KR20150085681A - Primer set for diagnosing Spinach latent virus and uses thereof - Google Patents

Abstract

The present invention relates to an oligonucleotide primer set whose sequence numbers are 5 and 16, an oligonucleotide primer set for diagnosing Spinach latent virus (SpLV) including a primer set of an oligonucleotide whose sequence numbers are 9 and 16, a kit for diagnosing the SpLV including the oligonucleotide primer set and a reagent used in an amplification reaction, and a method for diagnosing the SpLV using the oligonucleotide primer set, thereby being used for accurately checking infection for SpLV, which is 1000 times faster than an existing diagnosis method using antiserum and being used in a quarantine site.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a primer set for diagnosing a spinach latent virus,

The present invention relates to a primer set for detecting a spinach-latent virus and a use thereof, and more particularly to a primer set for a spinach latent virus (SpLV, < RTI ID = 0.0 > Spinach latent virus diagnostic oligonucleotide primer set, an oligonucleotide primer set for the oligonucleotide primer set, a reagent for performing the amplification reaction, and a method for diagnosing SpLV using the oligonucleotide primer set.

Most of the agronomically important crops are harvested and quality degraded by plant viruses or viroid infections, resulting in serious economic losses. Unlike diseases caused by fungi or bacteria, diseases caused by plant viruses can not be prevented or treated by spraying pesticides. Therefore, precise and rapid diagnosis of viral infection of plants and seeds is a prerequisite for virus disease management in advance, and prevention of damage caused by viral infection of cultivated crops.

Spinach latent virus (SpLV, Spinach latent virus is a phytopathogenic virus of about 27 nm in diameter that is classified as the group IV (+) ssRNA virus, Bromoviridae and Ilarvirus . SpLV has been reported to have high seed transmission and infection with spinach, mandrill, sweetpotato and tobacco. The total RNA of SpLV is 8.69 Kb. Five genes encode five kinds of proteins (replicase, movement protein, coat protein, polymerase and 2b protein) and G + C content is 42.9%.

Currently, RT-PCR methods with high detection sensitivity and convenience are most commonly used to diagnose RNA viruses. When the virus is diagnosed using the PCR method, it is necessary to provide an inspection system against discrimination of the infection due to a low specific strength of the reaction or against nonspecific reaction with other nucleic acids. In addition, the use of isolate-specific primers can lead to failure of diagnosis, and development of species-specific primers capable of detecting all the isolates present in the virus species is required.

Therefore, the present invention provides a primer for SpLV diagnosis and a nested primer matching therewith, a species-specific primer bank that can support the same, and a positive control to provide a PCR We want to build a system.

Korean Patent No. 1093235 discloses a specific primer for diagnosis of garlic latent virus and its use, and Korean Patent No. 0552633 discloses a specific primer for diagnosis of capsicum mild mottle virus. However, There is no description of a primer set for spinach latent virus diagnosis and its use.

SUMMARY OF THE INVENTION The present invention has been made in view of the above-mentioned needs, and it is an object of the present invention to provide an optimal PCR primer set capable of specifically detecting spinach latency virus (SpLV), a nested PCR primer set for assay, The present inventors completed the present invention by developing a plasmid containing a DNA fragment that can be used as a positive control.

In order to solve the above-mentioned problems, the present invention relates to a spinach latent virus (hereinafter referred to as " oligonucleotide primer ") comprising at least one oligonucleotide primer set selected from the group consisting of oligonucleotide primer sets of SEQ ID NOS: 5 and 16 and oligonucleotide primer sets of SEQ ID NOS: SpLV, Spinach latent virus < / RTI > diagnostic oligonucleotide primer set.

In addition, the present invention provides a SpLV diagnostic kit comprising the oligonucleotide primer set and a reagent for performing an amplification reaction.

The present invention also provides a method for diagnosing SpLV using the oligonucleotide primer set.

Using the SpLV diagnostic oligonucleotide primer set, SpLV diagnostic kit, and RT-PCR-based SpLV diagnostic method of the present invention, plants infected with Sprague-Dawley rats and plants, including SpLV, are more than 1,000 times more accurate than anti- , So it can be used effectively at the quarantine site.

FIG. 1 is a photograph of a plant showing symptoms of infection with spinach latent virus (SpLV).
Figure 2 shows the results of a primary selection for the specificity test for SpLV as a result of performing RT-PCR using the SpLV diagnostic primer combination (see Table 3).
FIG. 3 shows the result of the second screening using the primer sets selected through the first selection among the SpLV diagnostic primer combinations and using the positive control and the reference viruses PDV, PNRSV, TSV and BBWV as the template for the second screening ) And (non-specificity test with genomic DNA of host) using two primer sets selected by secondary selection (order of positive control, PDV, PNRSV, TSV and BBWV for each primer set) The result of the car selection (B).
FIG. 4 shows the sensitivity test results (A) and the nested PCR primer selection results (B) for the SpLV diagnostic primer sets 35 and 52. (A) indicate the dilution concentration of the positive control plasmid.
Figure 5 shows the nucleotide sequence of the mutation-positive control (410 bp) containing the nested primers SpLV_F6 and SpLV_R5 primer sites for assay and inserted a nonspecific base sequence. The binding sites of the primers SpLV_F6 and SpLV_R5 for the test were [_], and the insertion positions of the SpLV_R5 primers were indicated by black boxes.

In order to accomplish the object of the present invention, the present invention provides a method for producing a spinneret latent image comprising a set of oligonucleotide primers of SEQ ID NOs: 5 and 16 and a set of oligonucleotide primers selected from the group consisting of oligonucleotide primer sets of SEQ ID NOs: Viruses (SpLV, Spinach latent virus < / RTI > diagnostic oligonucleotide primer set.

In one embodiment of the present invention, the SpLV diagnostic oligonucleotide primer set of the present invention preferably comprises an oligonucleotide primer set (combination 35) of SEQ ID NOS: 5 and 16 and an oligonucleotide primer set (combination 52 ), More preferably an oligonucleotide primer set of SEQ ID NOs: 5 and 16 and an oligonucleotide primer set of SEQ ID NOs: 9 and 16 are added to the oligonucleotide primer set of SEQ ID NOs: 6 and 14 primer), combination 39) and an oligonucleotide primer set of SEQ ID NOs: 9 and 15 (nested primer, combination 51), and most preferably, the oligonucleotide primer set The oligonucleotides of SEQ ID NOS: 5 and 16 Oligonucleotide primer sets (nestled primer, combination 39) of SEQ ID NOS: 6 and 14 and oligonucleotide primers of SEQ ID NOS: 9 and 15 were added to the primer set (combination 35) and the oligonucleotide primer set of SEQ ID NOS: 9 and 16 Set (nestled primer, combination 51), but is not limited thereto.

That is, the SpLV diagnostic primer set of the present invention comprises a nested primer set (SpLV_F6; SEQ ID NO: 6) having an assay function for RT-PCR products of SpLV diagnostic primer combination 35 (SpLV_F5; SEQ ID NO: 5 and SpLV_R7; SEQ ID NO: 16) (SpLV_F9; SEQ ID NO: 9 and SpLV_R6; SEQ ID NO: 14) having a function for RT-PCR products of SpLV_R5; SEQ ID NO: 14) and SpLV diagnostic primer combination 52 (SpLV_F9; SEQ ID NO: 9 and SpLV_R7; SEQ ID NO: 16) Number 15). ≪ / RTI > PCR assays are performed using primers (nested primers) for this primer combination to determine if the results of the primary RT-PCR test are required, ie, whether the RT-PCR product is derived from SpLV. If the RT-PCR result is derived from SpLV, it will be positive in PCR for assay.

Wherein the oligonucleotide primer comprises at least 16, at least 18, at least 19, or at least 19 consecutive nucleotide fragments in the sequence of SEQ ID NO: 5, 6, 9, 14, 15 or 16 according to the sequence length of each primer Oligonucleotides. For example, the primer (20 oligonucleotides) of SEQ ID NO: 6 may comprise an oligonucleotide consisting of fragments of 16 or more, 17 or more, 18 or more, 19 or more consecutive nucleotides in the sequence of SEQ ID NO: 6 , The primer (18 oligonucleotides) of SEQ ID NO: 9 may comprise oligonucleotides consisting of fragments of 16 or more and 17 or more consecutive nucleotides in the sequence of SEQ ID NO: 9.

In the present invention, a "primer" refers to a single strand oligonucleotide sequence complementary to a nucleic acid strand to be copied, and may serve as a starting point for synthesis of a primer extension product. The length and sequence of the primer should allow the synthesis of the extension product to begin. The specific length and sequence of the primer will depend on the primer usage conditions such as temperature and ionic strength, as well as the complexity of the desired DNA or RNA target.

As used herein, the oligonucleotide used as a primer also includes a nucleotide analogue such as phosphorothioate, alkylphosphorothioate, or peptide nucleic acid Or may include an intercalating agent.

The present invention also provides a SpLV diagnostic kit comprising the oligonucleotide primer set and a reagent for performing an amplification reaction.

In the SpLV diagnostic kit according to one embodiment of the present invention, the kit may further include a DNA fragment having the nucleotide sequence of SEQ ID NO: 17, but is not limited thereto. The DNA fragment having the nucleotide sequence of SEQ ID NO: 17 can be used as a plasmid having a positive control function for RT-PCR or PCR reaction using the SpLV diagnostic oligonucleotide primer set (FIG. 5).

In one embodiment of the present invention, the reagent for performing the amplification reaction may include a DNA polymerase, dNTPs, and a buffer, and may further include a ribonuclease inhibitor, a thermostable polymerase, and the like But is not limited thereto. The DNA polymerase may be a reverse transcriptase such as RNA dependent DNA polymerase and may be a reverse transcriptase from various sources such as avian myeloblastosis virus- derived virus reverse transcriptase (AMV RTase), murine leukemia virus-derived virus reverse transcriptase (MuLV RTase), and Rouse-associated virus 2 reverse transcriptase (RAV-2 RTase , But is not limited thereto. In addition, the buffer may include both a reverse transcription buffer and a PCR buffer, and the thermostable polymerase may be an EF Taq polymerase.

In one embodiment of the present invention, the kit may further include a user guide describing optimal reaction performance conditions. The guide is printed to describe how to use the kit, for example, how to prepare reverse transcription buffer and PCR buffer, the reaction conditions presented, and so on. The brochure includes instructions on the surface of the package including the brochure or leaflet in the form of a brochure, a label attached to the kit, and a kit. In addition, the brochure includes information that is disclosed or provided through an electronic medium such as the Internet.

In addition,

Isolating total RNA from the plant sample;

Amplifying the target sequence by performing RT-PCR using the separated total RNA as a template and using the oligonucleotide primer set; And

And detecting the amplification product. The present invention also provides a method for diagnosing SpLV.

The method of the present invention comprises separating total RNA from a plant sample. Any method known in the art may be used as a method for separating the total RNA from the sample. For example, a phenol extraction method may be used. The target sequence can be amplified by performing RT-PCR using the separated total RNA as a template and using one or more oligonucleotide primer sets according to one embodiment of the present invention as primers. Such PCR methods are well known in the art, and commercially available kits may be used.

In the method according to an embodiment of the present invention, the plant may be selected from the group consisting of spinach, gooseberry, Changmyeongjae, modern beet, beetroot mushroom, cucumber herb, The plant may be a Chenopodiaceae plant, including, but not limited to, a sprout, a sprout, and a homozygote, preferably a spinach, but is not limited thereto and any plant that can be infected with SpLV can be included within the scope of the present invention.

In one embodiment of the invention, the amplified target sequence may be labeled with a detectable labeling substance. The labeling substance may be a fluorescent, phosphorescent or radioactive substance, but is not limited thereto. Preferably, the labeling substance is Cy-5 or Cy-3. When the target sequence is amplified, PCR is carried out by labeling the 5'-end of the primer with Cy-5 or Cy-3, and the target sequence may be labeled with a detectable fluorescent labeling substance. When the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution, the amplification product may be synthesized and the radioactive substance may be incorporated into the amplification product and the amplification product may be labeled as radioactive. One or more oligonucleotide primer combinations used to amplify the target sequence are as described above.

In one embodiment of the invention, the method for diagnosing SpLV comprises the step of detecting the amplification product, wherein the detection of the amplification product is performed by a DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, But it is not limited thereto. As one method of detecting the amplification product, capillary electrophoresis can be performed. Capillary electrophoresis, for example, can use the ABi Sequencer. In addition, gel electrophoresis can be performed, and gel electrophoresis can utilize agarose gel electrophoresis or acrylamide gel electrophoresis depending on the size of the amplification product. Also, in the fluorescence measurement method, Cy-5 or Cy-3 is labeled at the 5'-end of the primer. When PCR is carried out, the target is labeled with a fluorescent label capable of detecting the target sequence. The labeled fluorescence is measured using a fluorescence meter can do. In addition, in the case of performing the PCR, the radioactive isotope such as ³² P or ³⁵ S is added to the PCR reaction solution to mark the amplification product, and then a radioactive measurement device such as a Geiger counter or liquid scintillation counter The radioactivity can be measured using a liquid scintillation counter.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  1. Spinach latent virus ( SpLV ) Diagnostic Primer  Design and combination

PCR assays Spinach latent virus (SpLV) and reference virus strains (pseudotyped and homologous infectious virus) were obtained from NCBI (Table 1), followed by BioEdit version 7.1.3 Multiple alignments were performed.

SpLV and reference viruses for the construction of SpLV primers Primary NCBI sequence information Virus Type acronym GenBank registration number Spinach latent virus SpLV NC_003808 Prune dwarf virus PDV NC_008038 Prunus necrotic ringspot virus PNRSV NC_004362 Tobacco streak virus TSV NC_003844 Broad bean wilt virus BBWV NC_005289
NC_005290

Primer preparation was carried out using DNAMAN DNA analysis software package (DNAMAN version 6.0; Lynnon Biosoft, Canada), and primer specific primers were screened under primer Tm values of 51-59 ° C (Table 2).

SpLV Primer Information Name of the primer The sequence (5 '- > 3') SEQ ID NO: Length (bp) location Forward


SpLV_F1 TACCCGAGTATGAGCGAGGT One 20 2,187-2,206 SpLV_F2 ATGAGCGAGGTATGACGGT 2 19 2,196-2,214 SpLV_F3 GGTATGACGGTTGATGGTTT 3 20 2,204 ~ 2,223 SpLV_F4 GGTTGATGGTTTCGTCTC 4 18 2,212 ~ 2,229 SpLV_F5 GGTGGACGGAAACATTACT 5 19 2,239 to 2,257 SpLV_F6 GACTCTTCTTGCGTGTTTGA 6 20 2,303-2,322 SpLV_F7 CAACATCTCTCCTCAAGCA 7 19 2,421 ~ 2,439 SpLV_F8 GCGGCGTTATTCCTAAAG 8 18 2,505 ~ 2,522 SpLV_F9 GATTCCATTCGTGTCTCG 9 18 2,692 to 2,709 Reverse


SpLV_R1 AACACGCAAGAAGAGTCG 10 18 2,302-2,319 SpLV_R2 CTTGCTTGAGGAGAGATGT 11 19 2,423 to 2,441 SpLV_R3 TCACTCGGTATTCAAGCG 12 18 2,523 ~ 2,540 SpLV_R4 TACTTCCTTCACTCGTGC 13 18 2,651 ~ 2,668 SpLV_R5 GACACGAATGGAATCTGCT 14 19 2,688 to 2,706 SpLV_R6 TCTCACTAAGGACTGCCGT 15 19 2,795-2,813 SpLV_R7 CCATTCATCCCAGGTAAAC 16 19 2,958 to 2,976

The primers were designed in forward and reverse directions. Based on this, a primer set capable of PCR amplification between 80-1,300 bp was constructed based on the expected amplification products (Table 3).

Estimated size of SpLV diagnostic primer combination and RT-PCR product Combination Forward Reverse RT-PCR product size (bp) Combination Forward Reverse RT-PCR product size (bp) One SpLV_F1 SpLV_R1 133 31 SpLV_F5 SpLV_R3 302 2 SpLV_F1 SpLV_R2 255 32 SpLV_F5 SpLV_R4 430 3 SpLV_F1 SpLV_R3 354 33 SpLV_F5 SpLV_R5 468 4 SpLV_F1 SpLV_R4 482 34 SpLV_F5 SpLV_R6 575 5 SpLV_F1 SpLV_R5 520 35 SpLV_F5 SpLV_R7 738 6 SpLV_F1 SpLV_R6 627 36 SpLV_F6 SpLV_R2 139 7 SpLV_F1 SpLV_R7 790 37 SpLV_F6 SpLV_R3 238 8 SpLV_F2 SpLV_R1 124 38 SpLV_F6 SpLV_R4 366 9 SpLV_F2 SpLV_R2 246 39 SpLV_F6 SpLV_R5 404 10 SpLV_F2 SpLV_R3 345 40 SpLV_F6 SpLV_R6 511 11 SpLV_F2 SpLV_R4 473 41 SpLV_F6 SpLV_R7 674 12 SpLV_F2 SpLV_R5 511 42 SpLV_F7 SpLV_R3 120 13 SpLV_F2 SpLV_R6 618 43 SpLV_F7 SpLV_R4 248 14 SpLV_F2 SpLV_R7 781 44 SpLV_F7 SpLV_R5 286 15 SpLV_F3 SpLV_R1 116 45 SpLV_F7 SpLV_R6 393 16 SpLV_F3 SpLV_R2 238 46 SpLV_F7 SpLV_R7 556 17 SpLV_F3 SpLV_R3 337 47 SpLV_F8 SpLV_R4 164 18 SpLV_F3 SpLV_R4 465 48 SpLV_F8 SpLV_R5 202 19 SpLV_F3 SpLV_R5 503 49 SpLV_F8 SpLV_R6 309 20 SpLV_F3 SpLV_R6 610 50 SpLV_F8 SpLV_R7 472 21 SpLV_F3 SpLV_R7 773 51 SpLV_F9 SpLV_R6 122 22 SpLV_F4 SpLV_R1 108 52 SpLV_F9 SpLV_R7 285 23 SpLV_F4 SpLV_R2 230 24 SpLV_F4 SpLV_R3 329 25 SpLV_F4 SpLV_R4 457 26 SpLV_F4 SpLV_R5 495 27 SpLV_F4 SpLV_R6 602 28 SpLV_F4 SpLV_R7 765 29 SpLV_F5 SpLV_R1 81 30 SpLV_F5 SpLV_R2 203

For the synthesis of complementary DNA (cDNA), 4 μl of the reaction buffer (50 pmol, NNN NNN NNN NNN NNN NNN NNN NNN N , 3 μl of 2 mM dNTP (Enzynomics, Korea), 0.7 μl of RNasin (Promega, USA), 3 μl of M-MuLV 1.6 역 of reverse transcriptase (Roche, Switzerland) and 6.7 탈 of deionized distilled water were added to make a total volume of 20.. Then, 1 μl of the synthesized cDNA was used as a template, and 1 μl of 25 pmol forward and reverse primers were added to 10 μl of Fast PCR PreMixture (Plutos, Korea), and the PCR reaction was performed according to a total volume of 20 μl. One-step RT-PCR was performed using the RT-PCR PreMixture (Plutos, Korea) and the PCR was carried out at 42 ° C for 60 minutes after the reverse transcription. After the denaturation at 95 ° C for 10 minutes, the PCR reaction was repeated 35 times at 95 ° C for 45 seconds, at 55 ° C for 1 minute and at 72 ° C for 1 minute, and finally at 72 ° C for 5 minutes. All the PCR products were electrophoresed for 80 minutes in 150 μl of 1.2% agarose gel, and 4 μl of TopRed nucleic acid gel stain (Biopure, UK) was added and specific bands formed under UV were confirmed.

Example  2. SpLV  Optimal for diagnosis primer  Set selection and diagnosis primer  Bank construction

A screening procedure was conducted from 1 to 3 with 52 primer combinations designed for the selection of the optimal primer set for diagnosis of SpLV.

The primary selection of the diagnostic primer was selected by confirming whether the primer set was specific to SpLV by PCR or RT-PCR using the primer set combinations shown in Table 3, and the secondary selection was performed using the selected primer sets Viral strains (viruses susceptible to nucleotide sequence-like viruses and common infection hosts, see Table 1) were selected by PCR or RT-PCR to identify non-specific results. The selected primers should be nonspecific for host genomic DNA since they were used for the extraction of total RNA from the host. Therefore, the tertiary selection was confirmed by PCR using the primer set selected in the secondary selection, which is nonspecific to the host genomic DNA. In addition, 10 μl of Fast PCR PreMixture, 1 μl of template DNA as a PCR product, and 1 μl each of forward and reverse primers were added to a mixture of nested PCR for assay, and the total volume was adjusted to 20 μl using deionized distilled water Respectively. At this time, when the band of the RT-PCR product was strongly formed, it was diluted to 1/100 and when it was weakly formed, it was diluted to 1/10. When the band was not formed, the reaction was performed using the crude solution of the RT- Respectively. The PCR conditions for the assay were the same except for the reverse transcription step of 42 ° C for 60 minutes under the above-described conditions of RT-PCR.

For the analysis of spinach latent virus (SpLV), the detection results were compared among the plasmids constructed using the selected 52 PCR primer sets. As a result of analysis to confirm the formation of a specific band, a band of 81-790 bp was formed in all of the 52 primer sets applied (FIG. 2). Four combinations (11, 35, 46, and 52) in which a specific band was formed were selected as the first selection target considering the amplification position in the result of 52 combinations, and then the second selection process was performed.

As a result of applying primer sets of four primers selected for the reference viruses of PDV, PNRSV, TSV and BBWV to confirm positive control and specificity of SpLV, non-specific bands were formed in primer sets 11 and 46, In the primer sets 35 and 52, no band was formed for the reference virus, and the specificity of the primer for SpLV was confirmed. The primer sets 35 and 52 were selected as suitable primers for analyzing SpLV (FIG. 3A).

On the other hand, the possibility of SpLV was raised in the spinach for the detection of SpLV, and the specificity of the genomic DNA of the plant was re-analyzed using the template. As a result of performing reanalysis using primer sets 35 and 52, no nonspecific bands were formed. Therefore, primer sets 35 and 52 were selected as final compatible primers and sensitivity analysis was performed (FIG. 3B).

Example  3. SpLV  For diagnostic purposes primer  For set sensitivity measurement and calibration Nested primer  making

The prepared 1 ng / μl plasmid was diluted 10- ^fold to 10 ^-10 and analyzed by applying the primer sets 35 and 52 selected in the specificity analysis. As a result, it was found that a specific band was formed up to 10 ^{-8 in} both the primer sets 35 and 52 (Fig. 4A).

From the final RT-PCR primer set, a nested PCR primer for nested PCR analysis was selected again to select the final analysis primer. A total of 4 nested PCR primers (SpLV_F5 / R3; F6 / R5; F7 / R6; F8 / R6) were selected for the primer set 35. One set of nested PCR primers for the primer set 52 (SpLV_F9 / R6 ) Were selected and evaluated. For the primer set 35, all four sets of nested primers were specific bands, but considering the RT-PCR product and amplification size, there was no problem when sequencing was performed. The 404 bp product, which formed the most distinct and bright band, SpLV_F6 / R5 was the most suitable. In the primer set 52, SpLV_F9 / R6 amplifying 122 bp forms a specific band and its suitability is confirmed (FIG. 4B).

From these results, RT-PCR primer combinations for the analysis of SpLVs were finalized with primer set 35 (PCR product size 738 bp) and 52 (PCR product size 285 bp), and each assay nested PCR The amplification products were 404 bp and 122 bp, respectively (Table 4).

The final RT-PCR of SpLV and the combination of primers for nested PCR diagnosis and the size of the product primer Base sequence SEQ ID NO: primer
Length (bp) Amplification product
Length (bp) set PCR type name
35

RT SpLV_F5 GGTGGACGGAAACATTACT 5 19 738 SpLV_R7 CCATTCATCCCAGGTAAAC 16 19 Nested SpLV_F6 GACTCTTCTTGCGTGTTTGA 6 20 404 SpLV_R5 GACACGAATGGAATCTGCT 14 19
52

RT SpLV_F9 GATTCCATTCGTGTCTCG 9 18 285 SpLV_R7 CCATTCATCCCAGGTAAAC 16 19 Nested SpLV_F9 GATTCCATTCGTGTCTCG 9 18 122 SpLV_R6 TCTCACTAAGGACTGCCGT 15 19

Example  4. SpLV  Genetic modification for diagnosis Positive control  making

The PCR product containing the selected primer set region was amplified and cloned into the pGEM-T easy vector (Promega, USA) as an insert DNA. Five clones were sequenced and one clone with matching primer set attachment sites was selected. The selected clones were subjected to a site-directed mutagenesis kit (Enzynomics, Korea) using 6 nucleotides, which is a nucleotide sequence capable of reacting with restriction enzymes, inside the nested primer set amplification site Respectively. The EZchange ^TM site-directed mutagenesis kit marketed in Korea is a mutagenized primer. The plasmid DNA is used as a template to amplify a linear plasmid having a new mutation by the PCR method. Then, the original plasmid is removed, and terminal kination and ligation restriction enzyme sites of Xho I (CTCGAG) were inserted by performing ligation at the same time and using a three-step reaction for performing transformation.

As a result of analysis of nucleotide sequence after nested PCR for assay, it was confirmed that all six nucleotide sequences were inserted (Fig. 5). Thus, when the plasmid prepared above was used as a positive control for the SpLV test, The possibility of cross - contamination which can appear in the analysis can be detected and judged by the sequencing analysis, so it was considered to be applicable to the analysis of seed samples.

<110> REPUBLIC OF KOREA (Ministry of Agriculture, Food and Rural Affairs, Animal and Plant Quarantine Agency) <120> Primer set for diagnosing Spinach latent virus and uses thereof <130> PN13421 <160> 18 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 tacccgagta tgagcgaggt 20 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atgagcgagg tatgacggt 19 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ggtatgacgg ttgatggttt 20 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 ggttgatggt ttcgtctc 18 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 ggtggacgga aacattact 19 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 gactcttctt gcgtgtttga 20 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 caacatctct cctcaagca 19 <210> 8 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 8 gcggcgttat tcctaaag 18 <210> 9 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 gattccattc gtgtctcg 18 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 aacacgcaag aagagtcg 18 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 cttgcttgag gagagatgt 19 <210> 12 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 tcactcggta ttcaagcg 18 <210> 13 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 tacttccttc actcgtgc 18 <210> 14 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 gacacgaatg gaatctgct 19 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 tctcactaag gactgccgt 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ccattcatcc caggtaaac 19 <210> 17 <211> 410 <212> DNA <213> Artificial Sequence <220> <223> SpLV positive control <400> 17 gactcttctt gcgtgtttga tgccggttca cgtattatgc caggtctgaa aaaggcattg 60 gtaatggatg caaatttcaa aatcgtgatc gaggatggtg tggcaggatg tgggaaaaca 120 acatctctcc tcaagcaagc taagccggat tcggatttgt tgttagctgc caaccgtgag 180 actgcaaatg acgcaaaagc ctcgagcagc ggcgttattc ctaaagcgct tgaataccga 240 gtgagaactg tggattctta cttgatgttg agaacgtggt tcacagccga gagattgctc 300 gttgatgaat gtttcttggt ccatgctggc ttggtctatg cagctgccac cttggcacga 360 gtgaaggaag taatagcttt tggtgataca aagcagattc cattcgtgtc 410 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 nnnnnnnnnnn nnnnnnnnnn nnnnn 25

Claims (9)

A Spinach latent virus (SpLV, Spinach) containing a set of oligonucleotide primers of SEQ ID NO: 5 and SEQ ID NO: 16 and a set of oligonucleotide primers selected from the group consisting of SEQ ID NO: 9 and oligonucleotide primer set of SEQ ID NO: latent A set of diagnostic oligonucleotide primers. The oligonucleotide primer set of claim 1, wherein the oligonucleotide primer set of SEQ ID NO: 5 and SEQ ID NO: 16 and the oligonucleotide primer set of SEQ ID NO: 9 and SEQ ID NO: 16. The oligonucleotide primer set according to claim 1, further comprising one or more oligonucleotide primer sets selected from the group consisting of the oligonucleotide primer set of SEQ ID NO: 6 and the oligonucleotide primer set of SEQ ID NO: 9 and the oligonucleotide primer set of SEQ ID NO: A feature set of SpLV diagnostic oligonucleotide primers. A SpLV diagnostic kit comprising an oligonucleotide primer set of any one of claims 1 to 3 and a reagent for carrying out an amplification reaction. 5. The SpLV diagnostic kit according to claim 4, further comprising a DNA fragment having the nucleotide sequence of SEQ ID NO: The SpLV diagnostic kit according to claim 4, wherein the reagent for carrying out the amplification reaction comprises a DNA polymerase, dNTPs and a buffer. Isolating total RNA from the plant sample;
Performing the RT-PCR using the separated total RNA as a template and using the oligonucleotide primer set of any one of claims 1 to 3 to amplify the target sequence; And
And detecting the amplification product. The method of claim 7, wherein the plant is a method of diagnosing a SpLV, characterized in that chenopodiaceae (Chenopodiaceae) plants. 8. The method of claim 7, wherein the detection of the amplification product is performed by DNA chip, gel electrophoresis, capillary electrophoresis, radioactivity measurement, fluorescence measurement or phosphorescence measurement.

Images