptides can be purified and obtained by conventional methods such as purification from microbial cultures, enzymatic methods or chemical synthesis methods, or can be purified and used from natural products such as dermis and pig silk such as pigs and cattle.

고분자 다당으로서는 화장료에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 히드록시에틸셀룰로오스, 크산탄검, 히알루론산나트륨, 콘드로이틴 황산 또는 그 염(나트륨염 등) 등을 들 수 있다. 예를 들어, 콘드로이틴 황산 또는 그 염 등은 통상 포유동물이나 어류로부터 정제하여 사용할 수 있다.The polymer polysaccharide may be any compound as long as it can be blended into cosmetics. Preferably, hydroxyethyl cellulose, xanthan gum, sodium hyaluronate, chondroitin sulfate or a salt thereof (sodium salt, etc.) may be mentioned. For example, chondroitin sulfate or its salt, etc. can be normally purified from a mammal or fish.

스핑고 지질로서는 화장료에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 세라미드, 피토스핑고신, 스핑고당지질 등을 들 수 있다. 스핑고 지질은 통상 포유류, 어류, 패류, 효모 또는 식물 등으로부터 통상의 방법에 의해 정제하거나 화학 합성법에 의해 취득할 수 있다.The sphingolipid may be any compound as long as it can be blended into cosmetics. Preferably, ceramide, phytosphingosine, sphingosaccharide lipid, etc. may be mentioned. Sphingo lipids can usually be purified from mammals, fish, shellfish, yeasts or plants by conventional methods or obtained by chemical synthesis.

해초 엑기스로는 화장료에 배합 가능한 것이라면 어떠한 것이라도 되지만, 바람직하게는 갈조 엑기스, 홍조 엑기스, 녹조 엑기스 등을 들 수 있으며, 또, 이들의 해초 엑기스로부터 정제된 칼라기난, 아르긴산, 아르긴산나트륨, 아르긴산칼륨 등도 본 발명에서 사용되는 해초 엑기스에 포함된다. 해초 엑기스는 해초로부터 통상의 방법에 의해 정제하여 취득할 수 있다.The seaweed extract may be any compound as long as it can be blended into cosmetics. Preferably, the seaweed extract may include brown algae extract, red algae extract, green algae extract, and the like. Colorginine, arginate, sodium arginate, purified from these seaweed extracts, Potassium arginate and the like are also included in the seaweed extract used in the present invention. Seaweed extract can be obtained by purification from seaweed by conventional methods.

본 발명의 화장료에는 또한 통상의 화장료에 배합되는 다른 성분을 배합할 수도 있다.The cosmetic of the present invention may also be blended with other ingredients blended with ordinary cosmetics.

이외에 첨가해도 되는 배합 성분으로서는 유지 성분, 보습제, 에몰리엔트제, 계면 활성제, 유기 및 무기 안료, 유기 분체, 자외선 흡수제, 방부제, 살균제, 산화 방지제, 식물 추출물, pH 조정제, 알콜, 색소, 향료, 혈행 촉진제, 냉감제, 제한(制汗)제, 정제수 등을 들 수 있다.Other components that may be added include fats and oils, moisturizers, emollients, surfactants, organic and inorganic pigments, organic powders, ultraviolet absorbers, preservatives, fungicides, antioxidants, plant extracts, pH adjusters, alcohols, pigments, flavorings, Blood circulation accelerators, cooling agents, restriction agents, purified water and the like.

유지 성분으로서는 에스테르계 유지, 탄화수소계 유지, 실리콘계 유지, 불소계 유지, 동물 유지, 식물 유지 등을 들 수 있다.Examples of the fat or oil component include ester fats, hydrocarbon fats, silicone fats, fluorine fats, animal fats, and vegetable fats and oils.

에스테르계 유지로서는 트리2-에틸헥산산글리세릴, 2-에틸헥산산세틸, 미리스틴산이소프로필, 미리스틴산부틸, 팔미틴산이소프로필, 스테아르산에틸, 팔미틴산옥틸, 이소스테아르산이소세틸, 스테아르산부틸, 리놀레산에틸, 리놀레산이소프로필, 올레인산에틸, 미리스틴산이소세틸, 미리스틴산이소스테아릴, 팔미틴산이소스테아릴, 미리스틴산옥틸도데실, 이소스테아르산이소세틸, 세바신산디에틸, 아디핀산디이소프로필, 네오펜탄산이소알킬, 트리(카프릴, 카프린산)글리세릴, 트리2-에틸헥산산트리메틸롤프로판, 트리이소스테아르산트리메틸롤프로판, 테트라2-에틸헥산산펜타엘리슬리톨, 카프릴산세틸, 라우린산데실, 라우린산헥실, 미리스틴산데실, 미리스틴산미리스틸, 미리스틴산세틸, 스테아르산스테아릴, 올레인산데실, 리시노올레인산세틸, 라우린산이소스테아릴, 미리스틴산이소트리데실, 팔미틴산이소세틸, 스테아르산옥틸, 스테아르산이소세틸, 올레인산이소데실, 올레인산옥틸도데실, 리놀레산옥틸도데실, 이소스테아르산이소프로필, 2-에틸헥산산세토스테아릴, 2-에틸헥산산스테아릴, 이소스테아르산헥실, 디옥탄산에틸렌글리콜, 디올레인산에틸렌글리콜, 디카프린산프로필렌글리콜, 디(카프릴,카프린산)프로필렌글리콜, 디카프릴산프로필렌글리콜, 디카프린산네오펜틸글리콜, 디옥탄산네오펜틸글리콜, 트리카프릴산글리세릴, 트리운데실산글리세릴, 트리이소팔미틴산글리세릴, 트리이소스테아르산글리세릴, 네오펜탄산옥틸도데실, 옥탄산이소스테아릴, 이소노난산옥틸, 네오데칸산헥실데실, 네오데칸산옥틸도데실, 이소스테아르산이소세틸, 이소스테아르산이소스테아릴, 이소스테아르산옥틸데실, 폴리글리세린올레인산에스테르, 폴리글리세린이소스테아르산에스테르, 시트르산트리이소세틸, 시트르산트리이소알킬, 시트르산트리이소옥틸, 락트산라우릴, 락트산미리스틸, 락트산세틸, 락트산옥틸데실, 시트르산트리에틸, 시트르산아세틸트리에틸, 시트르산아세틸트리부틸, 시트르산트리옥틸, 말산디이소스테아릴, 히드록시스테아르산 2-에틸헥실, 숙신산디2-에틸헥실, 아디핀산디이소부틸, 세바신산디이소프로필, 세바신산디옥틸, 스테아르산콜레스테릴, 이소스테아르산콜레스테릴, 히드록시스테아르산콜레스테릴, 올레인산콜레스테릴, 올레인산디히드로콜레스테릴, 이소스테아르산피트스테릴, 올레인산피트스테릴, 12-스테알로일히드록시스테아르산이소세틸, 12-스테알로일히드록시스테아르산스테아릴, 12-스테알로일히드록시스테아르산이소스테아릴 등의 에스테르계 등을 들 수 있다.As ester fats and oils, glyceryl tri2-ethylhexanoate, cetyl 2-ethylhexanoate, isopropyl myristate, butyl mystinate, isopropyl palmitate, ethyl stearate, octyl palmitate, isocetyl isostearate, and stearic acid Butyl, ethyl linoleate, isopropyl linoleate, ethyl oleate, isocetyl acid isocetyl, isostyl acid isostearyl, isostaryl palmitate, octylate acid octyldodecyl, isostearic acid isetyl, diethyl sebacate, adipine Acid isopropyl, isoalkyl neopentane, tri (capryl, capric acid) glyceryl, trimethyl ethyl trimethylol propane, triisostearic acid trimethylol propane, tetra 2-ethylhexanoic penta erythritol Cetyl caprylate, lauric acid decyl, hexyl laurate, decyl myristin, myristin acid myristyl, myritic acid cetyl, stearyl stearate, decyl oleate, rininooleic acid , Isostearyl laurate, isotridecyl myristin, isocetyl palmitate, octyl stearate, isocetyl stearate, isodecate oleate, octylate decyl oleate, octyl dodecyl linoleate, isopropyl isopropyl acid, 2 -Cetostearyl ethylhexanoate, stearyl 2-ethylhexanoate, hexyl isostearate, ethylene glycol dioctanoate, ethylene glycol dioleate, propylene glycol dicapric acid, propylene glycol dicacapate, capric acid Propylene glycol, dicapric acid neopentyl glycol, dioctanoate neopentyl glycol, tricaprylic acid glyceryl, triundecyl glyceryl, triisopalmitinate glyceryl, triisostearate glyceryl, neopentane dodecyl Isostearyl octanoate, octyl isononate, hexyl decyl neodecanoate, octyl dodecyl neodecanoate, isocetyl isostearate, isostearyl isostearate, Sothete octylate, polyglycerol oleate, polyglycerine isostearate, triisocetyl citrate, triisoalkyl citrate, triisoctyl citrate, lauryl lactate, myritic lactate, octyl lactate, octyl lactate, tricitric acid Ethyl, acetyl triethyl citrate, acetyl tributyl citrate, trioctyl citrate, diisostearyl malic acid, 2-ethylhexyl hydroxystearate, di2-ethylhexyl succinate, diisobutyl adipicate, diisopropyl sebacinate, Dioctyl sebacate, cholesteryl stearate, cholesteryl isostearate, cholesteryl hydroxystearate, cholesteryl oleate, dihydrocholesteryl oleate, physteryl isostearate, phytic oleate, 12-Steloylhydroxystearate isocetyl, 12-Steloylhydroxystearate stearyl, 12-stealo Esters such as monohydroxystearic acid isostearyl; and the like.

탄화 수소계 유지로서는 스쿠알렌, 유동 파라핀, 알파-올레핀올리고머, 이소파라핀, 세레신, 파라핀, 유동 이소파라핀, 폴리부덴, 마이크로크리스탈린왁스, 와셀린 등의 탄화 수소계 유지 등을 들 수 있다.Hydrocarbon-based fats and oils, such as squalene, a liquid paraffin, alpha-olefin oligomer, isoparaffin, ceresin, paraffin, a liquid isoparaffin, polybutene, microcrystal wax, and a vaseline, etc. are mentioned as a hydrocarbon-type fats and oils.

실리콘계 유지로서는 폴리메틸실리콘, 메틸페닐실리콘, 메틸시클로폴리실록산, 옥타메틸폴리실록산, 데카메틸폴리실록산, 도데카메틸시클로실록산, 디메틸실록산ㆍ메틸세틸옥시실록산 공중합체, 디메틸실록산ㆍ메틸스테알록시실록산 공중합체, 알킬 변성 실리콘유, 아미노 변성 실리콘유 등을 들 수 있다.Examples of the silicone-based oils and fats include polymethylsilicone, methylphenylsilicone, methylcyclopolysiloxane, octamethylpolysiloxane, decamethylpolysiloxane, dodecamethylcyclosiloxane, dimethylsiloxane, methylcetyloxysiloxane copolymer, dimethylsiloxane and methylsteoxysiloxane copolymer, and alkyl. Modified silicone oil, amino modified silicone oil and the like.

불소계 유지로서는 퍼플루오로폴리에테르 등을 들 수 있다.Perfluoro polyether etc. are mentioned as fluorine-based fats and oils.

동물 또는 식물 유지로서는 아보카도유, 아르몬드유, 올리브유, 참깨유, 쌀겨유, 새플라워유, 대두유, 옥수수유, 유채유, 행인(杏仁)유, 팜핵유, 팜유, 피마자유, 해바라기유, 포도종자유, 면실유, 야자유, 쿠쿠이너트유, 소맥배아유, 쌀 배아유, 시아버터, 월견초유, 마커데이미아너트유, 메도홈유, 난황유, 우지(牛脂), 마유, 밍크유, 오렌지라피유, 호호바유, 캔데리러왁스, 카르나바왁스, 액상 라놀린, 경화피마자유 등의 동물 또는 식물 유지를 들 수 있다.Animal or vegetable oils include avocado oil, almond oil, olive oil, sesame oil, rice bran oil, soybean oil, soybean oil, corn oil, rapeseed oil, almond oil, palm kernel oil, palm oil, castor oil, sunflower oil, grape seed oil. , Cottonseed oil, Palm oil, Cucumber nut oil, Wheat germ oil, Rice germ oil, Shea butter, Walnut colostrum oil, Marker demia nut oil, Meadow home oil, Egg yolk oil, Uji, Horse oil, Mink oil, Orange rape oil, Jojoba oil And animal or plant fats and oils such as candeler wax, carnava wax, liquid lanolin and hardened castor oil.

보습제로서는 수용성 저분자 보습제, 지용성 분자 보습제, 수용성 고분자, 지용성 고분자 등을 들 수 있다.Examples of the moisturizing agent include a water-soluble low molecular moisturizer, a fat-soluble molecular moisturizer, a water-soluble polymer, and a fat-soluble polymer.

수용성 저분자 보습제로서는 세린, 글루타민, 솔비톨, 만니톨, 피롤리돈-카르복실산나트륨, 글리세린, 프로필렌글리콜, 1,3-부틸렌글리콜, 에틸렌글리콜, 폴리에틸렌글리콜B(중합도 n = 2 이상), 폴리프로필렌글리콜(중합도 n = 2 이상), 폴리글리세린B(중합도 n = 2 이상), 락트산, 락트산염 등을 들 수 있다.Water-soluble low molecular humectants include serine, glutamine, sorbitol, mannitol, pyrrolidone-sodium carboxylate, glycerin, propylene glycol, 1,3-butylene glycol, ethylene glycol, polyethylene glycol B (polymerization degree n = 2 or more), polypropylene Glycol (polymerization degree n = 2 or more), polyglycerol B (polymerization degree n = 2 or more), lactic acid, lactic acid salt, etc. are mentioned.

지용성 저분자 보습제로서는 콜레스테롤, 콜레스테롤에스테르 등을 들 수 있다.Examples of the fat-soluble low molecular humectants include cholesterol and cholesterol esters.

수용성 고분자로서는 카르복시비닐폴리머, 폴리아스파라긴산염, 트라가칸트, 크산탄검, 메틸셀룰로오스, 히드록시메틸셀룰로오스, 히드록시에틸셀룰로오스, 히드록시프로필셀룰로오스, 카르복시메틸셀룰로오스, 수용성 키틴, 키토산, 덱스트린 등을 들 수 있다.Examples of the water-soluble polymer include carboxyvinyl polymer, polyasparaginate, tragacanth, xanthan gum, methyl cellulose, hydroxymethyl cellulose, hydroxyethyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, water soluble chitin, chitosan, and dextrin. Can be.

지용성 고분자로서는 폴리비닐피롤리돈ㆍ에이코센 공중합체, 폴리비닐피롤리돈ㆍ헥사데센 공중합체, 니트로셀룰로오스, 덱스트린지방산에스테르, 고분자 실리콘 등을 들 수 있다.Examples of the fat-soluble polymers include polyvinylpyrrolidone-eicosene copolymers, polyvinylpyrrolidone-hexadecene copolymers, nitrocellulose, dextrin fatty acid esters, polymer silicones, and the like.

에몰리엔트제로서는 장쇄아실글루타민산콜레스테릴에스테르, 히드록시스테아르산콜레스테릴, 12-히드록시스테아르산, 스테아르산, 로진산, 라놀린지방산콜레스테릴에스테르 등을 들 수 있다.Examples of the emollient include long-chain acyl glutamic acid cholesteryl esters, hydroxy stearic acid cholesterol, 12-hydroxystearic acid, stearic acid, rosin acid, lanolin fatty acid cholesteryl esters, and the like.

계면 활성제로서는 비이온성 계면 활성제, 음이온성 계면 활성제, 양이온성 계면 활성제, 양성 계면 활성제 등을 들 수 있다.As surfactant, nonionic surfactant, anionic surfactant, cationic surfactant, amphoteric surfactant, etc. are mentioned.

비이온성 계면 활성제로서는 자기 유화형 모노스테아르산글리세린, 프로필렌글리콜지방산에스테르, 글리세린지방산에스테르, 폴리글리세린지방산에스테르, 솔비탄지방산에스테르, POE(폴리옥시에틸렌)솔비탄지방산에스테르, POE 솔비트지방산에스테르, POE 글리세린지방산에스테르, POE 알킬에테르, POE 지방산에스테르, POE 경화피마자유, POE 피마자유, POEㆍPOP(폴리옥시에틸렌ㆍ폴리옥시프로필렌) 공중합체, POEㆍPOP 알킬에테르, 폴리에테르변성실리콘, 라우린산알카놀아미드, 알킬아민옥시드, 수소첨가대두인지질 등을 들 수 있다.Nonionic surfactants include self-emulsifying glycerin monostearate, propylene glycol fatty acid esters, glycerin fatty acid esters, polyglycerol fatty acid esters, sorbitan fatty acid esters, POE (polyoxyethylene) sorbitan fatty acid esters, POE sorbitan fatty acid esters, POE Glycerin Fatty Acid Ester, POE Alkyl Ether, POE Fatty Acid Ester, POE Cured Castor Oil, POE Castor Oil, POE / POP (Polyoxyethylene / Polyoxypropylene) Copolymer, POE / POP Alkyl Ether, Polyether Modified Silicone, Laurin Acid Alkanolamide, alkylamine oxide, hydrogenated soybean phospholipid, etc. are mentioned.

음이온성 계면 활성제로서는 지방산비누, 알파-아실술폰산염, 알킬술폰산염, 알킬알릴술폰산염, 알킬나프탈렌술폰산염, 알킬황산염, POE 알킬에테르황산염, 알킬아미드황산염, 알킬인산염, POE 알킬인삼염, 알킬아미드인산염, 알킬로일알킬타우린염, N-아실아미노산염, POE 알킬에테르카르복실산염, 알킬술포숙신산염, 알킬술포아세트산나트륨, 아실화 가수분해 콜라겐펩티드염, 퍼플루오로알킬인산에스테르 등을 들 수 있다.Anionic surfactants include fatty acid soaps, alpha-acyl sulfonates, alkyl sulfonates, alkyl allyl sulfonates, alkyl naphthalene sulfonates, alkyl sulfates, POE alkyl ether sulfates, alkylamide sulfates, alkyl phosphates, POE alkylphosphates, and alkylamides. Phosphates, alkyloylalkyltaurine salts, N-acylamino acid salts, POE alkyl ether carboxylate salts, alkyl sulfosuccinate salts, sodium alkyl sulfo acetates, acylated hydrolyzed collagen peptide salts, perfluoroalkyl phosphate esters, and the like. have.

양이온성 계면 활성제로서는 염화알킬트리메틸암모늄, 염화스테아릴트리메틸암모늄, 브롬화스테아릴트리메틸암모늄, 염화세토스테아릴트리메틸암모늄, 염화디스테아릴디메틸암모늄, 염화스테아릴디메틸벤질암모늄, 브롬화베헤닐트리메틸암모늄, 염화벤잘코늄, 스테아르산디에틸아미노에틸아미드, 스테아르산디메틸아미노프로필아미드, 라놀린 유도체 제 4급 암모늄염 등을 들 수 있다.As cationic surfactant, alkyl trimethylammonium chloride, stearyl trimethyl ammonium chloride, stearyl trimethyl ammonium chloride, cetostearyl trimethyl ammonium chloride, distearyl dimethyl ammonium chloride, stearyl dimethyl benzyl ammonium bromide, behenyl trimethyl ammonium chloride, chloride Benzalkonium, diethylaminoethyl stearate, dimethylaminopropyl stearate, lanolin derivatives, quaternary ammonium salts, and the like.

양성 계면 활성제로서는 카르복시베타인형, 아미드베타인형, 술포베타인형, 히드록시술포베타인형, 아미드술포베타인형, 포스포베타인형, 아미노카르복실산염형, 이미다졸린 유도체형, 아미드아민형 등의 양성 계면 활성제 등을 들 수 있다.Examples of amphoteric surfactants include the carboxybetaine type, the amide betain type, the sulfobetain type, the hydroxysulfobetain type, the amide sulfobetain type, the phosphobetaine type, the aminocarboxylate type, the imidazoline derivative type, and the amideamine type. An amphoteric surfactant etc. are mentioned.

유기 및 무기 안료로서는 규산, 무수규산, 규산마그네슘, 탤크, 세리사이트, 마이카, 카올린, 벵갈라, 클레이, 벤토나이트, 티탄피막운모, 옥시염화비스무트, 산화지르코늄, 산화마그네슘, 산화아연, 산화티탄, 산화알루미늄, 황산칼슘, 황산바륨, 황산마그네슘, 탄산칼슘, 탄산마그네슘, 산화철, 군청, 산화크롬, 수산화크롬, 칼라민 및 이들의 복합체등의 무기 안료 ; 폴리아미드, 폴리에스테르, 폴리프로필렌, 폴리스티렌, 폴리우레탄, 비닐수지, 요소수지, 페놀수지, 불소수지, 규소수지, 아크릴수지, 멜라민수지, 에폭시수지, 폴리카보네이트수지, 디비닐벤젠ㆍ스티렌 공중합체, 실크파우더, 셀룰로오스, CI 피그먼트옐로우, CI 피그먼트오렌지 등의 유기 안료 및 이들의 무기 안료와 유기 안료의 복합 안료 등을 들 수 있다.Organic and inorganic pigments include silicic acid, silicic anhydride, magnesium silicate, talc, sericite, mica, kaolin, bengala, clay, bentonite, titanium film mica, bismuth oxychloride, zirconium oxide, magnesium oxide, zinc oxide, titanium oxide, aluminum oxide Inorganic pigments such as calcium sulfate, barium sulfate, magnesium sulfate, calcium carbonate, magnesium carbonate, iron oxide, ultramarine blue, chromium oxide, chromium hydroxide, calamine and composites thereof; Polyamide, polyester, polypropylene, polystyrene, polyurethane, vinyl resin, urea resin, phenol resin, fluorine resin, silicon resin, acrylic resin, melamine resin, epoxy resin, polycarbonate resin, divinylbenzene, styrene copolymer, Organic pigments such as silk powder, cellulose, CI pigment yellow, CI pigment orange, and composite pigments of these inorganic pigments and organic pigments;

유기 분체로서는 스테아르산칼슘 등의 금속비누 ; 세틸린산아연나트륨, 라우릴린산아연, 라우릴린산칼슘 등의 알킬인산금속염 ; N-라우로일-베타-알라닌칼슘, N-라우로일-베타-알라닌아연, N-라우로일글리신칼슘 등의 아실아미노산 다가금속염 ; N-라우로일-타우린칼슘, N-팔미토일-타우린칼슘 등의 아미드술폰산 다가금속염 ; N-엡실론-라우로일-L-리진, N-엡실론-팔미토일리진, N-알파-파리토일올니틴, N-알파-라우로일아르기닌, N-알파-경화우지지방산아실아르기닌 등의 N-아실염기성아미노산 ; N-라우로일글리실글리신 등의 N-아실폴리펩티드 ; 알파-아미노카프릴산, 알파-아미노라우린산 등의 알파-아미노지방산 ; 폴리에틸렌, 폴리프로필렌, 나일론, 폴리메틸메타크릴레이트, 폴리스티렌, 디비닐벤젠ㆍ스티렌 공중합체, 사불화에틸렌 등을 들 수 있다.As organic powder, Metal soaps, such as a calcium stearate; Alkyl phosphate metal salts such as sodium cetylinate, zinc lauryl acid and calcium laurate; Acylamino acid polyvalent metal salts such as N-lauroyl-beta-alanine calcium, N-lauroyl-beta-alanine zinc, and N-lauroylglycine calcium; Amide sulfonic acid polyvalent metal salts, such as N-lauroyl-taurine calcium and N-palmitoyl-taurine calcium; N-epsilon-lauroyl-L-lysine, N-epsilon-palmitolyzine, N-alpha-paratoylol nitin, N-alpha-lauroyl arginine, N-alpha-cured fatty acid acyl arginine -Acyl basic amino acid; N-acyl polypeptides, such as N-lauroyl glycyl glycine; Alpha-amino fatty acids such as alpha-aminocaprylic acid and alpha-aminolauric acid; Polyethylene, polypropylene, nylon, polymethyl methacrylate, polystyrene, divinylbenzene-styrene copolymer, ethylene tetrafluoride and the like.

자외선 흡수제로서는 파라아미노벤조산, 파라아미노벤조산에틸, 파라아미노벤조산아밀, 파라아미노벤조산옥틸, 살리실산에틸렌글리콜, 살리신산페닐, 살리신산옥틸, 살리신산벤질, 살리신산부틸페닐, 살리신산호모멘틸, 계피산벤질, 파라메톡시계피산-2-에톡시에틸, 파라메톡시계피산옥틸, 디파라메톡시계피산모노-2-에틸헥산글리세릴, 파라메톡시계피산이소프로필, 디이소프로필ㆍ디이소프로필계피산에스테르 혼합물, 우로카닌산, 우로카닌산에틸, 히드록시메톡시벤조페논, 히드록시메톡시벤조페논술폰산 및 그 염, 디히드록시메톡시벤조페논, 디히드록시메톡시벤조페논디술폰산나트륨, 디히드록시벤조페논, 테트라히드록시벤조페논, 4-tert-부틸-4'-메톡시디벤조일메탄, 2,4,6-트리아닐리노-p-(카르보-2'-에틸헥실-1'-옥시)-1,3,5-트리아진, 2-(2-히드록시-5-메틸페닐)벤조트리아졸 등을 들 수 있다.Examples of the ultraviolet absorber include paraaminobenzoic acid, ethyl paraaminobenzoate, amyl paraaminobenzoic acid, octyl paraaminobenzoate, ethylene glycol salicylate, phenyl salicylate, octyl salicylate, benzyl salicylate, butylphenyl salicylate, homomentyl salicylic acid and benzyl cinnamic acid. , Paramethoxy cinnamic acid-2-ethoxyethyl, paramethoxy cinnamic acid octyl, diparamethoxy cinnamic acid mono-2-ethylhexaneglyceryl, paramethoxy cinnamic acid isopropyl, diisopropyl diisopropyl cinnamic acid ester mixture, wuro Canonic acid, ethyl urokanoate, hydroxymethoxybenzophenone, hydroxymethoxybenzophenonesulfonic acid and salts thereof, dihydroxymethoxybenzophenone, dihydroxymethoxybenzophenone sodium sulfonate, dihydroxybenzophenone , Tetrahydroxybenzophenone, 4-tert-butyl-4'-methoxydibenzoylmethane, 2,4,6-trianilino-p- (carbo-2'-ethylhexyl-1'-oxy) -1 , 3,5-triazine, 2- (2-hydroxy Ci-5-methylphenyl) benzotriazole and the like.

살균제로서는 히노키티올, 트리클로산, 트리클로로히드록시디페닐에테르, 크로르헥시딘글루콘산염, 페녹시에탄올, 레조르신, 이소프로필메틸페놀, 아줄렌, 살리칠산, 진크필리티온, 염화벤잘코늄, 감광소 301 호, 모노니트로과이어콜나트륨, 운데시렌산 등을 들 수 있다.As fungicides, hinokithiol, trichloric acid, trichlorohydroxydiphenyl ether, chlorhexidine gluconate, phenoxyethanol, resorcin, isopropylmethylphenol, azulene, salicylic acid, ginxitlionone, benzalkonium chloride, photosensitive Sodium No. 301, sodium mononitroguicol, undecylenic acid, and the like.

산화 방지제로서는 부틸히드록시아니솔, 갈릭산프로필, 엘리소르빈산 등을 들 수 있다.Examples of the antioxidant include butylhydroxyanisole, propyl gallic acid, and erythorbic acid.

pH 조정제로서는 시트르산, 시트르산나트륨, 말산, 말산나트륨, 프말산, 프말산나트륨, 숙신산, 숙신산나트륨, 수산화나트륨, 인산일수소나트륨 등을 들 수 있다.Examples of the pH adjuster include citric acid, sodium citrate, malic acid, sodium malate, fmaric acid, sodium pmarate, succinic acid, sodium succinate, sodium hydroxide, sodium dihydrogen phosphate, and the like.

알코올로서는 세틸알코올 등의 고급 알코올을 들 수 있다.Examples of the alcohol include higher alcohols such as cetyl alcohol.

또한 이외에 첨가해도 되는 배합 성분은 이에 한정되는 것은 아니며, 또 상기 어느 성분도 본 발명의 목적 및 효과를 손상시키지 않는 범위 내에서 배합 가능하지만, 총중량에 대하여 바람직하게는 0.01 내지 5 중량%, 보다 바람직하게는 0.01 - 3 중량%로 배합될 수 있다.Moreover, the compounding component which may be added other than this is not limited to this, Moreover, Although all said components can be mix | blended within the range which does not impair the objective and effect of this invention, Preferably it is 0.01-5 weight% with respect to a total weight, More preferably, May be formulated at 0.01-3% by weight.

본 발명의 화장료는 용액, 유화물, 점성형 혼합물 등의 형상을 취할 수 있다.The cosmetic of the present invention may take the form of a solution, an emulsion, a viscous mixture, or the like.

본 발명의 화장료에 포함되는 성분은 유효성분으로서 상기 추출물 이외에 화장료에 통상적으로 이용되는 성분들을 포함할 수 있으며, 예를 들면, 안정화제, 용해화제, 비타민, 안료 및 향료와 같은 통상적인 보조제 및 담체를 포함한다.Ingredients included in the cosmetic of the present invention may include ingredients commonly used in cosmetics in addition to the extract as an active ingredient, for example, conventional auxiliaries and carriers such as stabilizers, solubilizers, vitamins, pigments and flavorings. It includes.

본 발명의 화장료 제형이 페이스트, 크림 또는 겔인 경우에는 담체 성분으로서 동물섬유, 식물섬유, 왁스, 파라핀, 전분, 트라칸트, 셀룰로오스 유도체, 폴리에틸렌 글리콜, 실리콘, 벤토나이트, 실리카, 탈크 또는 산화아연 등이 이용될 수 있다.When the cosmetic formulation of the present invention is a paste, cream or gel, animal fibers, plant fibers, waxes, paraffins, starches, trakants, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicas, talc or zinc oxide are used as carrier components. Can be.

본 발명의 화장료 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 락토스, 탈크, 실리카, 알루미늄 히드록시드, 칼슘 실리케이트 또는 폴리아미드 파우더가 이용될 수 있고, 특히 스프레이인 경우에는 추가적으로 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다.When the cosmetic formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular, in the case of a spray, additionally chlorofluorohydrocarbon, Propellant such as propane / butane or dimethyl ether.

본 발명의 화장료 제형이 용액 또는 유탁액의 경우에는 담체 성분으로서 용매, 용매화제 또는 유탁화제가 이용되고, 예컨대 물, 에탄올, 이소프로판올, 에틸 카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 있다.When the cosmetic formulation of the present invention is a solution or emulsion, a solvent, solvating agent or emulsifying agent is used as the carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, Fatty acid esters of 1,3-butylglycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan.

본 발명의 화장료 제형이 현탁액인 경우에는 담체 성분으로서 물, 에탄올 또는 프로필렌 글리콜과 같은 액상 희석제, 에톡실화 이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 미소결정성 셀룰로오스, 알루미늄 메타히드록시드, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다.When the cosmetic formulation of the present invention is a suspension, liquid carrier diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystals Soluble cellulose, aluminum metahydroxy, bentonite, agar or tracant and the like can be used.

본 발명의 화장료 제형이 계면-활성제 함유 클린징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르 설페이트, 설포숙신산 모노에스테르, 이세티오네이트, 이미다졸리늄 유도체, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 알킬아미도베타인, 지방족 알코올, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 리놀린 유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.When the cosmetic formulation of the present invention is a surfactant-containing cleansing agent, the carrier component is aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid. Amide ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, linolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

본 발명은 칡 추출물을 함유하는 열노화 방지용 화장료 조성물에 관한 것으로서, 상기 칡 추출물은 열충격 단백질을 활성화하여 적외선 조사에 따른 열노화 과정을 억제함으로써 콜라겐 합성 촉진 및 주름개선 효능이 뛰어난 화장료 조성물로서 용이하게 이용될 수 있다.The present invention relates to a cosmetic composition for preventing heat aging containing 칡 extract, the 칡 extract is easily activated as a cosmetic composition excellent in promoting collagen synthesis and improving wrinkles by activating a heat shock protein to inhibit the heat aging process according to infrared irradiation. Can be used.

도 1은 컬럼 정제된 칡의 물 추출물에 포함된 지표물질의 함량을 나타내는 그래프이다.
도 2는 컬럼 정제된 칡의 물 추출물을 처리한 Human Dermal Fibroblasts (HDFs) 세포에서의 MTT 어세이 결과를 나타내는 그래프이다.
도 3은 컬럼 정제된 칡의 물 추출물을 처리한 HaCaT 세포에서의 열충격 단백질의 mRNA 발현정도를 확인한 그래프이다.
도 4는 정제하지 않은 칡의 물 추출물(조추출물)을 처리한 HaCaT 세포에서의 열충격 단백질의 mRNA 발현정도를 확인한 그래프이다.
도 5는 적외선 처리한 HaCaT 세포에서의 열충격 단백질의 mRNA 발현정도를 확인한 그래프이다.
도 6은 칡 추출물과 이로부터 분리된 Daidzin, Daidzein을 처리한 HaCaT 세포에서의 열충격 단백질의 mRNA 발현정도를 확인한 그래프이다.
도 7은 HaCaT cell에 칡 추출물이 처리되었을 때의 열충격단백질인 HSP70과 HSP110의 단백질 발현을 ELISA 법으로 확인한 결과를 나타낸다.
도 8은 적외선 조사된 인체피부 섬유아세포에 칡 추출물을 처리한 후에 확인된 콜라겐 합성 정도를 나타내는 그래프이다.
도 9는 적외선 조사된 인체피부 섬유아세포에 칡 추출물을 처리한 후에 확인된 콜라게나제(MMP-1) 활성 억제 정도를 나타내는 그래프이다.
Figure 1 is a graph showing the content of the indicator contained in the water extract of column purified purified water.
Figure 2 is a graph showing the results of the MTT assay in Human Dermal Fibroblasts (HDFs) cells treated with column purified purified water extract.
Figure 3 is a graph confirming the mRNA expression level of the heat shock protein in the HaCaT cells treated with column purified purified water extract.
Figure 4 is a graph confirming the mRNA expression level of the heat shock protein in HaCaT cells treated with crude purified water extract (crude extract).
Figure 5 is a graph confirming the mRNA expression of the heat shock protein in infrared treated HaCaT cells.
Figure 6 is a graph confirming the mRNA expression of heat shock protein in HaCaT cells treated with 칡 extract and Daidzin, Daidzein isolated from it.
Figure 7 shows the results of confirming the protein expression of the heat shock proteins HSP70 and HSP110 when the extract was treated in HaCaT cells by ELISA method.
8 is a graph showing the degree of collagen synthesis confirmed after the treatment of the extract of the human skin fibroblasts irradiated with infrared rays.
9 is a graph showing the degree of inhibition of collagenase (MMP-1) activity confirmed after treatment of the extract of the human skin fibroblasts irradiated with infrared rays.

이하 본 발명의 바람직한 실시예를 상세히 설명하기로 한다. 그러나, 본 발명은 여기서 설명되는 실시예에 한정되지 않고 다른 형태로 구체화될 수도 있다. 오히려, 여기서 소개되는 내용이 철저하고 완전해지도록, 당업자에게 본 발명의 사상을 충분히 전달하기 위해 제공하는 것이다. Hereinafter, a preferred embodiment of the present invention will be described in detail. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, it is provided to fully convey the spirit of the present invention to those skilled in the art so that the contents introduced herein are thoroughly and completely.

<실시예 1. 칡 추출물 및 각종 식물 추출물의 제조><Example 1. Preparation of 칡 extract and various plant extracts>

실시예 1-1. 칡 추출물의 제조Example 1-1. Preparation of 칡 Extract

칡 뿌리 시료 20 g 준비한 후, 각 시료 10g씩에 물 또는 30%(v/v) 에탄올 수용액을 각각 100 mL을 첨가하고 80 ℃에서 16시간 동안 정치 후 760g에서 20분간 원심 분리하여 상등액을 0.45 μm syringe filter로 여과하였으며, 여과액을 수거하여 상기 여과액 시료를 sep-pak C18 cartridge (Waters Co.)을 이용하여 추출성분을 메탄올로 용출하여 정제 및 농축하였다. 이렇게 얻은 농축물을 Speedvac을 이용하여 용매를 제거하고 남은 분말을 증류수에 녹여 각 용매별 칡 추출물로 제조하였다. 이 때, 추출물은 원료시료인 칡뿌리 1g에서 얻은 농축물을 1ml에 녹여 1g(칡뿌리)/㎖의 농도로 stock solution을 제조하고 이 추출물(stock solution)을 세포배양용 배지의 1~10%(v/v)가 되도록 처리하여 실험하였다. 20 After preparing 20 g of root samples, 100 mL of water or 30% (v / v) aqueous ethanol solution was added to 10 g of each sample, and the mixture was allowed to stand at 80 ° C. for 16 hours, followed by centrifugation at 760 g for 20 minutes. The filtrate was collected using a syringe filter, and the filtrate sample was purified using a sep-pak C18 cartridge (Waters Co.). The concentrate thus obtained was removed with a solvent using Speedvac, and the remaining powder was dissolved in distilled water to prepare a extract for each solvent. At this time, the extract was dissolved in 1 ml of the concentrate obtained from 1 g of raw root powder as a raw material to prepare a stock solution at a concentration of 1 g (칡 root) / ㎖ and the extract (stock solution) 1 ~ 10% of the cell culture medium The experiment was conducted to (v / v).

또한 같은 방법으로 sep-pak C18 cartridge으로 추출하여 회수된 시료에 80% methanol을 첨가하여 최종 volume이 10 mL가 되도록 한 후 시료를 HPLC column에 주입하였다. 역상 HPLC를 이용하여 C18 column(size φ 4.6 mm×250 mm)을 사용하고, 이동상으로는 0.1% acetic acid를 함유 한 증류수(HPLC grade, 용매 A)와 0.1% acetic acid를 함유한 acetonitrile (HPLC grade, 용매 B)을 사용하였다. 254 nm 파장에서 흡광도를 측정하며, 분석을 위한 표준물질로는 Daidzin, Daidzein, Glycitin, Genistein, Genistin 을 사용하였다. Isoflavone 함량은 표준물질을 이용하여 표준검량곡선을 작성한 후 계산하였다. In addition, 80% methanol was added to the recovered sample extracted with a sep-pak C18 cartridge to a final volume of 10 mL, and then the sample was injected into an HPLC column. Reverse phase HPLC was used for C18 column (size φ 4.6 mm × 250 mm), mobile phase was distilled water containing 0.1% acetic acid (HPLC grade, solvent A) and acetonitrile containing 0.1% acetic acid (HPLC grade, Solvent B) was used. Absorbance was measured at 254 nm wavelength and Daidzin, Daidzein, Glycitin, Genistein, and Genistin were used as standards for analysis. Isoflavone content was calculated after preparing a standard calibration curve using standard materials.

분석결과는 도 1에 나타내었는데, 도 1을 참고하면 칡의 물 추출물이 칡의 30%(v/v) 에탄올 수용액과 비교하여 Daidzin과 Daidzein이 현저하게 많이 포함되어 있는 것으로 확인되었다. The analysis results are shown in Figure 1, referring to Figure 1 was confirmed that the water extract of 칡 contains significantly more Daidzin and Daidzein compared to the 30% (v / v) ethanol aqueous solution of 칡.

실시예 1-2. 각 식물 추출물의 제조Example 1-2. Preparation of each plant extract

오리스 뿌리, 지유, 병풍, 마텔, 초피나무 열매, 승마, 상황버섯, 차가버섯, 감초, 블루베리, 한련 또는 할미꽃 각각의 원료시료에 각 중량 대비 10배 부피의 70%(v/v)의 에탄올 수용액을 가하고 60℃에서 6시간 동안 추출한 후 건더기를 제거하여 액상만을 수거한 후 상기 액상을 감압농축하여 각각의 추출물을 제조하였다. 70% (v / v) ethanol, 10 times by volume, for each raw material of Oris root, fat, folding screen, matel, bark fruit, horse riding, mushroom, chaga, licorice, blueberry, nasturtium or pasqueflower Aqueous solution was added and extracted at 60 ° C. for 6 hours, and then dried to remove only the liquid phase, and the liquid phase was concentrated under reduced pressure to prepare each extract.

실시예 2. 세포 생존율 확인 Example 2. Confirmation of Cell Viability

실시예 1-1에서 얻은 각각의 용매별 sep-pak C18 cartridge 정제한 칡 추출물, 실시예 1-2에서 얻은 각각의 식물 추출물에 대해 MTT 어세이를 이용하여 세포 독성을 확인하였다. Human Dermal Fibroblasts (HDFs) 세포를 24 well plate에 2x104 cells/well이 되도록 분주하고 24시간 배양 후, 각각의 추출물(stock solution)을 0%, 1%, 2%, 4%, 6%, 8%, 10%(각각 v/v)의 농도가 되게 세포배양액에 첨가하여 세포에 처리하여 48시간 동안 배양한 후 세포 생존율을 측정하였다. For each solvent obtained in Example 1-1 sep-pak C18 cartridge purified 칡 extract, each plant extract obtained in Example 1-2 was confirmed for cytotoxicity using an MTT assay. Dispense Human Dermal Fibroblasts (HDFs) cells into 24 well plates at 2x10 4 cells / well, and incubate for 24 hours, then add stock solutions to 0%, 1%, 2%, 4%, 6%, 8 %, 10% (each v / v) was added to the cell culture solution to treat the cells and cultured for 48 hours and then cell viability was measured.

그 결과, 대부분의 추출물에서 세포 생존율이 90% 이상으로 세포독성이 매우 미미한 것으로 확인되었는데, 이를 대표하여 칡의 물 추출물에 대한 실험결과를 하기의 도 2에 나타내었다. As a result, it was confirmed that the cytotoxicity is very low as the cell viability of more than 90% in most extracts, representing the experimental results for the water extract of 칡 represented in Figure 2 below.

한편, 칡의 10%(v/v) 또는 30%(v/v) 에탄올 수용액 추출물을 24시간 처리 하였을 때 8% 이상의 고농도 처리군에서 세포가 대량 사멸하는 것으로 확인되어 에탄올 수용액 추출물에 비해 전체적으로 세포독성이 거의 없는 물 추출물을 이후의 실험에서 사용하기로 하였다. On the other hand, when 24% treatment of 10% (v / v) or 30% (v / v) ethanol aqueous solution extract of 대량 was confirmed to kill a large number of cells in the high concentration treatment group of 8% or more, as a whole compared to the ethanol aqueous solution extract Water extracts with little toxicity were to be used in subsequent experiments.

한편, 추가적으로 칡 추출물 처리 전에, IR-A (PHILIPS lamp)를 15분간 세포배양 플레이트에 쬐게 한 후, 세포배양 배지를 새로운 배지로 바꿔준 후 48시간 동안 처리한 후 동일한 실험을 한 바, IR-A만 처리한 군에서는 세포 생존율이 30% 이상 줄어들었으나 칡 추출물을 처리한 군에서는 대조군 대비 조건 이상으로 세포 생존율이 크게 증가하여 적외선 조사 조건에서도 칡 추출물이 피부세포의 증식에 유용한 효과를 내는 것으로 확인된다(데이터 미제시).On the other hand, before the extract treatment, IR-A (PHILIPS lamp) was exposed to the cell culture plate for 15 minutes, the cell culture medium was changed to fresh medium, and then treated for 48 hours. Cell survival rate was reduced by more than 30% in the group treated with A only, but the cell viability increased significantly above the control group in the group treated with the extract, and the extract was found to have a useful effect on the proliferation of skin cells even under infrared irradiation. (Data not shown).

<실시예 3. 열충격단백질의 발현 확인 - i><Example 3. Confirmation of expression of heat shock protein-i>

열충격단백질의 발현정도를 측정하기 위하여 qPCR을 이용하였다. 실험에 사용한 추출물은 Sep-pakㄾ light C18 cartridge를 이용하여 정제한 칡의 물 추출물을 사용하였다. QPCR was used to measure the expression level of the heat shock protein. The extract used in the experiment was a water extract of 칡 purified using Sep-pak ㄾ light C18 cartridge.

HaCaT 세포를 6-well plate에 5x105 cells/well이 되도록 접종한 후 37℃, 5% CO2 Incubator에서 24시간 배양하였다. 그리고, 배지를 버리고 Phosphate buffered saline(PBS)로 세척한 다음 2% 농도의 칡 추출물 및 FBS를 포함하지 않는 세포 배양액에 3~24시간 동안 처리하여 세포를 배양하였다. 또한 칡 추출물과 효과를 비교하기 위해 Daidzin, Daidzein을 처리하였다. HaCaT cells were inoculated in 6-well plates at 5x10 5 cells / well and incubated in 37 ° C., 5% CO 2 incubator for 24 hours. Then, the medium was discarded and washed with Phosphate buffered saline (PBS), and then cultured with cells treated with 2% concentration of 칡 extract and cell culture solution containing no FBS for 3 to 24 hours. In addition, Daidzin and Daidzein were treated to compare the effect with the extract.

이 때 칡 추출물 대신 Stress 처리군은 IR-A (PHILIPS lamp)를 15분간 세포배양 플레이트에 쬐게 하여 FBS를 포함하지 않는 세포 배양액으로 교체하였다. At this time, instead of the extract, the stress-treated group was irradiated with a cell culture plate irradiated with an IR-A (PHILIPS lamp) for 15 minutes to replace the cell culture medium containing no FBS.

이렇게 배양된 세포에서 Easy-spin (DNA free) Total RNA extraction kit(iNtRON Biotechnology)을 이용하여 RNA를 분리하였다. 이를 위해 RNA extraction buffer 1m을 첨가하여 세포를 lysis시킨 후 200μL의 Chloroform을 첨가하고 Vortexing 후 13000rpm, 15분, 4℃에서 원심 분리하였다. 상등액을 400μL 추출하여 Binding buffer와 섞고 1분간 Incubation 한 뒤 column에 sample을 옮긴 후 13000rpm, 30초 원심분리 하였다. Washing buffer로 washing 한 뒤 50ul elution buffer를 이용하여 RNA을 분리하였다. RNA was isolated from the cultured cells using an Easy-spin (DNA free) Total RNA extraction kit (iNtRON Biotechnology). To this end, cells were lysed by adding 1m RNA extraction buffer, followed by 200μL Chloroform and centrifugation at 13000rpm, 15min, 4 ℃ after Vortexing. After extracting 400μL of the supernatant and mixing with the binding buffer, Incubation for 1 minute, the sample was transferred to the column and centrifuged at 13000rpm, 30 seconds. After washing with washing buffer, RNA was separated using 50ul elution buffer.

다음으로는 iScript cDNA Synthesis kit (BIO-RAD)을 이용하여 1μg의 RNA에 5x iScript Reaction 4μL, iScript Reverse Transcriptase 1μL를 혼합하고 총 20μL가 되게 Nuclease-free water를 첨가하였다. cDNA 합성은 Priming 25℃ 5분, Reverse transcription 42℃ 30분, RT inactivation 85℃ 5분 진행하였다. RNA 및 cDNA의 정량은 Nano drop을 이용하였다. 이 후 cDNA 100 ng에 iQ SYBR Green Supermix (BIO-RAD)을 첨가하고, Bio-Rad CFX96 real-time PCR 기기를 이용하여 real-time qPCR을 진행하였다. qPCR의 반응 조건은 Denaturation 95℃, 3분, Amplification 40cycles (Denaturation 95℃, 15초, Annealing 60℃, 30초)에서 House keeping 유전자인 GAPDH를 이용하여 HSP 유전자의 mRNA 발현량을 상대적으로 정량하였다. 이 때 사용된 각 프라이머 서열은 하기 표 1과 같다. Next, using the iScript cDNA Synthesis kit (BIO-RAD), 1μg of RNA was mixed with 4μL of 5x iScript Reaction and 1μL of iScript Reverse Transcriptase, and Nuclease-free water was added to a total of 20μL. cDNA synthesis proceeded with Priming 25 5 minutes, Reverse transcription 42 30 minutes, RT inactivation 85 5 minutes. Nano drop was used for quantification of RNA and cDNA. Thereafter, iQ SYBR Green Supermix (BIO-RAD) was added to 100 ng of cDNA, and real-time qPCR was performed using a Bio-Rad CFX96 real-time PCR instrument. Reaction conditions of qPCR were relatively quantified mRNA expression level of HSP gene using GAPDH which is House keeping gene at Denaturation 95 ℃, 3min, Amplification 40cycles (Denaturation 95 ℃, 15sec, Annealing 60 ℃, 30sec). Each primer sequence used at this time is shown in Table 1 below.

GeneGene Forward (5'→3')Forward (5 '→ 3') Reverse (5'→3')Reverse (5 '→ 3') HSP27HSP27 AAGCTAGCCACGCAGTCCAAAAGCTAGCCACGCAGTCCAA CGACTCGAAGGTGACTGGGACGACTCGAAGGTGACTGGGA HSP40HSP40 AGTTGTGGACCATGAGAGGGAGTTGTGGACCATGAGAGGG CTTTTCCTGCTGTTCCCACCCTTTTCCTGCTGTTCCCACC HSP60HSP60 GCCGCCCCGCAGAAGCCGCCCCGCAGAA CCTGGACACCGGTCTCATCTCCTGGACACCGGTCTCATCT HSP70HSP70 ATGTCGGTGGTGGGCATAGAATGTCGGTGGTGGGCATAGA CACAGCGACGTAGCAGCTCTCACAGCGACGTAGCAGCTCT HSP90HSP90 ACCGCCCTGCTATCTTCTGGCTTACCGCCCTGCTATCTTCTGGCTT GCATCCTCATCGCCCTCGAGAGGCATCCTCATCGCCCTCGAGAG HSP110HSP110 TCCGGAAAGATGAACAGGTCTCCGGAAAGATGAACAGGTC TGCACATCCTCTGGCTACTGTGCACATCCTCTGGCTACTG GAPDHGAPDH TGGGCTACACTGAGCACCAGTGGGCTACACTGAGCACCAG GGGTGTCGCTGTTGAAGTCAGGGTGTCGCTGTTGAAGTCA

그 결과, 도 3의 정제된 칡의 물 추출물 결과와 도 5의 적외선 조사 결과를 참고하면, 적외선에 대한 스트레스가 가해졌을 때보다 정제된 칡의 물 추출물의 처리 후 열충격 단백질의 mRNA가 더 신속하게 발현하였음을 확인할 수 있어, 정제된 칡의 물 추출물이 열충격으로 인한 세포 손상을 억제할 수 있는 조성물임을 확인할 수 있다. As a result, referring to the purified water extract results of FIG. 3 and the infrared irradiation results of FIG. 5, the mRNA of the heat shock protein was more rapidly after treatment of the purified water extracts than the stress of infrared rays. It can be confirmed that the expression, it can be confirmed that the purified water extract is a composition capable of inhibiting cell damage due to thermal shock.

한편, 도 4의 결과를 참고하면, 정제하지 않은 조추출물 상태의 칡 물 추출물은 열충격단백질의 발현에 거의 영향을 주지 않은 것으로 확인된다. On the other hand, referring to the results of Figure 4, it was confirmed that the crude water extract of the crude extract state had little effect on the expression of the thermal shock protein.

또한 도 6의 결과를 참고하면, 정제된 칡의 물 추출물과 함께 Daidzin, Daidzein이 3시간 처리되었을 때의 열충격 단백질 발현정도를 비교한 바, 칡 추출물 내에 포함된 Daidzin, Daidzein도 역시 열충격 단백질의 발현을 유도하는 물질임이 확인된다. In addition, referring to the results of FIG. 6, the expression of the heat shock protein when Daidzin and Daidzein were treated for 3 hours together with the purified water extract of 바, Daidzin and Daidzein contained in 칡 extract also expressed the heat shock protein. It is confirmed that it is a substance inducing.

<실시예 3. 열충격단백질의 발현 확인 - ii><Example 3. Confirmation of expression of heat shock protein-ii>

HaCaT cell (Human keratinocyte cell line)을 10% Fetal bovine serum(FBS) 와 1% Penicillin-streptomycin 이 첨가된 DMEM 배지와 함께 Culture dish에 접종한 후 37℃, 5% CO2 Incubator에서 배양한 뒤 HaCaT 세포를 6 well plate에 5x105 cells/well이 되도록 분주하고 24시간 배양하였다. 칡 추출물로는 칡의 물 추출물을 Sep-pakㄾ light C18 cartridge를 이용하여 정제한 것으로 사용하였고, 추출물 처리 후 각각 12시간 및 24시간 배양하였다. HaCaT cells (Human keratinocyte cell line) were inoculated in a culture dish with DMEM medium supplemented with 10% Fetal bovine serum (FBS) and 1% Penicillin-streptomycin, and then incubated in a 37 ° C, 5% CO 2 incubator. The cells were aliquoted to 5x10 5 cells / well in 6 well plates and incubated for 24 hours. As the extract, the water extract of the extract was purified using Sep-pak® light C18 cartridge, and incubated for 12 hours and 24 hours after extract treatment.

세포로부터의 단백질 분리는 HSP70 (Enzo Life Science, Inc.) 및 HSP110 (Abebio) ELISA kit의 extraction reagent를 이용하여 분리하였다. 24시간 배양된 추출물을 제거한 뒤 Phosphate buffered saline(PBS)로 세척하였다. 각 well에 준비된 Lysis buffer를 1 mL 씩 분주한 뒤 cell scraper로 sample을 추출하였다. 추출한 sample을 Vortexing 후 Centrifuge를 13000rpm 10분, 4℃ 처리하였다. 상등액을 1 mL 추출하여 96-well plate로 20 μL 옮긴다. 소혈청알부민 (Bovine serum albumin, BSA)은 0, 10, 20 μg/mL로 증류수에 단계적으로 희석하고 BCA protein assay reagent B 와 reagent A를 1:50 비율로 혼합한 뒤 각 well에 200 μL 분주 한 뒤 37℃, 30min 반응시킨다. 반응된 plate를 595 nm에서 흡광도를 측정하여 BSA standard curve 및 Sample을 측정한 후 얻은 Standard curve를 이용하여 단백질량을 산출하였다.Protein separation from cells was carried out using extraction reagents of HSP70 (Enzo Life Science, Inc.) and HSP110 (Abebio) ELISA kit. 24 hours incubated extract was removed and washed with Phosphate buffered saline (PBS). After dispensing 1 mL of Lysis buffer prepared in each well, the sample was extracted with a cell scraper. After vortexing the extracted sample, the centrifuge was treated at 13000 rpm for 10 minutes at 4 ° C. Extract 1 mL of the supernatant and transfer 20 μL to a 96-well plate. Bovine serum albumin (BSA) is diluted 0, 10, 20 μg / mL in distilled water stepwise, mixed BCA protein assay reagent B with reagent A in a ratio of 1:50, and 200 μL is dispensed into each well. After reaction at 37 ℃, 30min. The amount of protein was calculated using the standard curve obtained after measuring the absorbance at 595 nm of the reacted plate BSA standard curve and Sample.

HSP70 열충격단백질의 발현량 측정은 HSP70 ELISA kit (Enzo Life Science, Inc.)을 이용하여 분석하였다. HSP70 특이 항체가 미리 코팅되어 있는 96-well plate에 정량한 단백질 100 μL를 넣어 상온에서 2시간 반응, 400 μL washing buffer로 4번 세척 후, HSP70 항체 100 μL를 넣어 상온에서 1시간 반응시켰다. 4번 세척, HSP70 Conjugate 100 μL를 넣어 상온에서 1시간 반응시킨 후 다시 washing buffer로 4번 세척하였다. 이후, TMB Substrate 100 μL를 넣어 상온에서 30분간 반응시킨 후, Stop Solution 2 100 μL를 넣어 반응을 중지하였다. 450 nm에서 흡광도를 측정하여 HSP70 standard curve 및 sample을 측정한 후 얻은 Standard curve를 이용하여 HSP70 열충격단백질의 발현량을 산출하였고 이에 대한 결과는 도 7에 나타내었다.  The expression level of HSP70 heat shock protein was analyzed using the HSP70 ELISA kit (Enzo Life Science, Inc.). 100 μL of the protein quantified in a 96-well plate coated with HSP70 specific antibody was reacted at room temperature for 2 hours, washed four times with 400 μL washing buffer, and 100 μL of HSP70 antibody was added and reacted at room temperature for 1 hour. After washing 4 times, 100 μL of HSP70 Conjugate was added and reacted at room temperature for 1 hour, followed by washing with washing buffer 4 times. Thereafter, 100 μL of TMB Substrate was added and allowed to react at room temperature for 30 minutes. Then, 100 μL of Stop Solution 2 was added to stop the reaction. The expression level of HSP70 thermal shock protein was calculated using the standard curve obtained after measuring the absorbance at 450 nm and the HSP70 standard curve and the sample. The results are shown in FIG. 7.

도 7의 결과를 참고하면, 2% 농도의 칡 추출물 처리로 인해 열충격단백질인 HSP70과 HSP110이 증가하였음을 알 수 있다. Referring to the results of Figure 7, it can be seen that the heat shock proteins HSP70 and HSP110 were increased by the treatment of the extract of 2% concentration.

<실시예 4. 콜라겐 생성 확인>Example 4 Collagen Production Confirmation

세포내 콜라겐 생성 정도를 평가하기 위해 인체피부 섬유아세포 Detroit551 (Human dermal fibroblast)를 24-well plate에 5x104 cells/mL로 접종하여 세포배양 조건에서 24시간 배양하였다. 이 때, 세포 Stress 조건으로 IR-A (PHILIPS lamp)를 각 물질 처리 전 15분간 쬐어 주었다. To evaluate the intracellular collagen production, human skin fibroblasts Detroit551 (Human dermal fibroblast) were inoculated at 5x10 4 cells / mL in a 24-well plate and incubated in cell culture conditions for 24 hours. At this time, IR-A (PHILIPS lamp) was exposed to light for 15 minutes before the treatment of each material under the conditions of cellular stress.

다음으로는 배지를 버리고 PBS로 세척한 다음 FBS를 포함하지 않는 새로운 배지로 갈아주고 일정농도의 시험물질(칡 추출물, Daidzin 및 Daidzein)을 처리하여 세포를 48시간 배양하였다. 칡 추출물로는 칡의 물 추출물을 Sep-pak® light C18 cartridge를 이용하여 정제한 것으로 사용하였다.Next, the medium was discarded, washed with PBS, and then changed to a fresh medium containing no FBS, and the cells were incubated for 48 hours by treatment with a certain concentration of test substance (칡 extract, Daidzin and Daidzein). The extract was used as a purified water extract using the Sep-pak® light C18 cartridge.

배양 후 상등액을 취하여 배지에 유리된 procollagen의 양은 Procollagen Type I C-Peptide EIA KIT(Takara, Japan)을 이용하여 측정하였다. Antibody-PoD conjugate solution 100μL를 well(96-well plate)에 넣은 다음 1/5로 희석한 배양액 및 표준액 20μL를 넣고 37℃에서 3시간 배양하였다. Well에서 배양액을 제거한 다음 PBS 400μL로 4회 세척 후, 발색시약 100μL를 넣고 상온에서 15분간 배양하고 1 N 황산 100μL을 넣은 다음 450 nm에서 ELISA reader로 측정하였다. 측정된 콜라겐 양은 브래드포드 단백질 정량법(Bradford assay)으로 구한 총 단백질 양으로 보정하고, 양성대조군으로는 L-ascorbate를 이용하여 공시료액과 비교하였다. After incubation, the supernatant was taken and the amount of procollagen released in the medium was measured using Procollagen Type I C-Peptide EIA KIT (Takara, Japan). 100μL of the antibody-PoD conjugate solution was put in a well (96-well plate), and the culture solution and 20μL of the standard solution diluted to 1/5 were added thereto, and then incubated at 37 ° C for 3 hours. After removing the culture medium from the well and washed four times with 400μL PBS, 100μL of the coloring reagent was added and incubated for 15 minutes at room temperature, 1N sulfuric acid 100μL was added and measured by ELISA reader at 450nm. The measured collagen amount was corrected by the total protein amount obtained by Bradford assay, and compared with the blank sample using L-ascorbate as a positive control group.

이에 대한 결과는 도 8에 나타내었는데, 도 8을 참고하면, 적외선 처리로 인해 콜라겐 합성량이 감소하였던 것이 2% 농도의 칡 추출물의 처리로 인해 증가하는 것을 확인할 수 있다. Results of this are shown in FIG. 8. Referring to FIG. 8, it can be seen that the amount of collagen synthesis decreased due to the infrared treatment increased due to the treatment of the extract of 2% concentration.

<실시예 5. 세포 내 콜라게나제(MMP-1) 활성 억제 측정>Example 5. Measurement of Inhibition of Intracellular Collagenase (MMP-1) Activity>

인체피부 섬유아세포 Detroit551 (Human dermal fibroblast)를 10% Fetal bovine serum(FBS) 와 1% Penicilin-streptomycin 이 첨가된 DMEM 배지와 함께 Culture dish에 접종한 후 37℃, 5% CO2 Incubator에서 배양한 뒤 인체피부 섬유아세포를 24 well plate에 5x104 cells/well이 되도록 분주하고 48시간 배양하였다. 이 때, 세포 Stress 조건으로 IR-A (PHILIPS lamp)를 칡 추출물 처리 전 15분간 쬐어 주었다. 칡 추출물로는 칡의 물 추출물을 Sep-pakㄾ light C18 cartridge를 이용하여 정제한 것으로 사용하였고, 이 때, 정제 전의 조추출물(칡의 물 추출물)도 동일 농도로 같이 처리하여 비교하였다(조추출물 - 1g의 칡으로부터 얻은 물 추출물 분말을 정제없이 그대로 물 1㎖에 녹인 것을 stock solution으로 사용함).Human skin fibroblasts Detroit551 (Human dermal fibroblast) a 10% Fetal bovine serum (FBS) and 1% Penicilin-streptomycin is inoculated in Culture dish with a DMEM medium was added after 37 ℃, then cultured in a 5% CO 2 Incubator Human skin fibroblasts were aliquoted to 5x10 4 cells / well in a 24 well plate and incubated for 48 hours. At this time, IR-A (PHILIPS lamp) was exposed to light for 15 minutes before the extract treatment. As the extract, the water extract of the water was purified using Sep-pak ㄾ light C18 cartridge. At this time, the crude extract (water extract of the water) before purification was also treated with the same concentration and compared (crude extract). -Dissolve the water extract powder from 1 g of water in 1 ml of water without purification as a stock solution).

이에 대한 결과는 도 9에 나타내었는데, 본 발명의 정제된 칡 추출물이 갖는 콜라게나제(MMP-1) 활성 억제 효과가 매우 뛰어남을 확인할 수 있는데, 이러한 효과는 컬럼 정제전 추출물과 비교하여 현저하게 우수한 것으로서, 콜라게나제(MMP-1) 활성을 무처리군과 거의 동일한 수준으로 억제하고 있음을 알 수 있다. The results are shown in Figure 9, it can be seen that the collagenase (MMP-1) activity of the purified 칡 extract of the present invention is very excellent, this effect is significantly compared to the extract before column purification As excellent, it can be seen that collagenase (MMP-1) activity is suppressed to almost the same level as the untreated group.

<실시예 6. 혼합 추출물의 효능 확인> <Example 6. Confirmation of the efficacy of the mixed extract>

본 발명의 칡 물 추출물의 컬럼 정제물이 갖는 효과를 보다 상승시킬 수 있는 혼합 추출물의 제조조건을 확인하기 위해, 칡 물 추출물의 컬럼 정제물에 실시예 1-2의 각 추출물들을 하기와 같이 혼합하여 이들이 갖는 콜라겐 생합성 효능을 확인하였다. 이 때, 칡 물 추출물의 컬럼 정제물은 실시예 1-2의 추출물처럼 감압농축하여 사용하였다. 표 2에서 복합 추출물로는 승마, 상황버섯, 차가버섯, 감초, 블루베리, 한련 또는 할미꽃의 각각의 추출물을 동일 중량으로 혼합한 것을 사용하였다. * 표 2의 조성물은 중량부 단위로 혼합되었다.In order to confirm the preparation conditions of the mixed extract that can further enhance the effect of the column purified water extract of the present invention, the respective extracts of Examples 1-2 were mixed in the column purified water of the water extract as follows They confirmed the collagen biosynthesis efficacy they have. At this time, the column purified product of the water extract was concentrated under reduced pressure like the extract of Example 1-2. As a composite extract in Table 2, a mixture of horse riding, situation mushroom, chaga, licorice, blueberry, nasturtium or pasqueflower was used in the same weight. * The compositions in Table 2 were mixed in parts by weight.

종류Kinds 칡 물 추출물의
컬럼 정제물
의 of water extract
Column purification
오리스 뿌리 추출물Oris Root Extract 지유 추출물Fat milk extract 병풍 추출물Screen extract 마텔 추출물Mattel Extract 초피나무
열매 추출물
Bark tree
Lychee extract
복합
추출물
complex
extract
A-1A-1 100100 1One 33 55 33 33 1010 A-2A-2 100100 1010 33 22 55 55 00 A-3A-3 100100 55 55 55 55 55 00 A-4A-4 100100 22 1616 33 22 22 00 B-1B-1 125125 00 00 00 00 00 00 B-2B-2 100100 00 00 00 00 00 2525 B-3B-3 100100 1010 00 1010 00 55 00 B-4B-4 100100 00 1010 00 1515 00 00

이 표 2의 추출물을 이용하여, 최종 세포처리 농도가 50μg/mL이 되도록 처리된 조건에서, 실시예 2 및 실시예 4에 개시된 열충격 단백질의 발현 및 콜라겐 생성 확인 실험을 수행하였고 이에 대한 결과를 표 3과 표 4에 나타내었다. Using the extract of Table 2, the experiments were performed to confirm the expression and collagen production of the heat shock proteins disclosed in Examples 2 and 4 under the condition that the final cell treatment concentration was 50 μg / mL. 3 and Table 4.

실험군Experimental group 추출물 처리 전과 대비한
추출물 처리 후 3시간 째의 열충격 단백질 mRNA 발현량
As compared to before extract treatment
Expression of heat shock protein mRNA at 3 hours after extract treatment
hsp70hsp70 hsp110hsp110 A-1A-1 3.13.1 4.04.0 A-2A-2 2.72.7 3.43.4 A-3A-3 2.82.8 3.63.6 A-4A-4 2.52.5 3.53.5 B-1B-1 1.71.7 2.32.3 B-2B-2 1.61.6 2.22.2 B-3B-3 1.51.5 2.02.0 B-4B-4 1.61.6 2.32.3

실험군Experimental group Procollagen 생성 정도 (% of control)Procollagen production degree (% of control) 무처리군 (control)Control group 100.3100.3 적외선 처리Infrared treatment 추출물 미처리Untreated extract 82.282.2 A-1A-1 212.5212.5 A-2A-2 182.0182.0 A-3A-3 167.5167.5 A-4A-4 172.6172.6 B-1B-1 110.7110.7 B-2B-2 105.3105.3 B-3B-3 113.1113.1 B-4B-4 112.2112.2

표 3의 결과를 참고하면, 컬럼 정제된 칡 추출물과 함께 A-1 내지 A-4의 조건으로 각종 생약 추출물이 첨가된 군에서 hsp70 및 hsp110의 발현이 현저하게 증가하는 것으로 나타난다. 또한, 표 4의 결과를 참고하여도, 컬럼 정제된 칡 추출물이 갖는 콜라겐 생성 효과를 보다 더 상승시킬 수 있는 것은 A-1 내지 A-4에 속한 혼합 추출물 조건인 것으로 확인되며, 특히, A-1의 혼합 추출물이 갖는 효과가 가장 좋은 것을 알 수 있다. Referring to the results of Table 3, it is shown that the expression of hsp70 and hsp110 is significantly increased in the group to which various herbal extracts were added under the conditions of A-1 to A-4 together with the columnar purified extract. In addition, even with reference to the results of Table 4, it is confirmed that it is a mixed extract condition belonging to A-1 to A-4 that can further increase the collagen production effect of the column purified 칡 extract, in particular, A- It can be seen that the effect of the mixed extract of 1 is the best.

<화장료 제조예 1. 마스크팩의 제조><Production Example of Cosmetics 1. Preparation of Mask Pack>

실시예 6의 A-1의 혼합추출물 1.7 중량%, 디프로필렌글라이콜 6 중량%, 글리세린 4.5 중량%, 카보머 0.2 중량%, 아크릴레이트/C10-30 0.02 중량%, 베타인 1 중량%, 트레할로스 0.5 중량%, 호모베타-글루칸 0.3 중량%, 다이메틸설폰 0.5 중량%, 소듐하이알루로네이트 0.5 중량%, 하이드록시아세토페논 0.1 중량%, 부틸렌글라이콜 0.1 중량%, 글리세린 0.1 중량%, 피이지-40 하이드로제네이티드 캐스터 오일 0.1 중량%, 피이지-60 하이드로제네이티드 캐스터 오일 0.15 중량%, 비스-피이지-18 메칠에틸디메칠실란 0.25 중량%, 디메치콘 0.3 중량%, 향료 0.02 중량%, 포타슘하이드록사이드 0.120 중량%, 에칠헥실글리세린 0.05 중량%, 프로판디올 0.2 중량%, 에탄올 0.2 중량%, 징크설페이트 0.1 중량%, 레티닐팔미테이드 0.1 중량%, 해수 1 중량%에 정제수가 총 100 중량%가 되도록 혼합한 것 25mL에 부직포 마스크를 함침시킨 후 1팩씩 밀봉하여 마스크팩을 제조하였다. 1.7% by weight of the mixed extract of A-1 of Example 6, 6% by weight of dipropylene glycol, 4.5% by weight of glycerin, 0.2% by weight of carbomer, 0.02% by weight of acrylate / C10-30, 1% by weight of betaine, Trehalose 0.5% by weight homobeta-glucan 0.3% by weight dimethylsulfone 0.5% by weight sodium hyaluronate 0.5% by weight hydroxyacetophenone 0.1% by weight butylene glycol 0.1% by weight glycerin, Fiji-40 Hydrogenated Castor Oil 0.1 wt%, Fiji-60 Hydrogenated Caster Oil 0.15 wt%, Bis-Pig-18-18 methylethyldimethylsilane, 0.25 wt% Dimethicone 0.3 wt%, Perfume 0.02 wt% %, 0.120 wt% potassium hydroxide, 0.05 wt% ethylhexylglycerin, 0.2 wt% propanediol, 0.2 wt% ethanol, 0.1 wt% zinc sulfate, 0.1 wt% retinyl palmitate, 1 wt% seawater Non-woven fabric in 25 mL A facial mask was prepared by sealing 1 paekssik was impregnated with the disk.

<화장료 제조예 2. 에멀전의 제조>Cosmetic Preparation Example 2. Preparation of Emulsion

실시예 6의 A-2의 혼합추출물 1.7 중량%, 소듐 도데실 설페이트 0.5 중량%, 글리세린 5 중량%, 프로필렌글리콜 4 중량%, 토코페릴아세테이트 3 중량%, 유동파라핀 5 중량%, 트리에탄올아민 0.1 중량%, 스쿠알란 3 중량%, 마카다미아너트오일 2 중량%, 폴리솔베이트60 1 중량%, 솔비탄세스퀴톨레이트 1 중량%, 카르복실비닐포리머 1 중량%에 정제수가 총 100 중량%가 되도록 혼합하여 에멀전을 제조하였다. 1.7% by weight of the mixed extract of A-2 of Example 6, 0.5% by weight of sodium dodecyl sulfate, 5% by weight of glycerin, 4% by weight of propylene glycol, 3% by weight of tocopheryl acetate, 5% by weight of liquid paraffin, 0.1% by weight of triethanolamine %, Squalane 3% by weight, macadamia nut oil 2% by weight, polysorbate60 1% by weight, sorbitan sesquitolate 1% by weight, carboxyvinyl polymer 1% by weight of the purified water mixed to a total of 100% by weight emulsion Was prepared.

<화장료 평가예 1. 피부 탄력도 확인> <Cosmetic Evaluation Example 1. Confirmation of Skin Elasticity>

화장료 제조예 1 및 2의 마스크팩과 에멀전을 각각 10명씩에게 사용하여 주름개선에 따른 피부 탄력도를 비교하게 하였다. 마스크팩은 취침 전 10분씩 사용하게 하였고, 에멀전은 아침 저녁으로 세안 후 콩알만한 크기로 사용하게 하였다. 이 때 대조군 그룹에는 화장료 제조예 1 및 2와 동일한 방법으로 마스크팩과 에멀전을 제조하되, A-1 또는 A-2의 혼합 추출물 대신 B-1의 정제된 칡 추출물만 포함된 것으로 제조한 마스크팩과 에멀전을 사용하게 하였다. 각 제품에 대한 사용효과는 1개월 후에 평가하게 하였다.The mask packs and emulsions of Cosmetic Preparation Examples 1 and 2 were used for 10 persons each to compare skin elasticity according to wrinkle improvement. The mask pack was used for 10 minutes before bedtime, and the emulsion was used as the size of the bean after washing the morning and evening. At this time, the control group in the mask pack and emulsion prepared in the same manner as in the cosmetic preparations 1 and 2, but instead of a mixed extract of A-1 or A-2 mask pack prepared by containing only the purified extract of B-1 And emulsions were used. The use effect for each product was evaluated after 1 month.

피부 탄력 측정은 눈가에서 3cm떨어진 부위에 Cutometer(MPA 580, Courage and Khazaka Electronic Co., Germany)를 사용하여 측정하였다. 평가는 3회 실시하였으며, 3개의 값에 대한 평균을 사용하였다. 변수로는 R2값을 선정하였으며, 값이 높아질수록 피부 탄력이 개선됨을 의미한다. 이번 시험에서는 변수 R2에 관하여 제품 사용 전(0주)과 제품 사용 2주 후, 제품 사용 4주 후에 값을 측정하였으며, 측정계수는 arbitrary unit(A.U.)이다. 또한 이렇게 얻은 결과를 탄력개선율(%)로 계산하여 확인하였다. Skin elasticity was measured using a cutometer (MPA 580, Courage and Khazaka Electronic Co., Germany) 3 cm away from the eyes. The evaluation was performed three times and an average of three values was used. R2 was selected as a variable, which means that the skin elasticity is improved as the value is increased. In this test, the values of variable R2 were measured before use (0 week), after 2 weeks of use, and after 4 weeks of use. The measurement coefficient is arbitrary unit (A.U.). In addition, the obtained results were confirmed by calculating the elasticity improvement rate (%).

Figure pat00001
Figure pat00001

시험 결과 표 5와 같이 정제된 칡 추출물만 포함된 화장료에서도 피부 탄력도가 크게 증가한 것을 알 수 있었고, 특히, 화장료 제조예 1 및 2의 마스크팩 또는 에멀전을 사용한 그룹의 피부 탄력도가 현저하게 증가함을 알 수 있다. As a result of the test, it was found that the skin elasticity was also significantly increased even in the cosmetics containing only the purified extract, as shown in Table 5. In particular, the skin elasticity of the group using the mask pack or the emulsion of cosmetic preparations 1 and 2 was significantly increased. Able to know.

사용 그룹Use group 4주 후 피부탄력도 증가율 (%) Skin elasticity increase rate after 4 weeks (%) 화장료 제조예 1의 마스크팩
(A-1의 혼합 추출물 포함된 것)
Mask Pack of Cosmetic Preparation Example 1
(Includes mixed extract of A-1)
15.515.5
대조군 마스크팩
(B-1의 정제된 칡 추출물만 포함된 것)
Control Mask Pack
(Contains only purified extract of B-1)
4.44.4
화장료 제조예 1의 에멀전
(A-2의 혼합 추출물 포함된 것)
Emulsion of Cosmetic Preparation Example 1
(Includes mixed extract of A-2)
10.210.2
대조군 에멀전
(B-1의 정제된 칡 추출물만 포함된 것)
Control emulsion
(Contains only purified extract of B-1)
4.24.2

Claims (8)

칡 추출물을 함유하는 것을 특징으로 하는 열노화 방지용 화장료 조성물.칡 A cosmetic composition for preventing heat aging, characterized in that it contains an extract. 제1항에 있어서,
상기 칡 추출물은 열수 추출물인 것을 특징으로 하는 열노화 방지용 화장료 조성물.
The method of claim 1,
The 칡 extract is a heat-aging cosmetic composition, characterized in that the hot water extract.
제1항에 있어서,
상기 칡 추출물은 옥타데실실란(C18)으로 충전된 컬럼으로 정제한 것을 특징으로 하는 열노화 방지용 화장료 조성물.
The method of claim 1,
The 칡 extract is a cosmetic composition for preventing heat aging, characterized in that purified by a column filled with octadecylsilane (C18).
제1항에 있어서,
상기 조성물에는 오리스 뿌리 추출물, 지유 추출물, 병풍 추출물, 마텔 추출물 및 초피나무 열매 추출물이 첨가되는 것을 특징으로 하는 열노화 방지용 화장료 조성물.
The method of claim 1,
The composition for preventing heat aging, characterized in that the composition is added to Oris root extract, fat extract, folding screen extract, Mattel extract and berry fruit extract.
제4항에 있어서,
상기 조성물에는 승마 추출물, 상황버섯 추출물, 차가버섯 추출물, 감초 추출물, 블루베리 추출물, 한련 추출물 및 할미꽃 추출물이 더 첨가되는 것을 특징으로 하는 열노화 방지용 화장료 조성물.
The method of claim 4, wherein
The composition for preventing heat aging, characterized in that the horse riding extract, situation mushroom extract, chaga mushroom extract, licorice extract, blueberry extract, nasturtium extract and pasqueflower extract are further added.
제1항 내지 제5항 중의 어느 한 항의 조성물을 포함하는 것을 특징으로 하는 열노화 방지용 화장료. A cosmetic for preventing heat aging comprising the composition of any one of claims 1 to 5. 제6항에 있어서,
상기 화장료는 마스크팩, 스킨로션, 스킨소프너, 스킨토너, 아스트린젠트, 로션, 밀크로션, 모이스쳐로션, 영양로션, 맛사지크림, 영양크림, 모이스쳐크림, 핸드크림, 파운데이션, 에센스, 영양에센스, 팩, 비누, 클렌징폼, 클렌징로션, 클렌징크림, 바디로션 및 바디클렌저로 이루어진 그룹에서 선택되는 제형의 화장료 조성물인 것을 특징으로 하는 열노화 방지용 화장료.
The method of claim 6,
The cosmetics are mask pack, skin lotion, skin softener, skin toner, astringent, lotion, milk lotion, moisturizing lotion, nutrition lotion, massage cream, nutrition cream, moisturizing cream, hand cream, foundation, essence, nutrition essence, pack, soap , Cleansing foam, cleansing lotion, cleansing cream, body lotion and body cleanser, characterized in that the cosmetic composition of the formulation selected from the group consisting of a thermal aging prevention cosmetics.
제7항에 있어서,
상기 화장료는 부형제로서 디프로필렌글라이콜, 글리세린, 카보머, 아크릴레이트/C10-30, 베타인, 트레할로스, 호모베타-글루칸, 다이메틸설폰, 소듐하이알루로네이트, 하이드록시아세토페논, 부틸렌글라이콜, 글리세린, 피이지-40 하이드로제네이티드 캐스터 오일, 피이지-60 하이드로제네이티드 캐스터 오일, 비스-피이지-18 메칠에틸디메칠실란, 디메치콘, 향료, 포타슘하이드록사이드, 에칠헥실글리세린, 프로판디올, 징크설페이트, 레티닐팔미테이드 및 해수가 포함되는 것을 특징으로 하는 열노화 방지용 화장료.
The method of claim 7, wherein
The cosmetics are dipropylene glycol, glycerin, carbomer, acrylate / C10-30, betaine, trehalose, homobeta-glucan, dimethylsulfone, sodium hyaluronate, hydroxyacetophenone, butylenes as excipients. Lycol, Glycerin, Fiji-40 Hydrogenated Castor Oil, Fiji-60 Hydrogenated Caster Oil, Bis-Pig-18-18 Methylethyldimethylmethylsilane, Dimethicone, Fragrance, Potassium Hydroxide, Ethylhexylglycerin , Propanediol, zinc sulfate, retinyl palmitate and seawater comprising a cosmetic for preventing heat aging.
KR1020180021030A 2018-02-22 2018-02-22 Cosmetic composition for preventing thermal skin aging comprising kudzu root extract KR102019592B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020180021030A KR102019592B1 (en) 2018-02-22 2018-02-22 Cosmetic composition for preventing thermal skin aging comprising kudzu root extract

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020180021030A KR102019592B1 (en) 2018-02-22 2018-02-22 Cosmetic composition for preventing thermal skin aging comprising kudzu root extract

Publications (2)

Publication Number Publication Date
KR20190101090A true KR20190101090A (en) 2019-08-30
KR102019592B1 KR102019592B1 (en) 2019-09-09

Family

ID=67776457

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020180021030A KR102019592B1 (en) 2018-02-22 2018-02-22 Cosmetic composition for preventing thermal skin aging comprising kudzu root extract

Country Status (1)

Country Link
KR (1) KR102019592B1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102148025B1 (en) 2020-02-25 2020-08-25 주식회사 엘엠바이오 Cosmetic composition comprising passion fruit derived meristem cells extracts
KR20210158661A (en) * 2020-06-24 2021-12-31 이스트힐(주) Cosmetic composition for preventing thermal skin aging comprising alpinia officinarum root extract
WO2024101587A1 (en) * 2022-11-10 2024-05-16 문주이 Functional cosmetic composition

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102265730B1 (en) 2020-11-06 2021-06-17 주식회사 본에스티스 cosmetic composition for skin wrinkle improvement and whitening facial skin

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150024502A (en) 2013-08-27 2015-03-09 경희대학교 산학협력단 A cosmetic composition for preventing and improving skin winkle
KR101661802B1 (en) 2014-05-19 2016-10-04 조효제 Cosmetic composition for improving anti-oxidant, anti-microbial, whitening and anti-wrinkling comprising Galgeuntang by-product
KR20170025801A (en) * 2015-08-31 2017-03-08 계명대학교 산학협력단 Composition for preventing or treating skin photoaging comprising Pueraria lobata root extract
KR101752147B1 (en) 2017-04-28 2017-06-29 계명대학교 산학협력단 Composition for preventing or treating skin photoaging comprising Pueraria lobata root extract

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150024502A (en) 2013-08-27 2015-03-09 경희대학교 산학협력단 A cosmetic composition for preventing and improving skin winkle
KR101661802B1 (en) 2014-05-19 2016-10-04 조효제 Cosmetic composition for improving anti-oxidant, anti-microbial, whitening and anti-wrinkling comprising Galgeuntang by-product
KR20170025801A (en) * 2015-08-31 2017-03-08 계명대학교 산학협력단 Composition for preventing or treating skin photoaging comprising Pueraria lobata root extract
KR101752147B1 (en) 2017-04-28 2017-06-29 계명대학교 산학협력단 Composition for preventing or treating skin photoaging comprising Pueraria lobata root extract

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Hirayama K et al., Metabolism of Isoflavones Found in the Pueraria thomsonii Flower by Human Intestinal Microbiota. Biosci Microflora. 2011;30(4):135-40.
Reppert A et al., Isolation of radiolabeled isoflavones from kudzu (Pueraria lobata) root cultures. J Agric Food Chem. 2008 Sep 10;56(17):7860-5.
Yamaki K et al., Effects of naturally occurring isoflavones on prostaglandin E2 production. Planta Med. 2002 Feb;68(2):97-100.

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102148025B1 (en) 2020-02-25 2020-08-25 주식회사 엘엠바이오 Cosmetic composition comprising passion fruit derived meristem cells extracts
KR20210158661A (en) * 2020-06-24 2021-12-31 이스트힐(주) Cosmetic composition for preventing thermal skin aging comprising alpinia officinarum root extract
WO2024101587A1 (en) * 2022-11-10 2024-05-16 문주이 Functional cosmetic composition

Also Published As

Publication number Publication date
KR102019592B1 (en) 2019-09-09

Similar Documents

Publication Publication Date Title
KR101857528B1 (en) Cosmetic composition with the extract of Aurea Helianthus for skin-whitening
KR102019592B1 (en) Cosmetic composition for preventing thermal skin aging comprising kudzu root extract
KR100755427B1 (en) Cosmetic composition comprising green tea seed oil for enhancing skin elasticity
KR100773856B1 (en) Composition comprising an extract of siraitia grosvenori or triterpene compound isolated therefrom showing anti-wrinkle activity
KR101086736B1 (en) Composition comprising a crude complex herb extract showing anti-aging and anti-wrinkle activity
KR100715485B1 (en) Cosmetic composition comprising the root extract of nymphaea tetragona having skin whitening and anti-aging activity
KR101263547B1 (en) Cosmetic composition comprising green tea seed coater extract having anti-oxidative or anti-inflammatory activity
KR20110115047A (en) Extracting method of nelumbo nucifera flower, leaf, stem, root, seed and cosmetic composition for anti-wrinkle containing extracts thereby
KR20070003365A (en) Cosmetic composition comprising the extract of crinum asiaticum linne var. having anti-allergic and anti-inflammatory activity
KR100805386B1 (en) A composition comprising the fruit extract of platycarya strobilacea having anti-aging activity
KR20080104759A (en) Composition comprising an extract of carex humilis leyss or alpha;-viniferin compound isolated therefrom for skin whitening
KR100535875B1 (en) Cosmetic composition comprising the extract of complex herb showing skin anti-aging and whitening effect
KR100888753B1 (en) Composition comprising an extract of Cornus kousa or the compounds isolated therefrom having anti-aging and anti-wrinkle activity
KR100865071B1 (en) Composition comprising the saururus chinensis extract or compound isolated therefrom for skin whitening
KR102171924B1 (en) External skin preparation for relaxing allergy comprising extract of wild-peach and method of producing the same
KR100713030B1 (en) A purifying method of Canavalia gladiata DC having antimicrobial activity
KR20050045428A (en) Cosmetic composition comprising an extract of flowers of prunus mume sieb. having antioxidant activity
KR100706285B1 (en) A topical composition comprising extract of ardisia crenata inhibiting wrinkle formation
KR101042690B1 (en) A composition comprising extract of Polystichum ovatopaleaceum var. coraiense H. Christ Sa.Kurata having anti-aging and anti-wrinkle activity
KR101230588B1 (en) Cosmetics Composite
KR100829831B1 (en) A skin whitening compositions comprising natural plant extract
KR20210123548A (en) Improvement composition for Hot flash comprising the extract of Salvia miltiorrhiza as an active ingredient
KR101267765B1 (en) A preparation method for PSE extract of Prunella vulgaris having antioxidative effect and the cosmetic composition comprising the same
KR100714172B1 (en) Cosmetic composition having the anti-wrinkle activity
KR100891734B1 (en) Cosmetic composition comprising extract and fraction of Persicae semen shell

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant